Silencing Genes in the Heart.

PubMed

Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

2017-01-01

Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

PubMed

Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

2016-11-15

Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

PubMed Central

Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

2016-01-01

ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

Tripartite polyionic complex (PIC) micelles as non-viral vectors for mesenchymal stem cell siRNA transfection.

PubMed

Raisin, Sophie; Morille, Marie; Bony, Claire; Noël, Danièle; Devoisselle, Jean-Marie; Belamie, Emmanuel

2017-08-22

In the context of regenerative medicine, the use of RNA interference mechanisms has already proven its efficiency in targeting specific gene expression with the aim of enhancing, accelerating or, more generally, directing stem cell differentiation. However, achievement of good transfection levels requires the use of a gene vector. For in vivo applications, synthetic vectors are an interesting option to avoid possible issues associated with viral vectors (safety, production costs, etc.). Herein, we report on the design of tripartite polyionic complex micelles as original non-viral polymeric vectors suited for mesenchymal stem cell transfection with siRNA. Three micelle formulations were designed to exhibit pH-triggered disassembly in an acidic pH range comparable to that of endosomes. One formulation was selected as the most promising with the highest siRNA loading capacity while clearly maintaining pH-triggered disassembly properties. A thorough investigation of the internalization pathway of micelles into cells with tagged siRNA was made before showing an efficient inhibition of Runx2 expression in primary bone marrow-derived stem cells. This work evidenced PIC micelles as promising synthetic vectors that allow efficient MSC transfection and control over their behavior, from the perspective of their clinical use.

Flavivirus RNAi suppression: decoding non-coding RNA.

PubMed

Pijlman, Gorben P

2014-08-01

Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

PubMed Central

Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

2009-01-01

Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Molecular interactions and immune responses between maize fine streak virus and the leafhopper vector G. nigrifrons through differential expression and RNA interference

USDA-ARS?s Scientific Manuscript database

Maize fine streak virus (MFSV) is an emerging virus of maize that is transmitted by an insect vector, the leafhopper called Graminella nigrifrons. Virus transmission by the leafhopper requires that the virus enter into and multiply in insect cells, tissues and organs before being transmitted to a ne...

Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

PubMed

Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

2010-01-01

Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

[Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

PubMed

Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

2016-12-20

Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

PubMed

Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

2013-01-01

The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Novel Methods for Mosquito Control using RNAi.

USDA-ARS?s Scientific Manuscript database

The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

PubMed Central

Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

2013-01-01

RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

PubMed Central

Xie, Yuran; Merkel, Olivia M

2015-01-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

Transcriptomics-guided development of RNA interference strategies to manage whiteflies: a globally distributed vector of crop viruses

USDA-ARS?s Scientific Manuscript database

Over 300 viruses are transmitted by the whitefly, Bemisia tabaci, with 90% of them belonging to the genus, Begomovirus. Begomoviruses are exclusively transmitted by whiteflies to a range of agriculture crops, resulting in billions of dollars lost annually, while jeopardizing food security worldwide....

Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

PubMed

Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

2018-03-21

Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

PubMed

He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

2009-02-01

The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight and left ventricular weight/body weight were significantly lower in ACE-RNAi rats (3.12+/-0.23 mg/g and 2.24+/-0.19 mg/g) compared with the vehicle controls (4.29+/-0.24 mg/g and 3.21+/-0.13 mg/g; P<0.05) and the vector controls (4.43+/-0.19 mg/g and 3.13+/-0.12 mg/g; P<0.05). The conclusion of the present study is that ACE-silencing had significant antihypertensive effects and reversed hypertensive-induced cardiac hypertrophy in SHRs, and therefore RNAi might be a new strategy in controlling hypertension.

Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

PubMed

Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

2018-04-01

Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

PubMed Central

Wuriyanghan, Hada; Falk, Bryce W.

2013-01-01

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

PubMed

Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

2018-06-01

Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus.

PubMed

Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian; Wei, Taiyun

2016-01-15

Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus

PubMed Central

Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian

2015-01-01

ABSTRACT Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. PMID:26537672

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

PubMed

Xie, Yuran; Merkel, Olivia M

2015-10-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

PubMed

Basit, Abdul; Tang, Wenwen; Wu, Dianqing

2016-01-01

To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

PubMed Central

Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

2013-01-01

Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

PubMed

Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

2014-04-20

A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

PubMed

Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

2017-06-01

Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

PubMed Central

Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

2012-01-01

Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

Highly efficient and specific modulation of cardiac calcium homeostasis by adenovector-derived short hairpin RNA targeting phospholamban.

PubMed

Fechner, H; Suckau, L; Kurreck, J; Sipo, I; Wang, X; Pinkert, S; Loschen, S; Rekittke, J; Weger, S; Dekkers, D; Vetter, R; Erdmann, V A; Schultheiss, H-P; Paul, M; Lamers, J; Poller, W

2007-02-01

Impaired function of the phospholamban (PLB)-regulated sarcoplasmic reticulum Ca(2+) pump (SERCA2a) contributes to cardiac dysfunction in heart failure (HF). PLB downregulation may increase SERCA2a activity and improve cardiac function. Small interfering (si)RNAs mediate efficient gene silencing by RNA interference (RNAi). However, their use for in vivo gene therapy is limited by siRNA instability in plasma and tissues, and by low siRNA transfer rates into target cells. To address these problems, we developed an adenoviral vector (AdV) transcribing short hairpin (sh)RNAs against rat PLB and evaluated its potential to silence the PLB gene and to modulate SERCA2a-mediated Ca(2+) sequestration in primary neonatal rat cardiomyocytes (PNCMs). Over a period of 13 days, vector transduction resulted in stable > 99.9% ablation of PLB-mRNA at a multiplicity of infection of 100. PLB protein gradually decreased until day 7 (7+/-2% left), whereas SERCA, Na(+)/Ca(2+) exchanger (NCX1), calsequestrin and troponin I protein remained unchanged. PLB silencing was associated with a marked increase in ATP-dependent oxalate-supported Ca(2+) uptake at 0.34 microM of free Ca(2+), and rapid loss of responsiveness to protein kinase A-dependent stimulation of Ca(2+) uptake was maintained until day 7. In summary, these results indicate that AdV-derived PLB-shRNA mediates highly efficient, specific and stable PLB gene silencing and modulation of active Ca(2+) sequestration in PNCMs. The availability of the new vector now enables employment of RNAi for the treatment of HF in vivo.

Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

PubMed

Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

2008-05-01

West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.

PubMed Central

Hu, W S; Bowman, E H; Delviks, K A; Pathak, V K

1997-01-01

Homologous recombination and deletions occur during retroviral replication when reverse transcriptase switches templates. While recombination occurs solely by intermolecular template switching (between copackaged RNAs), deletions can occur by an intermolecular or an intramolecular template switch (within the same RNA). To directly compare the rates of intramolecular and intermolecular template switching, two spleen necrosis virus-based vectors were constructed. Each vector contained a 110-bp direct repeat that was previously shown to delete at a high rate. The 110-bp direct repeat was flanked by two different sets of restriction site markers. These vectors were used to form heterozygotic virions containing RNAs of each parental vector, from which recombinant viruses were generated. By analyses of the markers flanking the direct repeats in recombinant and nonrecombinant proviruses, the rates of intramolecular and intermolecular template switching were determined. The results of these analyses indicate that intramolecular template switching is much more efficient than intermolecular template switching and that direct repeat deletions occur primarily through intramolecular template switching events. These studies also indicate that retroviral recombination occurs within a distinct viral subpopulation and exhibits high negative interference, whereby the selection of one recombination event increases the probability that a second recombination event will be observed. PMID:9223494

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

[Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

PubMed

FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

2010-02-01

To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (P<0.05). The apoptosis rate of A549/Lv-shCyPA (5.01% +/- 0.5%) was higher than control groups (0.35% +/- 0.17%) (P<0.05). Visible tumors were only detectable at 6th day after inoculated by A549/Lv-shCyPA. The xenograft tumors of A549/Lv-shCyPA remarkably delayed tumor growth and remained at a similarly small average size at 38th days after inoculation compared with the control group (P < 0.05). Lentiviral-vector-mediated siRNA technique effectively inhibits the expression of CyPA, induces the NSCLC cell apoptosis, inhibits the tumor growth. Elucidation of the precise role of CypA in these pathways may lead to new targeted therapies for non-small cell lung cancer.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle.

PubMed

Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

2013-04-16

Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike.Molecular Therapy - Nucleic Acids (2013) 2, e86; doi:10.1038/mtna.2013.16; published online 16 April 2013.

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

PubMed

Galdeano, Diogo Manzano; Breton, Michèle Claire; Lopes, João Roberto Spotti; Falk, Bryce W; Machado, Marcos Antonio

2017-01-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB). The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi) has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA). In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

Triatominae-Trypanosoma cruzi/T. rangeli: Vector-parasite interactions.

PubMed

Vallejo, G A; Guhl, F; Schaub, G A

2009-01-01

Of the currently known 140 species in the family Reduviidae, subfamily Triatominae, those which are most important as vectors of the aetiologic agent of Chagas disease, Trypanosoma cruzi, belong to the tribes Triatomini and Rhodniini. The latter not only transmit T. cruzi but also Trypanosoma rangeli, which is considered apathogenic for the mammalian host but can be pathogenic for the vectors. Using different molecular methods, two main lineages of T. cruzi have been classified, T. cruzi I and T. cruzi II. Within T. cruzi II, five subdivisions are recognized, T. cruzi IIa-IIe, according to the variability of the ribosomal subunits 24Salpha rRNA and 18S rRNA. In T. rangeli, differences in the organization of the kinetoplast DNA separate two forms denoted T. rangeli KP1+ and KP1-, although differences in the intergenic mini-exon gene and of the small subunit rRNA (SSU rRNA) suggest four subpopulations denoted T. rangeli A, B, C and D. The interactions of these subpopulations of the trypanosomes with different species and populations of Triatominae determine the epidemiology of the human-infecting trypanosomes in Latin America. Often, specific subpopulations of the trypanosomes are transmitted by specific vectors in a particular geographic area. Studies centered on trypanosome-triatomine interaction may allow identification of co-evolutionary processes, which, in turn, could consolidate hypotheses of the evolution and the distribution of T. cruzi/T. rangeli-vectors in America, and they may help to identify the mechanisms that either facilitate or impede the transmission of the parasites in different vector species. Such mechanisms seem to involve intestinal bacteria, especially the symbionts which are needed by the triatomines to complete nymphal development and to produce eggs. Development of the symbionts is regulated by the vector. T. cruzi and T. rangeli interfere with this system and induce the production of antibacterial substances. Whereas T. cruzi is only subpathogenic for the insect host, T. rangeli strongly affects species of the genus Rhodnius and this pathogenicity seems based on a reduction of the number of symbionts.

RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

PubMed

Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

2017-04-01

The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

Nanobiotechnology: an efficient approach to drug delivery of unstable biomolecules.

PubMed

Amaral, A C; Felipe, M S S

2013-11-01

Biotechnology and nanotechnology are fields of science that can be applied together to solve a variety of biological issues. In the case of human health, biotechnology attempts to improve advances on the therapy against several diseases. Therapeutic peptides and proteins are promissory molecules for developing new medicines. Gene transfection and RNA interference have been considered important approaches for modern therapy to treat cancer and viral infections. However, because of their instability, these molecules alone cannot be used for in vivo application, since they are easily degraded or presenting a poor efficiency. Nanotechnology can contribute by the development of nanostructured delivery systems to increase the stability and potency of these molecules. Studies involving polymeric and magnetic nanoparticles, dendrimers, and carbon nanotubes have demonstrated a possibility to use these systems as vectors instead of the conventional viral ones, which present adverse effects, such as recombination and immunogenicity. This review presents some possibilities and strategies to efficiently delivery peptides, proteins, gene and RNA interference using nanotechnology approach.

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

PubMed Central

Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

2015-01-01

Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

The NS3 protein of Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and miRNAs

PubMed Central

Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel

2007-01-01

RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697

Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

PubMed

Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

2017-01-01

Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

Transcript characteristic of myostatin in sheep fibroblasts.

PubMed

Lu, Jian; Ren, Hangxing; Sheng, Xihui; Zhang, Xiaoning; Li, Shangang; Zhao, Fuping; Zhou, Xinlei; Zhang, Li; Wei, Caihong; Ding, Jiatong; Li, Bichun; Du, Lixin

2012-08-01

Myostatin, a secreted growth factor highly expressed in skeletal muscle, negatively regulates skeletal muscle growth and differentiation. Recently, myostatin is emerged as a potential target for anti-atrophy and anti-fibrotic therapies. Therefore, to investigate the regulation of myostatin in sheep adult fibroblasts, we used the RNA interference mediated by lentiviral vector to gene silence myostatin. Simultaneously, we also had constructed the sheep myostatin overexpression vector to further explore the function of myostatin in fibroblasts. The results here demonstrated that the lentiviral vector could significantly reduce myostatin gene both at mRNA and protein level by 71% and 67%, respectively (P < 0.01). Inhibition of myostatin also resulted in a remarkable increase of activin receptor 2B (ACV2B), p21, PPARγ, leptin, C/EBPβ, and MEF2A expression, and a decrease of Akt1, CDK2, MEF2C, and Myf5 expression. Ectopic myostatin mRNA and protein were also present in the fibroblasts transfection. Furthermore, we observed that overexpression of myostatin contributed to an increase of Akt1, CDK2, Myf5 and PPARγ, and a decrease of p21, C/EBPα and leptin at the transcript level. These results suggested that myostatin positively regulated Akt1, CDK2, Myf5, leptin, and C/EBPα, but negatively regulated p21 mRNA expression in adult fibroblasts, and it also expanded our understanding of the regulation mechanism of myostatin. Moreover, the lentiviral system inactivated myostatin gene in fibroblasts would be used to generate transgenic sheep and to ameliorate muscle fibrosis and atrophy by gene therapy in the future. Copyright © 2012 Wiley Periodicals, Inc.

Biodegradable charged polyester-based vectors (BCPVs) as an efficient non-viral transfection nanoagent for gene knockdown of the BCR-ABL hybrid oncogene in a human chronic myeloid leukemia cell line

NASA Astrophysics Data System (ADS)

Yang, Chengbin; Panwar, Nishtha; Wang, Yucheng; Zhang, Butian; Liu, Maixian; Toh, Huiting; Yoon, Ho Sup; Tjin, Swee Chuan; Chong, Peter Han Joo; Law, Wing-Cheung; Chen, Chih-Kuang; Yong, Ken-Tye

2016-04-01

First-line therapy of chronic myelogenous leukemia (CML) has always involved the use of BCR-ABL tyrosine-kinase inhibitors which is associated with an abnormal chromosome called Philadelphia chromosome. Although the overall survival rate has been improved by the current therapeutic regime, the presence of resistance has resulted in limited efficacy. In this study, an RNA interference (RNAi)-based therapeutic regime is proposed with the aim to knockdown the BCR-ABL hybrid oncogene using small interfering RNA (siRNA). The siRNA transfection rates have usually been limited due to the declining contact probability among polyplexes and the non-adherent nature of leukemic cells. Our work aims at addressing this limitation by using a biodegradable charged polyester-based vector (BCPV) as a nanocarrier for the delivery of BCR-ABL-specific siRNA to the suspension culture of a K562 CML cell line. BCR-ABL siRNAs were encapsulated in the BCPVs by electrostatic force. Cell internalization was facilitated by the BCPV and assessed by confocal microscopy and flow cytometry. The regulation of the BCR-ABL level in K562 cells as a result of RNAi was analyzed by real-time polymerase chain reaction (RT-PCR). We observed that BCPV was able to form stable nanoplexes with siRNA molecules, even in the presence of fetal bovine serum (FBS), and successfully assisted in vitro siRNA transfection in the non-adherent K562 cells. As a consequence of downregulation of BCR-ABL, BCPV-siRNA nanoplexes inhibited cell proliferation and promoted cell apoptosis. All results were compared with a commercial transfection reagent, Lipofectamine2000™, which served as a positive control. More importantly, this class of non-viral vector exhibits biodegradable features and negligible cytotoxicity, thus providing a versatile platform to deliver siRNA to non-adherent leukemia cells with high transfection efficiency by effectively overcoming extra- and intra-cellular barriers. Due to the excellent in vitro transfection results from BCPV-siRNA, a newly developed biodegradable transfection agent, BCPV, is being probed for transfection performance in an animal model.

Small silencing RNAs: state-of-the-art.

PubMed

Grimm, Dirk

2009-07-25

Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.

Effective mRNA Inhibition in PANC-1 Cells in Vitro Mediated via an mPEG-SeSe-PEI Delivery System.

PubMed

Zhang, Yuefeng; Yang, Bin; Liu, Yajie; Qin, Wenjie; Li, Chao; Wang, Lantian; Zheng, Wen; Wu, Yulian

2016-05-01

RNA interference (RNAi)-mediated gene therapy is a promising approach to cure various diseases. However, developing an effective, safe, specific RNAi delivery system remains a major challenge. In this study, a novel redox-responsive polyetherimide (PEI)-based nanovector, mPEG-SeSe-PEI, was developed and its efficacy evaluated. We prepared three mPEG-SeSe-PEI vector candidates for small interfering glyceraldehyde-3-phosphate dehydrogenase (siGADPH) and determined their physiochemical properties and transfection efficiency using flow cytometry and PEG11.6-SeSe-PEI polymer. We investigated the silencing efficacy of GADPH mRNA expression in PANC-1 cells and observed that PEG11.6-SeSe-PEI/siGADPH (N/P ratio=10) polyplexes possessed the appropriate size and zeta-potential and exhibited excellent in vitro gene silencing effects with the least cytotoxicity in PANC-1 cells. In conclusion, we present PEG11.6-SeSe-PEI as a potential therapeutic gene delivery system for small interfering RNA (siRNA).

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

PubMed

Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

2013-08-01

Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

A chitin deacetylase-like protein is a predominant constituent of tick peritrophic membrane that influences the persistence of Lyme disease pathogens within the vector.

PubMed

Kariu, Toru; Smith, Alexis; Yang, Xiuli; Pal, Utpal

2013-01-01

Ixodes scapularis is the specific arthropod vector for a number of globally prevalent infections, including Lyme disease caused by the bacterium Borrelia burgdorferi. A feeding-induced and acellular epithelial barrier, known as the peritrophic membrane (PM) is detectable in I. scapularis. However, whether or how the PM influences the persistence of major tick-borne pathogens, such as B. burgdorferi, remains largely unknown. Mass spectrometry-based proteome analyses of isolated PM from fed ticks revealed that the membrane contains a few detectable proteins, including a predominant and immunogenic 60 kDa protein with homology to arthropod chitin deacetylase (CDA), herein termed I. scapularis CDA-like protein or IsCDA. Although IsCDA is primarily expressed in the gut and induced early during tick feeding, its silencing via RNA interference failed to influence either the occurrence of the PM or spirochete persistence, suggesting a redundant role of IsCDA in tick biology and host-pathogen interaction. However, treatment of ticks with antibodies against IsCDA, one of the most predominant protein components of PM, affected B. burgdorferi survival, significantly augmenting pathogen levels within ticks but without influencing the levels of total gut bacteria. These studies suggested a preferential role of tick PM in limiting persistence of B. burgdorferi within the vector. Further understanding of the mechanisms by which vector components contribute to pathogen survival may help the development of new strategies to interfere with the infection.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

PubMed

Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

PubMed

Poller, W; Fechner, H

2010-01-01

Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

Catalase is a determinant of the colonization and transovarial transmission of Rickettsia parkeri in the Gulf Coast tick Amblyomma maculatum.

PubMed

Budachetri, K; Kumar, D; Karim, S

2017-08-01

The Gulf Coast tick (Amblyomma maculatum) has evolved as a competent vector of the spotted-fever group rickettsia, Rickettsia parkeri. In this study, the functional role of catalase, an enzyme responsible for the degradation of toxic hydrogen peroxide, in the colonization of the tick vector by R. parkeri and transovarial transmission of this pathogen to the next tick generation, was investigated. Catalase gene (CAT) expression in midgut, salivary glands and ovarian tissues exhibited a 2-11-fold increase in transcription level upon R. parkeri infection. Depletion of CAT transcripts using an RNA-interference approach significantly reduced R. parkeri infection levels in midgut and salivary gland tissues by 53-63%. The role of CAT in transovarial transmission of R. parkeri was confirmed by simultaneously blocking the transcript and the enzyme by injecting double-stranded RNA for CAT and a catalase inhibitor (3-amino-1,2,4-triazole) into gravid females. Simultaneous inhibition of the CAT transcript and the enzyme significantly reduced the egg conversion ratio with a 44% reduction of R. parkeri transovarial transmission. These data suggest that catalase is required for rickettsial colonization of the tick vector and transovarial transmission to the next generation. © 2017 The Royal Entomological Society.

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

Using RNA-seq and targeted nucleases to identify mechanisms of drug resistance in acute myeloid leukemia.

PubMed

Rathe, Susan K; Moriarity, Branden S; Stoltenberg, Christopher B; Kurata, Morito; Aumann, Natalie K; Rahrmann, Eric P; Bailey, Natashay J; Melrose, Ellen G; Beckmann, Dominic A; Liska, Chase R; Largaespada, David A

2014-08-13

The evolution from microarrays to transcriptome deep-sequencing (RNA-seq) and from RNA interference to gene knockouts using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and Transcription Activator-Like Effector Nucleases (TALENs) has provided a new experimental partnership for identifying and quantifying the effects of gene changes on drug resistance. Here we describe the results from deep-sequencing of RNA derived from two cytarabine (Ara-C) resistance acute myeloid leukemia (AML) cell lines, and present CRISPR and TALEN based methods for accomplishing complete gene knockout (KO) in AML cells. We found protein modifying loss-of-function mutations in Dck in both Ara-C resistant cell lines. CRISPR and TALEN-based KO of Dck dramatically increased the IC₅₀ of Ara-C and introduction of a DCK overexpression vector into Dck KO clones resulted in a significant increase in Ara-C sensitivity. This effort demonstrates the power of using transcriptome analysis and CRISPR/TALEN-based KOs to identify and verify genes associated with drug resistance.

Dual silencing of Bcl-2 and Survivin by HSV-1 vector shows better antitumor efficacy in higher PKR phosphorylation tumor cells in vitro and in vivo.

PubMed

Chen, X; Zhou, Y; Wang, J; Wang, J; Yang, J; Zhai, Y; Li, B

2015-08-01

RNA interference (RNAi) is a promising tool for cancer therapy, but its delivery strategy is a major challenge for its application. Oncolytic herpes simplex virus type 1 (HSV-1) is not only an effective antitumor drug but also an excellent vector. Herein, RNAi of oncogenes Bcl-2 and Survivin was combined with oncolytic HSV-1 (ICP34.5-/ICP6-/ICP47-/CMV-GM-CSF) and a new vector HSV010-BS was constructed. Transfected cell viability assays and animal experiments revealed that the dual silencing of Bcl-2 and Survivin improved the antitumor effect of oncolytic HSV-1 in vitro and in vivo, while the antitumor effect was correlated with the phosphorylation levels of PKR of the tumor cells. The higher the phosphorylation levels of PKR of the tumor cells, the weaker the replication ability of oncolytic HSV-1, and the more powerful HSV010-BS was than its control vectors in inhibiting the growth of the tumor cells. The results provided direct supportive proofs for a new potential cancer therapy strategy.

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

A Role for Peptides in Overcoming Endosomal Entrapment in siRNA Delivery – A Focus on Melittin

PubMed Central

Hou, Kirk K.; Pan, Hua; Schlesinger, Paul H.; Wickline, Samuel A.

2015-01-01

siRNA has the possibility to revolutionize medicine by enabling highly specific and efficient silencing of proteins involved in disease pathogenesis. Despite nearly 20 years of research dedicated to translating siRNA from a research tool into a clinically relevant therapeutic, minimal success has been had to date. Access to RNA interference machinery located in the cytoplasm is often overlooked, but must be considered when designing the next generation of siRNA delivery strategies. Peptide transduction domains (PTD) have demonstrated moderate siRNA transfection, which is primarily limited by endosomal entrapment. Strategies aimed at overcoming endosomal entrapment associated with peptide vectors are reviewed here, including osmotic methods, lipid conjugation, and fusogenic peptides. As an alternative to traditional PTD, the hemolytic peptide melittin exhibits the native capacity for endosomal disruption but causes cytotoxicity. However, appropriate packaging and protection of melittin with activation and release in the endosomal compartment has allowed melittin-based strategies to demonstrate both in vitro and in vivo safety and efficacy. These data suggest that melittin's membrane disruptive properties can enable safe and effective endosomolysis, building a case for melittin as a key component in a new generation of siRNA therapeutics. PMID:26025036

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

PubMed

Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

2013-06-01

Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.

Post-transcriptional gene silencing in the root system of the actinorhizal tree Allocasuarina verticillata.

PubMed

Gherbi, Hassen; Nambiar-Veetil, Mathish; Zhong, Chonglu; Félix, Jessy; Autran, Daphné; Girardin, Raphaël; Vaissayre, Virginie; Auguy, Florence; Bogusz, Didier; Franche, Claudine

2008-05-01

In recent years, RNA interference has been exploited as a tool for investigating gene function in plants. We tested the potential of double-stranded RNA interference technology for silencing a transgene in the actinorhizal tree Allocasuarina verticillata. The approach was undertaken using stably transformed shoots expressing the beta-glucuronidase (GUS) gene under the control of the constitutive promoter 35S; the shoots were further transformed with the Agrobacterium rhizogenes A4RS containing hairpin RNA (hpRNA) directed toward the GUS gene, and driven by the 35S promoter. The silencing and control vectors contained the reporter gene of the green fluorescent protein (GFP), thus allowing a screening of GUS-silenced composite plantlets for autofluorescence. With this rapid procedure, histochemical data established that the reporter gene was strongly silenced in both fluorescent roots and actinorhizal nodules. Fluorometric data further established that the level of GUS silencing was usually greater than 90% in the hairy roots containing the hairpin GUS sequences. We found that the silencing process of the reporter gene did not spread to the aerial part of the composite A. verticillata plants. Real-time quantitative polymerase chain reaction showed that GUS mRNAs were substantially reduced in roots and, thereby, confirmed the knock-down of the GUS transgene in the GFP(+) hairy roots. The approach described here will provide a versatile tool for the rapid assessment of symbiotically related host genes in actinorhizal plants of the Casuarinaceae family.

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

PubMed

Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

2003-10-01

Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

Combination of RNA interference and virus receptor trap exerts additive antiviral activity in coxsackievirus B3-induced myocarditis in mice.

PubMed

Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens

2015-02-15

Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method.

PubMed

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-03-04

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications.

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method

PubMed Central

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-01-01

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications. PMID:26959020

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Identification of Short Hairpin RNA Targeting Foot-And-Mouth Disease Virus with Transgenic Bovine Fetal Epithelium Cells

PubMed Central

He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin

2012-01-01

Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125

RNA virus interference via CRISPR/Cas13a system in plants.

PubMed

Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy

2018-01-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A RNA Interference Screen Identifies the Protein Phosphatase 2A Subunit PR55γ as a Stress-Sensitive Inhibitor of c-SRC

PubMed Central

Eichhorn, Pieter J. A; Creyghton, Menno P; Wilhelmsen, Kevin; van Dam, Hans; Bernards, René

2007-01-01

Protein Phosphatase type 2A (PP2A) represents a family of holoenzyme complexes with diverse biological activities. Specific holoenzyme complexes are thought to be deregulated during oncogenic transformation and oncogene-induced signaling. Since most studies on the role of this phosphatase family have relied on the use of generic PP2A inhibitors, the contribution of individual PP2A holoenzyme complexes in PP2A-controlled signaling pathways is largely unclear. To gain insight into this, we have constructed a set of shRNA vectors targeting the individual PP2A regulatory subunits for suppression by RNA interference. Here, we identify PR55γ and PR55δ as inhibitors of c-Jun NH2-terminal kinase (JNK) activation by UV irradiation. We show that PR55γ binds c-SRC and modulates the phosphorylation of serine 12 of c-SRC, a residue we demonstrate to be required for JNK activation by c-SRC. We also find that the physical interaction between PR55γ and c-SRC is sensitive to UV irradiation. Our data reveal a novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55γ. PMID:18069897

Ethical Perspectives on RNA Interference Therapeutics

PubMed Central

Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

2008-01-01

RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

Classical reconstruction of interference patterns of position-wave-vector-entangled photon pairs by the time-reversal method

NASA Astrophysics Data System (ADS)

Ogawa, Kazuhisa; Kobayashi, Hirokazu; Tomita, Akihisa

2018-02-01

The quantum interference of entangled photons forms a key phenomenon underlying various quantum-optical technologies. It is known that the quantum interference patterns of entangled photon pairs can be reconstructed classically by the time-reversal method; however, the time-reversal method has been applied only to time-frequency-entangled two-photon systems in previous experiments. Here, we apply the time-reversal method to the position-wave-vector-entangled two-photon systems: the two-photon Young interferometer and the two-photon beam focusing system. We experimentally demonstrate that the time-reversed systems classically reconstruct the same interference patterns as the position-wave-vector-entangled two-photon systems.

RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.

PubMed

Rytlewski, Julie A; Beronja, Slobodan

2015-01-01

The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.

Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

PubMed

Rotenberg, D; Whitfield, A E

2010-08-01

Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

Involvement of LeMDR, an ATP-binding cassette protein gene, in shikonin transport and biosynthesis in Lithospermum erythrorhizon.

PubMed

Zhu, Yu; Lu, Gui-Hua; Bian, Zhuo-Wu; Wu, Feng-Yao; Pang, Yan-Jun; Wang, Xiao-Ming; Yang, Rong-Wu; Tang, Cheng-Yi; Qi, Jin-Liang; Yang, Yong-Hua

2017-11-13

Shikonin is a naphthoquinone secondary metabolite with important medicinal value and is found in Lithospermum erythrorhizon. Considering the limited knowledge on the membrane transport mechanism of shikonin, this study investigated such molecular mechanism. We successfully isolated an ATP-binding cassette protein gene, LeMDR, from L. erythrorhizon. LeMDR is predominantly expressed in L. erythrorhizon roots, where shikonin accumulated. Functional analysis of LeMDR by using the yeast cell expression system revealed that LeMDR is possibly involved in the shikonin efflux transport. The accumulation of shikonin is lower in yeast cells transformed with LeMDR-overexpressing vector than that with empty vector. The transgenic hairy roots of L. erythrorhizon overexpressing LeMDR (MDRO) significantly enhanced shikonin production, whereas the RNA interference of LeMDR (MDRi) displayed a reverse trend. Moreover, the mRNA expression level of LeMDR was up-regulated by treatment with shikonin and shikonin-positive regulators, methyl jasmonate and indole-3-acetic acid. There might be a relationship of mutual regulation between the expression level of LeMDR and shikonin biosynthesis. Our findings demonstrated the important role of LeMDR in transmembrane transport and biosynthesis of shikonin.

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

PubMed

Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

2008-03-17

RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

RNA interference against stromal interacting molecule-1 (STIM1) ameliorates ethanol-induced hepatotoxicity.

PubMed

Cui, Ruibing; Li, Rong; Guo, Xiaolan; Jia, Xiaoqing; Yan, Ming

2018-06-01

Previously we have demonstrated that stromal interacting molecule-1 (STIM1) was involved in ethanol induced liver injury. However, the exact pathogenic mechanism of STIM1 in alcoholic liver disease (ALD) is still unknown. We constructed plasmid vectors encoding short-hairpin RNA against STIM1 to investigate its role in ALD in the rat liver cell line BRL and in Sprague-Dawley rats. The results showed that STIM1 targeted sh-RNA (Sh-STIM1) significantly ameliorated ethanol-induced BRL cells injury and liver injury in rats with 20 weeks-induced alcoholic liver disease. Inhibition of STIM1 also reduced intracellular calcium ion concentration, reactive oxygen species (ROS) production, lipid peroxidation, NF-kappa B activation and TNF-α production under ethanol exposure. STIM1 may play an important role in the pathogenesis of alcoholic liver disease. Silencing STIM1 may be effective in preventing alcoholic liver disease. Copyright © 2018 Elsevier B.V. All rights reserved.

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Innate Immune Control of West Nile Virus Infection

PubMed Central

Arjona, Alvaro; Wang, Penghua; Montgomery, Ruth R.; Fikrig, Erol

2011-01-01

West Nile virus (WNV), from the Flaviviridae family, is a re-emerging zoonotic pathogen of medical importance. In humans, WNV infection may cause life-threatening meningoencephalitis or long-term neurologic sequelae. WNV is transmitted by Culex spp mosquitoes and both the arthropod vector and the mammalian host are equipped with antiviral innate immune mechanisms sharing a common phylogeny. As far as the current evidence is able to demonstrate, mosquitoes primarily rely on RNA interference, Toll, Imd and JAK-STAT signaling pathways for limiting viral infection, while mammals are provided with these and other more complex antiviral mechanisms involving antiviral effectors, inflammatory mediators, and cellular responses triggered by highly specialized pathogen detection mechanisms that often resemble their invertebrate ancestry. This mini-review summarizes our current understanding of how the innate immune systems of the vector and the mammalian host react to WNV infection and shape its pathogenesis. PMID:21790942

Identification of germline transcriptional regulatory elements in Aedes aegypti.

PubMed

Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

2014-02-04

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Identification of germline transcriptional regulatory elements in Aedes aegypti

NASA Astrophysics Data System (ADS)

Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

2014-02-01

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Selective gene silencing by viral delivery of short hairpin RNA

PubMed Central

2010-01-01

RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

PubMed

Israni, B; Rajam, M V

2017-04-01

RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

PubMed

Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

2017-10-01

This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

First comparative transcriptomic analysis of wild adult male and female Lutzomyia longipalpis, vector of visceral leishmaniasis.

PubMed

McCarthy, Christina B; Santini, María Soledad; Pimenta, Paulo F P; Diambra, Luis A

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi).

First Comparative Transcriptomic Analysis of Wild Adult Male and Female Lutzomyia longipalpis, Vector of Visceral Leishmaniasis

PubMed Central

McCarthy, Christina B.; Santini, María Soledad; Pimenta, Paulo F. P.; Diambra, Luis A.

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi). PMID:23554910

Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

PubMed

Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

2015-09-01

Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

Renewing the Assault on mRNA

PubMed Central

McCAIN, JACK

2004-01-01

Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488

repRNA: a web server for generating various feature vectors of RNA sequences.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2016-02-01

With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .

Delivery of gene silencing agents for breast cancer therapy

PubMed Central

2013-01-01

The discovery of RNA interference has opened the door for the development of a new class of cancer therapeutics. Small inhibitory RNA oligos are being designed to specifically suppress expression of proteins that are traditionally considered nondruggable, and microRNAs are being evaluated to exert broad control of gene expression for inhibition of tumor growth. Since most naked molecules are not optimized for in vivo applications, the gene silencing agents need to be packaged into delivery vehicles in order to reach the target tissues as their destinations. Thus, the selection of the right delivery vehicles serves as a crucial step in the development of cancer therapeutics. The current review summarizes the status of gene silencing agents in breast cancer and recent development of candidate cancer drugs in clinical trials. Nanotechnology-based delivery vectors for the formulation and packaging of gene silencing agents are also described. PMID:23659575

Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

PubMed Central

Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

2011-01-01

Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

A simple method for construction of artificial microRNA vector in plant.

PubMed

Li, Yang; Li, Yang; Zhao, Sunping; Zhong, Sheng; Wang, Zhaohai; Ding, Bo; Li, Yangsheng

2014-10-01

Artificial microRNA (amiRNA) is a powerful tool for silencing genes in many plant species. Here we provide an easy method to construct amiRNA vectors that reinvents the Golden Gate cloning approach and features a novel system called top speed amiRNA construction (TAC). This speedy approach accomplishes one restriction-ligation step in only 5 min, allowing easy and high-throughput vector construction. Three primers were annealed to be a specific adaptor, then digested and ligated on our novel vector pTAC. Importantly, this method allows the recombined amiRNA constructs to maintain the precursor of osa-miR528 with exception of the desired amiRNA/amiRNA* sequences. Using this method, our results showed the expected decrease of targeted genes in Nicotiana benthamiana and Oryza sativa.

A novel tyrosine-modified low molecular weight polyethylenimine (P10Y) for efficient siRNA delivery in vitro and in vivo.

PubMed

Ewe, Alexander; Przybylski, Susanne; Burkhardt, Jana; Janke, Andreas; Appelhans, Dietmar; Aigner, Achim

2016-05-28

The delivery of nucleic acids, particularly of small RNA molecules like siRNAs for the induction of RNA interference (RNAi), still represents a major hurdle with regard to their application in vivo. Possible therapeutic applications thus rely on the development of efficient non-viral gene delivery vectors. While low molecular weight polyethylenimines (PEIs) have been successfully explored, the introduction of chemical modifications offers an avenue towards the development of more efficient vectors. In this paper, we describe the synthesis of a novel tyrosine-modified low-molecular weight polyethylenimine (P10Y) for efficient siRNA complexation and delivery. The comparison with the respective parent PEI reveals that knockdown efficacies are considerably enhanced by the tyrosine modification, as determined in different reporter cell lines, without appreciable cytotoxicity. We furthermore identify optimal conditions for complex preparation as well as for storing or lyophilization of the complexes without loss of biological activity. Beyond reporter cell lines, P10Y/siRNA complexes mediate the efficient knockdown of endogenous target genes and, upon knockdown of the anti-apoptotic oncogene survivin, tumor cell inhibitory effects in different carcinoma cell lines. Pushing the system further towards its therapeutic in vivo application, we demonstrate in mice the delivery of intact siRNAs and distinct biodistribution profiles upon systemic (intravenous or intraperitoneal) injection. No adverse effects (hepatotoxicity, immunostimulation/alterations in immunophenotype, weight loss) are observed. More importantly, profound tumor-inhibitory effects in a melanoma xenograft mouse model are observed upon systemic application of P10Y/siRNA complexes for survivin knockdown, indicating the therapeutic efficacy of P10Y/siRNA complexes. Taken together, we (i) establish tyrosine-modified PEI (P10Y) as efficient platform for siRNA delivery in vitro and in vivo, (ii) identify optimal preparation and storage conditions as well as (iii) physicochemical and biological properties of P10Y complexes, and (iv) demonstrate their applicability as siRNA therapeutic in vivo (v) in the absence of adverse effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

PubMed

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

Induction of interferon lambda in influenza a virus infected cells treated with shRNAs against M1 transcript.

PubMed

Švančarová, P; Svetlíková, D; Betáková, T

2015-06-01

RNA interference (RNAi) represents a form of post-transcriptional gene silencing mediated by small interfering RNAs (siRNA) and provides a powerful tool to specifically inhibit viral infection. To investigate therapeutic capacity of siRNAs targeting M gene, six vectors with U1-short hairpin RNA (shRNA) expression system were prepared and tested in infected cells and animals. In infected cells, three of six shRNAs targeting M1 gene significantly (P <0,01) reduced the virus titer to 66%, 45% or 21%, respectively. Replication of IAV and levels of M1 RNAs were significantly reduced in the cells transfected with shRNAs, which decreased the virus titer. IFN-α/β altered in shRNAs-treated cells. The level of IFN-λ (type III interferon) mRNA was significantly increased in the infected cells treated with shM22, shM349, shM522, and (type I interferon) as well as IP-10 (type II interferon) mRNAs were not significantly their mixtures. The increased level of IFN-λ mRNA corresponded to significantly increased level of RIG-1 mRNA. shRNAs inhibited influenza virus infection in a gene-specific manner in co-operation with IFN-λ. Some constructs targeting the M1 transcript prolonged the survival of infected mice.

Folate-targeted amphiphilic cyclodextrin nanoparticles incorporating a fusogenic peptide deliver therapeutic siRNA and inhibit the invasive capacity of 3D prostate cancer tumours.

PubMed

Evans, James C; Malhotra, Meenakshi; Sweeney, Katrina; Darcy, Raphael; Nelson, Colleen C; Hollier, Brett G; O'Driscoll, Caitriona M

2017-10-30

The main barrier to the development of an effective RNA interference (RNAi) therapy is the lack of a suitable delivery vector. Modified cyclodextrins have emerged in recent years for the delivery of siRNA. In the present study, a folate-targeted amphiphilic cyclodextrin was formulated using DSPE-PEG 5000 -folate to target prostate cancer cells. The fusogenic peptide GALA was included in the formulation to aid in the endosomal release of siRNA. Targeted nanoparticles were less than 200nm in size with a neutral surface charge. The complexes were able to bind siRNA and protect it from serum nucleases. Incubation with excess free folate resulted in a significant decrease in the uptake of targeted nanoparticles in LNCaP and PC3 cells, both of which have been reported to have differing pathways of folate uptake. There was a significant reduction in the therapeutic targets, ZEB1 and NRP1 at mRNA and protein level following treatment with targeted complexes. In preliminary functional assays using 3D spheroids, treatment of PC3 tumours with targeted complexes with ZEB1 and NRP1 siRNA resulted in more compact colonies relative to the untargeted controls and inhibited infiltration into the Matrigel™ layer. Copyright © 2017 Elsevier B.V. All rights reserved.

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice

PubMed Central

Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping

2011-01-01

The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862

Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

PubMed Central

Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

2013-01-01

Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

PubMed

Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

2017-08-01

Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

KHARON Is an Essential Cytoskeletal Protein Involved in the Trafficking of Flagellar Membrane Proteins and Cell Division in African Trypanosomes*

PubMed Central

Sanchez, Marco A.; Tran, Khoa D.; Valli, Jessica; Hobbs, Sam; Johnson, Errin; Gluenz, Eva; Landfear, Scott M.

2016-01-01

African trypanosomes and related kinetoplastid parasites selectively traffic specific membrane proteins to the flagellar membrane, but the mechanisms for this trafficking are poorly understood. We show here that KHARON, a protein originally identified in Leishmania parasites, interacts with a putative trypanosome calcium channel and is required for its targeting to the flagellar membrane. KHARON is located at the base of the flagellar axoneme, where it likely mediates targeting of flagellar membrane proteins, but is also on the subpellicular microtubules and the mitotic spindle. Hence, KHARON is probably a multifunctional protein that associates with several components of the trypanosome cytoskeleton. RNA interference-mediated knockdown of KHARON mRNA results in failure of the calcium channel to enter the flagellar membrane, detachment of the flagellum from the cell body, and disruption of mitotic spindles. Furthermore, knockdown of KHARON mRNA induces a lethal failure of cytokinesis in both bloodstream (mammalian host) and procyclic (insect vector) life cycle stages, and KHARON is thus critical for parasite viability. PMID:27489106

New therapeutic opportunities for Hepatitis C based on small RNA

PubMed Central

Pan, Qiu-Wei; Henry, Scot D; Scholte, Bob J; Tilanus, Hugo W; Janssen, Harry LA; van der Laan, Luc JW

2007-01-01

Hepatitis C virus (HCV) infection is one of the major causes of chronic liver disease, including cirrhosis and liver cancer and is therefore, the most common indication for liver transplantation. Conventional antiviral drugs such as pegylated interferon-alpha, taken in combination with ribavirin, represent a milestone in the therapy of this disease. However, due to different viral and host factors, clinical success can be achieved only in approximately half of patients, making urgent the requirement of exploiting alternative approaches for HCV therapy. Fortunately, recent advances in the understanding of HCV viral replication and host cell interactions have opened new possibilities for therapeutic intervention. The most recent technologies, such as small interference RNA mediated gene-silencing, anti-sense oligonucleotides (ASO), or viral vector based gene delivery systems, have paved the way to develop novel therapeutic modalities for HCV. In this review, we outline the application of these technologies in the context of HCV therapy. In particular, we will focus on the newly defined role of cellular microRNA (miR-122) in viral replication and discuss its potential for HCV molecular therapy. PMID:17724797

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

PubMed

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.

Multifunctional nanocarrier based on clay nanotubes for efficient intracellular siRNA delivery and gene silencing.

PubMed

Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin

2014-04-01

RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.

Minimum Variance Distortionless Response Beamformer with Enhanced Nulling Level Control via Dynamic Mutated Artificial Immune System

PubMed Central

Kiong, Tiong Sieh; Salem, S. Balasem; Paw, Johnny Koh Siaw; Sankar, K. Prajindra

2014-01-01

In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals. PMID:25003136

Minimum variance distortionless response beamformer with enhanced nulling level control via dynamic mutated artificial immune system.

PubMed

Kiong, Tiong Sieh; Salem, S Balasem; Paw, Johnny Koh Siaw; Sankar, K Prajindra; Darzi, Soodabeh

2014-01-01

In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals.

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

PubMed Central

Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

2011-01-01

Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

Fluorescent carbon dots as an efficient siRNA nanocarrier for its interference therapy in gastric cancer cells.

PubMed

Wang, Qing; Zhang, Chunlei; Shen, Guangxia; Liu, Huiyang; Fu, Hualin; Cui, Daxiang

2014-12-30

Fluorescent carbon dots (Cdots) have attracted increasing attention due to their potential applications in sensing, catalysis, and biomedicine. Currently, intensive research has been concentrated on the synthesis and imaging-guided therapy of these benign photoluminescent materials. Meanwhile, Cdots have been explored as nonviral vector for nucleic acid or drug delivery by chemical modification on purpose. We have developed a microwave assisted one-step synthesis of Cdots with citric acid as carbon source and tryptophan (Trp) as both nitrogen source and passivation agent. The Cdots with uniform size show superior water solubility, excellent biocompatibility, and high quantum yield. Afterwards, the PEI (polyethylenimine)-adsorbed Cdots nanoparticles (Cdots@PEI) were applied to deliver Survivin siRNA into human gastric cancer cell line MGC-803. The results have confirmed the nanocarrier exhibited excellent biocompatibility and a significant increase in cellular delivery of siRNA, inducing efficient knockdown for Survivin protein to 6.1%. In addition, PEI@Cdots complexes mediated Survivin silencing, the arrested cell cycle progression in G1 phase as well as cell apoptosis was observed. The Cdots-based and PEI-adsorbed complexes both as imaging agents and siRNA nanocarriers have been developed for Survivin siRNA delivery. And the results indicate that Cdots-based nanocarriers could be utilized in a broad range of siRNA delivery systems for cancer therapy.

Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

PubMed Central

Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

2016-01-01

Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Adenovirus-vectored shRNAs targeted to the highly conserved regions of VP1 and 2B in tandem inhibits replication of foot-and-mouth disease virus both in vitro and in vivo.

PubMed

Xu, Yan-Fang; Shen, Hai-Yan; Zhao, Ming-Qiu; Chen, Li-Jun; Li, Yin-Guang; Liao, Ming; Jia, Jun-Tao; Lv, Ying-Ran; Yi, Lin; Chen, Jin-Ding

2012-04-01

Foot-and-mouth disease is a highly contagious and economically important disease of cloven-hoofed animals. RNA interference (RNAi) can be used as a rapid and specific antiviral approach. It was shown that treatment with recombinant adenovirus (Ad(VP1-2B)) carrying shRNAs targeted to the VP1 and 2B genes of FMDV expressed in tandem had marked antiviral effects against FMDV both in IBRS-2 cells and guinea pigs. Treatment with Ad(VP1-2B) both before and after FMDV infection was most effective in IBRS-2 cells, as the FMDV RNA transcripts could not be detected within 48 h post-challenge (hpc), and the viral RNA copy number at 72 hpc was only 0.02% of that in the positive control group. Delivery of Ad(VP1-2B) reduced significantly the susceptibility of guinea pigs to FMDV infection. All guinea pigs were protected within 3 days post challenge (dpc) when they were injected twice with the same dose of Ad(VP1-2B), and a third treatment with the same dose of Ad(VP1-2B) at 3 dpc was necessary to confer longer lasting protection (up to 6 dpc). In conclusion, application of such a adenovirus vector to inhibit more than one viral gene may be an advantageous method for prevention and therapy of FMDV infection. Copyright © 2012 Elsevier B.V. All rights reserved.

Improved nucleic acid descriptors for siRNA efficacy prediction.

PubMed

Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

2013-02-01

Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

RNA interference of acetylcholinesterase in the Asian citrus psyllid, Diaphorina citri, increases its susceptibility to carbamate and organophosphate insecticides.

PubMed

Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil

2017-11-01

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin, which indicated that AChE could be involved in the metabolism of fenpropathrin. Our results indicated that silencing of AChE and ChE genes in D. citri to increase its susceptibility to insecticides could be a promising tool for the control of this important vector. Copyright © 2017 Elsevier Inc. All rights reserved.

Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2 H – NbSe 2

DOE PAGES

Arguello, C. J.; Rosenthal, E. P.; Andrade, E. F.; ...

2015-01-21

We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe₂ that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe₂. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiologymore » and the interactions. In 2H-NbSe₂, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.« less

Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2H-NbSe2.

PubMed

Arguello, C J; Rosenthal, E P; Andrade, E F; Jin, W; Yeh, P C; Zaki, N; Jia, S; Cava, R J; Fernandes, R M; Millis, A J; Valla, T; Osgood, R M; Pasupathy, A N

2015-01-23

We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe2 that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe2. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiology and the interactions. In 2H-NbSe2, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

PubMed

Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

The promises and pitfalls of RNA-interference-based therapeutics

PubMed Central

Castanotto, Daniela; Rossi, John J.

2009-01-01

The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

PubMed

Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

2014-03-01

Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

PubMed Central

Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

2004-01-01

Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

Summary of bi-shRNA/GM-CSF augmented autologous tumor cell immunotherapy (FANG™) in advanced cancer of the liver.

PubMed

Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil

2014-01-01

Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.

Silencing of Endogenous IL-10 in Human Dendritic Cells Leads to the Generation of an Improved CTL Response Against Human Melanoma Associated Antigenic Epitope, MART-127−35

PubMed Central

Chhabra, Arvind; Chakraborty, Nityo G.; Mukherji, Bijay

2008-01-01

Dendritic cells (DC) present antigenic epitopes to and activate T cells. They also polarize the ensuing T cell response to Th1 or Th2 type response, depending on their cytokine production profile. For example, IL-12 producing DC generate Th1 type T cell response whereas IL-10 producing DC is usually tolerogenic. Different strategies -- such as the use of cytokines and anti-cytokine antibodies, dominant negative forms of protein, anti-sense RNA etc. -- have been employed to influence the cytokine synthetic profile of DC as well as to make DC more immunogenic. Utilizing GFP expressing recombinant adenoviruses in association with lipid-mediated transfection of siRNA, we have silenced the endogenous IL-10 gene in DC. We show that IL-10 gene silenced DC produce more IL-12 and also generates a better cytolytic T cell response against the human melanoma associated epitope, MART-127−35, in-vitro. We also show that the GFP expressing adenoviral vector can be used to optimize the parameters for siRNA delivery in primary cells and show that RNA interference methodology can efficiently knock-down virus encoded genes transcribed at very high multiplicity of infection in DC. PMID:18249038

Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

PubMed

Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M

2007-05-01

Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

RNA Interference Therapies for an HIV-1 Functional Cure.

PubMed

Scarborough, Robert J; Gatignol, Anne

2017-12-27

HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

PubMed

Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

2018-05-01

Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

PubMed Central

Ladunga, Istvan

2007-01-01

Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

PubMed

Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

2018-06-12

Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

Non-invasive delivery of dsGST is lethal to the sweet potato whitefly, Bemisia tabaci (G.) (Hemiptera: Aleyrodidae).

PubMed

Asokan, R; Rebijith, K B; Roopa, H K; Kumar, N K Krishna

2015-02-01

The sweet potato whitefly, Bemisia tabaci (G.) biotype B (Hemiptera: Aleyrodidae), is one of the most economically important pest, by being a dreaded vector of Geminiviruses, and also causes direct damage to the crops by sucking phloem sap. Glutathione S-transferase (GST) is a large family of multifunctional enzymes that play pivotal roles in the detoxification of secondary allelochemical produced by the host plants and in insecticide resistance, thus regulates insect growth and development. The objective of this study is to show the potential of RNA interference (RNAi) in the management of B. tabaci. RNAi is a sequence-specific gene silencing mechanism induced by double-stranded RNA (dsRNA) which holds tremendous potential in pest management. In this regard, we sequenced the GST from B. tabaci and synthesized approximately 500-bp dsRNA from the above and delivered through diet to B. tabaci. Real-time quantitative PCR (RT-qPCR) showed that continuous application of dsGST at 1.0, 0.5, and 0.25 μg/μl reduced mRNA expression levels for BtGST by 77.43, 64.86, and 52.95 % which resulted in mortality by 77, 59, and 40 %, respectively, after 72 h of application. Disruption of BtGST expression will enable the development of novel strategies in pest management and functional analysis of vital genes in B. tabaci.

Generation of siRNA Nanosheets for Efficient RNA Interference

NASA Astrophysics Data System (ADS)

Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

2016-04-01

After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

EPA Science Inventory

The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

PubMed Central

Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

2004-01-01

Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

Rootstock-to-scion transfer of transgene-derived small interfering RNAs and their effect on virus resistance in nontransgenic sweet cherry.

PubMed

Zhao, Dongyan; Song, Guo-qing

2014-12-01

Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

PubMed Central

McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

2016-01-01

RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

Short hairpin RNA interference therapy for ischemic heart disease.

PubMed

Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C

2008-09-30

During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future.

Short hairpin RNA interference therapy for ischemic heart disease

PubMed Central

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future. PMID:18824759

A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells

PubMed Central

Li, Guanhua; Hu, Zuojun; Yin, Henghui; Zhang, Yunjian; Huang, Xueling; Wang, Shenming; Li, Wen

2013-01-01

The application of RNA interference techniques is promising in gene therapeutic approaches, especially for cancers. To improve safety and efficiency of small interfering RNA (siRNA) delivery, a triblock dendritic nanocarrier, polyamidoamine-polyethylene glycol-cyclic RGD (PAMAM-PEG-cRGD), was developed and studied as an siRNA vector targeting the human ether-à-go-go-related gene (hERG) in human anaplastic thyroid carcinoma cells. Structure characterization, particle size, zeta potential, and gel retardation assay confirmed that complete triblock components were successfully synthesized with effective binding capacity of siRNA in this triblock nanocarrier. Cytotoxicity data indicated that conjugation of PEG significantly alleviated cytotoxicity when compared with unmodified PAMAM. PAMAM-PEG-cRGD exerted potent siRNA cellular internalization in which transfection efficiency measured by flow cytometry was up to 68% when the charge ratio (N/P ratio) was 3.5. Ligand-receptor affinity together with electrostatic interaction should be involved in the nano-siRNA endocytosis mechanism and we then proved that attachment of cRGD enhanced cellular uptake via RGD-integrin recognition. Gene silencing was evaluated by reverse transcription polymerase chain reaction and PAMAM-PEG-cRGD-siRNA complex downregulated the expression of hERG to 26.3% of the control value. Furthermore, gene knockdown of hERG elicited growth suppression as well as activated apoptosis by means of abolishing vascular endothelial growth factor secretion and triggering caspase-3 cascade in anaplastic thyroid carcinoma cells. Our study demonstrates that this novel triblock polymer, PAMAM-PEG-cRGD, exhibits negligible cytotoxicity, effective transfection, “smart” cancer targeting, and therefore is a promising siRNA nanocarrier. PMID:23569377

An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

PubMed Central

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

2015-01-01

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

Development of leafhopper cell culture to trace the early infection process of a nucleorhabdovirus, rice yellow stunt virus, in insect vector cells.

PubMed

Wang, Haitao; Wang, Juan; Xie, Yunjie; Fu, Zhijun; Wei, Taiyun; Zhang, Xiao-Feng

2018-04-20

In China, the rice pathogen Rice yellow stunt virus (RYSV), a member of the genus Nucleorhabdovirus in the family Rhabdoviridae, was a severe threat to rice production during the1960s and1970s. Fundamental aspects of the biology of this virus such as protein localization and formation of the RYSV viroplasm during infection of insect vector cells are largely unexplored. The specific role(s) of the structural proteins nucleoprotein (N) and phosphoprotein (P) in the assembly of the viroplasm during RYSV infection in insect vector is also unclear. In present study, we used continuous leafhopper cell culture, immunocytochemical techniques, and transmission electron microscopy to investigate the subcellular distributions of N and P during RYSV infection. Both GST pull-down assay and yeast two-hybrid assay were used to assess the in vitro interaction of N and P. The dsRNA interference assay was performed to study the functional roles of N and P in the assembly of RYSV viroplasm. Here we demonstrated that N and P colocalized in the nucleus of RYSV-infected Nephotettix cincticeps cell and formed viroplasm-like structures (VpLSs). The transiently expressed N and P are sufficient to form VpLSs in the Sf9 cells. In addition, the interactions of N/P, N/N and P/P were confirmed in vitro. More interestingly, the accumulation of RYSV was significantly reduced when the transcription of N gene or P gene was knocked down by dsRNA treatment. In summary, our results suggest that N and P are the main viral factors responsible for the formation of viroplasm in RYSV-infected insect cells. Early during RYSV infection in the insect vector, N and P interacted with each other in the nucleus to form viroplasm-like structures, which are essential for the infection of RYSV.

Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

PubMed

Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

2015-01-01

To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

Induced antiviral innate immunity in Drosophila.

PubMed

Lamiable, Olivier; Imler, Jean-Luc

2014-08-01

Immunity to viral infections in the model organism Drosophila melanogaster involves both RNA interference and additional induced responses. The latter include not only cellular mechanisms such as programmed cell death and autophagy, but also the induction of a large set of genes, some of which contribute to the control of viral replication and resistance to infection. This induced response to infection is complex and involves both virus-specific and cell-type specific mechanisms. We review here recent developments, from the sensing of viral infection to the induction of signaling pathways and production of antiviral effector molecules. Our current understanding, although still partial, validates the Drosophila model of antiviral induced immunity for insect pests and disease vectors, as well as for mammals. Copyright © 2014 Elsevier Ltd. All rights reserved.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

PubMed

Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

2015-03-01

Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.

Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.

PubMed

O'Connell, Mitchell

2018-06-22

Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.

RNA targeting with CRISPR-Cas13.

PubMed

Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

2017-10-12

RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

Larval application of sodium channel homologous dsRNA restores pyrethroid insecticide susceptibility in a resistant adult mosquito population.

PubMed

Bona, Ana Caroline Dalla; Chitolina, Rodrigo Faitta; Fermino, Marise Lopes; de Castro Poncio, Lisiane; Weiss, Avital; Lima, José Bento Pereira; Paldi, Nitzan; Bernardes, Emerson Soares; Henen, Jonathan; Maori, Eyal

2016-07-14

Mosquitoes host and pass on to humans a variety of disease-causing pathogens such as infectious viruses and other parasitic microorganisms. The emergence and spread of insecticide resistance is threatening the effectiveness of current control measures for common mosquito vector borne diseases, such as malaria, dengue and Zika. Therefore, the emerging resistance to the widely used pyrethroid insecticides is an alarming problem for public health. Herein we demonstrated the use of RNA interference (RNAi) to increase susceptibility of adult mosquitoes to a widely used pyrethroid insecticide. Experiments were performed on a field-collected pyrethroid resistant strain of Ae. aegypti (Rio de Janeiro; RJ). Larvae from the resistant Ae. aegypti population were soaked with double-stranded RNAs (dsRNAs) that correspond either to voltage-gate sodium channel (VGSC), P-glycoprotein, or P450 detoxification genes and reared to adulthood. Adult mortality rates in the presence of various Deltamethrin pyrethroid concentrations were used to assess mosquito insecticide susceptibility. We characterized the RJ Ae. aegypti strain with regard to its level of resistance to a pyrethroid insecticide and found that it was approximately 6 times more resistant to Deltamethrin compared to the laboratory Rockefeller strain. The RJ strain displayed a higher frequency of Val1016Ile and Phe1534Cys substitutions of the VGSC gene. The resistant strain also displayed a higher basal expression level of VGSC compared to the Rockefeller strain. When dsRNA-treated mosquitoes were subjected to a standard pyrethroid contact bioassay, only dsRNA targeting VGSC increased the adult mortality of the pyrethroid resistant strain. The dsRNA treatment proved effective in increasing adult mosquito susceptibility over a range of pyrethroid concentrations and these results were associated with dsRNA-specific small interfering RNAs in treated adults, and the corresponding specific down regulation of VGSC gene expression level. Finally, we demonstrated that the efficiency of our approach was further improved by 'tiling' along the VGSC gene in order to identify the most potent dsRNA sequences. These results demonstrate that dsRNA applied to mosquito larvae retains its biological activity into adulthood. Thus, the RNAi system reported here could be a useful approach to control the widespread insecticide resistance in mosquitoes and other insect vectors of human diseases.

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

PubMed

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

PubMed Central

Marraffini, Luciano A.; Sontheimer, Erik J.

2010-01-01

Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

User's guide to PANCOR: A panel method program for interference assessment in slotted-wall wind tunnels

NASA Technical Reports Server (NTRS)

Kemp, William B., Jr.

1990-01-01

Guidelines are presented for use of the computer program PANCOR to assess the interference due to tunnel walls and model support in a slotted wind tunnel test section at subsonic speeds. Input data requirements are described in detail and program output and general program usage are described. The program is written for effective automatic vectorization on a CDC CYBER 200 class vector processing system.

Adenovirus Delivered Short Hairpin RNA Targeting a Conserved Site in the 5′ Non-Translated Region Inhibits All Four Serotypes of Dengue Viruses

PubMed Central

Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam

2012-01-01

Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770

Cell-penetrating cationic siRNA and lipophilic derivatives efficient at nanomolar concentrations in the presence of serum and albumin.

PubMed

Perche, Phanélie; Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Kotera, Mitsuharu; Remy, Jean-Serge

2013-08-28

Despite its considerable interest in human therapy, in vivo siRNA delivery is still suffering from hurdles of vectorization. We have shown recently efficient gene silencing by non-vectorized cationic siRNA. Here, we describe the synthesis and in vitro evaluation of new amphiphilic cationic siRNA. C₁₂-, (C₁₂)₂- and cholesteryl-spermine(x)-siRNA were capable of luciferase knockdown at nanomolar concentrations without vectorization (i.e. one to two orders of magnitude more potent than commercially available cholesteryl siRNA). Moreover, incubation in the presence of serum did not impair their efficiency. Finally, amphiphilic cationic siRNA was pre-loaded on albumin. In A549Luc cells in the presence of serum, these siRNA conjugates were highly effective and had low toxicity. Copyright © 2013. Published by Elsevier B.V.

Analysis of the resistance-breaking ability of different beet necrotic yellow vein virus isolates loaded into a single Polymyxa betae population in soil.

PubMed

Bornemann, Kathrin; Varrelmann, Mark

2011-06-01

The genome of most Beet necrotic yellow vein virus (BNYVV) isolates is comprised of four RNAs. The ability of certain isolates to overcome Rz1-mediated resistance in sugar beet grown in the United States and Europe is associated with point mutations in the pathogenicity factor P25. When the virus is inoculated mechanically into sugar beet roots at high density, the ability depends on an alanine to valine substitution at P25 position 67. Increased aggressiveness is shown by BNYVV P type isolates, which carry an additional RNA species that encodes a second pathogenicity factor, P26. Direct comparison of aggressive isolates transmitted by the vector, Polymyxa betae, has been impossible due to varying population densities of the vector and other soilborne pathogens that interfere with BNYVV infection. Mechanical root inoculation and subsequent cultivation in soil that carried a virus-free P. betae population was used to load P. betae with three BNYVV isolates: a European A type isolate, an American A type isolate, and a P type isolate. Resistance tests demonstrated that changes in viral aggressiveness towards Rz1 cultivars were independent of the vector population. This method can be applied to the study of the synergism of BNYVV with other P. betae-transmitted viruses.

RNA interference-mediated intrinsic antiviral immunity in invertebrates.

PubMed

Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

2013-01-01

In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

[New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

PubMed

Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

1997-04-01

A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

Oral Delivery of Double-Stranded RNA in Larvae of the Yellow Fever Mosquito, Aedes aegypti: Implications for Pest Mosquito Control

PubMed Central

Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven

2013-01-01

RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468

An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

PubMed

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

2015-02-13

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Using adenovirus armed short hairpin RNA targeting transforming growth factor β1 inhibits melanoma growth and metastasis in an ex vivo animal model.

PubMed

Tai, Kuo-Feng; Wang, Chien-Hsing

2013-12-01

The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.

A surface transporter family conveys the trypanosome differentiation signal.

PubMed

Dean, Samuel; Marchetti, Rosa; Kirk, Kiaran; Matthews, Keith R

2009-05-14

Microbial pathogens use environmental cues to trigger the developmental events needed to infect mammalian hosts or transmit to disease vectors. The parasites causing African sleeping sickness respond to citrate or cis-aconitate (CCA) to initiate life-cycle development when transmitted to their tsetse fly vector. This requires hypersensitization of the parasites to CCA by exposure to low temperature, conditions encountered after tsetse fly feeding at dusk or dawn. Here we identify a carboxylate-transporter family, PAD (proteins associated with differentiation), required for perception of this differentiation signal. Consistent with predictions for the response of trypanosomes to CCA, PAD proteins are expressed on the surface of the transmission-competent 'stumpy-form' parasites in the bloodstream, and at least one member is thermoregulated, showing elevated expression and surface access at low temperature. Moreover, RNA-interference-mediated ablation of PAD expression diminishes CCA-induced differentiation and eliminates CCA hypersensitivity under cold-shock conditions. As well as being molecular transducers of the differentiation signal in these parasites, PAD proteins provide the first example of a surface marker able to discriminate the transmission stage of trypanosomes in their mammalian host.

Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

PubMed

Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

2018-06-21

Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

PubMed Central

Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

2012-01-01

Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors incorporating hypoxia-responsive promoters to drive transgene expression. We therefore employed a combinatorial approach using miRT-122 elements with hypoxia-responsive transcriptional targeting to further improve the tumor specific expression of an adenoviral reporter gene. Results from this investigation reveal that miRT122 elements alone decrease off-target liver expression and improve tumor specificity of adenoviral vectors. Furthermore, increased tumor specificity can be achieved by combining miRT-122 elements with hypoxia-responsive promoters. PMID:22555510

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

[Sendai virus vector: vector development and its application to health care and biotechnology].

PubMed

Iida, Akihiro

2007-06-01

Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

A novel intranuclear RNA vector system for long-term stem cell modification

PubMed Central

Ikeda, Yasuhiro; Makino, Akiko; Matchett, William E.; Holditch, Sara J.; Lu, Brian; Dietz, Allan B.; Tomonaga, Keizo

2015-01-01

Genetically modified stem and progenitor cells have emerged as a promising regenerative platform in the treatment of genetic and degenerative disorders, highlighted by their successful therapeutic use in inherent immunodeficiencies. However, biosafety concerns over insertional mutagenesis resulting from integrating recombinant viral vectors have overshadowed the widespread clinical applications of genetically modified stem cells. Here, we report an RNA-based episomal vector system, amenable for long-term transgene expression in stem cells. Specifically, we used a unique intranuclear RNA virus, Borna disease virus (BDV), as the gene transfer vehicle, capable of persistent infections in various cell types. BDV-based vectors allowed for long-term transgene expression in mesenchymal stem cells (MSCs) without affecting cellular morphology, cell surface CD105 expression, or the adipogenicity of MSCs. Similarly, replication-defective BDV vectors achieved long-term transduction of human induced pluripotent stem cells (iPSCs), while maintaining the ability to differentiate into three embryonic germ layers. Thus, the BDV-based vectors offer a genomic modification-free, episomal RNA delivery system for sustained stem cell transduction. PMID:26632671

RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.

PubMed

Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu

2017-04-01

Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.

A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer.

PubMed

Torrent, C; Gabus, C; Darlix, J L

1994-02-01

Retroviral genomes consist of two identical RNA molecules associated at their 5' ends by the dimer linkage structure located in the packaging element (Psi or E) necessary for RNA dimerization in vitro and packaging in vivo. In murine leukemia virus (MLV)-derived vectors designed for gene transfer, the Psi + sequence of 600 nucleotides directs the packaging of recombinant RNAs into MLV virions produced by helper cells. By using in vitro RNA dimerization as a screening system, a sequence of rat VL30 RNA located next to the 5' end of the Harvey mouse sarcoma virus genome and as small as 67 nucleotides was found to form stable dimeric RNA. In addition, a purine-rich sequence located at the 5' end of this VL30 RNA seems to be critical for RNA dimerization. When this VL30 element was extended by 107 nucleotides at its 3' end and inserted into an MLV-derived vector lacking MLV Psi +, it directed the efficient encapsidation of recombinant RNAs into MLV virions. Because this VL30 packaging signal is smaller and more efficient in packaging recombinant RNAs than the MLV Psi + and does not contain gag or glyco-gag coding sequences, its use in MLV-derived vectors should render even more unlikely recombinations which could generate replication-competent viruses. Therefore, utilization of the rat VL30 packaging sequence should improve the biological safety of MLV vectors for human gene transfer.

Exploring Fusarium head blight disease control by RNA interference

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

Compositions and Methods for Inhibiting Gene Expressions

NASA Technical Reports Server (NTRS)

Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)

2018-01-01

A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE PAGES

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

2016-10-13

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

[Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

PubMed

Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

2010-06-01

A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

High-level systemic expression of conserved influenza epitope in plants on the surface of rod-shaped chimeric particles.

PubMed

Petukhova, Natalia V; Gasanova, Tatiana V; Ivanov, Peter A; Atabekov, Joseph G

2014-04-21

Recombinant viruses based on the cDNA copy of the tobacco mosaic virus (TMV) genome carrying different versions of the conserved M2e epitope from influenza virus A cloned into the coat protein (CP) gene were obtained and partially characterized by our group previously; cysteines in the human consensus M2e sequence were changed to serine residues. This work intends to show some biological properties of these viruses following plant infections. Agroinfiltration experiments on Nicotiana benthamiana confirmed the efficient systemic expression of M2e peptides, and two point amino acid substitutions in recombinant CPs significantly influenced the symptoms and development of viral infections. Joint expression of RNA interference suppressor protein p19 from tomato bushy stunt virus (TBSV) did not affect the accumulation of CP-M2e-ser recombinant protein in non-inoculated leaves. RT-PCR analysis of RNA isolated from either infected leaves or purified TMV-M2e particles proved the genetic stability of TMV‑based viral vectors. Immunoelectron microscopy of crude plant extracts demonstrated that foreign epitopes are located on the surface of chimeric virions. The rod‑shaped geometry of plant-produced M2e epitopes is different from the icosahedral or helical filamentous arrangement of M2e antigens on the carrier virus-like particles (VLP) described earlier. Thereby, we created a simple and efficient system that employs agrobacteria and plant viral vectors in order to produce a candidate broad-spectrum flu vaccine.

LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

PubMed

Shao, Yongfu; Ye, Meng; Li, Qier; Sun, Weiliang; Ye, Guoliang; Zhang, Xinjun; Yang, Yunben; Xiao, Bingxiu; Guo, Junming

2016-06-21

Long noncoding RNAs (lncRNAs) play crucial roles in tumorigenesis. However, the mechanisms of most lncRNAs in cancers are largely unknown. Because the RNA component of mitochondrial RNA processing endoribonuclease (RMRP) is one of the dysregulated lncRNAs in gastric cancer, this study explored its molecular mechanisms in carcinogenesis. RMRP levels in 792 tissues, plasma and gastric juices from patients with various stages of gastric tumorigenesis were analyzed by quantitative reverse transcription-polymerase chain reaction. Overexpression and RNA interference were used to manipulate RMRP expression by RMRP expression vector and small interfering RNAs, respectively. Its mechanisms were evaluated by flow cytometry, real-time cell analysis, plate colony formation assays, and xenograft models. RMRP levels in tissue, plasma and gastric juices from patients with gastric cancer were significantly different from those from controls. Its levels were significantly associated with Borrmann type and metastasis. Plasma and gastric juice RMRP had higher sensitivity and specificity than commonly used markers (such as carcinoembryonic antigen and carbohydrate antigen 19-9). Knockdown of RMRP significantly inhibited cell proliferation in vitro and in vivo, whereas overexpression of RMRP promoted cell growth. Acting as a miR-206 sponge, RMRP modulated cell cycle by regulating Cyclin D2 expression. RMRP plays a crucial role in gastric cancer occurrence and can be used as a novel biomarker for gastric cancer.

Incommensurate smectic order at the free surface in the nematic phase of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2)

NASA Astrophysics Data System (ADS)

Ocko, B. M.; Pershan, P. S.; Safinya, C. R.; Chiang, L. Y.

1987-02-01

We report x-ray reflectivity measurements on the free surface of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2) at the nematic to smectic-A phase transition, TNA=99.9 °C. The free surface in the nematic phase exhibits smecticlike ordering at two q vectors, one which is commensurate with the smectic-A monolayer q vector q2. The other q vector is incommensurate corresponding to ordering at ~0.59q2. The commensurate peak constructively interferes with the air-liquid interface while the incommensurate peak destructively interferes. These results are compared with bulk-phase x-ray scattering measurements.

FIVQ algorithm for interference hyper-spectral image compression

NASA Astrophysics Data System (ADS)

Wen, Jia; Ma, Caiwen; Zhao, Junsuo

2014-07-01

Based on the improved vector quantization (IVQ) algorithm [1] which was proposed in 2012, this paper proposes a further improved vector quantization (FIVQ) algorithm for LASIS (Large Aperture Static Imaging Spectrometer) interference hyper-spectral image compression. To get better image quality, IVQ algorithm takes both the mean values and the VQ indices as the encoding rules. Although IVQ algorithm can improve both the bit rate and the image quality, it still can be further improved in order to get much lower bit rate for the LASIS interference pattern with the special optical characteristics based on the pushing and sweeping in LASIS imaging principle. In the proposed algorithm FIVQ, the neighborhood of the encoding blocks of the interference pattern image, which are using the mean value rules, will be checked whether they have the same mean value as the current processing block. Experiments show the proposed algorithm FIVQ can get lower bit rate compared to that of the IVQ algorithm for the LASIS interference hyper-spectral sequences.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for critical limb ischemia. PMID:24090375

An efficient protocol for the production of tRNA-free recombinant Selenocysteine Synthase (SELA) from Escherichia coli and its biophysical characterization.

PubMed

Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique

2013-03-01

Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

PubMed

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-10-03

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes

PubMed Central

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-01-01

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

PubMed

Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

2018-06-01

Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

Silence of the transcripts: RNA interference in medicine.

PubMed

Barik, Sailen

2005-10-01

Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer.

PubMed Central

Torrent, C; Gabus, C; Darlix, J L

1994-01-01

Retroviral genomes consist of two identical RNA molecules associated at their 5' ends by the dimer linkage structure located in the packaging element (Psi or E) necessary for RNA dimerization in vitro and packaging in vivo. In murine leukemia virus (MLV)-derived vectors designed for gene transfer, the Psi + sequence of 600 nucleotides directs the packaging of recombinant RNAs into MLV virions produced by helper cells. By using in vitro RNA dimerization as a screening system, a sequence of rat VL30 RNA located next to the 5' end of the Harvey mouse sarcoma virus genome and as small as 67 nucleotides was found to form stable dimeric RNA. In addition, a purine-rich sequence located at the 5' end of this VL30 RNA seems to be critical for RNA dimerization. When this VL30 element was extended by 107 nucleotides at its 3' end and inserted into an MLV-derived vector lacking MLV Psi +, it directed the efficient encapsidation of recombinant RNAs into MLV virions. Because this VL30 packaging signal is smaller and more efficient in packaging recombinant RNAs than the MLV Psi + and does not contain gag or glyco-gag coding sequences, its use in MLV-derived vectors should render even more unlikely recombinations which could generate replication-competent viruses. Therefore, utilization of the rat VL30 packaging sequence should improve the biological safety of MLV vectors for human gene transfer. Images PMID:8289369

Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

PubMed

Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

2015-01-01

Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of apple latent spherical virus-based vaccines against three tospoviruses.

PubMed

Taki, Ayano; Yamagishi, Noriko; Yoshikawa, Nobuyuki

2013-09-01

Apple latent spherical virus (ALSV) is characterized by its relatively broad host range, latency in most host plants, and ability to induce gene silencing in host plants. Herein, we focus on the above characteristic of ALSV and describe our development of ALSV vector vaccines against three tospoviruses, namely, Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), and Tomato spotted wilt virus (TSWV). DNA fragments of 201 nt of three tospovirus S-RNAs (silencing suppressor (NSS) and nucleocapsid protein (N) coding regions for each tospovirus) were inserted into an ALSV-RNA2 vector to obtain six types of ALSV vector vaccines. Nicotiana benthamiana plants at the five-leaf stage were inoculated with each ALSV vector vaccine and challenged with the corresponding tospovirus species. Tospovirus-induced symptoms and tospovirus replication after challenge were significantly suppressed in plants preinoculated with all ALSV vector vaccines having the N region fragment, indicating that strong resistance was acquired after infection with ALSV vector vaccines. On the other hand, cross protection was not significant in plants preinoculated with ALSV vectors having the NSs region fragment. Similarly, inoculation with an ALSV-RNA1 vector having the N region fragment in the 3'-noncoding region, but not the NSs region fragment, induced cross protection, indicating that cross protection is via RNA silencing, not via the function of the protein derived from the N region fragment. Our approach, wherein ALSV vectors and selected target inserts are used, enables rapid establishment of ALSV vector vaccines against many pathogenic RNA viruses with known sequences. Copyright © 2013 Elsevier B.V. All rights reserved.

PIWIs Go Viral: Arbovirus-Derived piRNAs in Vector Mosquitoes

PubMed Central

2016-01-01

Vector mosquitoes are responsible for transmission of the majority of arthropod-borne (arbo-) viruses. Virus replication in these vectors needs to be sufficiently high to permit efficient virus transfer to vertebrate hosts. The mosquito immune response therefore is a key determinant for arbovirus transmission. Mosquito antiviral immunity is primarily mediated by the small interfering RNA pathway. Besides this well-established antiviral machinery, the PIWI-interacting RNA (piRNA) pathway processes viral RNA into piRNAs. In recent years, significant progress has been made in characterizing the biogenesis and function of these viral piRNAs. In this review, we discuss these developments, identify knowledge gaps, and suggest directions for future research. PMID:28033427

Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

PubMed

Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

2018-04-30

Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

A reverse transcriptase-dependent mechanism plays central roles in fundamental biological processes.

PubMed

Spadafora, Corrado

2008-01-01

This review summarizes emerging evidence that LINE-1 (Long Interspersed Nuclear Elements) -encoded reverse transcriptase (RT) regulates fundamental biological processes. Earlier studies showed that sperm cells can be used as vectors of both exogenous DNA and RNA molecules in sperm-mediated gene transfer assays. During these studies, a sperm endogenous RT activity was identified, which can reverse-transcribe exogenous RNA directly, or DNA molecules through sequential transcription and reverse transcription. Resulting cDNA copies generated in sperm cells can be delivered to embryos at fertilization, further propagated in tissues as low-copy extrachromosomal structures and transmitted to the progeny in a non-mendelian fashion. Being transcriptionally competent, they can induce phenotypic variations in positive tissues. An RT activity is also present in preimplantation embryos, and its inhibition causes developmental arrest in early preimplantation stages, paralleled by an extensive reprogramming of gene expression. In analogy with this, drug-mediated inhibition of RT activity, or RNA interference-mediated silencing of human LINE-1, reduce cell proliferation and induce differentiation in a variety of cancer cell lines. Furthermore, RT inhibition in vivo antagonizes the growth of human tumors in animal models. As a whole, these data implicate a RT-dependent machinery in the genesis of new genetic information in spermatozoa and in normal and pathological developmental processes.

Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

NASA Astrophysics Data System (ADS)

Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

USDA-ARS?s Scientific Manuscript database

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Domain motions of Argonaute, the catalytic engine of RNA interference

PubMed Central

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-01-01

Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

Domain motions of Argonaute, the catalytic engine of RNA interference.

PubMed

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-11-30

The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection

PubMed Central

Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara

2014-01-01

Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Effect of radiofrequency energy emitted from monopolar "Bovie" instruments on cardiac implantable electronic devices.

PubMed

Robinson, Thomas N; Varosy, Paul D; Guillaume, Girard; Dunning, James E; Townsend, Nicole T; Jones, Edward L; Paniccia, Alessandro; Stiegmann, Greg V; Weyer, Christopher; Rozner, Marc A

2014-09-01

The monopolar "Bovie" instrument emits radiofrequency energy that can disrupt the function of other implanted electronic devices through a phenomenon termed electromagnetic interference. The purpose of this study was to quantify the electromagnetic interference occurring on cardiac implantable devices (CIEDs) resulting from monopolar instrument use in common, modifiable clinical scenarios. Three anesthetized pigs underwent CIED placement (1 pacemaker and 2 defibrillators). Electromagnetic interference was quantified when changing the monopolar instrument parameters of generator power, generator mode, surgical technique, orientation of active electrode cord, pathway of current vector, and proximity of active electrode to the CIED. Monopolar instrument parameters that decreased the electromagnetic interference occurring on the CIED included decreasing generator power from 60 W to 30 W (p < 0.001), using cut mode rather than coag mode (p < 0.001), using desiccation technique rather than fulguration technique (p < 0.001), orienting the active electrode cord from the feet rather than across the chest wall (p < 0.001), and avoiding the current vector from crossing the CIED system (p < 0.001). Increasing the distance between the active electrode tool and the CIED system decreased electromagnetic interference occurring on the CIED in a dose-response fashion up to a distance of 10 cm (ANOVA, p < 0.001), after which the magnitude of electromagnetic interference remained constant. Electromagnetic interference occurring on CIEDs resulting from monopolar instruments is minimized by decreasing generator power, using cut mode, using desiccation technique, orienting the active electrode cord from the feet, avoiding the current vector for crossing the CIED system, and increasing the distance between the active electrode and the CIED. Surgeons and operating room staff can minimize electromagnetic interference on CIEDs during monopolar instrument use by accounting for these modifiable clinical factors. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Development of an endogenous virus-free line of chickens susceptible to all subgroups of avian leukosis virus.

PubMed

Zhang, Huanmin; Bacon, Larry D; Fadly, Aly M

2008-09-01

Primary chicken embryo fibroblasts (CEF) from special specific pathogen-free chicken lines are used for detection of contamination of adult or embryonic tissues, meconium, or tissue culture fluids with avian leukosis viruses (ALV). The suitability and efficiency of such tests depend on the susceptibility of CEF to the various subgroups of exogenous as well as endogenous ALV. The ideal CEF for such tests should be not only susceptible to all retroviruses, but also free of endogenous viruses so that such tests are immune to any interference that may occur between the endogenous and the tested (exogenous) viruses. CEF and/or chickens free of endogenous viruses are also desirable for gene transfer studies using retroviral vectors, such as RNA interference (RNAi) experiments and transgenic work. The absence of ev genes in CEF or chickens can empower clean detection of successful RNAi construct delivery or gene transfer. CEF free of ev genes are also essential reagents routinely used in growing and detecting unknown retroviruses in varied viral assays. This report documents the development of a new line of chickens, 0.TVB*S1, that is free of endogenous viruses and susceptible to all subgroups of ALV identified in chickens.

Lipopolysaccharide promotes pulmonary fibrosis in acute respiratory distress syndrome (ARDS) via lincRNA-p21 induced inhibition of Thy-1 expression.

PubMed

Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian

2016-08-01

Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

Prokaryotic Argonautes - variations on the RNA interference theme.

PubMed

van der Oost, John; Swarts, Daan C; Jore, Matthijs M

2014-04-15

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

Prokaryotic Argonautes - variations on the RNA interference theme

PubMed Central

van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

2014-01-01

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

ERIC Educational Resources Information Center

Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

2010-01-01

RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

ERIC Educational Resources Information Center

Kuldell, Natalie H.

2006-01-01

It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

Inhibition of X-linked inhibitor of apoptosis protein enhances anti-tumor potency of pure total flavonoids on the growth of leukemic cells

PubMed Central

Wu, Liqiang; Zhang, Xiuxia; Lin, Xiaojie; Wang, Bo; Huang, Chang; Qin, Yao; Lin, Shengyun

2018-01-01

Flavonoids, a vast group of polyphenols widely distributed in plants, are known to possess a range of biological activities and potential anti-tumor effects. X-linked inhibitor of apoptosis protein (XIAP) promotes the progression of leukemia by preventing tumor cells undergoing apoptosis. The present study investigated the potential effects and underlying mechanisms of pure total flavonoids from Citrus paradisi Macfad (PTFC) on human U937 cells, and explored the effects of short hairpin (sh)RNA-mediated XIAP knockdown on the anti-cancer effects of PTFC. Western blotting was used to determine level of apoptosis-associated effectors following PTFC treatment. A lentiviral vector of RNA interference of XIAP gene was constructed to downregulate XIAP expression. MTT assay and flow cytometry were used to determine the effects of PTFC separately or combined with XIAP-shRNA on inhibition and apoptosis of U937 cells, respectively. Treatment with PTFC effectively inhibited leukemic cell proliferation in a dose- and time-dependent manner. PTFC induced apoptosis of U937 cells in a dose-dependent manner, at a particular concentration range, by decreasing XIAP expression levels and activating caspases-3, −7 and −9. PTFC treatment combined with XIAP-shRNA additionally demonstrated a marked increase in cell apoptosis, compared with PTFC or XIAP-shRNA alone (P<0.05). Therefore, these findings suggest that PTFC inhibits growth and induces apoptosis in U937 cells in vitro. Furthermore, suppression of XIAP expression enhances these effects. PMID:29434799

Silver nanoparticles-quercetin conjugation to siRNA against drug-resistant Bacillus subtilis for effective gene silencing: in vitro and in vivo.

PubMed

Sun, Dongdong; Zhang, Weiwei; Li, Nuan; Zhao, Zhiwei; Mou, Zhipeng; Yang, Endong; Wang, Weiyun

2016-06-01

Quercetin (Qe) exhibited extremely low water solubility, and thus, it was modified using silver nanoparticles (AgNPs). We fabricated AgNPs combined with Qe (AgNPs-Qe). The modification suggested that the synergistic properties of Qe enhanced the antibacterial activity of AgNPs. However, AgNPs-Qe exerted no effect on many kinds of drug-resistant bacteria, including Pseudomonas aeruginosa and Bacillus subtilis. RNA interference has considerable therapeutic potential because of its high specificity and potential capability to evade drug resistance. Therefore, we stabilized AgNPs-Qe with a layer of molecules (siRNA). The newly fabricated nanoparticles exerted improved effect on many kinds of bacteria, including the most prominent drug-resistant species B. subtilis. Agarose gel electrophoresis showed that the highest critical nitrogen-to-phosphorus (N/P) ratio occurred at a vector/siRNA with a w/w ratio of 7:1. Characterization experiment indicated that the diameter of siRNA/AgNPs-Qe was approximately 40 nm (40 ± 10 nm). Moreover, AgNPs-Qe were stabilized with a layer of siRNA that was approximately 10nm thick. Results of the in vitro study suggested that siRNA/AgNPs-Qe could destroy the cell wall and inhibit bacterial propagation. Meanwhile, the in vivo experiment on the animal bacteremia model, as well as the optical imaging of nude mice and their isolated organs, demonstrated that bacteria accumulated in the blood, heart, liver, spleen, lungs, and kidneys after the intravenous injection of B. subtilis. The bacteria in the blood and organs, as well as the inflamed cells in the tissues, gradually decreased after the mice received intravenous tail injection of siRNA/AgNPs-Qe for treatment. Both the in vitro and the in vivo studies exhibit that siRNA/AgNPs-Qe can be a potential nanoscale drug delivery system for B. subtilis targeting bacterimia. Copyright © 2016 Elsevier B.V. All rights reserved.

Capsule-Like Safe Genetic Vectors - Cell-Penetrating Core-Shell Particles Selectively Release Functional Small RNA and Entrap its Encoding DNA.

PubMed

Yu, Han; Pan, Houwen Matthew; Evalin, Fnu; Trau, Dieter Wilhelm; Patzel, Volker

2018-06-05

The breakthrough of genetic therapy is set back by the lack of suitable genetic vector systems. We present the development of permeability-tunable, capsule-like, polymeric, micron-sized, core-shell particles for delivery of recombinant nucleic acids into target cells. These particles were demonstrated to effectively release rod-shaped small hairpin RNA and to selectively retain the RNA-encoding DNA template which was designed to form a bulky tripartite structure. Thus, they can serve as delivery vectors preloaded with cargo RNA or alternatively as RNA producing micro-bioreactors. The internalization of particles by human tissue culture cells inversely correlated with particle size and with the cell to particle ratio, though at a higher than stoichiometric excess of particles over cells, cell viability was impaired. Among primary human peripheral blood mononuclear cells, up to 50% of the monocytes displayed positive uptake of particles. Finally, these particles efficiently delivered siRNA into HEK293T cells triggering functional knockdown of the target gene lamin A/C. Particle-mediated knockdown was superior to that observed after conventional siRNA delivery via lipofection. Core-shell particles protect encapsulated nucleic acids from degradation and target cell genomes from direct contact with recombinant DNA, thus representing a promising delivery vector system that can be explored for genetic therapy and vaccination.

[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

PubMed

Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

2010-01-01

RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

A Coarse Alignment Method Based on Digital Filters and Reconstructed Observation Vectors

PubMed Central

Xu, Xiang; Xu, Xiaosu; Zhang, Tao; Li, Yao; Wang, Zhicheng

2017-01-01

In this paper, a coarse alignment method based on apparent gravitational motion is proposed. Due to the interference of the complex situations, the true observation vectors, which are calculated by the apparent gravity, are contaminated. The sources of the interference are analyzed in detail, and then a low-pass digital filter is designed in this paper for eliminating the high-frequency noise of the measurement observation vectors. To extract the effective observation vectors from the inertial sensors’ outputs, a parameter recognition and vector reconstruction method are designed, where an adaptive Kalman filter is employed to estimate the unknown parameters. Furthermore, a robust filter, which is based on Huber’s M-estimation theory, is developed for addressing the outliers of the measurement observation vectors due to the maneuver of the vehicle. A comprehensive experiment, which contains a simulation test and physical test, is designed to verify the performance of the proposed method, and the results show that the proposed method is equivalent to the popular apparent velocity method in swaying mode, but it is superior to the current methods while in moving mode when the strapdown inertial navigation system (SINS) is under entirely self-contained conditions. PMID:28353682

Vertical amplitude phase structure of a low-frequency acoustic field in shallow water

NASA Astrophysics Data System (ADS)

Kuznetsov, G. N.; Lebedev, O. V.; Stepanov, A. N.

2016-11-01

We obtain in integral and analytic form the relations for calculating the amplitude and phase characteristics of an interference structure of orthogonal projections of the oscillation velocity vector in shallow water. For different frequencies and receiver depths, we numerically study the source depth dependences of the effective phase velocities of an equivalent plane wave, the orthogonal projections of the sound pressure phase gradient, and the projections of the oscillation velocity vector. We establish that at low frequencies in zones of interference maxima, independently of source depth, weakly varying effective phase velocity values are observed, which exceed the sound velocity in water by 5-12%. We show that the angles of arrival of the equivalent plane wave and the oscillation velocity vector in the general case differ; however, they virtually coincide in the zone of the interference maximum of the sound pressure under the condition that the horizontal projections of the oscillation velocity appreciably exceed the value of the vertical projection. We give recommendations on using the sound field characteristics in zones with maximum values for solving rangefinding and signal-detection problems.

Improved silencing properties using small internally segmented interfering RNAs

PubMed Central

Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

2007-01-01

RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

NASA Astrophysics Data System (ADS)

Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

2013-12-01

First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

PubMed

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

Transgenic strategies to confer resistance against viruses in rice plants

PubMed Central

Sasaya, Takahide; Nakazono-Nagaoka, Eiko; Saika, Hiroaki; Aoki, Hideyuki; Hiraguri, Akihiro; Netsu, Osamu; Uehara-Ichiki, Tamaki; Onuki, Masatoshi; Toki, Seichi; Saito, Koji; Yatou, Osamu

2014-01-01

Rice (Oryza sativa L.) is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. Many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA interference (RNAi), also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral “Achilles’ heel” gene to target for RNAi attack when engineering plants. PMID:24454308

Polymers in Small-Interfering RNA Delivery

PubMed Central

Singha, Kaushik; Namgung, Ran

2011-01-01

This review will cover the current strategies that are being adopted to efficiently deliver small interfering RNA using nonviral vectors, including the use of polymers such as polyethylenimine, poly(lactic-co-glycolic acid), polypeptides, chitosan, cyclodextrin, dendrimers, and polymers-containing different nanoparticles. The article will provide a brief and concise account of underlying principle of these polymeric vectors and their structural and functional modifications which were intended to serve different purposes to affect efficient therapeutic outcome of small-interfering RNA delivery. The modifications of these polymeric vectors will be discussed with reference to stimuli-responsiveness, target specific delivery, and incorporation of nanoconstructs such as carbon nanotubes, gold nanoparticles, and silica nanoparticles. The emergence of small-interfering RNA as the potential therapeutic agent and its mode of action will also be mentioned in a nutshell. PMID:21749290

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

USDA-ARS?s Scientific Manuscript database

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

An enzyme free electrochemical biosensor for sensitive detection of miRNA with a high discrimination factor by coupling the strand displacement reaction and catalytic hairpin assembly recycling.

PubMed

Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan

2017-10-23

An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.

Using RNA interference to knock down the adhesion protein TES.

PubMed

Griffith, Elen

2007-01-01

RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

The RNA-induced silencing complex: a versatile gene-silencing machine.

PubMed

Pratt, Ashley J; MacRae, Ian J

2009-07-03

RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.

In vivo reduction or blockade of interleukin-1β in primary osteoarthritis influences expression of mediators implicated in pathogenesis

PubMed Central

Santangelo, K. S.; Nuovo, G. J.; Bertone, A. L.

2012-01-01

Summary Objective Diminish interleukin-1β (IL-1β) signaling in a model of primary osteoarthritis by RNA interference-based transcript reduction or receptor blockade, and quantify changes incurred on transcript expression of additional mediators. Methods Knees of Hartley guinea pigs were collected at 120 and 180 days of age following injection with viral vectors (N=4/treatment group/date) at 60 days. Two groups received either adeno-associated viral serotype 5 vector containing a knockdown sequence (TV), or adenoviral vector encoding for IL-1 receptor antagonist protein (Ad-IRAP); treatments were contrasted with opposite knees administered corresponding vector controls. A third group evaluated TV relative to saline-only injected knees. Chondropathy and immunohistochemistry findings were compared to untreated guinea pigs. Transcript expression levels in cartilage were calculated using the comparative CT (2−ΔΔCT) method and analyzed by one-way ANOVA with pairwise comparisons using Tukey 95% confidence intervals. Results Vector transduction was confirmed at both harvest dates. TV and Ad-IRAP, relative to vector controls, significantly decreased IL-1β. Inflammatory mediators [tumor necrosis factor-α (TNF-α), interleukin-8 (IL-8), interferon-γ (IFN-γ)], and catabolic matrix metalloproteinase 13 (MMP13) were also decreased, while anabolic transforming growth factor-β1 (TGF-β1) was increased. IL-1β was also decreased by TV versus saline, with a decrease in MMP13 and increase TGF-β1; TNF-α, IL-8, and IFN-γ were transiently increased. Conclusions This work confirmed that a reduction in IL-1β signaling was accomplished by either method, resulting in decreased expression of three inflammatory mediators and one catabolic agent, and increased expression of an anabolic molecule. Thus, evidence is provided that IL-1β serves a role in vivo in spontaneous osteoarthritis and that these translational tools may provide beneficial disease modification. PMID:22935786

Beamforming design with proactive interference cancelation in MISO interference channels

NASA Astrophysics Data System (ADS)

Li, Yang; Tian, Yafei; Yang, Chenyang

2015-12-01

In this paper, we design coordinated beamforming at base stations (BSs) to facilitate interference cancelation at users in interference networks, where each BS is equipped with multiple antennas and each user is with a single antenna. By assuming that each user can select the best decoding strategy to mitigate the interference, either canceling the interference after decoding when it is strong or treating it as noise when it is weak, we optimize the beamforming vectors that maximize the sum rate for the networks under different interference scenarios and find the solutions of beamforming with closed-form expressions. The inherent design principles are then analyzed, and the performance gain over passive interference cancelation is demonstrated through simulations in heterogeneous cellular networks.

Flavivirus Infection of Ixodes scapularis (Black-Legged Tick) Ex Vivo Organotypic Cultures and Applications for Disease Control.

PubMed

Grabowski, Jeffrey M; Tsetsarkin, Konstantin A; Long, Dan; Scott, Dana P; Rosenke, Rebecca; Schwan, Tom G; Mlera, Luwanika; Offerdahl, Danielle K; Pletnev, Alexander G; Bloom, Marshall E

2017-08-22

Ixodes scapularis ticks transmit many infectious agents that cause disease, including tick-borne flaviviruses (TBFVs). TBFV infections cause thousands of human encephalitis cases worldwide annually. In the United States, human TBFV infections with Powassan virus (POWV) are increasing and have a fatality rate of 10 to 30%. Additionally, Langat virus (LGTV) is a TBFV of low neurovirulence and is used as a model TBFV. TBFV replication and dissemination within I. scapularis organs are poorly characterized, and a deeper understanding of virus biology in this vector may inform effective countermeasures to reduce TBFV transmission. Here, we describe short-term, I. scapularis organ culture models of TBFV infection. Ex vivo organs were metabolically active for 9 to 10 days and were permissive to LGTV and POWV replication. Imaging and videography demonstrated replication and spread of green fluorescent protein-expressing LGTV in the organs. Immunohistochemical staining confirmed LGTV envelope and POWV protein synthesis within the infected organs. LGTV- and POWV-infected organs produced infectious LGTV and POWV; thus, the ex vivo cultures were suitable for study of virus replication in individual organs. LGTV- and POWV-infected midgut and salivary glands were subjected to double-stranded RNA (dsRNA) transfection with dsRNA to the LGTV 3' untranslated region (UTR), which reduced infectious LGTV and POWV replication, providing a proof-of-concept use of RNA interference in I. scapularis organ cultures to study the effects on TBFV replication. The results contribute important information on TBFV localization within ex vivo I. scapularis organs and provide a significant translational tool for evaluating recombinant, live vaccine candidates and potential tick transcripts and proteins for possible therapeutic use and vaccine development to reduce TBFV transmission. IMPORTANCE Tick-borne flavivirus (TBFV) infections cause neurological and/or hemorrhagic disease in humans worldwide. There are currently no licensed therapeutics or vaccines against Powassan virus (POWV), the only TBFV known to circulate in North America. Evaluating tick vector targets for antitick vaccines directed at reducing TBFV infection within the arthropod vector is a critical step in identifying efficient approaches to controlling TBFV transmission. This study characterized infection of female Ixodes scapularis tick organ cultures of midgut, salivary glands, and synganglion with the low-neurovirulence Langat virus (LGTV) and the more pathogenic POWV. Cell types of specific organs were susceptible to TBFV infection, and a difference in LGTV and POWV replication was noted in TBFV-infected organs. This tick organ culture model of TBFV infection will be useful for various applications, such as screening of tick endogenous dsRNA corresponding to potential control targets within midgut and salivary glands to confirm restriction of TBFV infection.

Contributions of hydrology to Vesicular Stomatitis Virus emergence in the Western United States

USDA-ARS?s Scientific Manuscript database

Relationships between environmental variables associated with the spread of vector-borne pathogens, such as RNA viruses transmitted to humans and animals, remain poorly understood. Vesicular stomatitis (VS) is caused by a vector-borne, zoonotic RNA virus (VSV), and is the most common vesicular dise...

In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

PubMed

Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

2000-02-01

Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed

Parrish, S; Fire, A

2001-10-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed Central

Parrish, S; Fire, A

2001-01-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

PubMed Central

Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

1999-01-01

We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

Dendrimer Nanovectors for SiRNA Delivery.

PubMed

Liu, Xiaoxuan; Peng, Ling

2016-01-01

Small interfering RNA (SiRNA) delivery remains a major challenge in RNAi-based therapy. Dendrimers are emerging as appealing nonviral vectors for SiRNA delivery thanks to their well-defined architecture and their unique cooperativity and multivalency confined within a nanostructure. We have recently demonstrated that structurally flexible poly(amidoamine) (PAMAM) dendrimers are safe and effective nanovectors for SiRNA delivery in various disease models in vitro and in vivo. The present chapter showcases these dendrimers can package different SiRNA molecules into stable and nanosized particles, which protect SiRNA from degradation and promote cellular uptake of SiRNA, resulting in potent gene silencing at both mRNA and protein level in the prostate cancer cell model. Our results demonstrate this set of flexible PAMAM dendrimers are indeed safe and effective nonviral vectors for SiRNA delivery and hold great promise for further applications in functional genomics and RNAi-based therapies.

Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

DTIC Science & Technology

2012-01-01

utilization of dsRNA as a bio-insecticide against mosquitoes has only recently begun to be evaluated. Double-stranded RNA targeting chitin syn- thase...double- stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African malaria mosquito

EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

PubMed Central

Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

2013-01-01

Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

2008-02-05

Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

miR-Sens--a retroviral dual-luciferase reporter to detect microRNA activity in primary cells.

PubMed

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A; Voorhoeve, P Mathijs

2012-05-01

MicroRNA-mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3' UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3' UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3' UTR-mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs.

Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

PubMed

Vassella, Erik; Probst, Matthias; Schneider, André; Studer, Erwin; Renggli, Christina Kunz; Roditi, Isabel

2004-09-01

In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

Molecular and functional characterization of Anopheles gambiae inward rectifier potassium (Kir1) channels: a novel role in egg production.

PubMed

Raphemot, Rene; Estévez-Lao, Tania Y; Rouhier, Matthew F; Piermarini, Peter M; Denton, Jerod S; Hillyer, Julián F

2014-08-01

Inward rectifier potassium (Kir) channels play essential roles in regulating diverse physiological processes. Although Kir channels are encoded in mosquito genomes, their functions remain largely unknown. In this study, we identified the members of the Anopheles gambiae Kir gene family and began to investigate their function. Notably, we sequenced the A. gambiae Kir1 (AgKir1) gene and showed that it encodes all the canonical features of a Kir channel: an ion pore that is composed of a pore helix and a selectivity filter, two transmembrane domains that flank the ion pore, and the so-called G-loop. Heterologous expression of AgKir1 in Xenopus oocytes revealed that this gene encodes a functional, barium-sensitive Kir channel. Quantitative RT-PCR experiments then showed that relative AgKir1 mRNA levels are highest in the pupal stage, and that AgKir1 mRNA is enriched in the adult ovaries. Gene silencing of AgKir1 by RNA interference did not affect the survival of female mosquitoes following a blood meal, but decreased their egg output. These data provide evidence for a new role of Kir channels in mosquito fecundity, and further validates them as promising molecular targets for the development of a new class of mosquitocides to be used in vector control. Copyright © 2014 Elsevier Ltd. All rights reserved.

A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

PubMed

Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

2005-01-01

Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

PubMed Central

Horn, Thomas; Boutros, Michael

2010-01-01

The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

PubMed

Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

2013-08-16

Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

SiLEncing SLE: the power and promise of small noncoding RNAs.

PubMed

Rigby, Robert J; Vinuesa, Carola G

2008-09-01

In this study, we outline the evidence suggesting that defects in the RNA silencing machinery can lead to the prototypic systemic autoimmune disease, systemic lupus erythematosus, and describe the potential for RNA interference to provide novel therapeutic agents. Over the last year, a class of small noncoding RNAs--microRNAs--have been shown to play key roles in immune regulation including T-cell selection in the thymus, B cell affinity maturation and selection in germinal centres, and development of regulatory T cells, suggesting that the microRNA machinery may be crucial in the maintenance of immunological tolerance. Two RNA silencing mechanisms have been shown to be involved in lupus pathogenesis: failed Roquin-mediated repression of inducible costimulatory receptors messenger RNA through miR-101 in roquin(san/san) mice and decreased expression of pro-apoptotic molecule and phosphatase and tensin homologue on chromosome 10 in mice transgenic for the miR-17-92 cluster, leading to lymphoproliferation and other lupus manisfestations. MicroRNA array experiments performed on peripheral blood mononuclear cells have revealed different expression profiles in systemic lupus erythematosus patients. RNA interference has also been used ex vivo to silence dysregulated T-cell molecules in cells from systemic lupus erythematosus patients. Dysregulation of the RNA silencing machinery has been implicated in systemic lupus erythematosus pathogenesis. Although microRNA profiling may prove to be a useful diagnostic and prognostic tool for a notoriously heterogeneous disease, manipulation of RNA interference emerges as a powerful and potentially specific means to correct dysregulated gene expression in systemic lupus erythematosus patients.

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema

PubMed Central

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-01-01

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema: Correlation with variation in apparent diffusion coefficient.

PubMed

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-07-25

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.

Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

PubMed Central

Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

2012-01-01

Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

Emerging and re-emerging viruses of the honey bee (Apis mellifera L.)

PubMed Central

Genersch, Elke; Aubert, Michel

2010-01-01

Until the late 1980s, specific viral infections of the honey bee were generally considered harmless in all countries. Then, with the worldwide introduction of the ectoparasite mite Varroa destructor, beekeepers encountered increasing difficulties in maintaining their colonies. Epidemiological surveys and laboratory experiments have demonstrated that the newly acquired virulence of several viruses belonging to the family Dicistroviridae (acute bee paralysis virus, Kashmir bee virus and Israeli acute paralysis virus) in Europe and the USA had been observed in relation with V. destructor acting as a disseminator of these viruses between and within bee colonies and as an activator of virus multiplication in the infected individuals: bee larvae and adults. Equal emphasis is given to deformed wing virus (DWV) belonging to the Iflaviridae. Overt outbreaks of DWV infections have been shown to be linked to the ability of V. destructor to act not only as a mechanical vector of DWV but also as a biological vector. Its replication in mites prior to its vectoring into pupae seemed to be necessary and sufficient for the induction of a overt infection in pupae developing in non-viable bees with deformed wings. DWV in V. destructor infested colonies is now considered as one of the key players of the final collapse. Various approaches for combating bee viral diseases are described: they include selection of tolerant bees, RNA interference and prevention of new pathogen introduction. None of these approaches are expected to lead to enhanced bee-health in the short term. PMID:20423694

miR-Sens—a retroviral dual-luciferase reporter to detect microRNA activity in primary cells

PubMed Central

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A.; Voorhoeve, P. Mathijs

2012-01-01

MicroRNA–mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3′ UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3′ UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3′ UTR–mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs. PMID:22417692

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Evaluation of vaccine competition using HVT vector vaccines

USDA-ARS?s Scientific Manuscript database

Turkey herpesvirus (HVT) has been widely used as a vaccine for Marek’s disease (MD) since the 1970s. Because HVT is a safe vaccine that is poorly sensitive to interference from maternally derived antibodies, it has seen rising use as a vector for vaccines developed for protection against other comm...

Electric cell-substrate impedance sensing (ECIS) based real-time measurement of titer dependent cytotoxicity induced by adenoviral vectors in an IPI-2I cell culture model.

PubMed

Müller, Jakob; Thirion, Christian; Pfaffl, Michael W

2011-01-15

Recombinant viral vectors are widespread tools for transfer of genetic material in various modern biotechnological applications like for example RNA interference (RNAi). However, an accurate and reproducible titer assignment represents the basic step for most downstream applications regarding a precise multiplicity of infection (MOI) adjustment. As necessary scaffold for the studies described in this work we introduce a quantitative real-time PCR (qPCR) based approach for viral particle measurement. Still an implicated problem concerning physiological effects is that the appliance of viral vectors is often attended by toxic effects on the individual target. To determine the critical viral dose leading to cell death we developed an electric cell-substrate impedance sensing (ECIS) based assay. With ECIS technology the impedance change of a current flow through the cell culture medium in an array plate is measured in a non-invasive manner, visualizing effects like cell attachment, cell-cell contacts or proliferation. Here we describe the potential of this online measurement technique in an in vitro model using the porcine ileal epithelial cell line IPI-2I in combination with an adenoviral transfection vector (Ad5-derivate). This approach shows a clear dose-depending toxic effect, as the amount of applied virus highly correlates (p<0.001) with the level of cell death. Thus this assay offers the possibility to discriminate the minimal non-toxic dose of the individual transfection method. In addition this work suggests that the ECIS-device bears the feasibility to transfer this assay to multiple other cytotoxicological questions. Copyright © 2010 Elsevier B.V. All rights reserved.

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

PubMed

Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

2008-11-01

A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

Cardiospecific CD36 suppression by lentivirus-mediated RNA interference prevents cardiac hypertrophy and systolic dysfunction in high-fat-diet induced obese mice.

PubMed

Zhang, Yijie; Bao, Mingwei; Dai, Mingyan; Wang, Xin; He, Wenbo; Tan, Tuantuan; Lin, Dandan; Wang, Wei; Wen, Ying; Zhang, Rui

2015-06-03

Fatty acid (FA) catabolism abnormality has been proved to play an important role in obesity-related cardiomyopathy. We hypothesized that cardiospecific suppression of CD36, the predominant membrane FA transporter, would protect against obesity-related cardiomyopathy. Four-wk-old male C57BL/6 J mice were fed with either high-fat-diet (HFD) or control-normal-diet for 2 wk. Then they were subjected to intramyocardial injection with recombinant lentiviral vectors containing short hairpin RNAs to selectively downregulate the expression of either cardiac CD36 or irrelevant gene by RNA interference. After a 10-wk continuation of the diet, biochemical, functional, morphological, histological, metabolic and molecular profiles were assessed. HFD administration elicited obesity, cardiac hypertrophy and systolic dysfunction accompanied with elevated serum levels of blood urea nitrogen (BUN), creatinine, fasting serum glucose (FSG), total cholesterol (TC) and triglyceride. Additionally, HFD consumption promoted lipid accumulation and reactive oxygen species (ROS) generation in the cardiomyocytes. Cardiospecific CD36 inhibition protected against HFD induced cardiac remodeling by decreasing heart/body weight ratio, increasing left ventricular (LV) ejection fraction and fractional shortening as well as normalizing LV diameter, without influencing body weight gain. Inhibition of cardiac CD36 also mitigated obesity induced alteration in BUN, creatinine and triglyceride, but had no effect on FSG or TC. Moreover, cardiospecific CD36 deficiency corrected myocardial lipid overaccumulation and intracellular ROS overproduction that were induced by HFD feeding. Cardiospecific CD36 inhibition protects against the aggravation of cardiac functional and morphological changes associated with HFD induced obesity. CD36 represents a potential therapeutic target for obesity cardiomyopathy.

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.

PubMed

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells

PubMed Central

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M.; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells. PMID:28123598

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

Phosphodiesterase 5a Inhibition with Adenoviral Short Hairpin RNA Benefits Infarcted Heart Partially through Activation of Akt Signaling Pathway and Reduction of Inflammatory Cytokines.

PubMed

Li, Longhu; Zhao, Dong; Jin, Zhe; Zhang, Jian; Paul, Christian; Wang, Yigang

2015-01-01

Treatment with short hairpin RNA (shRNA) interference therapy targeting phosphodiesterase 5a after myocardial infarction (MI) has been shown to mitigate post-MI heart failure. We investigated the mechanisms that underpin the beneficial effects of PDE5a inhibition through shRNA on post-MI heart failure. An adenoviral vector with an shRNA sequence inserted was adopted for the inhibition of phosphodiesterase 5a (Ad-shPDE5a) in vivo and in vitro. Myocardial infarction (MI) was induced in male C57BL/6J mice by left coronary artery ligation, and immediately after that, the Ad-shPDE5a was injected intramyocardially around the MI region and border areas. Four weeks post-MI, the Ad-shPDE5a-treated mice showed significant mitigation of the left ventricular (LV) dilatation and dysfunction compared to control mice. Infarction size and fibrosis were also significantly reduced in Ad-shPDE5a-treated mice. Additionally, Ad-shPDE5a treatment decreased the MI-induced inflammatory cytokines interleukin (IL)-1β, IL-6, tumor necrosis factor-α, and transforming growth factor-β1, which was confirmed in vitro in Ad-shPDE5a transfected myofibroblasts cultured under oxygen glucose deprivation. Finally, Ad-shPDE5a treatment was found to activate the myocardial Akt signaling pathway in both in vivo and in vitro experiments. These findings indicate that PDE5a inhibition by Ad-shPDE5a via the Akt signal pathway could be of significant value in the design of future therapeutics for post-MI heart failure.

LncRNA NEAT1 promotes autophagy in MPTP-induced Parkinson's disease through stabilizing PINK1 protein.

PubMed

Yan, Wang; Chen, Zhao-Ying; Chen, Jia-Qi; Chen, Hui-Min

2018-02-19

Long non-coding RNA nuclear paraspeckle assembly transcript 1 (lncRNA NEAT1) was found to be closely related to the pathological changes in brain and nervous system. However, the role of NEAT1 and its potential mechanism in Parkinson's disease (PD) largely remain uncharacterized. In this study, PD mouse model was established by intraperitoneal injection of MPTP. The numbers of TH + neurons, NEAT1 expression and the level of PINK1, LC3-II, LC3-I protein were assessed in PD mice. SH-SY5Y cells were treated with MPP + as PD cell model. RNA pull-down assay was used to identify the interaction between NEAT1 and PINK1 in vitro. The endogenous expression of NEAT1 was modified by lentiviral vector carrying interference sequence for NEAT1 in vivo. The numbers of TH + neurons significantly decreased in PD mice compared with the control. The expressions of NEAT1, PINK1 protein and LC3-II/LC3-I level were increased by MPTP in vitro and in vivo. Moreover, NEAT1 positively regulated the protein level of PINK1 through inhibition of PINK1 protein degradation. And NEAT1 mediated the effects of MPP + on SH-SY5Y cells through stabilization of PINK1 protein. The results of in vivo experiments revealed that NEAT1 knockdown could effectively suppress MPTP-induced autophagy in vivo that alleviated dopaminergic neuronal injury. LncRNA NEAT1 promoted the MPTP-induced autophagy in PD through stabilization of PINK1 protein. Copyright © 2017 Elsevier Inc. All rights reserved.

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

PubMed Central

Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

2018-01-01

Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

42 CFR 71.54 - Import regulations for infectious biological agents, infectious substances, and vectors.

Code of Federal Regulations, 2014 CFR

2014-10-01

... segmented configuration and may be positive sense (same polarity as mRNA), negative sense, or ambisense... material. Deoxyribonucleic acid (DNA) or Ribonucleic acid (RNA) comprising the genome or organism's... threat to public health and safety as listed in 42 CFR 73.3 and 73.4. Vector. Any animals (vertebrate or...

42 CFR 71.54 - Import regulations for infectious biological agents, infectious substances, and vectors.

Code of Federal Regulations, 2013 CFR

2013-10-01

... segmented configuration and may be positive sense (same polarity as mRNA), negative sense, or ambisense... material. Deoxyribonucleic acid (DNA) or Ribonucleic acid (RNA) comprising the genome or organism's... threat to public health and safety as listed in 42 CFR 73.3 and 73.4. Vector. Any animals (vertebrate or...

[Inhibitory effect of Mig-7 silencing by retrovirus-mediated shRNA on vasculogenic mimicry, invasion and metastasis of human hepatocellular carcinoma cells in vitro].

PubMed

Qu, Bo; Sheng, Guan-Nan; Yu, Fei; Chen, Guan-Nan; Lv, Qi; Mao, Zhong-Peng; Guo, Long; Lv, Yi

2016-11-20

To explore the inhibitory effect of migration-inducing gene 7 (Mig-7) gene silencing induced by retroviral-mediated small hairpin RNA (shRNA) on vasculogenic mimicry (VM), invasion and metastasis of human hepatocellular carcinoma (HCC) cells in vitro. Two target sequences (Mig-7 shRNA-1 and Mig-7 shRNA-2) and one negative control sequence (Mig-7 shRNA-N) were synthesized. The recombinant retroviral vectors carrying Mig-7 shRNA were constructed, and HCC cell line MHCC-97H were transfected with Mig-7 shRNA-1, Mig-7 shRNA-2, Mig-7 shRNA-N, or the empty vector, or treated with 125 µg/mL recombinant human endostatin (ES). Mig-7 expression in the treated cells was detected using semi-quantitative PCR and Western blotting. The inhibitory effect of Mig-7 silencing on VM formation was investigated in a 3-dimensional cell culture system; the changes in cell adhesion, invasion and migration were assessed with intercellular adhesion assay, Transwell invasion assay and Transwell migration assay, respectively. The expression of Mig-7 at both mRNA and protein levels decreased significantly, VM formation, invasion and metastasis were suppressed, while intercellular adhesion increased significantly in MHCC-97H cells in Mig-7 shRNA-1 and Mig-7 shRNA-2 groups (P<0.05); such changes were not observed in cells transfected with Mig-7 shRNA-N or the empty vector, nor in cells treated with ES. Mig-7 silencing by retroviral-mediated shRNA significantly inhibits VM formation, invasion and metastasis and increases the intercellular adhesion of the HCC cells, while ES does not have such inhibitory effects.

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

Exosomes from iPSCs Delivering siRNA Attenuate Intracellular Adhesion Molecule-1 Expression and Neutrophils Adhesion in Pulmonary Microvascular Endothelial Cells.

PubMed

Ju, Zhihai; Ma, Jinhui; Wang, Chen; Yu, Jie; Qiao, Yeru; Hei, Feilong

2017-04-01

The pro-inflammatory activation of pulmonary microvascular endothelial cells resulting in continuous expression of cellular adhesion molecules, and subsequently recruiting primed neutrophils to form a firm neutrophils-endothelium (PMN-EC) adhesion, has been examined and found to play a vital role in acute lung injury (ALI). RNA interference (RNAi) is a cellular process through harnessing a natural pathway silencing target gene based on recognition and subsequent degradation of specific mRNA sequences. It opens a promising approach for precision medicine. However, this application was hampered by many obstacles, such as immunogenicity, instability, toxicity problems, and difficulty in across the biological membrane. In this study, we reprogrammed urine exfoliated renal epithelial cells into human induced pluripotent stem cells (huiPSCs) and purified the exosomes (Exo) from huiPSCs as RNAi delivery system. Through choosing the episomal system to deliver transcription factors, we obtained a non-integrating huiPSCs. Experiments in both vitro and vivo demonstrated that these huiPSCs possess the pluripotent properties. The exosomes of huiPSCs isolated by differential centrifugation were visualized by transmission electron microscopy (TEM) showing a typical exosomal appearance with an average diameter of 122 nm. Immunoblotting confirmed the presence of the typical exosomal markers, including CD63, TSG 101, and Alix. Co-cultured PKH26-labeled exosomes with human primary pulmonary microvascular endothelial cells (HMVECs) confirmed that they could be internalized by recipient cells at a time-dependent manner. Then, electroporation was used to introduce siRNA against intercellular adhesion molecule-1 (ICAM-1) into exosomes to form an Exo/siRNA compound. The Exo/siRNA compound efficiently delivered the target siRNA into HMVECs causing selective gene silencing, inhibiting the ICAM-1 protein expression, and PMN-EC adhesion induced by lipopolysaccharide (LPS). These data suggest that huiPSCs exosomes could be used as a natural gene delivery vector to transport therapeutic siRNAs for alleviating inflammatory responses in recipient cells.

Self-assembling complexes between binary mixtures of lipids with different linkers and nucleic acids promote universal mRNA, DNA and siRNA delivery.

PubMed

Colombani, Thibault; Peuziat, Pauline; Dallet, Laurence; Haudebourg, Thomas; Mével, Mathieu; Berchel, Mathieu; Lambert, Olivier; Habrant, Damien; Pitard, Bruno

2017-03-10

Protein expression and RNA interference require efficient delivery of DNA or mRNA and small double stranded RNA into cells, respectively. Although cationic lipids are the most commonly used synthetic delivery vectors, a clear need still exists for a better delivery of various types of nucleic acids molecules to improve their biological activity. To optimize the transfection efficiency, a molecular approach consisting in modifying the chemical structure of a given cationic lipid is usually performed, but an alternative strategy could rely on modulating the supramolecular assembly of lipidic lamellar phases sandwiching the nucleic acids molecules. To validate this new concept, we synthesized on one hand two paromomycin-based cationic lipids, with either an amide or a phosphoramide linker, and on the other hand two imidazole-based neutral lipids, having as well either an amide or a phosphoramide function as linker. Combinations of cationic and helper lipids containing the same amide or phosphoramide linkers led to the formation of homogeneous lamellar phases, while hybrid lamellar phases were obtained when the linkers on the cationic and helper lipids were different. Cryo-transmission electron microscopy and fluorescence experiments showed that liposomes/nucleic acids complexes resulting from the association of nucleic acids with hybrid lamellar phases led to complexes that were more stable in the extracellular compartment compared to those obtained with homogeneous systems. In addition, we observed that the most active supramolecular assemblies for the delivery of DNA, mRNA and siRNA were obtained when the cationic and helper lipids possess linkers of different natures. The results clearly show that this supramolecular strategy modulating the property of the lipidic lamellar phase constitutes a new approach for increasing the delivery of various types of nucleic acid molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Measurement of the topological charge and index of vortex vector optical fields with a space-variant half-wave plate.

PubMed

Liu, Gui-Geng; Wang, Ke; Lee, Yun-Han; Wang, Dan; Li, Ping-Ping; Gou, Fangwang; Li, Yongnan; Tu, Chenghou; Wu, Shin-Tson; Wang, Hui-Tian

2018-02-15

Vortex vector optical fields (VVOFs) refer to a kind of vector optical field with an azimuth-variant polarization and a helical phase, simultaneously. Such a VVOF is defined by the topological index of the polarization singularity and the topological charge of the phase vortex. We present a simple method to measure the topological charge and index of VVOFs by using a space-variant half-wave plate (SV-HWP). The geometric phase grating of the SV-HWP diffracts a VVOF into ±1 orders with orthogonally left- and right-handed circular polarizations. By inserting a polarizer behind the SV-HWP, the two circular polarization states project into the linear polarization and then interfere with each other to form the interference pattern, which enables the direct measurement of the topological charge and index of VVOFs.

Messenger RNA transcripts

Treesearch

Dan Cullen

2004-01-01

In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...

Reduced 64Cu uptake and tumor growth inhibition by knockdown of human copper transporter 1 in xenograft mouse model of prostate cancer.

PubMed

Cai, Huawei; Wu, Jiu-sheng; Muzik, Otto; Hsieh, Jer-Tsong; Lee, Robert J; Peng, Fangyu

2014-04-01

Copper is an element required for cell proliferation and angiogenesis. Human prostate cancer xenografts with increased (64)Cu radioactivity were visualized previously by PET using (64)CuCl2 as a radiotracer ((64)CuCl2 PET). This study aimed to determine whether the increased tumor (64)Cu radioactivity was due to increased cellular uptake of (64)Cu mediated by human copper transporter 1 (hCtr1) or simply due to nonspecific binding of ionic (64)CuCl2 to tumor tissue. In addition, the functional role of hCtr1 in proliferation of prostate cancer cells and tumor growth was also assessed. A lentiviral vector encoding short-hairpin RNA specific for hCtr1 (Lenti-hCtr1-shRNA) was constructed for RNA interference-mediated knockdown of hCtr1 expression in prostate cancer cells. The degree of hCtr1 knockdown was determined by Western blot, and the effect of hCtr1 knockdown on copper uptake and proliferation were examined in vitro by cellular (64)Cu uptake and cell proliferation assays. The effects of hCtr1 knockdown on tumor uptake of (64)Cu were determined by PET quantification and tissue radioactivity assay. The effects of hCtr1 knockdown on tumor growth were assessed by PET/CT and tumor size measurement with a caliper. RNA interference-mediated knockdown of hCtr1 was associated with the reduced cellular uptake of (64)Cu and the suppression of prostate cancer cell proliferation in vitro. At 24 h after intravenous injection of the tracer (64)CuCl2, the (64)Cu uptake by the tumors with knockdown of hCtr1 (4.02 ± 0.31 percentage injected dose per gram [%ID/g] in Lenti-hCtr1-shRNA-PC-3 and 2.30 ± 0.59 %ID/g in Lenti-hCtr1-shRNA-DU-145) was significantly lower than the (64)Cu uptake by the control tumors without knockdown of hCtr1 (7.21 ± 1.48 %ID/g in Lenti-SCR-shRNA-PC-3 and 5.57 ± 1.20 %ID/g in Lenti-SCR-shRNA-DU-145, P < 0.001) by PET quantification. Moreover, the volumes of prostate cancer xenograft tumors with knockdown of hCtr1 (179 ± 111 mm(3) for Lenti-hCtr1-shRNA-PC-3 or 39 ± 22 mm(3) for Lenti-hCtr1-shRNA-DU-145) were significantly smaller than those without knockdown of hCtr1 (536 ± 191 mm(3) for Lenti- SCR-shRNA-PC-3 or 208 ± 104 mm(3) for Lenti-SCR-shRNA-DU-145, P < 0.01). Overall, data indicated that hCtr1 is a promising theranostic target, which can be further developed for metabolic imaging of prostate cancer using (64)CuCl2 PET/CT and personalized cancer therapy targeting copper metabolism.

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

DTIC Science & Technology

2005-07-01

pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

On the time-dependent Aharonov-Bohm effect

NASA Astrophysics Data System (ADS)

Jing, Jian; Zhang, Yu-Fei; Wang, Kang; Long, Zheng-Wen; Dong, Shi-Hai

2017-11-01

The Aharonov-Bohm effect in the background of a time-dependent vector potential is re-examined for both non-relativistic and relativistic cases. Based on the solutions to the Schrodinger and Dirac equations which contain the time-dependent magnetic vector potential, we find that contrary to the conclusions in a recent paper (Singleton and Vagenas 2013 [4]), the interference pattern will be altered with respect to time because of the time-dependent vector potential.

GNSS Space-Time Interference Mitigation and Attitude Determination in the Presence of Interference Signals

PubMed Central

Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

2015-01-01

The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios. PMID:26016909

GNSS space-time interference mitigation and attitude determination in the presence of interference signals.

PubMed

Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

2015-05-26

The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios.

Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

PubMed

Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

2012-05-01

Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

Homologous interference mediated by defective interfering influenza virus derived from a temperature-sensitive mutant of influenza virus.

PubMed Central

Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K

1978-01-01

A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication. Images PMID:702654

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

ABCE1 Is a Highly Conserved RNA Silencing Suppressor

PubMed Central

Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

2015-01-01

ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

PubMed Central

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

2012-01-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

PubMed

Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

2012-05-01

The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

PubMed

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

RNAi therapeutics and applications of microRNAs in cancer treatment.

PubMed

Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

2013-06-01

RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

PubMed

Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

2016-09-01

Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo

PubMed Central

White, Melanie D.; Milne, Ruth V. J.; Nolan, Matthew F.

2011-01-01

We introduce a molecular toolbox for manipulation of neuronal gene expression in vivo. The toolbox includes promoters, ion channels, optogenetic tools, fluorescent proteins, and intronic artificial microRNAs. The components are easily assembled into adeno-associated virus (AAV) or lentivirus vectors using recombination cloning. We demonstrate assembly of toolbox components into lentivirus and AAV vectors and use these vectors for in vivo expression of inwardly rectifying potassium channels (Kir2.1, Kir3.1, and Kir3.2) and an artificial microRNA targeted against the ion channel HCN1 (HCN1 miRNA). We show that AAV assembled to express HCN1 miRNA produces efficacious and specific in vivo knockdown of HCN1 channels. Comparison of in vivo viral transduction using HCN1 miRNA with mice containing a germ line deletion of HCN1 reveals similar physiological phenotypes in cerebellar Purkinje cells. The easy assembly and re-usability of the toolbox components, together with the ability to up- or down-regulate neuronal gene expression in vivo, may be useful for applications in many areas of neuroscience. PMID:21772812

A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

PubMed

Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

2014-03-01

Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

An Algorithm for Converting Static Earth Sensor Measurements into Earth Observation Vectors

NASA Technical Reports Server (NTRS)

Harman, R.; Hashmall, Joseph A.; Sedlak, Joseph

2004-01-01

An algorithm has been developed that converts penetration angles reported by Static Earth Sensors (SESs) into Earth observation vectors. This algorithm allows compensation for variation in the horizon height including that caused by Earth oblateness. It also allows pitch and roll to be computed using any number (greater than 1) of simultaneous sensor penetration angles simplifying processing during periods of Sun and Moon interference. The algorithm computes body frame unit vectors through each SES cluster. It also computes GCI vectors from the spacecraft to the position on the Earth's limb where each cluster detects the Earth's limb. These body frame vectors are used as sensor observation vectors and the GCI vectors are used as reference vectors in an attitude solution. The attitude, with the unobservable yaw discarded, is iteratively refined to provide the Earth observation vector solution.

Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

PubMed

Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

2014-03-01

A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

Virus induced gene silencing (VIGS) for functional analysis of wheat genes involved in Zymoseptoria tritici susceptibility and resistance.

PubMed

Lee, Wing-Sham; Rudd, Jason J; Kanyuka, Kostya

2015-06-01

Virus-induced gene silencing (VIGS) has emerged as a powerful reverse genetic technology in plants supplementary to stable transgenic RNAi and, in certain species, as a viable alternative approach for gene functional analysis. The RNA virus Barley stripe mosaic virus (BSMV) was developed as a VIGS vector in the early 2000s and since then it has been used to study the function of wheat genes. Several variants of BSMV vectors are available, with some requiring in vitro transcription of infectious viral RNA, while others rely on in planta production of viral RNA from DNA-based vectors delivered to plant cells either by particle bombardment or Agrobacterium tumefaciens. We adapted the latest generation of binary BSMV VIGS vectors for the identification and study of wheat genes of interest involved in interactions with Zymoseptoria tritici and here present detailed and the most up-to-date protocols. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Biochemical and Structural Studies of RNA Modification and Repair

ERIC Educational Resources Information Center

Chan, Chio Mui

2009-01-01

RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…

Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

PubMed

Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

2018-05-02

Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector.

PubMed

Akbari, Omar S; Antoshechkin, Igor; Amrhein, Henry; Williams, Brian; Diloreto, Race; Sandler, Jeremy; Hay, Bruce A

2013-09-04

Mosquitoes are vectors of a number of important human and animal diseases. The development of novel vector control strategies requires a thorough understanding of mosquito biology. To facilitate this, we used RNA-seq to identify novel genes and provide the first high-resolution view of the transcriptome throughout development and in response to blood feeding in a mosquito vector of human disease, Aedes aegypti, the primary vector for Dengue and yellow fever. We characterized mRNA expression at 34 distinct time points throughout Aedes development, including adult somatic and germline tissues, by using polyA+ RNA-seq. We identify a total of 14,238 novel new transcribed regions corresponding to 12,597 new loci, as well as many novel transcript isoforms of previously annotated genes. Altogether these results increase the annotated fraction of the transcribed genome into long polyA+ RNAs by more than twofold. We also identified a number of patterns of shared gene expression, as well as genes and/or exons expressed sex-specifically or sex-differentially. Expression profiles of small RNAs in ovaries, early embryos, testes, and adult male and female somatic tissues also were determined, resulting in the identification of 38 new Aedes-specific miRNAs, and ~291,000 small RNA new transcribed regions, many of which are likely to be endogenous small-interfering RNAs and Piwi-interacting RNAs. Genes of potential interest for transgene-based vector control strategies also are highlighted. Our data have been incorporated into a user-friendly genome browser located at www.Aedes.caltech.edu, with relevant links to Vectorbase (www.vectorbase.org).

Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials.

PubMed

Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun

2018-09-01

Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

An RNA isolation system for plant tissues rich in secondary metabolites

PubMed Central

2011-01-01

Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

Analysis of Antisense Expression by Whole Genome Tiling Microarrays and siRNAs Suggests Mis-Annotation of Arabidopsis Orphan Protein-Coding Genes

PubMed Central

Richardson, Casey R.; Luo, Qing-Jun; Gontcharova, Viktoria; Jiang, Ying-Wen; Samanta, Manoj; Youn, Eunseog; Rock, Christopher D.

2010-01-01

Background MicroRNAs (miRNAs) and trans-acting small-interfering RNAs (tasi-RNAs) are small (20–22 nt long) RNAs (smRNAs) generated from hairpin secondary structures or antisense transcripts, respectively, that regulate gene expression by Watson-Crick pairing to a target mRNA and altering expression by mechanisms related to RNA interference. The high sequence homology of plant miRNAs to their targets has been the mainstay of miRNA prediction algorithms, which are limited in their predictive power for other kingdoms because miRNA complementarity is less conserved yet transitive processes (production of antisense smRNAs) are active in eukaryotes. We hypothesize that antisense transcription and associated smRNAs are biomarkers which can be computationally modeled for gene discovery. Principal Findings We explored rice (Oryza sativa) sense and antisense gene expression in publicly available whole genome tiling array transcriptome data and sequenced smRNA libraries (as well as C. elegans) and found evidence of transitivity of MIRNA genes similar to that found in Arabidopsis. Statistical analysis of antisense transcript abundances, presence of antisense ESTs, and association with smRNAs suggests several hundred Arabidopsis ‘orphan’ hypothetical genes are non-coding RNAs. Consistent with this hypothesis, we found novel Arabidopsis homologues of some MIRNA genes on the antisense strand of previously annotated protein-coding genes. A Support Vector Machine (SVM) was applied using thermodynamic energy of binding plus novel expression features of sense/antisense transcription topology and siRNA abundances to build a prediction model of miRNA targets. The SVM when trained on targets could predict the “ancient” (deeply conserved) class of validated Arabidopsis MIRNA genes with an accuracy of 84%, and 76% for “new” rapidly-evolving MIRNA genes. Conclusions Antisense and smRNA expression features and computational methods may identify novel MIRNA genes and other non-coding RNAs in plants and potentially other kingdoms, which can provide insight into antisense transcription, miRNA evolution, and post-transcriptional gene regulation. PMID:20520764

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

PubMed

Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

2011-08-23

Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

New Genetics

MedlinePlus

... Century-Old Evolutionary Puzzle Computing Genetics Model Organisms RNA Interference The New Genetics is a science education ... the basics of DNA and its molecular cousin RNA, and new directions in genetic research. The New ...

Fluorescence-based high-throughput screening of dicer cleavage activity.

PubMed

Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr

2014-03-01

Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.

Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

PubMed

Abe, Hiroshi; Kimura, Yasuaki

2018-01-01

Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

Genome-wide piRNA profiles of virus transmitting whitefly Bemisia tabaci during feeding on TYLCV-infected tomato

USDA-ARS?s Scientific Manuscript database

Small RNAs (sRNAs) are 20-31 nucleotide (nt) non-coding regulatory elements commonly found in plants and animals, which are classified as short interfering RNA (siRNA), microRNA (miRNA) and Piwi-interacting RNA (piRNA). The whitefly Bemisia tabaci MEAM1 is a vector capable of transmitting many devas...

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

Stable Dispersions of Covalently Tethered Polymer Improved Graphene Oxide Nanoconjugates as an Effective Vector for siRNA Delivery.

PubMed

Yadav, Nisha; Kumar, Naveen; Prasad, Peeyush; Shirbhate, Shivani; Sehrawat, Seema; Lochab, Bimlesh

2018-05-02

Conjugates of poly(amidoamine) (PAMAM) with modified graphene oxide (GO) are attractive nonviral vectors for gene-based cancer therapeutics. GO protects siRNA from enzymatic cleavage and showed reasonable transfection efficiency along with simultaneous benefits of low cost and large scale production. PAMAM is highly effective in siRNA delivery but suffers from high toxicity with poor in vivo efficacy. Co-reaction of GO and PAMAM led to aggregation and more importantly, have detrimental effect on stability of dispersion at physiological pH preventing their exploration at clinical level. In the current work, we have designed, synthesized, characterized and explored a new type of hybrid vector (GPD), using GO synthesized via improved method which was covalently tethered with poly(ethylene glycol) (PEG) and PAMAM. The existence of covalent linkage, relative structural changes and properties of GPD is well supported by Fourier transform infrared (FTIR), UV-visible (UV-vis), Raman, X-ray photoelectron (XPS), elemental analysis, powder X-ray diffraction (XRD), thermogravimetry analysis (TGA), dynamic light scattering (DLS), and zeta potential. Scanning electron microscopy (SEM), and transmission electron microscopy (TEM) of GPD showed longitudinally aligned columnar self-assembled ∼10 nm thick polymeric nanoarchitectures onto the GO surface accounting to an average size reduction to ∼20 nm. GPD revealed an outstanding stability in both phosphate buffer saline (PBS) and serum containing cell medium. The binding efficiency of EPAC1 siRNA to GPD was supported by gel retardation assay, DLS, zeta potential and photoluminescence (PL) studies. A lower cytotoxicity with enhanced cellular uptake and homogeneous intracellular distribution of GPD/siRNA complex is confirmed by imaging studies. GPD exhibited a higher transfection efficiency with remarkable inhibition of cell migration and lower invasion than PAMAM and Lipofectamine 2000 suggesting its role in prevention of breast cancer progression and metastasis. A significant reduction in the expression of the specific protein against which siRNA was delivered is revealed by Western blot assay. Furthermore, a pH-triggered release of siRNA from the GPD/siRNA complex was studied to provide a mechanistic insight toward unloading of siRNA from the vector. Current strategy is a way forward for designing effective therapeutic vectors for gene-based antitumor therapy.

RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

PubMed

Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

2017-01-01

Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea

PubMed Central

Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L.; Mukherjee, Sunil Kumar

2017-01-01

Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea. PMID:29077738

MicroRNA-mediated non-viral direct conversion of embryonic fibroblasts to cardiomyocytes: comparison of commercial and synthetic non-viral vectors.

PubMed

Kim, Hyosuk; Kim, Dongkyu; Ku, Sook Hee; Kim, Kwangmeyung; Kim, Sun Hwa; Kwon, Ick Chan

Technological advances opened up new ways of directing cell fate conversion from one cell lineage to another. The direct cell conversion technique has recently attracted much attention in regenerative medicine to treat devastated organs and tissues, particularly having limited regenerative capacity such as the heart and brain. Unfortunately, its clinical application is severely limited due to a safety concern and immunogenicity of viral vectors, as human gene therapy did in the beginning stages. In this study, we examined the possibility of adopting non-viral vectors to direct cell conversion from mouse embryonic fibroblasts to induced cardiomyocytes (iCM) by transient transfection of four types of chemically synthesized micro-RNA mimics (miRNA-1, 133, 208, and 499). Herein, we tested several commercial and synthetic non-viral gene delivery carriers, which could be divided into three different categories: polymers [branched PEI (bPEI), bioreducible PEI (PEI-SS), deoxycholic acid-conjugated PEI (DA-PEI), jetPEI™, SuperFect™], lipids (Lipofectamine 2000™), and peptides (PepMute™). According to the analyses of physicochemical properties, cellular uptake, and cytotoxicity of the carrier/miRNA complexes, DA-PEI exhibited excellent miRNA delivery efficiency to mouse embryonic fibroblasts. One week after a single treatment of DA-PEI/miRNA without other adjuvants, the cells started to express cardiomyocyte-specific markers, such as α-actinin and α-MHC, indicating the formation of cardiomyocyte-like cells. Although the overall frequency of non-viral vector induced cardiomyogenic transdifferentiation was quite low (ca. 0.2%), this study can provide compelling support to develop clinically applicable transdifferentiation techniques.

Long non-coding RNA discovery across the genus anopheles reveals conserved secondary structures within and beyond the Gambiae complex.

PubMed

Jenkins, Adam M; Waterhouse, Robert M; Muskavitch, Marc A T

2015-04-23

Long non-coding RNAs (lncRNAs) have been defined as mRNA-like transcripts longer than 200 nucleotides that lack significant protein-coding potential, and many of them constitute scaffolds for ribonucleoprotein complexes with critical roles in epigenetic regulation. Various lncRNAs have been implicated in the modulation of chromatin structure, transcriptional and post-transcriptional gene regulation, and regulation of genomic stability in mammals, Caenorhabditis elegans, and Drosophila melanogaster. The purpose of this study is to identify the lncRNA landscape in the malaria vector An. gambiae and assess the evolutionary conservation of lncRNAs and their secondary structures across the Anopheles genus. Using deep RNA sequencing of multiple Anopheles gambiae life stages, we have identified 2,949 lncRNAs and more than 300 previously unannotated putative protein-coding genes. The lncRNAs exhibit differential expression profiles across life stages and adult genders. We find that across the genus Anopheles, lncRNAs display much lower sequence conservation than protein-coding genes. Additionally, we find that lncRNA secondary structure is highly conserved within the Gambiae complex, but diverges rapidly across the rest of the genus Anopheles. This study offers one of the first lncRNA secondary structure analyses in vector insects. Our description of lncRNAs in An. gambiae offers the most comprehensive genome-wide insights to date into lncRNAs in this vector mosquito, and defines a set of potential targets for the development of vector-based interventions that may further curb the human malaria burden in disease-endemic countries.

Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

PubMed

Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

2015-01-30

Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

Apigenin Inhibits Enterovirus-71 Infection by Disrupting Viral RNA Association with trans-Acting Factors

PubMed Central

Zhang, Wei; Qiao, Haishi; Lv, Yuanzi; Wang, Jingjing; Chen, Xiaoqing; Hou, Yayi; Tan, Renxiang; Li, Erguang

2014-01-01

Flavonoids are widely distributed natural products with broad biological activities. Apigenin is a dietary flavonoid that has recently been demonstrated to interact with heterogeneous nuclear ribonucleoproteins (hnRNPs) and interferes with their RNA editing activity. We investigated whether apigenin possessed antiviral activity against enterovirus-71 (EV71) infection since EV71 infection requires of hnRNP proteins. We found that apigenin selectively blocks EV71 infection by disrupting viral RNA association with hnRNP A1 and A2 proteins. The estimated EC50 value for apigenin to block EV71 infection was determined at 10.3 µM, while the CC50 was estimated at 79.0 µM. The anti-EV71 activity was selective since no activity was detected against several DNA and RNA viruses. Although flavonoids in general share similar structural features, apigenin and kaempferol were among tested compounds with significant activity against EV71 infection. hnRNP proteins function as trans-acting factors regulating EV71 translation. We found that apigenin treatment did not affect EV71-induced nucleocytoplasmic redistribution of hnRNP A1 and A2 proteins. Instead, it prevented EV71 RNA association with hnRNP A1 and A2 proteins. Accordingly, suppression of hnRNP A1 and A2 expression markedly reduced EV71 infection. As a positive sense, single strand RNA virus, EV71 has a type I internal ribosome entry site (IRES) that cooperates with host factors and regulates EV71 translation. The effect of apigenin on EV71 infection was further demonstrated using a bicistronic vector that has the expression of a GFP protein under the control of EV71 5′-UTR. We found that apigenin treatment selectively suppressed the expression of GFP, but not a control gene. In addition to identification of apigenin as an antiviral agent against EV71 infection, this study also exemplifies the significance in antiviral agent discovery by targeting host factors essential for viral replication. PMID:25330384

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Emerging and re-emerging viruses of the honey bee (Apis mellifera L.).

PubMed

Genersch, Elke; Aubert, Michel

2010-01-01

Until the late 1980s, specific viral infections of the honey bee were generally considered harmless in all countries. Then, with the worldwide introduction of the ectoparasite mite Varroa destructor, beekeepers encountered increasing difficulties in maintaining their colonies. Epidemiological surveys and laboratory experiments have demonstrated that the newly acquired virulence of several viruses belonging to the family Dicistroviridae (acute bee paralysis virus, Kashmir bee virus and Israeli acute paralysis virus) in Europe and the USA had been observed in relation with V. destructor acting as a disseminator of these viruses between and within bee colonies and as an activator of virus multiplication in the infected individuals: bee larvae and adults. Equal emphasis is given to deformed wing virus (DWV) belonging to the Iflaviridae. Overt outbreaks of DWV infections have been shown to be linked to the ability of V. destructor to act not only as a mechanical vector of DWV but also as a biological vector. Its replication in mites prior to its vectoring into pupae seemed to be necessary and sufficient for the induction of a overt infection in pupae developing in non-viable bees with deformed wings. DWV in V. destructor infested colonies is now considered as one of the key players of the final collapse. Various approaches for combating bee viral diseases are described: they include selection of tolerant bees, RNA interference and prevention of new pathogen introduction. None of these approaches are expected to lead to enhanced bee-health in the short term. © INRA, EDP Sciences, 2010.

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Subspace-based interference removal methods for a multichannel biomagnetic sensor array.

PubMed

Sekihara, Kensuke; Nagarajan, Srikantan S

2017-10-01

In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

Subspace-based interference removal methods for a multichannel biomagnetic sensor array

NASA Astrophysics Data System (ADS)

Sekihara, Kensuke; Nagarajan, Srikantan S.

2017-10-01

Objective. In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. Approach. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

PubMed Central

Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

2013-01-01

AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

Multimodality Imaging of RNA Interference

PubMed Central

Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

2013-01-01

The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

USDA-ARS?s Scientific Manuscript database

Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

PubMed Central

Harris, M E; Pace, N R

1995-01-01

The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

Molecular mechanisms influencing efficiency of RNA interference in insects.

PubMed

Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

2018-06-21

RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].

PubMed

Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye

2013-01-01

To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.

Molecular function of microtubule-associated protein 2 for filial imprinting in domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Katagiri, Sachiko; Aoki, Naoya; Iikubo, Eiji; Kitajima, Takaaki; Matsushima, Toshiya; Homma, Koichi J

2011-01-01

RNA interference (RNAi)-mediated gene-silencing can be a tool for elucidating the role of genes in the neural basis of behavioral plasticity. Previously, we reported that exogenous DNA could be successfully delivered into newly-hatched chick brains via electroporation. Here, we used this in vivo gene-transfer technique and showed that transfected microRNA vectors preferentially silence exogenous DNA expression in neuronal cells. Using this system, the up-regulation of microtubule-associated protein 2 (MAP2) accompanying filial imprinting was suppressed in vivo, which impaired the filial imprinting in chicks. In addition, the phosphorylation of MAP2 was found to increase in parallel with filial imprinting, and lithium chloride, an inhibitor of glycogen synthase kinase 3 (GSK3), was found to impair filial imprinting. Our results suggest that the regulation of MAP2 expression and its phosphorylation are required for filial imprinting and may modify microtubule stability, thereby leading to cytoskeletal reorganization during imprinting. This in vivo RNAi-mediated gene-silencing system will facilitate the analysis of gene function in the living chick brain and provides further clues regarding the molecular mechanisms underpinning avian learning. Copyright © 2010 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

PubMed Central

Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

2014-01-01

The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

Estimation of the size of genetic bottlenecks in cell-to-cell movement of soil-borne wheat mosaic virus and the possible role of the bottlenecks in speeding up selection of variations in trans-acting genes or elements.

PubMed

Miyashita, Shuhei; Kishino, Hirohisa

2010-02-01

Genetic bottlenecks facilitate the fixation and extinction of variants in populations, and viral populations are no exception to this theory. To examine the existence of genetic bottlenecks in cell-to-cell movement of plant RNA viruses, we prepared constructs for Soil-borne wheat mosaic virus RNA2 vectors carrying two different fluorescent proteins, yellow fluorescent protein (YFP) and cyan fluorescent protein (CFP). Coinoculation of host plant leaves with the two RNA2 vectors and the wild-type RNA1 showed separation of the two vector RNA2s, mostly within seven to nine cell-to-cell movements from individual initially coinfected cells. Our statistical analysis showed that the number of viral RNA genomes establishing infection in adjacent cells after the first cell-to-cell movement from an initially infected cell was 5.97 +/- 0.22 on average and 5.02 +/- 0.29 after the second cell-to-cell movement. These results indicate that plant RNA viruses may generally face narrow genetic bottlenecks in every cell-to-cell movement. Furthermore, our model suggests that, rather than suffering from fitness losses caused by the bottlenecks, the plant RNA viruses are utilizing the repeated genetic bottlenecks as an essential element of rapid selection of their adaptive variants in trans-acting genes or elements to respond to host shifting and changes in the growth conditions of the hosts.

Genetics Home Reference: myotonic dystrophy

MedlinePlus

... mutated gene produces an expanded version of messenger RNA , which is a molecular blueprint of the gene ... the production of proteins. The abnormally long messenger RNA forms clumps inside the cell that interfere with ...

Transverse spin in the scattering of focused radially and azimuthally polarized vector beams

NASA Astrophysics Data System (ADS)

Singh, Ankit Kumar; Saha, Sudipta; Gupta, Subhasish Dutta; Ghosh, Nirmalya

2018-04-01

We study the effect of focusing of the radially and azimuthally polarized vector beams on the spin angular momentum (SAM) density and Poynting vector of scattered waves from a Mie particle. Remarkably, the study reveals that the SAM density of the scattered field is solely transverse in nature for radially and azimuthally polarized incident vector beams; however, the Poynting vector shows the usual longitudinal character. We also demonstrate that the transverse SAM density can further be tuned with wavelength and focusing of the incident beam by exploiting the interference of different scattering modes. These results may stimulate further experimental techniques to detect the transverse spin and Belinfante's spin-momentum densities.

Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

PubMed

Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

2005-07-01

The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Viral and Synthetic RNA Vector Technologies and Applications

PubMed Central

Schott, Juliane W; Morgan, Michael; Galla, Melanie; Schambach, Axel

2016-01-01

Use of RNA is an increasingly popular method to transiently deliver genetic information for cell manipulation in basic research and clinical therapy. In these settings, viral and nonviral RNA platforms are employed for delivery of small interfering RNA and protein-coding mRNA. Technological advances allowing RNA modification for increased stability, improved translation and reduced immunogenicity have led to increased use of nonviral synthetic RNA, which is delivered in naked form or upon formulation. Alternatively, highly efficient viral entry pathways are exploited to transfer genes of interest as RNA incorporated into viral particles. Current viral RNA transfer technologies are derived from Retroviruses, nonsegmented negative-strand RNA viruses or positive-stranded Alpha- and Flaviviruses. In retroviral particles, the genes of interest can either be incorporated directly into the viral RNA genome or as nonviral RNA. Nonsegmented negative-strand virus-, Alpha- and Flavivirus-derived vectors support prolonged expression windows through replication of viral RNA encoding genes of interest. Mixed technologies combining viral and nonviral components are also available. RNA transfer is ideal for all settings that do not require permanent transgene expression and excludes potentially detrimental DNA integration into the target cell genome. Thus, RNA-based technologies are successfully applied for reprogramming, transdifferentiation, gene editing, vaccination, tumor therapy, and gene therapy. PMID:27377044

A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

PubMed Central

Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

2014-01-01

Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Convergent transcription in the butyrolactone regulon in Streptomyces coelicolor confers a bistable genetic switch for antibiotic biosynthesis.

PubMed

Chatterjee, Anushree; Drews, Laurie; Mehra, Sarika; Takano, Eriko; Kaznessis, Yiannis N; Hu, Wei-Shou

2011-01-01

cis-encoded antisense RNAs (cis asRNA) have been reported to participate in gene expression regulation in both eukaryotic and prokaryotic organisms. Its presence in Streptomyces coelicolor has also been reported recently; however, its role has yet to be fully investigated. Using mathematical modeling we explore the role of cis asRNA produced as a result of convergent transcription in scbA-scbR genetic switch. scbA and scbR gene pair, encoding repressor-amplifier proteins respectively, mediates the synthesis of a signaling molecule, the γ-butyrolactone SCB1 and controls the onset of antibiotic production. Our model considers that transcriptional interference caused by convergent transcription of two opposing RNA polymerases results in fatal collision and transcriptional termination, which suppresses transcription efficiency. Additionally, convergent transcription causes sense and antisense interactions between complementary sequences from opposing strands, rendering the full length transcript inaccessible for translation. We evaluated the role of transcriptional interference and the antisense effect conferred by convergent transcription on the behavior of scbA-scbR system. Stability analysis showed that while transcriptional interference affects the system, it is asRNA that confers scbA-scbR system the characteristics of a bistable switch in response to the signaling molecule SCB1. With its critical role of regulating the onset of antibiotic synthesis the bistable behavior offers this two gene system the needed robustness to be a genetic switch. The convergent two gene system with potential of transcriptional interference is a frequent feature in various genomes. The possibility of asRNA regulation in other such gene-pairs is yet to be examined.

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

PubMed

Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

2009-01-01

To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

Field applications of stand-off sensing using visible/NIR multivariate optical computing

NASA Astrophysics Data System (ADS)

Eastwood, DeLyle; Soyemi, Olusola O.; Karunamuni, Jeevanandra; Zhang, Lixia; Li, Hongli; Myrick, Michael L.

2001-02-01

12 A novel multivariate visible/NIR optical computing approach applicable to standoff sensing will be demonstrated with porphyrin mixtures as examples. The ultimate goal is to develop environmental or counter-terrorism sensors for chemicals such as organophosphorus (OP) pesticides or chemical warfare simulants in the near infrared spectral region. The mathematical operation that characterizes prediction of properties via regression from optical spectra is a calculation of inner products between the spectrum and the pre-determined regression vector. The result is scaled appropriately and offset to correspond to the basis from which the regression vector is derived. The process involves collecting spectroscopic data and synthesizing a multivariate vector using a pattern recognition method. Then, an interference coating is designed that reproduces the pattern of the multivariate vector in its transmission or reflection spectrum, and appropriate interference filters are fabricated. High and low refractive index materials such as Nb2O5 and SiO2 are excellent choices for the visible and near infrared regions. The proof of concept has now been established for this system in the visible and will later be extended to chemicals such as OP compounds in the near and mid-infrared.

Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations.

PubMed

Pfaller, Christian K; Mastorakos, George M; Matchett, William E; Ma, Xiao; Samuel, Charles E; Cattaneo, Roberto

2015-08-01

Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and other infectious diseases. The efficacy of MV-based vectors depends on their replication proficiency and immune activation capacity. Here we document that copy-back defective interfering RNAs (DI-RNAs) are generated by recombinant vaccine and wild-type MVs immediately after rescue. The MV C protein interferes with DI-RNA generation and may enhance the processivity of the viral polymerase. We frequently detected clusters of A-to-G or U-to-C transitions and noted that sequences flanking individual mutations contain motifs favoring recognition by the adenosine deaminase acting on RNA-1 (ADAR1). The consistent type of transitions on the DI-RNAs indicates that these are direct substrates for editing by ADAR1. The ADAR1-mediated biased hypermutation events are consistent with the protein kinase R (PKR)-ADAR1 balancing model of innate immunity activation. We show by coinfection that the C-defective phenotype is dominant. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations

PubMed Central

Pfaller, Christian K.; Mastorakos, George M.; Matchett, William E.; Ma, Xiao; Samuel, Charles E.

2015-01-01

ABSTRACT Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. IMPORTANCE Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and other infectious diseases. The efficacy of MV-based vectors depends on their replication proficiency and immune activation capacity. Here we document that copy-back defective interfering RNAs (DI-RNAs) are generated by recombinant vaccine and wild-type MVs immediately after rescue. The MV C protein interferes with DI-RNA generation and may enhance the processivity of the viral polymerase. We frequently detected clusters of A-to-G or U-to-C transitions and noted that sequences flanking individual mutations contain motifs favoring recognition by the adenosine deaminase acting on RNA-1 (ADAR1). The consistent type of transitions on the DI-RNAs indicates that these are direct substrates for editing by ADAR1. The ADAR1-mediated biased hypermutation events are consistent with the protein kinase R (PKR)-ADAR1 balancing model of innate immunity activation. We show by coinfection that the C-defective phenotype is dominant. PMID:25972541

The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.

PubMed

Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi

2011-01-01

Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.

The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight

PubMed Central

Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi

2011-01-01

Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were statistically significant (P<0.05). The relative mRNA and protein expression of Jagged1, Hes1 and Hey1 in xenograft tissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (P<0.05). There were no differences of relative mRNA and protein expression of Notch1 in xenograft tissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

[Wnt/β-catenin pathway involved in the regulation of rat mesangial cell proliferation by adipose-derived mesenchymal stem cells].

PubMed

Li, Zhi; Zhang, Mengying; Li, Xueqin; Lu, Jinming; Xu, Liang

2016-11-01

Objective To investigate the effect of adipose-derived mesenchymal stem cells (ADSCs) on glomerular mesangial cell proliferation via Wnt/β-catenin pathway. Methods The rat glomerular mesangial cells (HBZY-1) were incubated in conditioned ADSC medium. Cell cycle was analyzed with flow cytometry; the proliferation rate of HBZY-1 and the expression levels of relative genes and proteins of Wnt signaling pathway were measured using RNA interference, quantitative real-time PCR and Western blotting, respectively. Results HBZY-1 proliferation was significantly inhibited under the action of conditioned ADSC medium, whereas dickkopf WNT signaling pathway inhibitor 1 (DKK1) mRNA level was up-regulated. Fibronectin and TGF-β1 mRNA expression as well as β-catenin and Bcl-2 protein levels of HBZY-1 were significantly down-regulated. DKK1 gene expression level in ADSCs was significantly higher than that of HBZY-1. After RNA interference, DKK1 expression level in ADSCs was markedly inhibited, yet the β-catenin protein level was notably elevated. The β-catenin and Bcl-2 protein levels of HBZY-1 were also significantly raised in HBZY-1 after cultured with conditioned medium containing ADSCs treated with RNA interference. Conclusion Wnt/β-catenin may be a potential signaling pathway involved in the regulative effect of ADSCs on glomerular mesangial cell proliferation.

Combine EPR and two-slit experiments: Interference of advanced waves

NASA Astrophysics Data System (ADS)

Klyshko, D. N.

1988-10-01

A nonclassical interference effect, using two-photon correlations in nonlinear optical interactions, is discussed. The apparent nonlocality could be conveniently interpreted in terms of advanced waves, emitted by one detector toward the other. A new Bell-type experiment is proposed, in which the measured photon's parameter is the wave-vector (instead of the polarisation), so that the observable can take more than two possible values.

Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

PubMed Central

Dang, Que; Hu, Wei-Shau

2001-01-01

Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

PubMed

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

2015-02-06

Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

Engineering Molecular Immunity Against Plant Viruses.

PubMed

Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M

2017-01-01

Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.

The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

PubMed

Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

2014-08-01

Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Low molecular weight chitosan conjugated with folate for siRNA delivery in vitro: optimization studies

PubMed Central

Fernandes, Julio C; Qiu, Xingping; Winnik, Francoise M; Benderdour, Mohamed; Zhang, Xiaoling; Dai, Kerong; Shi, Qin

2012-01-01

The low transfection efficiency of chitosan is one of its drawbacks as a gene delivery carrier. Low molecular weight chitosan may help to form small-sized polymer-DNA or small interfering RNA (siRNA) complexes. Folate conjugation may improve gene transfection efficiency because of the promoted uptake of folate receptor-bearing cells. In the present study, chitosan was conjugated with folate and investigated for its efficacy as a delivery vector for siRNA in vitro. We demonstrate that the molecular weight of chitosan has a major influence on its biological and physicochemical properties, and very low molecular weight chitosan (below 10 kDa) has difficulty in forming stable complexes with siRNA. In this study, chitosan 25 kDa and 50 kDa completely absorbed siRNA and formed nanoparticles (≤220 nm) at a chitosan to siRNA weight ratio of 50:1. The introduction of a folate ligand onto chitosan decreased nanoparticle toxicity. Compared with chitosan-siRNA, folate-chitosan-siRNA nanoparticles improved gene silencing transfection efficiency. Therefore, folate-chitosan shows potential as a viable candidate vector for safe and efficient siRNA delivery. PMID:23209368

RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-01

Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

PubMed

Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

2017-01-01

Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

PubMed

Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

2016-05-01

To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

Gene Silencing in Insect Cells Using RNAi.

PubMed

Wu, Hsuan-Chen; March, John C; Bentley, William E

2016-01-01

A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.

Photorefractive Tungsten Bronze Crystals for Optical Limiters and Filters.

DTIC Science & Technology

1996-01-01

vector , X is the laser light wavelength, 0 is the half- angle between the two crossing laser beams, and k0 is the Debye screening wave vector given by...between the grating and the dielectric constant E’ = 950) such that the grating’ vector is interference pattern, the intensities of the output beams from...substituting Io, I, and Id into expression 0 ple d 2o0o 25i00 (8), we can calculate the phase shift between the grating and Applied Electric Feild in V

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

PubMed

Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

2015-12-01

Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated that the developed DOX-PLGA/PEI/P-gp shRNA NBs is a potential, safe and efficient theranotic agent for cancer therapy and diagnostics.

A Cysteine Protease Is Critical for Babesia spp. Transmission in Haemaphysalis Ticks

PubMed Central

Tsuji, Naotoshi; Miyoshi, Takeharu; Battsetseg, Badger; Matsuo, Tomohide; Xuan, Xuenan; Fujisaki, Kozo

2008-01-01

Vector ticks possess a unique system that enables them to digest large amounts of host blood and to transmit various animal and human pathogens, suggesting the existence of evolutionally acquired proteolytic mechanisms. We report here the molecular and reverse genetic characterization of a multifunctional cysteine protease, longipain, from the babesial parasite vector tick Haemaphysalis longicornis. Longipain shares structural similarity with papain-family cysteine proteases obtained from invertebrates and vertebrates. Endogenous longipain was mainly expressed in the midgut epithelium and was specifically localized at lysosomal vacuoles and possibly released into the lumen. Its expression was up-regulated by host blood feeding. Enzymatic functional assays using in vitro and in vivo substrates revealed that longipain hydrolysis occurs over a broad range of pH and temperature. Haemoparasiticidal assays showed that longipain dose-dependently killed tick-borne Babesia parasites, and its babesiacidal effect occurred via specific adherence to the parasite membranes. Disruption of endogenous longipain by RNA interference revealed that longipain is involved in the digestion of the host blood meal. In addition, the knockdown ticks contained an increased number of parasites, suggesting that longipain exerts a killing effect against the midgut-stage Babesia parasites in ticks. Our results suggest that longipain is essential for tick survival, and may have a role in controlling the transmission of tick-transmittable Babesia parasites. PMID:18483546

Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

PubMed

Tao, Zhi-Wei; Zou, Ping-An

2018-06-13

Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

Research Area 14.3 Microbiology and Biodegradation: Development of RNA-based Vectors for in vivo Delivery of siRNAs

DTIC Science & Technology

2014-09-08

P.O. Box 12211 Research Triangle Park, NC 27709-2211 Vector, RNAi, delivery REPORT DOCUMENTATION PAGE 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 10...suggesstions for reducing this burden, to Washington Headquarters Services , Directorate for Information Operations and Reports, 1215 Jefferson Davis...Shapiro, Alissa M Pham, Benjamin R tenOever. In Vivo Delivery of Cytoplasmic RNA Virus-derived miRNAs, Molecular Therapy, (11 2011): 0. doi

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

Static internal performance of a single expansion ramp nozzle with multiaxis thrust vectoring capability

NASA Technical Reports Server (NTRS)

Capone, Francis J.; Schirmer, Alberto W.

1993-01-01

An investigation was conducted at static conditions in order to determine the internal performance characteristics of a multiaxis thrust vectoring single expansion ramp nozzle. Yaw vectoring was achieved by deflecting yaw flaps in the nozzle sidewall into the nozzle exhaust flow. In order to eliminate any physical interference between the variable angle yaw flap deflected into the exhaust flow and the nozzle upper ramp and lower flap which were deflected for pitch vectoring, the downstream corners of both the nozzle ramp and lower flap were cut off to allow for up to 30 deg of yaw vectoring. The effects of nozzle upper ramp and lower flap cutout, yaw flap hinge line location and hinge inclination angle, sidewall containment, geometric pitch vector angle, and geometric yaw vector angle were studied. This investigation was conducted in the static-test facility of the Langley 16-Foot Transonic Tunnel at nozzle pressure ratios up to 8.0.

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

NASA Astrophysics Data System (ADS)

Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

2015-11-01

Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers. Electronic supplementary information (ESI) available: Non-fusogenic liposomes; cytotoxicity of naked siRNA and the empty vector; immunogenicity; low-magnification images; DOPE/DPPC liposomes. See DOI: 10.1039/c5nr04807a

wFlu: Characterization and Evaluation of a Native Wolbachia from the Mosquito Aedes fluviatilis as a Potential Vector Control Agent

PubMed Central

Gonçalves, Daniela da Silva; Moreira, Luciano Andrade

2013-01-01

There is currently considerable interest and practical progress in using the endosymbiotic bacteria Wolbachia as a vector control agent for human vector-borne diseases. Such vector control strategies may require the introduction of multiple, different Wolbachia strains into target vector populations, necessitating the identification and characterization of appropriate endosymbiont variants. Here, we report preliminary characterization of wFlu, a native Wolbachia from the neotropical mosquito Aedes fluviatilis, and evaluate its potential as a vector control agent by confirming its ability to cause cytoplasmic incompatibility, and measuring its effect on three parameters determining host fitness (survival, fecundity and fertility), as well as vector competence (susceptibility) for pathogen infection. Using an aposymbiotic strain of Ae. fluviatilis cured of its native Wolbachia by antibiotic treatment, we show that in its natural host wFlu causes incomplete, but high levels of, unidirectional cytoplasmic incompatibility, has high rates of maternal transmission, and no detectable fitness costs, indicating a high capacity to rapidly spread through host populations. However, wFlu does not inhibit, and even enhances, oocyst infection with the avian malaria parasite Plasmodium gallinaceum. The stage- and sex-specific density of wFlu was relatively low, and with limited tissue distribution, consistent with the lack of virulence and pathogen interference/symbiont-mediated protection observed. Unexpectedly, the density of wFlu was also shown to be specifically-reduced in the ovaries after bloodfeeding Ae. fluviatilis. Overall, our observations indicate that the Wolbachia strain wFlu has the potential to be used as a vector control agent, and suggests that appreciable mutualistic coevolution has occurred between this endosymbiont and its natural host. Future work will be needed to determine whether wFlu has virulent host effects and/or exhibits pathogen interference when artificially-transfected to the novel mosquito hosts that are the vectors of human pathogens. PMID:23555728

Structural analyses of the CRISPR protein Csc2 reveal the RNA-binding interface of the type I-D Cas7 family.

PubMed

Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena

2014-01-01

Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs.

PubMed

Miesen, Pascal; Ivens, Alasdair; Buck, Amy H; van Rij, Ronald P

2016-02-01

In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of the antiviral RNA interference machinery, one of the key pathways that limit virus replication in invertebrates. Besides siRNAs, Aedes mosquitoes and cells derived from these insects produce arbovirus-derived piRNAs, the best studied examples being viruses from the Togaviridae or Bunyaviridae families. Host miRNAs modulate the expression of a large number of genes and their levels may change in response to viral infections. In addition, some viruses, mostly with a DNA genome, express their own miRNAs to regulate host and viral gene expression. Here, we perform a comprehensive analysis of both viral and host-derived small RNAs in Aedes aegypti Aag2 cells infected with dengue virus 2 (DENV), a member of the Flaviviridae family. Aag2 cells are competent in producing all three types of small RNAs and provide a powerful tool to explore the crosstalk between arboviral infection and the distinct RNA silencing pathways. Interestingly, besides the well-characterized DENV-derived siRNAs, a specific population of viral piRNAs was identified in infected Aag2 cells. Knockdown of Piwi5, Ago3 and, to a lesser extent, Piwi6 results in reduction of vpiRNA levels, providing the first genetic evidence that Aedes PIWI proteins produce DENV-derived small RNAs. In contrast, we do not find convincing evidence for the production of virus-derived miRNAs. Neither do we find that host miRNA expression is strongly changed upon DENV2 infection. Finally, our deep-sequencing analyses detect 30 novel Aedes miRNAs, complementing the repertoire of regulatory small RNAs in this important vector species.

Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs

PubMed Central

Miesen, Pascal; Ivens, Alasdair; Buck, Amy H.; van Rij, Ronald P.

2016-01-01

In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of the antiviral RNA interference machinery, one of the key pathways that limit virus replication in invertebrates. Besides siRNAs, Aedes mosquitoes and cells derived from these insects produce arbovirus-derived piRNAs, the best studied examples being viruses from the Togaviridae or Bunyaviridae families. Host miRNAs modulate the expression of a large number of genes and their levels may change in response to viral infections. In addition, some viruses, mostly with a DNA genome, express their own miRNAs to regulate host and viral gene expression. Here, we perform a comprehensive analysis of both viral and host-derived small RNAs in Aedes aegypti Aag2 cells infected with dengue virus 2 (DENV), a member of the Flaviviridae family. Aag2 cells are competent in producing all three types of small RNAs and provide a powerful tool to explore the crosstalk between arboviral infection and the distinct RNA silencing pathways. Interestingly, besides the well-characterized DENV-derived siRNAs, a specific population of viral piRNAs was identified in infected Aag2 cells. Knockdown of Piwi5, Ago3 and, to a lesser extent, Piwi6 results in reduction of vpiRNA levels, providing the first genetic evidence that Aedes PIWI proteins produce DENV-derived small RNAs. In contrast, we do not find convincing evidence for the production of virus-derived miRNAs. Neither do we find that host miRNA expression is strongly changed upon DENV2 infection. Finally, our deep-sequencing analyses detect 30 novel Aedes miRNAs, complementing the repertoire of regulatory small RNAs in this important vector species. PMID:26914027

Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

PubMed

Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

2017-01-01

Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can be applied to functional genomics analyses to facilitate, species-specific dsRNA-mediated control of other non-model hemipterans.

The role of Cas8 in type I CRISPR interference.

PubMed

Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

2015-05-05

CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689