Equally parsimonious pathways through an RNA sequence space are not equally likely
NASA Technical Reports Server (NTRS)
Lee, Y. H.; DSouza, L. M.; Fox, G. E.
1997-01-01
An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.
Common 5S rRNA variants are likely to be accepted in many sequence contexts
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.
Prediction of RNA secondary structures: from theory to models and real molecules
NASA Astrophysics Data System (ADS)
Schuster, Peter
2006-05-01
RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA molecules can be modelled readily at the secondary structure level and allows prediction of the most stable (mfe) conformations of complexes together with suboptimal states. Cofolding algorithms are important tools for efficient and highly specific primer design in the polymerase chain reaction (PCR) and help to explain the mechanisms of small interference RNA (si-RNA) molecules in gene regulation. The evolutionary optimization of RNA structures is illustrated by the search for a target structure and mimics aptamer selection in evolutionary biotechnology. It occurs typically in steps consisting of short adaptive phases interrupted by long epochs of little or no obvious progress in optimization. During these quasi-stationary epochs the populations are essentially confined to neutral networks where they search for sequences that allow a continuation of the adaptive process. Modelling RNA evolution as a simultaneous process in sequence and shape space provides answers to questions of the optimal population size and mutation rates. Kinetic folding is a stochastic process in conformation space. Exact solutions are derived by direct simulation in the form of trajectory sampling or by solving the master equation. The exact solutions can be approximated straightforwardly by Arrhenius kinetics on barrier trees, which represent simplified versions of conformational energy landscapes. The existence of at least one sequence forming any arbitrarily chosen pair of structures is granted by the intersection theorem. Folding kinetics is the key to understanding and designing multistable RNA molecules or RNA switches. These RNAs form two or more long lived conformations, and conformational changes occur either spontaneously or are induced through binding of small molecules or other biopolymers. RNA switches are found in nature where they act as elements in genetic and metabolic regulation. The reliability of RNA secondary structure prediction is limited by the accuracy with which the empirical parameters can be determined and by principal deficiencies, for example by the lack of energy contributions resulting from tertiary interactions. In addition, native structures may be determined by folding kinetics rather than by thermodynamics. We address the first problem by considering base pair probabilities or base pairing entropies, which are derived from the partition function of conformations. A high base pair probability corresponding to a low pairing entropy is taken as an indicator of a high reliability of prediction. Pseudoknots are discussed as an example of a tertiary interaction that is highly important for RNA function. Moreover, pseudoknot formation is readily incorporated into structure prediction algorithms. Some examples of experimental data on RNA secondary structures that are readily explained using the landscape concept are presented. They deal with (i) properties of RNA molecules with random sequences, (ii) RNA molecules from restricted alphabets, (iii) existence of neutral networks, (iv) shape space covering, (v) riboswitches and (vi) evolution of non-coding RNAs as an example of evolution restricted to neutral networks.
Experimental investigation of an RNA sequence space
NASA Technical Reports Server (NTRS)
Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.
1993-01-01
Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.
Topological Structure of the Space of Phenotypes: The Case of RNA Neutral Networks
Aguirre, Jacobo; Buldú, Javier M.; Stich, Michael; Manrubia, Susanna C.
2011-01-01
The evolution and adaptation of molecular populations is constrained by the diversity accessible through mutational processes. RNA is a paradigmatic example of biopolymer where genotype (sequence) and phenotype (approximated by the secondary structure fold) are identified in a single molecule. The extreme redundancy of the genotype-phenotype map leads to large ensembles of RNA sequences that fold into the same secondary structure and can be connected through single-point mutations. These ensembles define neutral networks of phenotypes in sequence space. Here we analyze the topological properties of neutral networks formed by 12-nucleotides RNA sequences, obtained through the exhaustive folding of sequence space. A total of 412 sequences fragments into 645 subnetworks that correspond to 57 different secondary structures. The topological analysis reveals that each subnetwork is far from being random: it has a degree distribution with a well-defined average and a small dispersion, a high clustering coefficient, and an average shortest path between nodes close to its minimum possible value, i.e. the Hamming distance between sequences. RNA neutral networks are assortative due to the correlation in the composition of neighboring sequences, a feature that together with the symmetries inherent to the folding process explains the existence of communities. Several topological relationships can be analytically derived attending to structural restrictions and generic properties of the folding process. The average degree of these phenotypic networks grows logarithmically with their size, such that abundant phenotypes have the additional advantage of being more robust to mutations. This property prevents fragmentation of neutral networks and thus enhances the navigability of sequence space. In summary, RNA neutral networks show unique topological properties, unknown to other networks previously described. PMID:22028856
A computational proposal for designing structured RNA pools for in vitro selection of RNAs.
Kim, Namhee; Gan, Hin Hark; Schlick, Tamar
2007-04-01
Although in vitro selection technology is a versatile experimental tool for discovering novel synthetic RNA molecules, finding complex RNA molecules is difficult because most RNAs identified from random sequence pools are simple motifs, consistent with recent computational analysis of such sequence pools. Thus, enriching in vitro selection pools with complex structures could increase the probability of discovering novel RNAs. Here we develop an approach for engineering sequence pools that links RNA sequence space regions with corresponding structural distributions via a "mixing matrix" approach combined with a graph theory analysis. We define five classes of mixing matrices motivated by covariance mutations in RNA; these constructs define nucleotide transition rates and are applied to chosen starting sequences to yield specific nonrandom pools. We examine the coverage of sequence space as a function of the mixing matrix and starting sequence via clustering analysis. We show that, in contrast to random sequences, which are associated only with a local region of sequence space, our designed pools, including a structured pool for GTP aptamers, can target specific motifs. It follows that experimental synthesis of designed pools can benefit from using optimized starting sequences, mixing matrices, and pool fractions associated with each of our constructed pools as a guide. Automation of our approach could provide practical tools for pool design applications for in vitro selection of RNAs and related problems.
Swellix: a computational tool to explore RNA conformational space.
Sloat, Nathan; Liu, Jui-Wen; Schroeder, Susan J
2017-11-21
The sequence of nucleotides in an RNA determines the possible base pairs for an RNA fold and thus also determines the overall shape and function of an RNA. The Swellix program presented here combines a helix abstraction with a combinatorial approach to the RNA folding problem in order to compute all possible non-pseudoknotted RNA structures for RNA sequences. The Swellix program builds on the Crumple program and can include experimental constraints on global RNA structures such as the minimum number and lengths of helices from crystallography, cryoelectron microscopy, or in vivo crosslinking and chemical probing methods. The conceptual advance in Swellix is to count helices and generate all possible combinations of helices rather than counting and combining base pairs. Swellix bundles similar helices and includes improvements in memory use and efficient parallelization. Biological applications of Swellix are demonstrated by computing the reduction in conformational space and entropy due to naturally modified nucleotides in tRNA sequences and by motif searches in Human Endogenous Retroviral (HERV) RNA sequences. The Swellix motif search reveals occurrences of protein and drug binding motifs in the HERV RNA ensemble that do not occur in minimum free energy or centroid predicted structures. Swellix presents significant improvements over Crumple in terms of efficiency and memory use. The efficient parallelization of Swellix enables the computation of sequences as long as 418 nucleotides with sufficient experimental constraints. Thus, Swellix provides a practical alternative to free energy minimization tools when multiple structures, kinetically determined structures, or complex RNA-RNA and RNA-protein interactions are present in an RNA folding problem.
Exploration of RNA Sequence Space in the Absence of a Replicase.
Tirumalai, Madhan R; Tran, Quyen; Paci, Maxim; Chavan, Dimple; Marathe, Anuradha; Fox, George E
2018-05-11
It is generally considered that if an RNA World ever existed that it would be driven by an RNA capable of RNA replication. Whether such a catalytic RNA could emerge in an RNA World or not, there would need to be prior routes to increasing complexity in order to produce it. It is hypothesized here that increasing sequence variety, if not complexity, can in fact readily emerge in response to a dynamic equilibrium between synthesis and degradation. A model system in which T4 RNA ligase catalyzes synthesis and Benzonase catalyzes degradation was constructed. An initial 20-mer served as a seed and was subjected to 180 min of simultaneous ligation and degradation. The seed RNA rapidly disappeared and was replaced by an increasing number and variety of both larger and smaller variants. Variants of 40-80 residues were consistently seen, typically representing 2-4% of the unique sequences. In a second experiment with four individual 9-mers, numerous variants were again produced. These included variants of the individual 9-mers as well as sequences that contained sequence segments from two or more 9-mers. In both cases, the RNA products lack large numbers of point mutations but instead incorporate additions and subtractions of fragments of the original RNAs. The system demonstrates that if such equilibrium were established in a prebiotic world it would result in significant exploration of RNA sequence space and likely increased complexity. It remains to be seen if the variety of products produced is affected by the presence of small peptide oligomers.
Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.
Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk
2010-01-01
The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by <25% in sequence identity fold into very similar structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.
Information-Theoretic Uncertainty of SCFG-Modeled Folding Space of The Non-coding RNA
Manzourolajdad, Amirhossein; Wang, Yingfeng; Shaw, Timothy I.; Malmberg, Russell L.
2012-01-01
RNA secondary structure ensembles define probability distributions for alternative equilibrium secondary structures of an RNA sequence. Shannon’s Entropy is a measure for the amount of diversity present in any ensemble. In this work, Shannon’s entropy of the SCFG ensemble on an RNA sequence is derived and implemented in polynomial time for both structurally ambiguous and unambiguous grammars. Micro RNA sequences generally have low folding entropy, as previously discovered. Surprisingly, signs of significantly high folding entropy were observed in certain ncRNA families. More effective models coupled with targeted randomization tests can lead to a better insight into folding features of these families. PMID:23160142
Exploring Connectivity in Sequence Space of Functional RNA
NASA Technical Reports Server (NTRS)
Wei, Chenyu; Pohorille, Andrzej; Popovic, Milena; Ditzler, Mark
2017-01-01
Emergence of replicable genetic molecules was one of the marking points in the origin of life, evolution of which can be conceptualized as a walk through the space of all possible sequences. A theoretical concept of fitness landscape helps to understand evolutionary processes through assigning a value of fitness to each genotype. Then, evolution of a phenotype is viewed as a series of consecutive, single-point mutations. Natural selection biases evolution toward peaks of high fitness and away from valleys of low fitness. whereas neutral drift occurs in the sequence space without direction as mutations are introduced at random. Large networks of neutral or near-neutral mutations on a fitness landscape, especially for sufficiently long genomes, are possible or even inevitable. Their detection in experiments, however, has been elusive. Although a few near-neutral evolutionary pathways have been found, recent experimental evidence indicates landscapes consist of largely isolated islands. The generality of these results, however, is not clear, as the genome length or the fraction of functional molecules in the genotypic space might have been insufficient for the emergence of large, neutral networks. Thorough investigation on the structure of the fitness landscape is essential to understand the mechanisms of evolution of early genomes. RNA molecules are commonly assumed to play the pivotal role in the origin of genetic systems. They are widely believed to be early, if not the earliest, genetic and catalytic molecules, with abundant biochemical activities as aptamers and ribozymes, i.e. RNA molecules capable, respectively, to bind small molecules or catalyze chemical reactions. Here, we present results of our recent studies on the structure of the sequence space of RNA ligase ribozymes selected through in vitro evolution. Several hundred thousands of sequences active to a different degree were obtained by way of deep sequencing. Analysis of these sequences revealed several large clusters defined such that every sequence in a cluster can be reached from any other sequence in the same cluster through a series of single point mutations. Sequences in a single cluster appear to adopt more than one secondary structure. The mechanism of refolding within a single cluster was examined. To shed light on possible evolutionary paths in the space of ribozymes, the connectivity between clusters was investigated. The effect of length of RNA molecules on the structure of the fitness landscape and possible evolutionary paths was examined by way of comparing functional sequences of 20 and 80 nucleobases in length. It was found that sequences of different lengths shared secondary structure motifs that were presumed responsible for catalytic activity, with increasing complexity and global structural rearrangements emerging in longer molecules.
Smoothness within ruggedness: the role of neutrality in adaptation.
Huynen, M A; Stadler, P F; Fontana, W
1996-01-01
RNA secondary structure folding algorithms predict the existence of connected networks of RNA sequences with identical structure. On such networks, evolving populations split into subpopulations, which diffuse independently in sequence space. This demands a distinction between two mutation thresholds: one at which genotypic information is lost and one at which phenotypic information is lost. In between, diffusion enables the search of vast areas in genotype space while still preserving the dominant phenotype. By this dynamic the success of phenotypic adaptation becomes much less sensitive to the initial conditions in genotype space. Images Fig. 2 PMID:8552647
RNA inverse folding using Monte Carlo tree search.
Yang, Xiufeng; Yoshizoe, Kazuki; Taneda, Akito; Tsuda, Koji
2017-11-06
Artificially synthesized RNA molecules provide important ways for creating a variety of novel functional molecules. State-of-the-art RNA inverse folding algorithms can design simple and short RNA sequences of specific GC content, that fold into the target RNA structure. However, their performance is not satisfactory in complicated cases. We present a new inverse folding algorithm called MCTS-RNA, which uses Monte Carlo tree search (MCTS), a technique that has shown exceptional performance in Computer Go recently, to represent and discover the essential part of the sequence space. To obtain high accuracy, initial sequences generated by MCTS are further improved by a series of local updates. Our algorithm has an ability to control the GC content precisely and can deal with pseudoknot structures. Using common benchmark datasets for evaluation, MCTS-RNA showed a lot of promise as a standard method of RNA inverse folding. MCTS-RNA is available at https://github.com/tsudalab/MCTS-RNA .
NASA Astrophysics Data System (ADS)
Kozlova, Olga; Gusev, Oleg; Levinskikh, Margarita; Sychev, Vladimir; Poddubko, Svetlana
The current study is addressed to the complex analysis of whole genome mRNA expression profile and properties of splicing variants formation in different organs of medaka fish exposed to prolonged space flight in the frame of joint Russia-Japan research program “Aquarium-AQH”. The fish were kept in the AQH joint-aquariums system in October-December 2013, followed by fixation in RNA-preserving buffers and freezing during the space flight. The samples we returned to the Earth frozen in March 2013 and mRNAs from four fish were sequenced in organ-specific manner using HiSeq Illumina sequencing platform. The ground group fish treated in the same way was used as a control. The comparison between the groups revealed space group-specific specific mRNA expression pattern. More than 50 genes (including several types of myosins) were down-regulated in the space group. Moreover, we found an evidence for formation of space group-specific splicing variants of mRNA. Taking together, the data suggest that in spite of aquatic environment, space flight-associated factors have a strong effect on the activity of fish genome. This work was supported in part by subsidy of the Russian Government to support the Program of competitive growth of Kazan Federal University among world class academic centres and universities.
Mutational robustness accelerates the origin of novel RNA phenotypes through phenotypic plasticity.
Wagner, Andreas
2014-02-18
Novel phenotypes can originate either through mutations in existing genotypes or through phenotypic plasticity, the ability of one genotype to form multiple phenotypes. From molecules to organisms, plasticity is a ubiquitous feature of life, and a potential source of exaptations, adaptive traits that originated for nonadaptive reasons. Another ubiquitous feature is robustness to mutations, although it is unknown whether such robustness helps or hinders the origin of new phenotypes through plasticity. RNA is ideal to address this question, because it shows extensive plasticity in its secondary structure phenotypes, a consequence of their continual folding and unfolding, and these phenotypes have important biological functions. Moreover, RNA is to some extent robust to mutations. This robustness structures RNA genotype space into myriad connected networks of genotypes with the same phenotype, and it influences the dynamics of evolving populations on a genotype network. In this study I show that both effects help accelerate the exploration of novel phenotypes through plasticity. My observations are based on many RNA molecules sampled at random from RNA sequence space, and on 30 biological RNA molecules. They are thus not only a generic feature of RNA sequence space but are relevant for the molecular evolution of biological RNA. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Present Day Biology seen in the Looking Glass of Physics of Complexity
NASA Astrophysics Data System (ADS)
Schuster, P.
Darwin's theory of variation and selection in its simplest form is directly applicable to RNA evolution in vitro as well as to virus evolution, and it allows for quantitative predictions. Understanding evolution at the molecular level is ultimately related to the central paradigm of structural biology: sequence⇒ structure ⇒ function. We elaborate on the state of the art in modeling and understanding evolution of RNA driven by reproduction and mutation. The focus will be laid on the landscape concept—originally introduced by Sewall Wright—and its application to problems in biology. The relation between genotypes and phenotypes is the result of two consecutive mappings from a space of genotypes called sequence space onto a space of phenotypes or structures, and fitness is the result of a mapping from phenotype space into non-negative real numbers. Realistic landscapes as derived from folding of RNA sequences into structures are characterized by two properties: (i) they are rugged in the sense that sequences lying nearby in sequence space may have very different fitness values and (ii) they are characterized by an appreciable degree of neutrality implying that a certain fraction of genotypes and/or phenotypes cannot be distinguished in the selection process. Evolutionary dynamics on realistic landscapes will be studied as a function of the mutation rate, and the role of neutrality in the selection process will be discussed.
Structurally complex and highly active RNA ligases derived from random RNA sequences
NASA Technical Reports Server (NTRS)
Ekland, E. H.; Szostak, J. W.; Bartel, D. P.
1995-01-01
Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.
RNA regulators responding to ribosomal protein S15 are frequent in sequence space
Slinger, Betty L.; Meyer, Michelle M.
2016-01-01
There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716
Exploration of sequence space as the basis of viral RNA genome segmentation.
Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia
2014-05-06
The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.
Hayden, Eric J
2016-08-15
RNA molecules provide a realistic but tractable model of a genotype to phenotype relationship. This relationship has been extensively investigated computationally using secondary structure prediction algorithms. Enzymatic RNA molecules, or ribozymes, offer access to genotypic and phenotypic information in the laboratory. Advancements in high-throughput sequencing technologies have enabled the analysis of sequences in the lab that now rivals what can be accomplished computationally. This has motivated a resurgence of in vitro selection experiments and opened new doors for the analysis of the distribution of RNA functions in genotype space. A body of computational experiments has investigated the persistence of specific RNA structures despite changes in the primary sequence, and how this mutational robustness can promote adaptations. This article summarizes recent approaches that were designed to investigate the role of mutational robustness during the evolution of RNA molecules in the laboratory, and presents theoretical motivations, experimental methods and approaches to data analysis. Copyright © 2016 Elsevier Inc. All rights reserved.
Revisiting Robustness and Evolvability: Evolution in Weighted Genotype Spaces
Partha, Raghavendran; Raman, Karthik
2014-01-01
Robustness and evolvability are highly intertwined properties of biological systems. The relationship between these properties determines how biological systems are able to withstand mutations and show variation in response to them. Computational studies have explored the relationship between these two properties using neutral networks of RNA sequences (genotype) and their secondary structures (phenotype) as a model system. However, these studies have assumed every mutation to a sequence to be equally likely; the differences in the likelihood of the occurrence of various mutations, and the consequence of probabilistic nature of the mutations in such a system have previously been ignored. Associating probabilities to mutations essentially results in the weighting of genotype space. We here perform a comparative analysis of weighted and unweighted neutral networks of RNA sequences, and subsequently explore the relationship between robustness and evolvability. We show that assuming an equal likelihood for all mutations (as in an unweighted network), underestimates robustness and overestimates evolvability of a system. In spite of discarding this assumption, we observe that a negative correlation between sequence (genotype) robustness and sequence evolvability persists, and also that structure (phenotype) robustness promotes structure evolvability, as observed in earlier studies using unweighted networks. We also study the effects of base composition bias on robustness and evolvability. Particularly, we explore the association between robustness and evolvability in a sequence space that is AU-rich – sequences with an AU content of 80% or higher, compared to a normal (unbiased) sequence space. We find that evolvability of both sequences and structures in an AU-rich space is lesser compared to the normal space, and robustness higher. We also observe that AU-rich populations evolving on neutral networks of phenotypes, can access less phenotypic variation compared to normal populations evolving on neutral networks. PMID:25390641
Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.
Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B
2018-06-07
RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
Kim, K H; Hemenway, C
1997-05-26
The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.
Metagenomic ventures into outer sequence space.
Dutilh, Bas E
Sequencing DNA or RNA directly from the environment often results in many sequencing reads that have no homologs in the database. These are referred to as "unknowns," and reflect the vast unexplored microbial sequence space of our biosphere, also known as "biological dark matter." However, unknowns also exist because metagenomic datasets are not optimally mined. There is a pressure on researchers to publish and move on, and the unknown sequences are often left for what they are, and conclusions drawn based on reads with annotated homologs. This can cause abundant and widespread genomes to be overlooked, such as the recently discovered human gut bacteriophage crAssphage. The unknowns may be enriched for bacteriophage sequences, the most abundant and genetically diverse component of the biosphere and of sequence space. However, it remains an open question, what is the actual size of biological sequence space? The de novo assembly of shotgun metagenomes is the most powerful tool to address this question.
Stone, Jonathan W; Bleckley, Samuel; Lavelle, Sean; Schroeder, Susan J
2015-01-01
We present new modifications to the Wuchty algorithm in order to better define and explore possible conformations for an RNA sequence. The new features, including parallelization, energy-independent lonely pair constraints, context-dependent chemical probing constraints, helix filters, and optional multibranch loops, provide useful tools for exploring the landscape of RNA folding. Chemical probing alone may not necessarily define a single unique structure. The helix filters and optional multibranch loops are global constraints on RNA structure that are an especially useful tool for generating models of encapsidated viral RNA for which cryoelectron microscopy or crystallography data may be available. The computations generate a combinatorially complete set of structures near a free energy minimum and thus provide data on the density and diversity of structures near the bottom of a folding funnel for an RNA sequence. The conformational landscapes for some RNA sequences may resemble a low, wide basin rather than a steep funnel that converges to a single structure.
Cui, Yi; Han, Jin; Xiao, Zhifeng; Qi, Yiduo; Zhao, Yannan; Chen, Bing; Fang, Yongxiang; Liu, Sumei; Wu, Xianming; Dai, Jianwu
2017-01-01
Recently, with the development of the space program there are growing concerns about the influence of spaceflight on tissue engineering. The purpose of this study was thus to determine the variations of neural stem cells (NSCs) during spaceflight. RNA-Sequencing (RNA-Seq) based transcriptomic profiling of NSCs identified many differentially expressed mRNAs and miRNAs between space and earth groups. Subsequently, those genes with differential expression were subjected to bioinformatic evaluation using gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) and miRNA-mRNA network analyses. The results showed that NSCs maintain greater stemness ability during spaceflight although the growth rate of NSCs was slowed down. Furthermore, the results indicated that NSCs tended to differentiate into neuron in outer space conditions. Detailed genomic analyses of NSCs during spaceflight will help us to elucidate the molecular mechanisms behind their differentiation and proliferation when they are in outer space.
Arkas: Rapid reproducible RNAseq analysis
Colombo, Anthony R.; J. Triche Jr, Timothy; Ramsingh, Giridharan
2017-01-01
The recently introduced Kallisto pseudoaligner has radically simplified the quantification of transcripts in RNA-sequencing experiments. We offer cloud-scale RNAseq pipelines Arkas-Quantification, and Arkas-Analysis available within Illumina’s BaseSpace cloud application platform which expedites Kallisto preparatory routines, reliably calculates differential expression, and performs gene-set enrichment of REACTOME pathways . Due to inherit inefficiencies of scale, Illumina's BaseSpace computing platform offers a massively parallel distributive environment improving data management services and data importing. Arkas-Quantification deploys Kallisto for parallel cloud computations and is conveniently integrated downstream from the BaseSpace Sequence Read Archive (SRA) import/conversion application titled SRA Import. Arkas-Analysis annotates the Kallisto results by extracting structured information directly from source FASTA files with per-contig metadata, calculates the differential expression and gene-set enrichment analysis on both coding genes and transcripts. The Arkas cloud pipeline supports ENSEMBL transcriptomes and can be used downstream from the SRA Import facilitating raw sequencing importing, SRA FASTQ conversion, RNA quantification and analysis steps. PMID:28868134
NASA Astrophysics Data System (ADS)
Eigen, Manfred
1988-12-01
The Darwinian concept of evolution through natural selection has been revised and put on a solid physical basis, in a form which applies to self-replicable macromolecules. Two new concepts are introduced: sequence space and quasi-species. Evolutionary change in the DNA- or RNA-sequence of a gene can be mapped as a trajectory in a sequence space of dimension ν, where ν corresponds to the number of changeable positions in the genomic sequence. Emphasis, however, is shifted from the single surviving wildtype, a single point in the sequence space, to the complex structure of the mutant distribution that constitutes the quasi-species. Selection is equivalent to an establishment of the quasi-species in a localized region of sequence space, subject to threshold conditions for the error rate and sequence length. Arrival of a new mutant may violate the local threshold condition and thereby lead to a displacement of the quasi-species into a different region of sequence space. This transformation is similar to a phase transition; the dynamical equations that describe the quase-species have been shown to be analogous to those of the two-dimensional Ising model of ferromagnetism. The occurrence of a selectively advantageous mutant is biased by the particulars of the quasi-species distribution, whose mutants are populated according to their fitness relative to that of the wild-type. Inasmuch as fitness regions are connected (like mountain ridges) the evolutionary trajectory is guided to regions of optimal fitness. Evolution experiments in test tubes confirm this modification of the simple chance and law nature of the Darwinian concept. The results of the theory can also be applied to the construction of a machine that provides optimal conditions for a rapid evolution of functionally active macromolecules. An introduction to the physics of molecular evolution by the author has appeared recently.1 Detailed studies of the kinetics and mechanisms of replication of RNA, the most likely candidate for early evolution2,3, and of the implications on natural selection have been given in Refs. 4 and 5. The quasi-species model has been constructed in Refs. 6 and 7 using the concept of sequence space. Subsequently various methods have been invented to elucidate this concept and to relate it to the theory of critical phenomena 8-19. The instability of the quasi-species at the error threshold is discussed in Ref. 10. Evolution experiments with RNA strands in test tubes are described in Refs. 21 and 22.
Waldispühl, Jérôme; Ponty, Yann
2011-11-01
The analysis of the relationship between sequences and structures (i.e., how mutations affect structures and reciprocally how structures influence mutations) is essential to decipher the principles driving molecular evolution, to infer the origins of genetic diseases, and to develop bioengineering applications such as the design of artificial molecules. Because their structures can be predicted from the sequence data only, RNA molecules provide a good framework to study this sequence-structure relationship. We recently introduced a suite of algorithms called RNAmutants which allows a complete exploration of RNA sequence-structure maps in polynomial time and space. Formally, RNAmutants takes an input sequence (or seed) to compute the Boltzmann-weighted ensembles of mutants with exactly k mutations, and sample mutations from these ensembles. However, this approach suffers from major limitations. Indeed, since the Boltzmann probabilities of the mutations depend of the free energy of the structures, RNAmutants has difficulties to sample mutant sequences with low G+C-contents. In this article, we introduce an unbiased adaptive sampling algorithm that enables RNAmutants to sample regions of the mutational landscape poorly covered by classical algorithms. We applied these methods to sample mutations with low G+C-contents. These adaptive sampling techniques can be easily adapted to explore other regions of the sequence and structural landscapes which are difficult to sample. Importantly, these algorithms come at a minimal computational cost. We demonstrate the insights offered by these techniques on studies of complete RNA sequence structures maps of sizes up to 40 nucleotides. Our results indicate that the G+C-content has a strong influence on the size and shape of the evolutionary accessible sequence and structural spaces. In particular, we show that low G+C-contents favor the apparition of internal loops and thus possibly the synthesis of tertiary structure motifs. On the other hand, high G+C-contents significantly reduce the size of the evolutionary accessible mutational landscapes.
Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B
1993-09-25
To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.
Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors.
Haghverdi, Laleh; Lun, Aaron T L; Morgan, Michael D; Marioni, John C
2018-06-01
Large-scale single-cell RNA sequencing (scRNA-seq) data sets that are produced in different laboratories and at different times contain batch effects that may compromise the integration and interpretation of the data. Existing scRNA-seq analysis methods incorrectly assume that the composition of cell populations is either known or identical across batches. We present a strategy for batch correction based on the detection of mutual nearest neighbors (MNNs) in the high-dimensional expression space. Our approach does not rely on predefined or equal population compositions across batches; instead, it requires only that a subset of the population be shared between batches. We demonstrate the superiority of our approach compared with existing methods by using both simulated and real scRNA-seq data sets. Using multiple droplet-based scRNA-seq data sets, we demonstrate that our MNN batch-effect-correction method can be scaled to large numbers of cells.
MANGO: a new approach to multiple sequence alignment.
Zhang, Zefeng; Lin, Hao; Li, Ming
2007-01-01
Multiple sequence alignment is a classical and challenging task for biological sequence analysis. The problem is NP-hard. The full dynamic programming takes too much time. The progressive alignment heuristics adopted by most state of the art multiple sequence alignment programs suffer from the 'once a gap, always a gap' phenomenon. Is there a radically new way to do multiple sequence alignment? This paper introduces a novel and orthogonal multiple sequence alignment method, using multiple optimized spaced seeds and new algorithms to handle these seeds efficiently. Our new algorithm processes information of all sequences as a whole, avoiding problems caused by the popular progressive approaches. Because the optimized spaced seeds are provably significantly more sensitive than the consecutive k-mers, the new approach promises to be more accurate and reliable. To validate our new approach, we have implemented MANGO: Multiple Alignment with N Gapped Oligos. Experiments were carried out on large 16S RNA benchmarks showing that MANGO compares favorably, in both accuracy and speed, against state-of-art multiple sequence alignment methods, including ClustalW 1.83, MUSCLE 3.6, MAFFT 5.861, Prob-ConsRNA 1.11, Dialign 2.2.1, DIALIGN-T 0.2.1, T-Coffee 4.85, POA 2.0 and Kalign 2.0.
Computational biology of RNA interactions.
Dieterich, Christoph; Stadler, Peter F
2013-01-01
The biodiversity of the RNA world has been underestimated for decades. RNA molecules are key building blocks, sensors, and regulators of modern cells. The biological function of RNA molecules cannot be separated from their ability to bind to and interact with a wide space of chemical species, including small molecules, nucleic acids, and proteins. Computational chemists, physicists, and biologists have developed a rich tool set for modeling and predicting RNA interactions. These interactions are to some extent determined by the binding conformation of the RNA molecule. RNA binding conformations are approximated with often acceptable accuracy by sequence and secondary structure motifs. Secondary structure ensembles of a given RNA molecule can be efficiently computed in many relevant situations by employing a standard energy model for base pair interactions and dynamic programming techniques. The case of bi-molecular RNA-RNA interactions can be seen as an extension of this approach. However, unbiased transcriptome-wide scans for local RNA-RNA interactions are computationally challenging yet become efficient if the binding motif/mode is known and other external information can be used to confine the search space. Computational methods are less developed for proteins and small molecules, which bind to RNA with very high specificity. Binding descriptors of proteins are usually determined by in vitro high-throughput assays (e.g., microarrays or sequencing). Intriguingly, recent experimental advances, which are mostly based on light-induced cross-linking of binding partners, render in vivo binding patterns accessible yet require new computational methods for careful data interpretation. The grand challenge is to model the in vivo situation where a complex interplay of RNA binders competes for the same target RNA molecule. Evidently, bioinformaticians are just catching up with the impressive pace of these developments. Copyright © 2012 John Wiley & Sons, Ltd.
Structator: fast index-based search for RNA sequence-structure patterns
2011-01-01
Background The secondary structure of RNA molecules is intimately related to their function and often more conserved than the sequence. Hence, the important task of searching databases for RNAs requires to match sequence-structure patterns. Unfortunately, current tools for this task have, in the best case, a running time that is only linear in the size of sequence databases. Furthermore, established index data structures for fast sequence matching, like suffix trees or arrays, cannot benefit from the complementarity constraints introduced by the secondary structure of RNAs. Results We present a novel method and readily applicable software for time efficient matching of RNA sequence-structure patterns in sequence databases. Our approach is based on affix arrays, a recently introduced index data structure, preprocessed from the target database. Affix arrays support bidirectional pattern search, which is required for efficiently handling the structural constraints of the pattern. Structural patterns like stem-loops can be matched inside out, such that the loop region is matched first and then the pairing bases on the boundaries are matched consecutively. This allows to exploit base pairing information for search space reduction and leads to an expected running time that is sublinear in the size of the sequence database. The incorporation of a new chaining approach in the search of RNA sequence-structure patterns enables the description of molecules folding into complex secondary structures with multiple ordered patterns. The chaining approach removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our method runs up to two orders of magnitude faster than previous methods. Conclusions The presented method's sublinear expected running time makes it well suited for RNA sequence-structure pattern matching in large sequence databases. RNA molecules containing several stem-loop substructures can be described by multiple sequence-structure patterns and their matches are efficiently handled by a novel chaining method. Beyond our algorithmic contributions, we provide with Structator a complete and robust open-source software solution for index-based search of RNA sequence-structure patterns. The Structator software is available at http://www.zbh.uni-hamburg.de/Structator. PMID:21619640
Dean, Kimberly M; Grayhack, Elizabeth J
2012-12-01
We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.
RNA Bricks—a database of RNA 3D motifs and their interactions
Chojnowski, Grzegorz; Waleń, Tomasz; Bujnicki, Janusz M.
2014-01-01
The RNA Bricks database (http://iimcb.genesilico.pl/rnabricks), stores information about recurrent RNA 3D motifs and their interactions, found in experimentally determined RNA structures and in RNA–protein complexes. In contrast to other similar tools (RNA 3D Motif Atlas, RNA Frabase, Rloom) RNA motifs, i.e. ‘RNA bricks’ are presented in the molecular environment, in which they were determined, including RNA, protein, metal ions, water molecules and ligands. All nucleotide residues in RNA bricks are annotated with structural quality scores that describe real-space correlation coefficients with the electron density data (if available), backbone geometry and possible steric conflicts, which can be used to identify poorly modeled residues. The database is also equipped with an algorithm for 3D motif search and comparison. The algorithm compares spatial positions of backbone atoms of the user-provided query structure and of stored RNA motifs, without relying on sequence or secondary structure information. This enables the identification of local structural similarities among evolutionarily related and unrelated RNA molecules. Besides, the search utility enables searching ‘RNA bricks’ according to sequence similarity, and makes it possible to identify motifs with modified ribonucleotide residues at specific positions. PMID:24220091
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
NASA Technical Reports Server (NTRS)
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Sparse RNA folding revisited: space-efficient minimum free energy structure prediction.
Will, Sebastian; Jabbari, Hosna
2016-01-01
RNA secondary structure prediction by energy minimization is the central computational tool for the analysis of structural non-coding RNAs and their interactions. Sparsification has been successfully applied to improve the time efficiency of various structure prediction algorithms while guaranteeing the same result; however, for many such folding problems, space efficiency is of even greater concern, particularly for long RNA sequences. So far, space-efficient sparsified RNA folding with fold reconstruction was solved only for simple base-pair-based pseudo-energy models. Here, we revisit the problem of space-efficient free energy minimization. Whereas the space-efficient minimization of the free energy has been sketched before, the reconstruction of the optimum structure has not even been discussed. We show that this reconstruction is not possible in trivial extension of the method for simple energy models. Then, we present the time- and space-efficient sparsified free energy minimization algorithm SparseMFEFold that guarantees MFE structure prediction. In particular, this novel algorithm provides efficient fold reconstruction based on dynamically garbage-collected trace arrows. The complexity of our algorithm depends on two parameters, the number of candidates Z and the number of trace arrows T; both are bounded by [Formula: see text], but are typically much smaller. The time complexity of RNA folding is reduced from [Formula: see text] to [Formula: see text]; the space complexity, from [Formula: see text] to [Formula: see text]. Our empirical results show more than 80 % space savings over RNAfold [Vienna RNA package] on the long RNAs from the RNA STRAND database (≥2500 bases). The presented technique is intentionally generalizable to complex prediction algorithms; due to their high space demands, algorithms like pseudoknot prediction and RNA-RNA-interaction prediction are expected to profit even stronger than "standard" MFE folding. SparseMFEFold is free software, available at http://www.bioinf.uni-leipzig.de/~will/Software/SparseMFEFold.
Microbial survival in space shuttle crash
McLean, Robert J.C.; Welsh, Allana K.; Casasanto, Valerie A.
2011-01-01
A slow growing, heat resistant bacterium, identified by 16S rRNA gene sequencing as Microbispora sp., was recovered from the wreckage of the ill-fated space shuttle Columbia (STS-107). As this organism survived disintegration of the space craft, heat of reentry, and impact, it supports the possibility of a natural mechanism for the interplanetary spread of life by meteorites. PMID:21804644
Gene expression of rice seeds surviving 13- and 20-month exposure to space environment.
Sugimoto, Manabu; Oono, Youko; Kawahara, Yoshihiro; Gusev, Oleg; Maekawa, Masahiko; Matsumoto, Takashi; Levinskikh, Margarita; Sychev, Vladimir; Novikova, Natalia; Grigoriev, Anatoly
2016-11-01
Rice seeds were exposed outside of the international space station to assess the risk of space environment exposure on gene expression associated with seed germination. The germination percentages of the space-stored and ground-stored seeds exposed for 13 months were 48 and 96% respectively. Those for 20 months were 7 and 76%, respectively. Germination was defined 3 days after imbibition, except for the space-stored seeds exposed for 20 months, which germinated 5 days after imbibition. Subsequent RNA-seq analyses of the dry seeds, germinated seeds, and roots and shoots of seedlings revealed that the mutation rates of mRNA sequences were not significantly different between space-stored and ground-stored samples exposed for 13 months and 20 months. In all, 4 and 16 transcripts of glycolysis-related genes were increased in the germinated seeds after 13-month and 20-month exposure, respectively. Also, 2 and 39 transcripts of long-lived mRNA required for germination were decreased more than 2-fold in the dry seeds after 13-month and 20-month exposure, respectively. These results suggest that damage to long-lived mRNA in seeds by a space environment delays and reduces germination. Copyright © 2016 The Committee on Space Research (COSPAR). Published by Elsevier Ltd. All rights reserved.
Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight
NASA Astrophysics Data System (ADS)
Shi, Jinming
In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.
RNAblueprint: flexible multiple target nucleic acid sequence design.
Hammer, Stefan; Tschiatschek, Birgit; Flamm, Christoph; Hofacker, Ivo L; Findeiß, Sven
2017-09-15
Realizing the value of synthetic biology in biotechnology and medicine requires the design of molecules with specialized functions. Due to its close structure to function relationship, and the availability of good structure prediction methods and energy models, RNA is perfectly suited to be synthetically engineered with predefined properties. However, currently available RNA design tools cannot be easily adapted to accommodate new design specifications. Furthermore, complicated sampling and optimization methods are often developed to suit a specific RNA design goal, adding to their inflexibility. We developed a C ++ library implementing a graph coloring approach to stochastically sample sequences compatible with structural and sequence constraints from the typically very large solution space. The approach allows to specify and explore the solution space in a well defined way. Our library also guarantees uniform sampling, which makes optimization runs performant by not only avoiding re-evaluation of already found solutions, but also by raising the probability of finding better solutions for long optimization runs. We show that our software can be combined with any other software package to allow diverse RNA design applications. Scripting interfaces allow the easy adaption of existing code to accommodate new scenarios, making the whole design process very flexible. We implemented example design approaches written in Python to demonstrate these advantages. RNAblueprint , Python implementations and benchmark datasets are available at github: https://github.com/ViennaRNA . s.hammer@univie.ac.at, ivo@tbi.univie.ac.at or sven@tbi.univie.ac.at. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Tosar, Juan Pablo; Gámbaro, Fabiana; Sanguinetti, Julia; Bonilla, Braulio; Witwer, Kenneth W.; Cayota, Alfonso
2015-01-01
Intercellular communication can be mediated by extracellular small regulatory RNAs (sRNAs). Circulating sRNAs are being intensively studied for their promising use as minimally invasive disease biomarkers. To date, most attention is centered on exosomes and microRNAs as the vectors and the secreted species, respectively. However, this field would benefit from an increased understanding of the plethora of sRNAs secreted by different cell types in different extracellular fractions. It is still not clear if specific sRNAs are selected for secretion, or if sRNA secretion is mostly passive. We sequenced the intracellular sRNA content (19–60 nt) of breast epithelial cell lines (MCF-7 and MCF-10A) and compared it with extracellular fractions enriched in microvesicles, exosomes and ribonucleoprotein complexes. Our results are consistent with a non-selective secretion model for most microRNAs, although a few showed secretion patterns consistent with preferential secretion. On the contrary, 5′ tRNA halves and 5′ RNA Y4-derived fragments of 31–33 were greatly and significantly enriched in the extracellular space (even in non-mammary cell lines), where tRNA halves were detected as part of ∼45 kDa ribonucleoprotein complexes. Overall, we show that different sRNA families have characteristic secretion patterns and open the question of the role of these sRNAs in the extracellular space. PMID:25940616
Pair-barcode high-throughput sequencing for large-scale multiplexed sample analysis
2012-01-01
Background The multiplexing becomes the major limitation of the next-generation sequencing (NGS) in application to low complexity samples. Physical space segregation allows limited multiplexing, while the existing barcode approach only permits simultaneously analysis of up to several dozen samples. Results Here we introduce pair-barcode sequencing (PBS), an economic and flexible barcoding technique that permits parallel analysis of large-scale multiplexed samples. In two pilot runs using SOLiD sequencer (Applied Biosystems Inc.), 32 independent pair-barcoded miRNA libraries were simultaneously discovered by the combination of 4 unique forward barcodes and 8 unique reverse barcodes. Over 174,000,000 reads were generated and about 64% of them are assigned to both of the barcodes. After mapping all reads to pre-miRNAs in miRBase, different miRNA expression patterns are captured from the two clinical groups. The strong correlation using different barcode pairs and the high consistency of miRNA expression in two independent runs demonstrates that PBS approach is valid. Conclusions By employing PBS approach in NGS, large-scale multiplexed pooled samples could be practically analyzed in parallel so that high-throughput sequencing economically meets the requirements of samples which are low sequencing throughput demand. PMID:22276739
Pair-barcode high-throughput sequencing for large-scale multiplexed sample analysis.
Tu, Jing; Ge, Qinyu; Wang, Shengqin; Wang, Lei; Sun, Beili; Yang, Qi; Bai, Yunfei; Lu, Zuhong
2012-01-25
The multiplexing becomes the major limitation of the next-generation sequencing (NGS) in application to low complexity samples. Physical space segregation allows limited multiplexing, while the existing barcode approach only permits simultaneously analysis of up to several dozen samples. Here we introduce pair-barcode sequencing (PBS), an economic and flexible barcoding technique that permits parallel analysis of large-scale multiplexed samples. In two pilot runs using SOLiD sequencer (Applied Biosystems Inc.), 32 independent pair-barcoded miRNA libraries were simultaneously discovered by the combination of 4 unique forward barcodes and 8 unique reverse barcodes. Over 174,000,000 reads were generated and about 64% of them are assigned to both of the barcodes. After mapping all reads to pre-miRNAs in miRBase, different miRNA expression patterns are captured from the two clinical groups. The strong correlation using different barcode pairs and the high consistency of miRNA expression in two independent runs demonstrates that PBS approach is valid. By employing PBS approach in NGS, large-scale multiplexed pooled samples could be practically analyzed in parallel so that high-throughput sequencing economically meets the requirements of samples which are low sequencing throughput demand.
Reference genome sequence of the model plant Setaria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species thatmore » demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).« less
Reference genome sequence of the model plant Setaria.
Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M
2012-05-13
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
SimRNA: a coarse-grained method for RNA folding simulations and 3D structure prediction.
Boniecki, Michal J; Lach, Grzegorz; Dawson, Wayne K; Tomala, Konrad; Lukasz, Pawel; Soltysinski, Tomasz; Rother, Kristian M; Bujnicki, Janusz M
2016-04-20
RNA molecules play fundamental roles in cellular processes. Their function and interactions with other biomolecules are dependent on the ability to form complex three-dimensional (3D) structures. However, experimental determination of RNA 3D structures is laborious and challenging, and therefore, the majority of known RNAs remain structurally uncharacterized. Here, we present SimRNA: a new method for computational RNA 3D structure prediction, which uses a coarse-grained representation, relies on the Monte Carlo method for sampling the conformational space, and employs a statistical potential to approximate the energy and identify conformations that correspond to biologically relevant structures. SimRNA can fold RNA molecules using only sequence information, and, on established test sequences, it recapitulates secondary structure with high accuracy, including correct prediction of pseudoknots. For modeling of complex 3D structures, it can use additional restraints, derived from experimental or computational analyses, including information about secondary structure and/or long-range contacts. SimRNA also can be used to analyze conformational landscapes and identify potential alternative structures. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
Marré, Julia; Traver, Edward C.
2016-01-01
Experiences during the lifetime of an animal have been proposed to have consequences for subsequent generations. Although it is unclear how such intergenerational transfer of information occurs, RNAs found extracellularly in animals are candidate molecules that can transfer gene-specific regulatory information from one generation to the next because they can enter cells and regulate gene expression. In support of this idea, when double-stranded RNA (dsRNA) is introduced into some animals, the dsRNA can silence genes of matching sequence and the silencing can persist in progeny. Such persistent gene silencing is thought to result from sequence-specific interaction of the RNA within parents to generate chromatin modifications, DNA methylation, and/or secondary RNAs, which are then inherited by progeny. Here, we show that dsRNA can be directly transferred between generations in the worm Caenorhabditis elegans. Intergenerational transfer of dsRNA occurs even in animals that lack any DNA of matching sequence, and dsRNA that reaches progeny can spread between cells to cause gene silencing. Surprisingly, extracellular dsRNA can also reach progeny without entry into the cytosol, presumably within intracellular vesicles. Fluorescently labeled dsRNA is imported from extracellular space into oocytes along with yolk and accumulates in punctate structures within embryos. Subsequent entry into the cytosol of early embryos causes gene silencing in progeny. These results demonstrate the transport of extracellular RNA from one generation to the next to regulate gene expression in an animal and thus suggest a mechanism for the transmission of experience-dependent effects between generations. PMID:27791108
Extraordinary Structured Noncoding RNAs Revealed by Bacterial Metagenome Analysis
Weinberg, Zasha; Perreault, Jonathan; Meyer, Michelle M.; Breaker, Ronald R.
2012-01-01
Estimates of the total number of bacterial species1-3 suggest that existing DNA sequence databases carry only a tiny fraction of the total amount of DNA sequence space represented by this division of life. Indeed, environmental DNA samples have been shown to encode many previously unknown classes of proteins4 and RNAs5. Bioinformatics searches6-10 of genomic DNA from bacteria commonly identify novel noncoding RNAs (ncRNAs)10-12 such as riboswitches13,14. In rare instances, RNAs that exhibit more extensive sequence and structural conservation across a wide range of bacteria are encountered15,16. Given that large structured RNAs are known to carry out complex biochemical functions such as protein synthesis and RNA processing reactions, identifying more RNAs of great size and intricate structure is likely to reveal additional biochemical functions that can be achieved by RNA. We applied an updated computational pipeline17 to discover ncRNAs that rival the known large ribozymes in size and structural complexity or that are among the most abundant RNAs in bacteria that encode them. These RNAs would have been difficult or impossible to detect without examining environmental DNA sequences, suggesting that numerous RNAs with extraordinary size, structural complexity, or other exceptional characteristics remain to be discovered in unexplored sequence space. PMID:19956260
The complete mitochondrial genome of Chrysopa pallens (Insecta, Neuroptera, Chrysopidae).
He, Kun; Chen, Zhe; Yu, Dan-Na; Zhang, Jia-Yong
2012-10-01
The complete mitochondrial genome of Chrysopa pallens (Neuroptera, Chrysopidae) was sequenced. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA (rRNA) genes, and a control region (AT-rich region). The total length of C. pallens mitogenome is 16,723 bp with 79.5% AT content, and the length of control region is 1905 bp with 89.1% AT content. The non-coding regions of C. pallens include control region between 12S rRNA and trnI genes, and a 75-bp space region between trnI and trnQ genes.
Evolutionary optimization of biopolymers and sequence structure maps
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reidys, C.M.; Kopp, S.; Schuster, P.
1996-06-01
Searching for biopolymers having a predefined function is a core problem of biotechnology, biochemistry and pharmacy. On the level of RNA sequences and their corresponding secondary structures we show that this problem can be analyzed mathematically. The strategy will be to study the properties of the RNA sequence to secondary structure mapping that is essential for the understanding of the search process. We show that to each secondary structure s there exists a neutral network consisting of all sequences folding into s. This network can be modeled as a random graph and has the following generic properties: it is densemore » and has a giant component within the graph of compatible sequences. The neutral network percolates sequence space and any two neutral nets come close in terms of Hamming distance. We investigate the distribution of the orders of neutral nets and show that above a certain threshold the topology of neutral nets allows to find practically all frequent secondary structures.« less
Distribution of genotype network sizes in sequence-to-structure genotype-phenotype maps.
Manrubia, Susanna; Cuesta, José A
2017-04-01
An essential quantity to ensure evolvability of populations is the navigability of the genotype space. Navigability, understood as the ease with which alternative phenotypes are reached, relies on the existence of sufficiently large and mutually attainable genotype networks. The size of genotype networks (e.g. the number of RNA sequences folding into a particular secondary structure or the number of DNA sequences coding for the same protein structure) is astronomically large in all functional molecules investigated: an exhaustive experimental or computational study of all RNA folds or all protein structures becomes impossible even for moderately long sequences. Here, we analytically derive the distribution of genotype network sizes for a hierarchy of models which successively incorporate features of increasingly realistic sequence-to-structure genotype-phenotype maps. The main feature of these models relies on the characterization of each phenotype through a prototypical sequence whose sites admit a variable fraction of letters of the alphabet. Our models interpolate between two limit distributions: a power-law distribution, when the ordering of sites in the prototypical sequence is strongly constrained, and a lognormal distribution, as suggested for RNA, when different orderings of the same set of sites yield different phenotypes. Our main result is the qualitative and quantitative identification of those features of sequence-to-structure maps that lead to different distributions of genotype network sizes. © 2017 The Author(s).
Dalmay, Tamas
2018-01-01
RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379
Loher, Phillipe; Telonis, Aristeidis G.; Rigoutsos, Isidore
2017-01-01
Transfer RNA fragments (tRFs) are an established class of constitutive regulatory molecules that arise from precursor and mature tRNAs. RNA deep sequencing (RNA-seq) has greatly facilitated the study of tRFs. However, the repeat nature of the tRNA templates and the idiosyncrasies of tRNA sequences necessitate the development and use of methodologies that differ markedly from those used to analyze RNA-seq data when studying microRNAs (miRNAs) or messenger RNAs (mRNAs). Here we present MINTmap (for MItochondrial and Nuclear TRF mapping), a method and a software package that was developed specifically for the quick, deterministic and exhaustive identification of tRFs in short RNA-seq datasets. In addition to identifying them, MINTmap is able to unambiguously calculate and report both raw and normalized abundances for the discovered tRFs. Furthermore, to ensure specificity, MINTmap identifies the subset of discovered tRFs that could be originating outside of tRNA space and flags them as candidate false positives. Our comparative analysis shows that MINTmap exhibits superior sensitivity and specificity to other available methods while also being exceptionally fast. The MINTmap codes are available through https://github.com/TJU-CMC-Org/MINTmap/ under an open source GNU GPL v3.0 license. PMID:28220888
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bennetzen, Jeffrey L; Yang, Xiaohan; Ye, Chuyu
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species thatmore » demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).« less
Helmling, Christina; Wacker, Anna; Wolfinger, Michael T; Hofacker, Ivo L; Hengesbach, Martin; Fürtig, Boris; Schwalbe, Harald
2017-02-22
Gene repression induced by the formation of transcriptional terminators represents a prime example for the coupling of RNA synthesis, folding, and regulation. In this context, mapping the changes in available conformational space of transcription intermediates during RNA synthesis is important to understand riboswitch function. A majority of riboswitches, an important class of small metabolite-sensing regulatory RNAs, act as transcriptional regulators, but the dependence of ligand binding and the subsequent allosteric conformational switch on mRNA transcript length has not yet been investigated. We show a strict fine-tuning of binding and sequence-dependent alterations of conformational space by structural analysis of all relevant transcription intermediates at single-nucleotide resolution for the I-A type 2'dG-sensing riboswitch from Mesoplasma florum by NMR spectroscopy. Our results provide a general framework to dissect the coupling of synthesis and folding essential for riboswitch function, revealing the importance of metastable states for RNA-based gene regulation.
SimRNAweb: a web server for RNA 3D structure modeling with optional restraints.
Magnus, Marcin; Boniecki, Michał J; Dawson, Wayne; Bujnicki, Janusz M
2016-07-08
RNA function in many biological processes depends on the formation of three-dimensional (3D) structures. However, RNA structure is difficult to determine experimentally, which has prompted the development of predictive computational methods. Here, we introduce a user-friendly online interface for modeling RNA 3D structures using SimRNA, a method that uses a coarse-grained representation of RNA molecules, utilizes the Monte Carlo method to sample the conformational space, and relies on a statistical potential to describe the interactions in the folding process. SimRNAweb makes SimRNA accessible to users who do not normally use high performance computational facilities or are unfamiliar with using the command line tools. The simplest input consists of an RNA sequence to fold RNA de novo. Alternatively, a user can provide a 3D structure in the PDB format, for instance a preliminary model built with some other technique, to jump-start the modeling close to the expected final outcome. The user can optionally provide secondary structure and distance restraints, and can freeze a part of the starting 3D structure. SimRNAweb can be used to model single RNA sequences and RNA-RNA complexes (up to 52 chains). The webserver is available at http://genesilico.pl/SimRNAweb. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Cassandra retrotransposons carry independently transcribed 5S RNA
Kalendar, Ruslan; Tanskanen, Jaakko; Chang, Wei; Antonius, Kristiina; Sela, Hanan; Peleg, Ofer; Schulman, Alan H.
2008-01-01
We report a group of TRIMs (terminal-repeat retrotransposons in miniature), which are small nonautonomous retrotransposons. These elements, named Cassandra, universally carry conserved 5S RNA sequences and associated RNA polymerase (pol) III promoters and terminators in their long terminal repeats (LTRs). They were found in all vascular plants investigated. Uniquely for LTR retrotransposons, Cassandra produces noncapped, polyadenylated transcripts from the 5S pol III promoter. Capped, read-through transcripts containing Cassandra sequences can also be detected in RNA and in EST databases. The predicted Cassandra RNA 5S secondary structures resemble those for cellular 5S rRNA, with high information content specifically in the pol III promoter region. Genic integration sites are common for Cassandra, an unusual feature for abundant retrotransposons. The 5S in each LTR produces a tandem 5S arrangement with an inter-5S spacing resembling that of cellular 5S. The distribution of 5S genes is very variable in flowering plants and may be partially explained by Cassandra activity. Cassandra thus appears both to have adapted a ubiquitous cellular gene for ribosomal RNA for use as a promoter and to parasitize an as-yet-unidentified group of retrotransposons for the proteins needed in its lifecycle. PMID:18408163
PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction
Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.
2008-01-01
A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945
Detection of microRNAs in color space.
Marco, Antonio; Griffiths-Jones, Sam
2012-02-01
Deep sequencing provides inexpensive opportunities to characterize the transcriptional diversity of known genomes. The AB SOLiD technology generates millions of short sequencing reads in color-space; that is, the raw data is a sequence of colors, where each color represents 2 nt and each nucleotide is represented by two consecutive colors. This strategy is purported to have several advantages, including increased ability to distinguish sequencing errors from polymorphisms. Several programs have been developed to map short reads to genomes in color space. However, a number of previously unexplored technical issues arise when using SOLiD technology to characterize microRNAs. Here we explore these technical difficulties. First, since the sequenced reads are longer than the biological sequences, every read is expected to contain linker fragments. The color-calling error rate increases toward the 3(') end of the read such that recognizing the linker sequence for removal becomes problematic. Second, mapping in color space may lead to the loss of the first nucleotide of each read. We propose a sequential trimming and mapping approach to map small RNAs. Using our strategy, we reanalyze three published insect small RNA deep sequencing datasets and characterize 22 new microRNAs. A bash shell script to perform the sequential trimming and mapping procedure, called SeqTrimMap, is available at: http://www.mirbase.org/tools/seqtrimmap/ antonio.marco@manchester.ac.uk Supplementary data are available at Bioinformatics online.
Klauser, Benedikt; Atanasov, Janina; Siewert, Lena K; Hartig, Jörg S
2015-05-15
Systems for conditional gene expression are powerful tools in basic research as well as in biotechnology. For future applications, it is of great importance to engineer orthogonal genetic switches that function reliably in diverse contexts. RNA-based switches have the advantage that effector molecules interact immediately with regulatory modules inserted into the target RNAs, getting rid of the need of transcription factors usually mediating genetic control. Artificial riboswitches are characterized by their simplicity and small size accompanied by a high degree of modularity. We have recently reported a series of hammerhead ribozyme-based artificial riboswitches that allow for post-transcriptional regulation of gene expression via switching mRNA, tRNA, or rRNA functions. A more widespread application was so far hampered by moderate switching performances and a limited set of effector molecules available. Here, we report the re-engineering of hammerhead ribozymes in order to respond efficiently to aminoglycoside antibiotics. We first established an in vivo selection protocol in Saccharomyces cerevisiae that enabled us to search large sequence spaces for optimized switches. We then envisioned and characterized a novel strategy of attaching the aptamer to the ribozyme catalytic core, increasing the design options for rendering the ribozyme ligand-dependent. These innovations enabled the development of neomycin-dependent RNA modules that switch gene expression up to 25-fold. The presented aminoglycoside-responsive riboswitches belong to the best-performing RNA-based genetic regulators reported so far. The developed in vivo selection protocol should allow for sampling of large sequence spaces for engineering of further optimized riboswitches.
Simplified Identification of mRNA or DNA in Whole Cells
NASA Technical Reports Server (NTRS)
Almeida, Eduardo; Kadambi, Geeta
2007-01-01
A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.
RAG-3D: A search tool for RNA 3D substructures
Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef; ...
2015-08-24
In this study, to address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally describedmore » in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding.« less
RAG-3D: a search tool for RNA 3D substructures
Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef; Schlick, Tamar
2015-01-01
To address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally described in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding. PMID:26304547
RAG-3D: A search tool for RNA 3D substructures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef
In this study, to address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally describedmore » in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding.« less
Systematic Evaluation of the Dependence of Deoxyribozyme Catalysis on Random Region Length
Velez, Tania E.; Singh, Jaydeep; Xiao, Ying; Allen, Emily C.; Wong, On Yi; Chandra, Madhavaiah; Kwon, Sarah C.; Silverman, Scott K.
2012-01-01
Functional nucleic acids are DNA and RNA aptamers that bind targets, or they are deoxyribozymes and ribozymes that have catalytic activity. These functional DNA and RNA sequences can be identified from random-sequence pools by in vitro selection, which requires choosing the length of the random region. Shorter random regions allow more complete coverage of sequence space but may not permit the structural complexity necessary for binding or catalysis. In contrast, longer random regions are sampled incompletely but may allow adoption of more complicated structures that enable function. In this study, we systematically examined random region length (N20 through N60) for two particular deoxyribozyme catalytic activities, DNA cleavage and tyrosine-RNA nucleopeptide linkage formation. For both activities, we previously identified deoxyribozymes using only N40 regions. In the case of DNA cleavage, here we found that shorter N20 and N30 regions allowed robust catalytic function, either by DNA hydrolysis or by DNA deglycosylation and strand scission via β-elimination, whereas longer N50 and N60 regions did not lead to catalytically active DNA sequences. Follow-up selections with N20, N30, and N40 regions revealed an interesting interplay of metal ion cofactors and random region length. Separately, for Tyr-RNA linkage formation, N30 and N60 regions provided catalytically active sequences, whereas N20 was unsuccessful, and the N40 deoxyribozymes were functionally superior (in terms of rate and yield) to N30 and N60. Collectively, the results indicate that with future in vitro selection experiments for DNA and RNA catalysts, and by extension for aptamers, random region length should be an important experimental variable. PMID:23088677
Velagapudi, Sai Pradeep; Disney, Matthew D
2013-10-15
RNA is an extremely important target for the development of chemical probes of function or small molecule therapeutics. Aminoglycosides are the most well studied class of small molecules to target RNA. However, the RNA motifs outside of the bacterial rRNA A-site that are likely to be bound by these compounds in biological systems is largely unknown. If such information were known, it could allow for aminoglycosides to be exploited to target other RNAs and, in addition, could provide invaluable insights into potential bystander targets of these clinically used drugs. We utilized two-dimensional combinatorial screening (2DCS), a library-versus-library screening approach, to select the motifs displayed in a 3×3 nucleotide internal loop library and in a 6-nucleotide hairpin library that bind with high affinity and selectivity to six aminoglycoside derivatives. The selected RNA motifs were then analyzed using structure-activity relationships through sequencing (StARTS), a statistical approach that defines the privileged RNA motif space that binds a small molecule. StARTS allowed for the facile annotation of the selected RNA motif-aminoglycoside interactions in terms of affinity and selectivity. The interactions selected by 2DCS generally have nanomolar affinities, which is higher affinity than the binding of aminoglycosides to a mimic of their therapeutic target, the bacterial rRNA A-site. Copyright © 2013 Elsevier Ltd. All rights reserved.
Velagapudi, Sai Pradeep; Disney, Matthew D.
2013-01-01
RNA is an extremely important target for the development of chemical probes of function or small molecule therapeutics. Aminoglycosides are the most well studied class of small molecules to target RNA. However, the RNA motifs outside of the bacterial rRNA A-site that are likely to be bound by these compounds in biological systems is largely unknown. If such information were known, it could allow for aminoglycosides to be exploited to target other RNAs and, in addition, could provide invaluable insights into potential bystander targets of these clinically used drugs. We utilized two-dimensional combinatorial screening (2DCS), a library-versus-library screening approach, to select the motifs displayed in a 3 × 3 nucleotide internal loop library and in a 6-nucleotide hairpin library that bind with high affinity and selectivity to six aminoglycoside derivatives. The selected RNA motifs were then analyzed using structure–activity relationships through sequencing (StARTS), a statistical approach that defines the privileged RNA motif space that binds a small molecule. StARTS allowed for the facile annotation of the selected RNA motif–aminoglycoside interactions in terms of affinity and selectivity. The interactions selected by 2DCS generally have nanomolar affinities, which is higher affinity than the binding of aminoglycosides to a mimic of their therapeutic target, the bacterial rRNA A-site. PMID:23719281
Mantis: A Fast, Small, and Exact Large-Scale Sequence-Search Index.
Pandey, Prashant; Almodaresi, Fatemeh; Bender, Michael A; Ferdman, Michael; Johnson, Rob; Patro, Rob
2018-06-18
Sequence-level searches on large collections of RNA sequencing experiments, such as the NCBI Sequence Read Archive (SRA), would enable one to ask many questions about the expression or variation of a given transcript in a population. Existing approaches, such as the sequence Bloom tree, suffer from fundamental limitations of the Bloom filter, resulting in slow build and query times, less-than-optimal space usage, and potentially large numbers of false-positives. This paper introduces Mantis, a space-efficient system that uses new data structures to index thousands of raw-read experiments and facilitates large-scale sequence searches. In our evaluation, index construction with Mantis is 6× faster and yields a 20% smaller index than the state-of-the-art split sequence Bloom tree (SSBT). For queries, Mantis is 6-108× faster than SSBT and has no false-positives or -negatives. For example, Mantis was able to search for all 200,400 known human transcripts in an index of 2,652 RNA sequencing experiments in 82 min; SSBT took close to 4 days. Copyright © 2018 Elsevier Inc. All rights reserved.
Thermodynamic Basis for the Emergence of Genomes during Prebiotic Evolution
Woo, Hyung-June; Vijaya Satya, Ravi; Reifman, Jaques
2012-01-01
The RNA world hypothesis views modern organisms as descendants of RNA molecules. The earliest RNA molecules must have been random sequences, from which the first genomes that coded for polymerase ribozymes emerged. The quasispecies theory by Eigen predicts the existence of an error threshold limiting genomic stability during such transitions, but does not address the spontaneity of changes. Following a recent theoretical approach, we applied the quasispecies theory combined with kinetic/thermodynamic descriptions of RNA replication to analyze the collective behavior of RNA replicators based on known experimental kinetics data. We find that, with increasing fidelity (relative rate of base-extension for Watson-Crick versus mismatched base pairs), replications without enzymes, with ribozymes, and with protein-based polymerases are above, near, and below a critical point, respectively. The prebiotic evolution therefore must have crossed this critical region. Over large regions of the phase diagram, fitness increases with increasing fidelity, biasing random drifts in sequence space toward ‘crystallization.’ This region encloses the experimental nonenzymatic fidelity value, favoring evolutions toward polymerase sequences with ever higher fidelity, despite error rates above the error catastrophe threshold. Our work shows that experimentally characterized kinetics and thermodynamics of RNA replication allow us to determine the physicochemical conditions required for the spontaneous crystallization of biological information. Our findings also suggest that among many potential oligomers capable of templated replication, RNAs may have evolved to form prebiotic genomes due to the value of their nonenzymatic fidelity. PMID:22693440
Cladaras, C; Hadzopoulou-Cladaras, M; Nolte, R T; Atkinson, D; Zannis, V I
1986-01-01
We have isolated and sequenced overlapping cDNA clones covering the entire sequence of human apolipoprotein B-100 (apoB-100). DNA sequence analysis and determination of the mRNA transcription initiation site by S1 nuclease mapping showed that the apoB mRNA consists of 14,112 nucleotides including the 5' and 3' untranslated regions which are 128 and 301 nucleotides respectively. The DNA-derived protein sequence shows that apoB-100 is 513,000 daltons and contains 4560 amino acids including a 24-amino-acid-long signal peptide. The mol. wt of apoB-100 implies that there is one apoB molecule per LDL particle. Computer analysis of the predicted secondary structure of the protein showed that some of the potential alpha helical and beta sheet structures are amphipathic, whereas others have non-amphipathic neutral to apolar character. These latter regions may contribute to the formation of the lipid-binding domains of apoB-100. The protein contains 25 cysteines and 20 potential N-glycosylation sites. The majority of cysteines are distributed in the amino terminal portion of the protein. Four of the potential glycosylation sites are in predicted beta turn structures and may represent true glycosylation positions. ApoB lacks the tandem repeats which are characteristic of other apolipoproteins. The mean hydrophobicity the mean value of H1 and helical hydrophobic moment the mean value of microH profiles of apoB showed the presence of several potential helical regions with strong polar character and high hydrophobic moment. The region with the highest hydrophobic moment, between amino acid residues 3352 and 3369, contains five closely spaced, positively charged residues, and has sequence homology to the LDL receptor binding site of apoE. This region is flanked by three neighbouring regions with positively charged amino acids and high hydrophobic moment that are located between residues 3174 and 3681. One or more of these closely spaced apoB sequences may be involved in the formation of the LDL receptor-binding domain of apoB-100. Blotting analysis of intestinal RNA and hybridization of the blots with carboxy apoB cDNA probes produced a single 15-kb hybridization band whereas hybridization with amino terminal probes produced two hybridization bands of 15 and 8 kb. Our data indicate that both forms of apoB mRNA contain common sequences which extend from the amino terminal of apoB-100 to the vicinity of nucleotide residue 6300. These two messages may have resulted from differential splicing of the same primary apoB mRNA transcript. Images Fig. 4. Fig. 6. PMID:3030729
Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.
Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu
2017-11-10
The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.
Mango: multiple alignment with N gapped oligos.
Zhang, Zefeng; Lin, Hao; Li, Ming
2008-06-01
Multiple sequence alignment is a classical and challenging task. The problem is NP-hard. The full dynamic programming takes too much time. The progressive alignment heuristics adopted by most state-of-the-art works suffer from the "once a gap, always a gap" phenomenon. Is there a radically new way to do multiple sequence alignment? In this paper, we introduce a novel and orthogonal multiple sequence alignment method, using both multiple optimized spaced seeds and new algorithms to handle these seeds efficiently. Our new algorithm processes information of all sequences as a whole and tries to build the alignment vertically, avoiding problems caused by the popular progressive approaches. Because the optimized spaced seeds have proved significantly more sensitive than the consecutive k-mers, the new approach promises to be more accurate and reliable. To validate our new approach, we have implemented MANGO: Multiple Alignment with N Gapped Oligos. Experiments were carried out on large 16S RNA benchmarks, showing that MANGO compares favorably, in both accuracy and speed, against state-of-the-art multiple sequence alignment methods, including ClustalW 1.83, MUSCLE 3.6, MAFFT 5.861, ProbConsRNA 1.11, Dialign 2.2.1, DIALIGN-T 0.2.1, T-Coffee 4.85, POA 2.0, and Kalign 2.0. We have further demonstrated the scalability of MANGO on very large datasets of repeat elements. MANGO can be downloaded at http://www.bioinfo.org.cn/mango/ and is free for academic usage.
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
Reeder, Jens; Giegerich, Robert
2004-01-01
Background The general problem of RNA secondary structure prediction under the widely used thermodynamic model is known to be NP-complete when the structures considered include arbitrary pseudoknots. For restricted classes of pseudoknots, several polynomial time algorithms have been designed, where the O(n6)time and O(n4) space algorithm by Rivas and Eddy is currently the best available program. Results We introduce the class of canonical simple recursive pseudoknots and present an algorithm that requires O(n4) time and O(n2) space to predict the energetically optimal structure of an RNA sequence, possible containing such pseudoknots. Evaluation against a large collection of known pseudoknotted structures shows the adequacy of the canonization approach and our algorithm. Conclusions RNA pseudoknots of medium size can now be predicted reliably as well as efficiently by the new algorithm. PMID:15294028
Accurate Classification of RNA Structures Using Topological Fingerprints
Li, Kejie; Gribskov, Michael
2016-01-01
While RNAs are well known to possess complex structures, functionally similar RNAs often have little sequence similarity. While the exact size and spacing of base-paired regions vary, functionally similar RNAs have pronounced similarity in the arrangement, or topology, of base-paired stems. Furthermore, predicted RNA structures often lack pseudoknots (a crucial aspect of biological activity), and are only partially correct, or incomplete. A topological approach addresses all of these difficulties. In this work we describe each RNA structure as a graph that can be converted to a topological spectrum (RNA fingerprint). The set of subgraphs in an RNA structure, its RNA fingerprint, can be compared with the fingerprints of other RNA structures to identify and correctly classify functionally related RNAs. Topologically similar RNAs can be identified even when a large fraction, up to 30%, of the stems are omitted, indicating that highly accurate structures are not necessary. We investigate the performance of the RNA fingerprint approach on a set of eight highly curated RNA families, with diverse sizes and functions, containing pseudoknots, and with little sequence similarity–an especially difficult test set. In spite of the difficult test set, the RNA fingerprint approach is very successful (ROC AUC > 0.95). Due to the inclusion of pseudoknots, the RNA fingerprint approach both covers a wider range of possible structures than methods based only on secondary structure, and its tolerance for incomplete structures suggests that it can be applied even to predicted structures. Source code is freely available at https://github.rcac.purdue.edu/mgribsko/XIOS_RNA_fingerprint. PMID:27755571
Jaeckisch, Nina; Yang, Ines; Wohlrab, Sylke; Glöckner, Gernot; Kroymann, Juergen; Vogel, Heiko; Cembella, Allan; John, Uwe
2011-01-01
Many dinoflagellate species are notorious for the toxins they produce and ecological and human health consequences associated with harmful algal blooms (HABs). Dinoflagellates are particularly refractory to genomic analysis due to the enormous genome size, lack of knowledge about their DNA composition and structure, and peculiarities of gene regulation, such as spliced leader (SL) trans-splicing and mRNA transposition mechanisms. Alexandrium ostenfeldii is known to produce macrocyclic imine toxins, described as spirolides. We characterized the genome of A. ostenfeldii using a combination of transcriptomic data and random genomic clones for comparison with other dinoflagellates, particularly Alexandrium species. Examination of SL sequences revealed similar features as in other dinoflagellates, including Alexandrium species. SL sequences in decay indicate frequent retro-transposition of mRNA species. This probably contributes to overall genome complexity by generating additional gene copies. Sequencing of several thousand fosmid and bacterial artificial chromosome (BAC) ends yielded a wealth of simple repeats and tandemly repeated longer sequence stretches which we estimated to comprise more than half of the whole genome. Surprisingly, the repeats comprise a very limited set of 79–97 bp sequences; in part the genome is thus a relatively uniform sequence space interrupted by coding sequences. Our genomic sequence survey (GSS) represents the largest genomic data set of a dinoflagellate to date. Alexandrium ostenfeldii is a typical dinoflagellate with respect to its transcriptome and mRNA transposition but demonstrates Alexandrium-like stop codon usage. The large portion of repetitive sequences and the organization within the genome is in agreement with several other studies on dinoflagellates using different approaches. It remains to be determined whether this unusual composition is directly correlated to the exceptionally genome organization of dinoflagellates with a low amount of histones and histone-like proteins. PMID:22164224
Mechanisms for RNA capture by ssDNA viruses: grand theft RNA.
Stedman, Kenneth
2013-06-01
Viruses contain three common types of packaged genomes; double-stranded DNA (dsDNA), RNA (mostly single and occasionally double stranded) and single-stranded DNA (ssDNA). There are relatively straightforward explanations for the prevalence of viruses with dsDNA and RNA genomes, but the evolutionary basis for the apparent success of ssDNA viruses is less clear. The recent discovery of four ssDNA virus genomes that appear to have been formed by recombination between co-infecting RNA and ssDNA viruses, together with the high mutation rate of ssDNA viruses provide possible explanations. RNA-DNA recombination allows ssDNA viruses to access much broader sequence space than through nucleotide substitution and DNA-DNA recombination alone. Multiple non-exclusive mechanisms, all due to the unique replication of ssDNA viruses, are proposed for this unusual RNA capture. RNA capture provides an explanation for the evolutionary success of the ssDNA viruses and may help elucidate the mystery of integrated RNA viruses in viral and cellular DNA genomes.
Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W
1993-12-01
Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.
Richardson, Aaron O; Rice, Danny W; Young, Gregory J; Alverson, Andrew J; Palmer, Jeffrey D
2013-04-15
The mitochondrial genomes of flowering plants vary greatly in size, gene content, gene order, mutation rate and level of RNA editing. However, the narrow phylogenetic breadth of available genomic data has limited our ability to reconstruct these traits in the ancestral flowering plant and, therefore, to infer subsequent patterns of evolution across angiosperms. We sequenced the mitochondrial genome of Liriodendron tulipifera, the first from outside the monocots or eudicots. This 553,721 bp mitochondrial genome has evolved remarkably slowly in virtually all respects, with an extraordinarily low genome-wide silent substitution rate, retention of genes frequently lost in other angiosperm lineages, and conservation of ancestral gene clusters. The mitochondrial protein genes in Liriodendron are the most heavily edited of any angiosperm characterized to date. Most of these sites are also edited in various other lineages, which allowed us to polarize losses of editing sites in other parts of the angiosperm phylogeny. Finally, we added comprehensive gene sequence data for two other magnoliids, Magnolia stellata and the more distantly related Calycanthus floridus, to measure rates of sequence evolution in Liriodendron with greater accuracy. The Magnolia genome has evolved at an even lower rate, revealing a roughly 5,000-fold range of synonymous-site divergence among angiosperms whose mitochondrial gene space has been comprehensively sequenced. Using Liriodendron as a guide, we estimate that the ancestral flowering plant mitochondrial genome contained 41 protein genes, 14 tRNA genes of mitochondrial origin, as many as 7 tRNA genes of chloroplast origin, >700 sites of RNA editing, and some 14 colinear gene clusters. Many of these gene clusters, genes and RNA editing sites have been variously lost in different lineages over the course of the ensuing ∽200 million years of angiosperm evolution.
Georgiev, O; Birnstiel, M L
1985-01-01
Analysis of cDNA sequences obtained from the small nuclear RNA U7 has previously suggested specific contacts, by base pairing, between the conserved stem-loop structure and CAAGAAAGA sequence of the histone pre-mRNA and the 5'-terminal sequence of the U7 RNA during RNA processing. In order to test some aspects of the model we have created a series of linker scan, deletion and insertion mutants of the 3' terminus of a sea urchin H3 histone gene and have injected mutant DNAs or in vitro synthesized precursors into frog oocyte nuclei for interpretation. We find that, in addition to the stem-loop structure of the mRNA, the CAAGAAAGA spacer transcript within the histone pre-mRNA is required absolutely for RNA processing, as predicted from our model. Spacer sequences immediately downstream of the CAAGAAAGA motif are not complementary to U7 RNA. Nevertheless, they are necessary for obtaining a maximal rate of RNA processing, as is the ACCA sequence coding for the 3' terminus of the mature mRNA. An increase of distance between the mRNA palindrome and the CAAGAAAGA by as little as six nucleotides abolishes all processing. It may, therefore, be useful to regard both these sequence motifs as part of one and the same RNA processing signal with narrowly defined topologies. Interestingly, U7 RNA-dependent 3' processing of histone pre-mRNA can occur in RNA injection experiments only when the in vitro synthesized pre-mRNA contains sequence extensions well beyond the region of sequence complementarities to the U7 RNA. In addition to directing 3' processing the terminal mRNA sequences may have a role in histone mRNA stabilization in the cytoplasmic compartment. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2410259
Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish
USDA-ARS?s Scientific Manuscript database
RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...
antaRNA: ant colony-based RNA sequence design.
Kleinkauf, Robert; Mann, Martin; Backofen, Rolf
2015-10-01
RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Wickersheim, Michelle L; Blumenstiel, Justin P
2013-11-01
A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.
Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.
Makeyev, E V; Bamford, D H
2001-05-01
Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.
SPAR: small RNA-seq portal for analysis of sequencing experiments.
Kuksa, Pavel P; Amlie-Wolf, Alexandre; Katanic, Živadin; Valladares, Otto; Wang, Li-San; Leung, Yuk Yee
2018-05-04
The introduction of new high-throughput small RNA sequencing protocols that generate large-scale genomics datasets along with increasing evidence of the significant regulatory roles of small non-coding RNAs (sncRNAs) have highlighted the urgent need for tools to analyze and interpret large amounts of small RNA sequencing data. However, it remains challenging to systematically and comprehensively discover and characterize sncRNA genes and specifically-processed sncRNA products from these datasets. To fill this gap, we present Small RNA-seq Portal for Analysis of sequencing expeRiments (SPAR), a user-friendly web server for interactive processing, analysis, annotation and visualization of small RNA sequencing data. SPAR supports sequencing data generated from various experimental protocols, including smRNA-seq, short total RNA sequencing, microRNA-seq, and single-cell small RNA-seq. Additionally, SPAR includes publicly available reference sncRNA datasets from our DASHR database and from ENCODE across 185 human tissues and cell types to produce highly informative small RNA annotations across all major small RNA types and other features such as co-localization with various genomic features, precursor transcript cleavage patterns, and conservation. SPAR allows the user to compare the input experiment against reference ENCODE/DASHR datasets. SPAR currently supports analyses of human (hg19, hg38) and mouse (mm10) sequencing data. SPAR is freely available at https://www.lisanwanglab.org/SPAR.
Fujimori, Shigeo; Hirai, Naoya; Ohashi, Hiroyuki; Masuoka, Kazuyo; Nishikimi, Akihiko; Fukui, Yoshinori; Washio, Takanori; Oshikubo, Tomohiro; Yamashita, Tatsuhiro; Miyamoto-Sato, Etsuko
2012-01-01
Next-generation sequencing (NGS) has been applied to various kinds of omics studies, resulting in many biological and medical discoveries. However, high-throughput protein-protein interactome datasets derived from detection by sequencing are scarce, because protein-protein interaction analysis requires many cell manipulations to examine the interactions. The low reliability of the high-throughput data is also a problem. Here, we describe a cell-free display technology combined with NGS that can improve both the coverage and reliability of interactome datasets. The completely cell-free method gives a high-throughput and a large detection space, testing the interactions without using clones. The quantitative information provided by NGS reduces the number of false positives. The method is suitable for the in vitro detection of proteins that interact not only with the bait protein, but also with DNA, RNA and chemical compounds. Thus, it could become a universal approach for exploring the large space of protein sequences and interactome networks. PMID:23056904
Accurate multiple sequence-structure alignment of RNA sequences using combinatorial optimization.
Bauer, Markus; Klau, Gunnar W; Reinert, Knut
2007-07-27
The discovery of functional non-coding RNA sequences has led to an increasing interest in algorithms related to RNA analysis. Traditional sequence alignment algorithms, however, fail at computing reliable alignments of low-homology RNA sequences. The spatial conformation of RNA sequences largely determines their function, and therefore RNA alignment algorithms have to take structural information into account. We present a graph-based representation for sequence-structure alignments, which we model as an integer linear program (ILP). We sketch how we compute an optimal or near-optimal solution to the ILP using methods from combinatorial optimization, and present results on a recently published benchmark set for RNA alignments. The implementation of our algorithm yields better alignments in terms of two published scores than the other programs that we tested: This is especially the case with an increasing number of input sequences. Our program LARA is freely available for academic purposes from http://www.planet-lisa.net.
Integrated sequencing of exome and mRNA of large-sized single cells.
Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang
2018-01-10
Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hudson, Corey M.; Williams, Kelly P.
We report that the transfer-messenger RNA (tmRNA) and its partner protein SmpB act together in resolving problems arising when translating bacterial ribosomes reach the end of mRNA with no stop codon. Their genes have been found in nearly all bacterial genomes and in some organelles. The tmRNA Website serves tmRNA sequences, alignments and feature annotations, and has recently moved to http: //bioinformatics.sandia.gov/tmrna/. New features include software used to find the sequences, an update raising the number of unique tmRNA sequences from 492 to 1716, and a database of SmpB sequences which are served along with the tmRNA sequence from themore » same organism.« less
Hudson, Corey M.; Williams, Kelly P.
2014-11-05
We report that the transfer-messenger RNA (tmRNA) and its partner protein SmpB act together in resolving problems arising when translating bacterial ribosomes reach the end of mRNA with no stop codon. Their genes have been found in nearly all bacterial genomes and in some organelles. The tmRNA Website serves tmRNA sequences, alignments and feature annotations, and has recently moved to http: //bioinformatics.sandia.gov/tmrna/. New features include software used to find the sequences, an update raising the number of unique tmRNA sequences from 492 to 1716, and a database of SmpB sequences which are served along with the tmRNA sequence from themore » same organism.« less
Complete mitochondrial genome of the Yellow-spotted skate Okamejei hollandi (Rajiformes: Rajidae).
Li, Weidong; Chen, Xiao; Liu, Wenai; Sun, Renjie; Zhou, Haolang
2016-07-01
The complete mitochondrial genome of the Yellow-spotted skate Okamejei hollandi was determined in this study. It is 16,974 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, and one putative control region. The overall base composition is 30.5% A, 27.8% C, 14.0% G, and 27.8% T. There are 28 bp short intergenic spaces located in 12 gene junctions and 31 bp overlaps located in nine gene junctions in the whole mitogenome. Two start codons (ATG and GTG) and two stop codons (TAG and TAA/T) were used in the protein-coding genes. The lengths of 22 tRNA genes range from 68 (tRNA-Ser2) to 75 (tRNA-Leu1) bp. The origin of L-strand replication (OL) sequence (37 bp) was identified between the tRNA-Asn and tRNA-Cys genes. The control region is 1311 bp in length with high A + T and poor G content.
Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes
NASA Technical Reports Server (NTRS)
Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.
1987-01-01
A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.
Quantifying the relationship between sequence and three-dimensional structure conservation in RNA
2010-01-01
Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657
SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics.
Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf
2015-08-01
RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of [Formula: see text]. Subsequently, numerous faster 'Sankoff-style' approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks down for RNAs with sequence identities below 60%. Alignment approaches like LocARNA that do not require sequence-based heuristics, have been limited to high complexity ([Formula: see text] quartic time). Breaking this barrier, we introduce the novel Sankoff-style algorithm 'sparsified prediction and alignment of RNAs based on their structure ensembles (SPARSE)', which runs in quadratic time without sequence-based heuristics. To achieve this low complexity, on par with sequence alignment algorithms, SPARSE features strong sparsification based on structural properties of the RNA ensembles. Following PMcomp, SPARSE gains further speed-up from lightweight energy computation. Although all existing lightweight Sankoff-style methods restrict Sankoff's original model by disallowing loop deletions and insertions, SPARSE transfers the Sankoff algorithm to the lightweight energy model completely for the first time. Compared with LocARNA, SPARSE achieves similar alignment and better folding quality in significantly less time (speedup: 3.7). At similar run-time, it aligns low sequence identity instances substantially more accurate than RAF, which uses sequence-based heuristics. © The Author 2015. Published by Oxford University Press.
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki
2009-04-01
We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).
RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals.
Breitenberger, C A; Browning, K S; Alzner-DeWeerd, B; RajBhandary, U L
1985-01-01
We have used RNA gel transfer hybridization, S1 nuclease mapping and primer extension to analyze transcripts derived from several genes in Neurospora crassa mitochondria. The transcripts studied include those for cytochrome oxidase subunit III, 17S rRNA and an unidentified open reading frame. In all three cases, initial transcripts are long, include tRNA sequences, and are subsequently processed to generate the mature RNAs. We find that endpoints of the most abundant transcripts generally coincide with those of tRNA sequences. We therefore conclude that tRNA sequences in long transcripts act as primary signals for RNA processing in N. crassa mitochondria. The situation is somewhat analogous to that observed in mammalian mitochondrial systems. The difference, however, is that in mammalian mitochondria, noncoding spacers between tRNA, rRNA and protein genes are very short and in many cases non-existent, allowing no room for intergenic RNA processing signals whereas, in N. crassa mtDNA, intergenic non-coding sequences are usually several hundred nucleotides long and contain highly conserved GC-rich palindromic sequences. Since these GC-rich palindromic sequences are retained in the processed mature RNAs, we conclude that they do not serve as signals for RNA processing. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2990893
RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.
Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko
2018-05-17
RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.
RNAcentral: A comprehensive database of non-coding RNA sequences
Williams, Kelly Porter; Lau, Britney Yan
2016-10-28
RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less
RNAcentral: A comprehensive database of non-coding RNA sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, Kelly Porter; Lau, Britney Yan
RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less
Protein Interaction Profile Sequencing (PIP-seq).
Foley, Shawn W; Gregory, Brian D
2016-10-10
Every eukaryotic RNA transcript undergoes extensive post-transcriptional processing from the moment of transcription up through degradation. This regulation is performed by a distinct cohort of RNA-binding proteins which recognize their target transcript by both its primary sequence and secondary structure. Here, we describe protein interaction profile sequencing (PIP-seq), a technique that uses ribonuclease-based footprinting followed by high-throughput sequencing to globally assess both protein-bound RNA sequences and RNA secondary structure. PIP-seq utilizes single- and double-stranded RNA-specific nucleases in the absence of proteins to infer RNA secondary structure. These libraries are also compared to samples that undergo nuclease digestion in the presence of proteins in order to find enriched protein-bound sequences. Combined, these four libraries provide a comprehensive, transcriptome-wide view of RNA secondary structure and RNA protein interaction sites from a single experimental technique. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
miRBase: integrating microRNA annotation and deep-sequencing data.
Kozomara, Ana; Griffiths-Jones, Sam
2011-01-01
miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.
3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.
Goldfarb, Katherine C; Cech, Thomas R
2013-09-21
Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.
Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.
Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus
Kinoti, Wycliff M.; Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan
2017-01-01
The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus, occurring in 48 of the 61 Ilarvirus-positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus-like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus-like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus-like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the need for a standardized approach to accurately determine what constitutes an active, viable virus infection after detection by molecular based methods. PMID:28713347
Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus.
Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan
2017-01-01
The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus , occurring in 48 of the 61 Ilarvirus -positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus -like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus -like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus -like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the need for a standardized approach to accurately determine what constitutes an active, viable virus infection after detection by molecular based methods.
INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.
Busch, Anke; Backofen, Rolf
2007-07-01
INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/
Characterization of circulating transfer RNA-derived RNA fragments in cattle
Casas, Eduardo; Cai, Guohong; Neill, John D.
2015-01-01
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699
Targeting MED1 LxxLL Motifs for Tissue-Selective Treatment of Human Breast Cancer
2013-09-01
colleagues have successfully conjugated malachite green aptamer to RNA nanoparticles characterized by a 3WJ pRNA motif. The in vitro experiment indi- cated...DNA/RNA sequence FIGURE 19.5 Diagram of RNA nanoparticle harboring malachite green aptamer, survivin siRNA and folate-DNA/RNA sequence for targeting...of RNA Aptamer to RNA Nanoparticles (Figure 19.5; Shu et al. 2011). The sequence for the malachite green aptamer nanoparticle was rationally designed
Targeting MED1 LxxLL Motifs for Tissue-Selective Treatment of Human Breast Cancer
2014-09-01
his colleagues have successfully conjugated malachite green aptamer to RNA nanoparticles characterized by a 3WJ pRNA motif. The in vitro experiment...Folate-DNA/RNA sequence FIGURE 19.5 Diagram of RNA nanoparticle harboring malachite green aptamer, survivin siRNA and folate-DNA/RNA sequence for...405Conjugation of RNA Aptamer to RNA Nanoparticles (Figure 19.5; Shu et al. 2011). The sequence for the malachite green aptamer nanoparticle was rationally
Toxins of Prokaryotic Toxin-Antitoxin Systems with Sequence-Specific Endoribonuclease Activity
Masuda, Hisako; Inouye, Masayori
2017-01-01
Protein translation is the most common target of toxin-antitoxin system (TA) toxins. Sequence-specific endoribonucleases digest RNA in a sequence-specific manner, thereby blocking translation. While past studies mainly focused on the digestion of mRNA, recent analysis revealed that toxins can also digest tRNA, rRNA and tmRNA. Purified toxins can digest single-stranded portions of RNA containing recognition sequences in the absence of ribosome in vitro. However, increasing evidence suggests that in vivo digestion may occur in association with ribosomes. Despite the prevalence of recognition sequences in many mRNA, preferential digestion seems to occur at specific positions within mRNA and also in certain reading frames. In this review, a variety of tools utilized to study the nuclease activities of toxins over the past 15 years will be reviewed. A recent adaptation of an RNA-seq-based technique to analyze entire sets of cellular RNA will be introduced with an emphasis on its strength in identifying novel targets and redefining recognition sequences. The differences in biochemical properties and postulated physiological roles will also be discussed. PMID:28420090
Senter, Evan; Sheikh, Saad; Dotu, Ivan; Ponty, Yann; Clote, Peter
2012-01-01
Using complex roots of unity and the Fast Fourier Transform, we design a new thermodynamics-based algorithm, FFTbor, that computes the Boltzmann probability that secondary structures differ by base pairs from an arbitrary initial structure of a given RNA sequence. The algorithm, which runs in quartic time and quadratic space , is used to determine the correlation between kinetic folding speed and the ruggedness of the energy landscape, and to predict the location of riboswitch expression platform candidates. A web server is available at http://bioinformatics.bc.edu/clotelab/FFTbor/. PMID:23284639
Comparative study of topological indices of macro/supramolecular RNA complex networks.
Agüero-Chapín, Guillermín; Antunes, Agostinho; Ubeira, Florencio M; Chou, Kuo-Chen; González-Díaz, Humberto
2008-11-01
RNA function annotation is often based on alignment to a previously studied template. In contrast to the study of proteins, there are not many alignment-free methods to predict RNA functions if alignment fails. The use of topological indices (TIs) of RNA complex networks (CNs) to find quantitative structure-activity relationships (QSAR) may be an alternative to incorporate secondary structure or sequence-to-sequence similarity. Here, we introduce new QSAR-like techniques using RNA macromolecular CNs (mmCNs), where nodes are nucleotides, or RNA supramolecular CNs (smCNs), where nodes are RNA sequences. We studied a data set of 198 sequences including 18S-rRNAs (important phylogenetic molecular biomarkers). We constructed three types of RNA mmCNs: sequence-linear (SL), Cartesian-lattice (CL), and sequence-folding CNs (SF-CNs) and two smCNs: sequence-sequence disagreement CN (SSD) and sequence-sequence similarity (SSS-smCN). We reported the first comparative QSAR study with all these CIs and CNs, which includes: (i) spectral moments ( ( i )micro d ( w)) of SL-mmCNs (accuracy = 75.3%), (ii) electrostatic CIs (xi d ) of CL-mmCNs (>90%), (iii) thermodynamic parameters (Delta G, Delta H, Delta S, and T m) of SF-mmCNs (64.7%), (iv) disagreement-distribution moments ( M k ) of the SSD-smCN (79.3%), and (v) node centralities of the SSD-smCN (78.0%). Furthermore, we reported the experimental isolation of a new RNA sequence from Psidum guajava leaf tissue and its QSAR and BLAST prediction to illustrate the practical use of these methods. We also investigated the use of these CNs to explore rRNA diversity on bacteria, plants, and parasites from the Dactylogyrus genus. The HPL-mmCNs model was the best of all found. All the CNs and TIs, except SF-mmCNs, were introduced here by the first time for the QSAR study of RNA, which allowed a comparative study for RNA classification.
Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y
2016-11-01
High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Discriminative Prediction of A-To-I RNA Editing Events from DNA Sequence
Sun, Jiangming; Singh, Pratibha; Bagge, Annika; Valtat, Bérengère; Vikman, Petter; Spégel, Peter; Mulder, Hindrik
2016-01-01
RNA editing is a post-transcriptional alteration of RNA sequences that, via insertions, deletions or base substitutions, can affect protein structure as well as RNA and protein expression. Recently, it has been suggested that RNA editing may be more frequent than previously thought. A great impediment, however, to a deeper understanding of this process is the paramount sequencing effort that needs to be undertaken to identify RNA editing events. Here, we describe an in silico approach, based on machine learning, that ameliorates this problem. Using 41 nucleotide long DNA sequences, we show that novel A-to-I RNA editing events can be predicted from known A-to-I RNA editing events intra- and interspecies. The validity of the proposed method was verified in an independent experimental dataset. Using our approach, 203 202 putative A-to-I RNA editing events were predicted in the whole human genome. Out of these, 9% were previously reported. The remaining sites require further validation, e.g., by targeted deep sequencing. In conclusion, the approach described here is a useful tool to identify potential A-to-I RNA editing events without the requirement of extensive RNA sequencing. PMID:27764195
Freiburg RNA tools: a central online resource for RNA-focused research and teaching.
Raden, Martin; Ali, Syed M; Alkhnbashi, Omer S; Busch, Anke; Costa, Fabrizio; Davis, Jason A; Eggenhofer, Florian; Gelhausen, Rick; Georg, Jens; Heyne, Steffen; Hiller, Michael; Kundu, Kousik; Kleinkauf, Robert; Lott, Steffen C; Mohamed, Mostafa M; Mattheis, Alexander; Miladi, Milad; Richter, Andreas S; Will, Sebastian; Wolff, Joachim; Wright, Patrick R; Backofen, Rolf
2018-05-21
The Freiburg RNA tools webserver is a well established online resource for RNA-focused research. It provides a unified user interface and comprehensive result visualization for efficient command line tools. The webserver includes RNA-RNA interaction prediction (IntaRNA, CopraRNA, metaMIR), sRNA homology search (GLASSgo), sequence-structure alignments (LocARNA, MARNA, CARNA, ExpaRNA), CRISPR repeat classification (CRISPRmap), sequence design (antaRNA, INFO-RNA, SECISDesign), structure aberration evaluation of point mutations (RaSE), and RNA/protein-family models visualization (CMV), and other methods. Open education resources offer interactive visualizations of RNA structure and RNA-RNA interaction prediction as well as basic and advanced sequence alignment algorithms. The services are freely available at http://rna.informatik.uni-freiburg.de.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A; Venkateswaran, Kasthuri
2012-12-01
In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing.
Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng
2018-05-09
Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.
How Messenger RNA and Nascent Chain Sequences Regulate Translation Elongation.
Choi, Junhong; Grosely, Rosslyn; Prabhakar, Arjun; Lapointe, Christopher P; Wang, Jinfan; Puglisi, Joseph D
2018-06-20
Translation elongation is a highly coordinated, multistep, multifactor process that ensures accurate and efficient addition of amino acids to a growing nascent-peptide chain encoded in the sequence of translated messenger RNA (mRNA). Although translation elongation is heavily regulated by external factors, there is clear evidence that mRNA and nascent-peptide sequences control elongation dynamics, determining both the sequence and structure of synthesized proteins. Advances in methods have driven experiments that revealed the basic mechanisms of elongation as well as the mechanisms of regulation by mRNA and nascent-peptide sequences. In this review, we highlight how mRNA and nascent-peptide elements manipulate the translation machinery to alter the dynamics and pathway of elongation.
NASA Astrophysics Data System (ADS)
Yoon, Minchul; Choi, Jong-il; Yamashita, Masamichi
2013-05-01
The composting system is the most efficient method for processing organic waste in space; however, the composting activity of microorganisms can be altered by cosmic rays. In this study, the effect of ionizing irradiation on composting bacteria was investigated. Sequence analyses of amplified 16S rRNA, 18S rRNA, and amoA genes were used to identify hyperthermal composting microorganisms. The viability of microorganisms in compost soil after gamma irradiation was directly determined using LIVE/DEAD BacLight viability kit. The dominant bacterial genera were Weissella cibaria and Leuconostoc sp., and the fungal genera were Metschnikowia bicuspidata and Pichia guilliermondii. Gamma irradiation up to a dose of 10 kGy did not significantly alter the microbial population. Furthermore, amylase and cellulase activities were maintained after high-dose gamma irradiation. Our results show that hyperthermal microorganisms can be used to recycle agricultural and fermented material in space stations and other human-inhabiting facilities on the Moon, Mars, and other planets.
INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints
Busch, Anke; Backofen, Rolf
2007-01-01
INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka
2008-06-06
Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less
3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing
2013-01-01
Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768
Evidence for a Complex Class of Nonadenylated mRNA in Drosophila
Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.
1980-01-01
The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246
Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy
Matkovich, Scot J.; Dorn, Gerald W.
2018-01-01
Summary MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicates purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses. PMID:25836573
Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.
Matkovich, Scot J; Dorn, Gerald W
2015-01-01
MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.
Identification of MicroRNA Targets of Capsicum spp. Using MiRTrans—a Trans-Omics Approach
Zhang, Lu; Qin, Cheng; Mei, Junpu; Chen, Xiaocui; Wu, Zhiming; Luo, Xirong; Cheng, Jiaowen; Tang, Xiangqun; Hu, Kailin; Li, Shuai C.
2017-01-01
The microRNA (miRNA) can regulate the transcripts that are involved in eukaryotic cell proliferation, differentiation, and metabolism. Especially for plants, our understanding of miRNA targets, is still limited. Early attempts of prediction on sequence alignments have been plagued by enormous false positives. It is helpful to improve target prediction specificity by incorporating the other data sources such as the dependency between miRNA and transcript expression or even cleaved transcripts by miRNA regulations, which are referred to as trans-omics data. In this paper, we developed MiRTrans (Prediction of MiRNA targets by Trans-omics data) to explore miRNA targets by incorporating miRNA sequencing, transcriptome sequencing, and degradome sequencing. MiRTrans consisted of three major steps. First, the target transcripts of miRNAs were predicted by scrutinizing their sequence characteristics and collected as an initial potential targets pool. Second, false positive targets were eliminated if the expression of miRNA and its targets were weakly correlated by lasso regression. Third, degradome sequencing was utilized to capture the miRNA targets by examining the cleaved transcripts that regulated by miRNAs. Finally, the predicted targets from the second and third step were combined by Fisher's combination test. MiRTrans was applied to identify the miRNA targets for Capsicum spp. (i.e., pepper). It can generate more functional miRNA targets than sequence-based predictions by evaluating functional enrichment. MiRTrans identified 58 miRNA-transcript pairs with high confidence from 18 miRNA families conserved in eudicots. Most of these targets were transcription factors; this lent support to the role of miRNA as key regulator in pepper. To our best knowledge, this work is the first attempt to investigate the miRNA targets of pepper, as well as their regulatory networks. Surprisingly, only a small proportion of miRNA-transcript pairs were shared between degradome sequencing and expression dependency predictions, suggesting that miRNA targets predicted by a single technology alone may be prone to report false negatives. PMID:28443105
Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang
2006-01-01
Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074
Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759
DSAP: deep-sequencing small RNA analysis pipeline.
Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus
2010-07-01
DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Evaluation of ribosomal RNA removal protocols for Salmonella RNA-Seq projects
USDA-ARS?s Scientific Manuscript database
Next generation sequencing is a powerful technology and its application to sequencing entire RNA populations of food-borne pathogens will provide valuable insights. A problem unique to prokaryotic RNA-Seq is the massive abundance of ribosomal RNA. Unlike eukaryotic messenger RNA (mRNA), bacterial ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenger, Drake C., E-mail: drake.stenger@ars.usda.
Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less
RNA-Seq for Bacterial Gene Expression.
Poulsen, Line Dahl; Vinther, Jeppe
2018-06-01
RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.
Short RNA indicator sequences are not completely degraded by autoclaving
Unnithan, Veena V.; Unc, Adrian; Joe, Valerisa; Smith, Geoffrey B.
2014-01-01
Short indicator RNA sequences (<100 bp) persist after autoclaving and are recovered intact by molecular amplification. Primers targeting longer sequences are most likely to produce false positives due to amplification errors easily verified by melting curves analyses. If short indicator RNA sequences are used for virus identification and quantification then post autoclave RNA degradation methodology should be employed, which may include further autoclaving. PMID:24518856
Wei, Yulong; Silke, Jordan R; Xia, Xuhua
2017-12-15
Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.
SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.
Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael
2018-05-25
Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.
ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data
Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa
2017-01-01
Abstract RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM’s model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. PMID:28977546
Unusual RNA plant virus integration in the soybean genome leads to the production of small RNAs.
da Fonseca, Guilherme Cordenonsi; de Oliveira, Luiz Felipe Valter; de Morais, Guilherme Loss; Abdelnor, Ricardo Vilela; Nepomuceno, Alexandre Lima; Waterhouse, Peter M; Farinelli, Laurent; Margis, Rogerio
2016-05-01
Horizontal gene transfer (HGT) is known to be a major force in genome evolution. The acquisition of genes from viruses by eukaryotic genomes is a well-studied example of HGT, including rare cases of non-retroviral RNA virus integration. The present study describes the integration of cucumber mosaic virus RNA-1 into soybean genome. After an initial metatranscriptomic analysis of small RNAs derived from soybean, the de novo assembly resulted a 3029-nt contig homologous to RNA-1. The integration of this sequence in the soybean genome was confirmed by DNA deep sequencing. The locus where the integration occurred harbors the full RNA-1 sequence followed by the partial sequence of an endogenous mRNA and another sequence of RNA-1 as an inverted repeat and allowing the formation of a hairpin structure. This region recombined into a retrotransposon located inside an exon of a soybean gene. The nucleotide similarity of the integrated sequence compared to other Cucumber mosaic virus sequences indicates that the integration event occurred recently. We described a rare event of non-retroviral RNA virus integration in soybean that leads to the production of a double-stranded RNA in a similar fashion to virus resistance RNAi plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Greenberg, Jay R.; Perry, Robert P.
1971-01-01
The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767
Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.
Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan
2017-12-15
RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs.
Panda, Amaresh C; De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B; Abdelmohsen, Kotb; Gorospe, Myriam
2017-07-07
High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs
De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B.; Gorospe, Myriam
2017-01-01
Abstract High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. PMID:28444238
SSMART: Sequence-structure motif identification for RNA-binding proteins.
Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe
2018-06-11
RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
Vioque, A
1997-01-01
The RNase P RNA gene (rnpB) from 10 cyanobacteria has been characterized. These new RNAs, together with the previously available ones, provide a comprehensive data set of RNase P RNA from diverse cyanobacterial lineages. All heterocystous cyanobacteria, but none of the non-heterocystous strains analyzed, contain short tandemly repeated repetitive (STRR) sequences that increase the length of helix P12. Site-directed mutagenesis experiments indicate that the STRR sequences are not required for catalytic activity in vitro. STRR sequences seem to have recently and independently invaded the RNase P RNA genes in heterocyst-forming cyanobacteria because closely related strains contain unrelated STRR sequences. Most cyanobacteria RNase P RNAs lack the sequence GGU in the loop connecting helices P15 and P16 that has been established to interact with the 3'-end CCA in precursor tRNA substrates in other bacteria. This character is shared with plastid RNase P RNA. Helix P6 is longer than usual in most cyanobacteria as well as in plastid RNase P RNA. PMID:9254706
Nuclease footprint analyses of the interactions between RNase P ribozyme and a model mRNA substrate.
Trang, P; Hsu, A W; Liu, F
1999-01-01
RNase P ribozyme cleaves an RNA helix substrate which resembles the acceptor stem and T-stem structures of its natural tRNA substrate. By linking the ribozyme covalently to a sequence (guide sequence) complementary to a target RNA, the catalytic RNA can be converted into a sequence-specific ribozyme, M1GS RNA. We have previously shown that M1GS RNA can efficiently cleave the mRNA sequence encoding thymidine kinase (TK) of herpes simplex virus 1. In this study, a footprint procedure using different nucleases was carried out to map the regions of a M1GS ribozyme that potentially interact with the TK mRNA substrate. The ribozyme regions that are protected from nuclease degradation in the presence of the TK mRNA substrate include those that interact with the acceptor stem and T-stem, the 3' terminal CCA sequence and the cleavage site of a tRNA substrate. However, some of the protected regions (e.g. P13 and P14) are unique and not among those protected in the presence of a tRNA substrate. Identification of the regions that interact with a mRNA substrate will allow us to study how M1GS RNA recognizes a mRNA substrate and facilitate the development of mRNA-cleaving ribozymes for gene-targeting applications. PMID:10556315
Mapping the miRNA interactome by crosslinking ligation and sequencing of hybrids (CLASH)
Helwak, Aleksandra; Tollervey, David
2014-01-01
RNA-RNA interactions play critical roles in many cellular processes but studying them is difficult and laborious. Here, we describe an experimental procedure, termed crosslinking ligation and sequencing of hybrids (CLASH), which allows high-throughput identification of sites of RNA-RNA interaction. During CLASH, a tagged bait protein is UV crosslinked in vivo to stabilise RNA interactions and purified under denaturing conditions. RNAs associated with the bait protein are partially truncated, and the ends of RNA-duplexes are ligated together. Following linker addition, cDNA library preparation and high-throughput sequencing, the ligated duplexes give rise to chimeric cDNAs, which unambiguously identify RNA-RNA interaction sites independent of bioinformatic predictions. This protocol is optimized for studying miRNA targets bound by Argonaute proteins, but should be easily adapted for other RNA-binding proteins and classes of RNA. The protocol requires around 5 days to complete, excluding the time required for high-throughput sequencing and bioinformatic analyses. PMID:24577361
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
repRNA: a web server for generating various feature vectors of RNA sequences.
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2016-02-01
With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .
Jossinet, Fabrice; Westhof, Eric
2005-08-01
Efficient RNA sequence manipulations (such as multiple alignments) need to be constrained by rules of RNA structure folding. The structural knowledge has increased dramatically in the last years with the accumulation of several large RNA structures similar to those of the bacterial ribosome subunits. However, no tool in the RNA community provides an easy way to link and integrate progress made at the sequence level using the available three-dimensional information. Sequence to Structure (S2S) proposes a framework in which an user can easily display, manipulate and interconnect heterogeneous RNA data, such as multiple sequence alignments, secondary and tertiary structures. S2S has been implemented using the Java language and has been developed and tested under UNIX systems, such as Linux and MacOSX. S2S is available at http://bioinformatics.org/S2S/.
Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server
Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J
2006-01-01
Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563
Chávez Montes, Ricardo A; de Fátima Rosas-Cárdenas, Flor; De Paoli, Emanuele; Accerbi, Monica; Rymarquis, Linda A; Mahalingam, Gayathri; Marsch-Martínez, Nayelli; Meyers, Blake C; Green, Pamela J; de Folter, Stefan
2014-04-23
Small RNAs are pivotal regulators of gene expression that guide transcriptional and post-transcriptional silencing mechanisms in eukaryotes, including plants. Here we report a comprehensive atlas of sRNA and miRNA from 3 species of algae and 31 representative species across vascular plants, including non-model plants. We sequence and quantify sRNAs from 99 different tissues or treatments across species, resulting in a data set of over 132 million distinct sequences. Using miRBase mature sequences as a reference, we identify the miRNA sequences present in these libraries. We apply diverse profiling methods to examine critical sRNA and miRNA features, such as size distribution, tissue-specific regulation and sequence conservation between species, as well as to predict putative new miRNA sequences. We also develop database resources, computational analysis tools and a dedicated website, http://smallrna.udel.edu/. This study provides new insights on plant sRNAs and miRNAs, and a foundation for future studies.
Early Detection of NSCLC Using Stromal Markers in Peripheral Blood
2016-09-01
circulating myeloid cells, flow cytometry, RNA -sequencing, expression profiling. 3. ACCOMPLISHMENTS: What were the major goals of the project...Subtask 2: Flow cytometry sorting of circulating myeloid cells. Subtask 3: RNA -Sequencing Subtask 4: RNA -seq data analysis Subtask 5: Feasible RT-PCR...accomplished the patient recruitment, flow cytometry sorting of circulating myeloid cells, RNA -sequencing of the samples. During the RNA - seq data analysis, we
Organization and transient expression of the gene for human U11 snRNA
Clemens, Suter-Crazzolara; Walter, Keller
1991-01-01
The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.
Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko
2015-12-01
RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.
Picardi, Ernesto; Gallo, Angela; Galeano, Federica; Tomaselli, Sara; Pesole, Graziano
2012-01-01
RNA editing is a post-transcriptional process occurring in a wide range of organisms. In human brain, the A-to-I RNA editing, in which individual adenosine (A) bases in pre-mRNA are modified to yield inosine (I), is the most frequent event. Modulating gene expression, RNA editing is essential for cellular homeostasis. Indeed, its deregulation has been linked to several neurological and neurodegenerative diseases. To date, many RNA editing sites have been identified by next generation sequencing technologies employing massive transcriptome sequencing together with whole genome or exome sequencing. While genome and transcriptome reads are not always available for single individuals, RNA-Seq data are widespread through public databases and represent a relevant source of yet unexplored RNA editing sites. In this context, we propose a simple computational strategy to identify genomic positions enriched in novel hypothetical RNA editing events by means of a new two-steps mapping procedure requiring only RNA-Seq data and no a priori knowledge of RNA editing characteristics and genomic reads. We assessed the suitability of our procedure by confirming A-to-I candidates using conventional Sanger sequencing and performing RNA-Seq as well as whole exome sequencing of human spinal cord tissue from a single individual. PMID:22957051
Increased complexity of circRNA expression during species evolution.
Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li
2017-08-03
Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.
tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.
Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi
2014-01-01
The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.
NASA Technical Reports Server (NTRS)
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
RNA editing: trypanosomes rewrite the genetic code.
Stuart, K
1998-01-01
The understanding of how genetic information is stored and expressed has advanced considerably since the "central dogma" asserted that genetic information flows from the nucleotide sequence of DNA to that of messenger RNA (mRNA) which in turn specifies the amino acid sequence of a protein. It was found that genetic information can be stored as RNA (e.g. in RNA viruses) and can flow from RNA to DNA by reverse transcriptase enzyme activity. In addition, some genes contain introns, nucleotide sequences that are removed from their RNA (by RNA splicing) and thus are not represented in the resultant protein. Furthermore, alternative splicing was found to produce variant proteins from a single gene. More recently, the study of trypanosome parasites revealed an unexpected and indeed counter-intuitive genetic complexity. Genetic information for a single protein can be dispersed among several (DNA) genes in these organisms. One of these genes specifies an encrypted precursor mRNA that is converted to a functional mRNA by a process called RNA editing that inserts and deletes uridylate nucleotides. The sequence of the edited mRNA is specified by multiple small RNAs, named guide RNAs, (gRNAs) each of which is encoded in a separate gene. Thus, edited mRNA sequences are assembled from multiple genes by the transfer of information from one type of RNA to another. The existence of editing was surprising but has stimulated the discovery of other types of RNA editing. The Stuart laboratory has been exploring RNA editing in trypanosomes from the time of its discovery. They found dramatic differences between the mitochondrial gene sequences and those of the corresponding mRNAs, which indicated editing by the insertion and deletion of uridylates. Some editing was modest; simply eliminating shifts in sequence register of minimally extending the protein coding sequence. However, editing of many mRNAs was startingly extensive. The RNA sequence was essentially entirely remodeled with its sequence more the result of editing than the gene sequence. The identities of genes for such extensively edited RNA were not recognizable from the DNA sequence but they were readily identifiable from the edited mRNA sequence. Thus, despite the complex and extensive editing the resultant mRNA sequence is precise. Characterization of partially edited RNAs indicated that editing proceeds in the direction opposite to that used to specify the protein which reflects the use of the gRNAs. The numerous gRNAs that are used for editing are encoded in the DNA molecules whose role was previously a mystery. Using information gained in our earlier studies, the Stuart group developed an in vitro system that reproduces the fundamental process of editing in order to resolve the mechanism by which it occurs. They determined that editing entails a series of enzymatic steps rather than the mechanism used in RNA splicing. They also showed that chimeric gRNA-mRNA molecules are aberrant by-products of editing rather than intermediates in the process as had been proposed. Additional studies are exploring precisely how the number of added and deleted uridylates is specified by the gRNA. The Stuart laboratory showed that editing is performed by an aggregation of enzymes that catalyze the separate steps of editing. It also developed a method to purify this multimolecule complex that contains several, perhaps tens of, proteins. This will allow the study of its composition and the functions of its component parts. Indeed, the gene for one component has been identified and its detailed characterization begun. These studies are developing tools to explore related processes. An early finding in the lab was that the various mRNAs are differentially edited during the life cycle of the parasite. The pattern of this editing indicates that editing serves to regulate the alternation between two modes of energy generation. This regulation is coordinated with other events that are occurring during the life c
Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.
Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L
1996-01-01
Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200
Fragmentation of whole-transcriptome RNA using E. coli RNase III.
Ares, Manuel
2013-05-01
High-throughput sequencing (HTS) methods can provide short sequence reads for many millions of individual molecules in a sample, allowing the use of sequencing to measure the abundance of RNA molecules. To quantify the amount of a particular sequence in a sample of large RNAs (e.g., mRNAs), it is important to fragment the RNA into short pieces that can be ligated to oligonucleotides that allow polymerase chain reaction (PCR) amplification and sequencing. The most desired end structure of RNA for such ligation steps is a 5' phosphate and a 3' OH. Thus, enzymes that leave these groups after cleavage are of particular utility, avoiding the need to dephosphorylate the 3' end with phosphatases or phosphorylate the 5' end with kinase before proceeding. One such enzyme, RNase III, is widely available. Although it primarily cuts duplex RNA, this specificity is salt- and concentration-dependent, and many RNAs that lack strong extended duplexes are nonetheless susceptible to cleavage at many spots. RNA fragmentation by RNase III does not seem to grossly affect the distribution of RNA sequencing reads. Thus, it has become a standard method for creating nominally representative pools of transcriptome sequences with 5' phosphates and 3' OH for library construction. Three steps in preparing fragmented transcriptome RNA for sequencing library construction are described here: (1) fragmenting the RNA with RNase III to the extent that ~60-100-nucleotide fragments are created, (2) purifying the RNA from the RNase III reaction, and (3) analyzing the digestion products for their suitability in library production.
AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES
This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...
Computational Analysis of Mouse piRNA Sequence and Biogenesis
Betel, Doron; Sheridan, Robert; Marks, Debora S; Sander, Chris
2007-01-01
The recent discovery of a new class of 30-nucleotide long RNAs in mammalian testes, called PIWI-interacting RNA (piRNA), with similarities to microRNAs and repeat-associated small interfering RNAs (rasiRNAs), has raised puzzling questions regarding their biogenesis and function. We report a comparative analysis of currently available piRNA sequence data from the pachytene stage of mouse spermatogenesis that sheds light on their sequence diversity and mechanism of biogenesis. We conclude that (i) there are at least four times as many piRNAs in mouse testes than currently known; (ii) piRNAs, which originate from long precursor transcripts, are generated by quasi-random enzymatic processing that is guided by a weak sequence signature at the piRNA 5′ends resulting in a large number of distinct sequences; and (iii) many of the piRNA clusters contain inverted repeats segments capable of forming double-strand RNA fold-back segments that may initiate piRNA processing analogous to transposon silencing. PMID:17997596
RNA design using simulated SHAPE data.
Lotfi, Mohadeseh; Zare-Mirakabad, Fatemeh; Montaseri, Soheila
2018-05-03
It has long been established that in addition to being involved in protein translation, RNA plays essential roles in numerous other cellular processes, including gene regulation and DNA replication. Such roles are known to be dictated by higher-order structures of RNA molecules. It is therefore of prime importance to find an RNA sequence that can fold to acquire a particular function that is desirable for use in pharmaceuticals and basic research. The challenge of finding an RNA sequence for a given structure is known as the RNA design problem. Although there are several algorithms to solve this problem, they mainly consider hard constraints, such as minimum free energy, to evaluate the predicted sequences. Recently, SHAPE data has emerged as a new soft constraint for RNA secondary structure prediction. To take advantage of this new experimental constraint, we report here a new method for accurate design of RNA sequences based on their secondary structures using SHAPE data as pseudo-free energy. We then compare our algorithm with four others: INFO-RNA, ERD, MODENA and RNAifold 2.0. Our algorithm precisely predicts 26 out of 29 new sequences for the structures extracted from the Rfam dataset, while the other four algorithms predict no more than 22 out of 29. The proposed algorithm is comparable to the above algorithms on RNA-SSD datasets, where they can predict up to 33 appropriate sequences for RNA secondary structures out of 34.
Computational Prediction of the Immunomodulatory Potential of RNA Sequences.
Nagpal, Gandharva; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Raghava, Gajendra Pal Singh
2017-01-01
Advances in the knowledge of various roles played by non-coding RNAs have stimulated the application of RNA molecules as therapeutics. Among these molecules, miRNA, siRNA, and CRISPR-Cas9 associated gRNA have been identified as the most potent RNA molecule classes with diverse therapeutic applications. One of the major limitations of RNA-based therapeutics is immunotoxicity of RNA molecules as it may induce the innate immune system. In contrast, RNA molecules that are potent immunostimulators are strong candidates for use in vaccine adjuvants. Thus, it is important to understand the immunotoxic or immunostimulatory potential of these RNA molecules. The experimental techniques for determining immunostimulatory potential of siRNAs are time- and resource-consuming. To overcome this limitation, recently our group has developed a web-based server "imRNA" for predicting the immunomodulatory potential of RNA sequences. This server integrates a number of modules that allow users to perform various tasks including (1) generation of RNA analogs with reduced immunotoxicity, (2) identification of highly immunostimulatory regions in RNA sequence, and (3) virtual screening. This server may also assist users in the identification of minimum mutations required in a given RNA sequence to minimize its immunomodulatory potential that is required for designing RNA-based therapeutics. Besides, the server can be used for designing RNA-based vaccine adjuvants as it may assist users in the identification of mutations required for increasing immunomodulatory potential of a given RNA sequence. In summary, this chapter describes major applications of the "imRNA" server in designing RNA-based therapeutics and vaccine adjuvants (http://www.imtech.res.in/raghava/imrna/).
Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib
2008-01-01
The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.
Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer
2015-07-01
AWARD NUMBER: W81XWH-14-1-0234 TITLE: Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Single-Cell RNA Sequencing of the Bronchial Epithelium in Smokers With Lung Cancer 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH...single cell RNA sequencing on airway epithelial cells obtained from smokers with and without lung cancer to identify cell-type dependent gene expression
Local neutral networks help maintain inaccurately replicating ribozymes.
Szilágyi, András; Kun, Ádám; Szathmáry, Eörs
2014-01-01
The error threshold of replication limits the selectively maintainable genome size against recurrent deleterious mutations for most fitness landscapes. In the context of RNA replication a distinction between the genotypic and the phenotypic error threshold has been made; where the latter concerns the maintenance of secondary structure rather than sequence. RNA secondary structure is treated as a proxy for function. The phenotypic error threshold allows higher per digit mutation rates than its genotypic counterpart, and is known to increase with the frequency of neutral mutations in sequence space. Here we show that the degree of neutrality, i.e. the frequency of nearest-neighbour (one-step) neutral mutants is a remarkably accurate proxy for the overall frequency of such mutants in an experimentally verifiable formula for the phenotypic error threshold; this we achieve by the full numerical solution for the concentration of all sequences in mutation-selection balance up to length 16. We reinforce our previous result that currently known ribozymes could be selectively maintained by the accuracy known from the best available polymerase ribozymes. Furthermore, we show that in silico stabilizing selection can increase the mutational robustness of ribozymes due to the fact that they were produced by artificial directional selection in the first place. Our finding offers a better understanding of the error threshold and provides further insight into the plausibility of an ancient RNA world.
Hayashi, Tetsutaro; Ozaki, Haruka; Sasagawa, Yohei; Umeda, Mana; Danno, Hiroki; Nikaido, Itoshi
2018-02-12
Total RNA sequencing has been used to reveal poly(A) and non-poly(A) RNA expression, RNA processing and enhancer activity. To date, no method for full-length total RNA sequencing of single cells has been developed despite the potential of this technology for single-cell biology. Here we describe random displacement amplification sequencing (RamDA-seq), the first full-length total RNA-sequencing method for single cells. Compared with other methods, RamDA-seq shows high sensitivity to non-poly(A) RNA and near-complete full-length transcript coverage. Using RamDA-seq with differentiation time course samples of mouse embryonic stem cells, we reveal hundreds of dynamically regulated non-poly(A) transcripts, including histone transcripts and long noncoding RNA Neat1. Moreover, RamDA-seq profiles recursive splicing in >300-kb introns. RamDA-seq also detects enhancer RNAs and their cell type-specific activity in single cells. Taken together, we demonstrate that RamDA-seq could help investigate the dynamics of gene expression, RNA-processing events and transcriptional regulation in single cells.
Sequence variation between 462 human individuals fine-tunes functional sites of RNA processing
NASA Astrophysics Data System (ADS)
Ferreira, Pedro G.; Oti, Martin; Barann, Matthias; Wieland, Thomas; Ezquina, Suzana; Friedländer, Marc R.; Rivas, Manuel A.; Esteve-Codina, Anna; Estivill, Xavier; Guigó, Roderic; Dermitzakis, Emmanouil; Antonarakis, Stylianos; Meitinger, Thomas; Strom, Tim M.; Palotie, Aarno; François Deleuze, Jean; Sudbrak, Ralf; Lerach, Hans; Gut, Ivo; Syvänen, Ann-Christine; Gyllensten, Ulf; Schreiber, Stefan; Rosenstiel, Philip; Brunner, Han; Veltman, Joris; Hoen, Peter A. C. T.; Jan van Ommen, Gert; Carracedo, Angel; Brazma, Alvis; Flicek, Paul; Cambon-Thomsen, Anne; Mangion, Jonathan; Bentley, David; Hamosh, Ada; Rosenstiel, Philip; Strom, Tim M.; Lappalainen, Tuuli; Guigó, Roderic; Sammeth, Michael
2016-09-01
Recent advances in the cost-efficiency of sequencing technologies enabled the combined DNA- and RNA-sequencing of human individuals at the population-scale, making genome-wide investigations of the inter-individual genetic impact on gene expression viable. Employing mRNA-sequencing data from the Geuvadis Project and genome sequencing data from the 1000 Genomes Project we show that the computational analysis of DNA sequences around splice sites and poly-A signals is able to explain several observations in the phenotype data. In contrast to widespread assessments of statistically significant associations between DNA polymorphisms and quantitative traits, we developed a computational tool to pinpoint the molecular mechanisms by which genetic markers drive variation in RNA-processing, cataloguing and classifying alleles that change the affinity of core RNA elements to their recognizing factors. The in silico models we employ further suggest RNA editing can moonlight as a splicing-modulator, albeit less frequently than genomic sequence diversity. Beyond existing annotations, we demonstrate that the ultra-high resolution of RNA-Seq combined from 462 individuals also provides evidence for thousands of bona fide novel elements of RNA processing—alternative splice sites, introns, and cleavage sites—which are often rare and lowly expressed but in other characteristics similar to their annotated counterparts.
Impact of sequencing depth and read length on single cell RNA sequencing data of T cells.
Rizzetto, Simone; Eltahla, Auda A; Lin, Peijie; Bull, Rowena; Lloyd, Andrew R; Ho, Joshua W K; Venturi, Vanessa; Luciani, Fabio
2017-10-06
Single cell RNA sequencing (scRNA-seq) provides great potential in measuring the gene expression profiles of heterogeneous cell populations. In immunology, scRNA-seq allowed the characterisation of transcript sequence diversity of functionally relevant T cell subsets, and the identification of the full length T cell receptor (TCRαβ), which defines the specificity against cognate antigens. Several factors, e.g. RNA library capture, cell quality, and sequencing output affect the quality of scRNA-seq data. We studied the effects of read length and sequencing depth on the quality of gene expression profiles, cell type identification, and TCRαβ reconstruction, utilising 1,305 single cells from 8 publically available scRNA-seq datasets, and simulation-based analyses. Gene expression was characterised by an increased number of unique genes identified with short read lengths (<50 bp), but these featured higher technical variability compared to profiles from longer reads. Successful TCRαβ reconstruction was achieved for 6 datasets (81% - 100%) with at least 0.25 millions (PE) reads of length >50 bp, while it failed for datasets with <30 bp reads. Sufficient read length and sequencing depth can control technical noise to enable accurate identification of TCRαβ and gene expression profiles from scRNA-seq data of T cells.
Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.
1987-04-16
the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r
Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.
Benslimane, A A; Dron, M; Hartmann, C; Rode, A
1986-01-01
Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
TriageTools: tools for partitioning and prioritizing analysis of high-throughput sequencing data.
Fimereli, Danai; Detours, Vincent; Konopka, Tomasz
2013-04-01
High-throughput sequencing is becoming a popular research tool but carries with it considerable costs in terms of computation time, data storage and bandwidth. Meanwhile, some research applications focusing on individual genes or pathways do not necessitate processing of a full sequencing dataset. Thus, it is desirable to partition a large dataset into smaller, manageable, but relevant pieces. We present a toolkit for partitioning raw sequencing data that includes a method for extracting reads that are likely to map onto pre-defined regions of interest. We show the method can be used to extract information about genes of interest from DNA or RNA sequencing samples in a fraction of the time and disk space required to process and store a full dataset. We report speedup factors between 2.6 and 96, depending on settings and samples used. The software is available at http://www.sourceforge.net/projects/triagetools/.
An Adaptive Defect Weighted Sampling Algorithm to Design Pseudoknotted RNA Secondary Structures
Zandi, Kasra; Butler, Gregory; Kharma, Nawwaf
2016-01-01
Computational design of RNA sequences that fold into targeted secondary structures has many applications in biomedicine, nanotechnology and synthetic biology. An RNA molecule is made of different types of secondary structure elements and an important RNA element named pseudoknot plays a key role in stabilizing the functional form of the molecule. However, due to the computational complexities associated with characterizing pseudoknotted RNA structures, most of the existing RNA sequence designer algorithms generally ignore this important structural element and therefore limit their applications. In this paper we present a new algorithm to design RNA sequences for pseudoknotted secondary structures. We use NUPACK as the folding algorithm to compute the equilibrium characteristics of the pseudoknotted RNAs, and describe a new adaptive defect weighted sampling algorithm named Enzymer to design low ensemble defect RNA sequences for targeted secondary structures including pseudoknots. We used a biological data set of 201 pseudoknotted structures from the Pseudobase library to benchmark the performance of our algorithm. We compared the quality characteristics of the RNA sequences we designed by Enzymer with the results obtained from the state of the art MODENA and antaRNA. Our results show our method succeeds more frequently than MODENA and antaRNA do, and generates sequences that have lower ensemble defect, lower probability defect and higher thermostability. Finally by using Enzymer and by constraining the design to a naturally occurring and highly conserved Hammerhead motif, we designed 8 sequences for a pseudoknotted cis-acting Hammerhead ribozyme. Enzymer is available for download at https://bitbucket.org/casraz/enzymer. PMID:27499762
Characterization of the mammalian miRNA turnover landscape
Guo, Yanwen; Liu, Jun; Elfenbein, Sarah J.; Ma, Yinghong; Zhong, Mei; Qiu, Caihong; Ding, Ye; Lu, Jun
2015-01-01
Steady state cellular microRNA (miRNA) levels represent the balance between miRNA biogenesis and turnover. The kinetics and sequence determinants of mammalian miRNA turnover during and after miRNA maturation are not fully understood. Through a large-scale study on mammalian miRNA turnover, we report the co-existence of multiple cellular miRNA pools with distinct turnover kinetics and biogenesis properties and reveal previously unrecognized sequence features for fast turnover miRNAs. We measured miRNA turnover rates in eight mammalian cell types with a combination of expression profiling and deep sequencing. While most miRNAs are stable, a subset of miRNAs, mostly miRNA*s, turnovers quickly, many of which display a two-step turnover kinetics. Moreover, different sequence isoforms of the same miRNA can possess vastly different turnover rates. Fast turnover miRNA isoforms are enriched for 5′ nucleotide bias against Argonaute-(AGO)-loading, but also additional 3′ and central sequence features. Modeling based on two fast turnover miRNA*s miR-222-5p and miR-125b-1-3p, we unexpectedly found that while both miRNA*s are associated with AGO, they strongly differ in HSP90 association and sensitivity to HSP90 inhibition. Our data characterize the landscape of genome-wide miRNA turnover in cultured mammalian cells and reveal differential HSP90 requirements for different miRNA*s. Our findings also implicate rules for designing stable small RNAs, such as siRNAs. PMID:25653157
SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics
Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf
2015-01-01
Motivation: RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of O(n6). Subsequently, numerous faster ‘Sankoff-style’ approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks down for RNAs with sequence identities below 60%. Alignment approaches like LocARNA that do not require sequence-based heuristics, have been limited to high complexity (≥ quartic time). Results: Breaking this barrier, we introduce the novel Sankoff-style algorithm ‘sparsified prediction and alignment of RNAs based on their structure ensembles (SPARSE)’, which runs in quadratic time without sequence-based heuristics. To achieve this low complexity, on par with sequence alignment algorithms, SPARSE features strong sparsification based on structural properties of the RNA ensembles. Following PMcomp, SPARSE gains further speed-up from lightweight energy computation. Although all existing lightweight Sankoff-style methods restrict Sankoff’s original model by disallowing loop deletions and insertions, SPARSE transfers the Sankoff algorithm to the lightweight energy model completely for the first time. Compared with LocARNA, SPARSE achieves similar alignment and better folding quality in significantly less time (speedup: 3.7). At similar run-time, it aligns low sequence identity instances substantially more accurate than RAF, which uses sequence-based heuristics. Availability and implementation: SPARSE is freely available at http://www.bioinf.uni-freiburg.de/Software/SPARSE. Contact: backofen@informatik.uni-freiburg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25838465
Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A.; Venkateswaran, Kasthuri
2012-01-01
In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing. PMID:23346038
SARA-Coffee web server, a tool for the computation of RNA sequence and structure multiple alignments
Di Tommaso, Paolo; Bussotti, Giovanni; Kemena, Carsten; Capriotti, Emidio; Chatzou, Maria; Prieto, Pablo; Notredame, Cedric
2014-01-01
This article introduces the SARA-Coffee web server; a service allowing the online computation of 3D structure based multiple RNA sequence alignments. The server makes it possible to combine sequences with and without known 3D structures. Given a set of sequences SARA-Coffee outputs a multiple sequence alignment along with a reliability index for every sequence, column and aligned residue. SARA-Coffee combines SARA, a pairwise structural RNA aligner with the R-Coffee multiple RNA aligner in a way that has been shown to improve alignment accuracy over most sequence aligners when enough structural data is available. The server can be accessed from http://tcoffee.crg.cat/apps/tcoffee/do:saracoffee. PMID:24972831
Continuous in vitro evolution of bacteriophage RNA polymerase promoters
NASA Technical Reports Server (NTRS)
Breaker, R. R.; Banerji, A.; Joyce, G. F.
1994-01-01
Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-01-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.
Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani
2018-01-01
Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.
Meng, Yijun; Yu, Dongliang; Xue, Jie; Lu, Jiangjie; Feng, Shangguo; Shen, Chenjia; Wang, Huizhong
2016-01-01
Dendrobium officinale is an important traditional Chinese herb. Here, we did a transcriptome-wide, organ-specific study on this valuable plant by combining RNA, small RNA (sRNA) and degradome sequencing. RNA sequencing of four organs (flower, root, leaf and stem) of Dendrobium officinale enabled us to obtain 536,558 assembled transcripts, from which 2,645, 256, 42 and 54 were identified to be highly expressed in the four organs respectively. Based on sRNA sequencing, 2,038, 2, 21 and 24 sRNAs were identified to be specifically accumulated in the four organs respectively. A total of 1,047 mature microRNA (miRNA) candidates were detected. Based on secondary structure predictions and sequencing, tens of potential miRNA precursors were identified from the assembled transcripts. Interestingly, phase-distributed sRNAs with degradome-based processing evidences were discovered on the long-stem structures of two precursors. Target identification was performed for the 1,047 miRNA candidates, resulting in the discovery of 1,257 miRNA--target pairs. Finally, some biological meaningful subnetworks involving hormone signaling, development, secondary metabolism and Argonaute 1-related regulation were established. All of the sequencing data sets are available at NCBI Sequence Read Archive (http://www.ncbi.nlm.nih.gov/sra/). Summarily, our study provides a valuable resource for the in-depth molecular and functional studies on this important Chinese orchid herb. PMID:26732614
Dictyostelium mobile elements: strategies to amplify in a compact genome.
Winckler, T; Dingermann, T; Glöckner, G
2002-12-01
Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.
Memetic algorithms for de novo motif-finding in biomedical sequences.
Bi, Chengpeng
2012-09-01
The objectives of this study are to design and implement a new memetic algorithm for de novo motif discovery, which is then applied to detect important signals hidden in various biomedical molecular sequences. In this paper, memetic algorithms are developed and tested in de novo motif-finding problems. Several strategies in the algorithm design are employed that are to not only efficiently explore the multiple sequence local alignment space, but also effectively uncover the molecular signals. As a result, there are a number of key features in the implementation of the memetic motif-finding algorithm (MaMotif), including a chromosome replacement operator, a chromosome alteration-aware local search operator, a truncated local search strategy, and a stochastic operation of local search imposed on individual learning. To test the new algorithm, we compare MaMotif with a few of other similar algorithms using simulated and experimental data including genomic DNA, primary microRNA sequences (let-7 family), and transmembrane protein sequences. The new memetic motif-finding algorithm is successfully implemented in C++, and exhaustively tested with various simulated and real biological sequences. In the simulation, it shows that MaMotif is the most time-efficient algorithm compared with others, that is, it runs 2 times faster than the expectation maximization (EM) method and 16 times faster than the genetic algorithm-based EM hybrid. In both simulated and experimental testing, results show that the new algorithm is compared favorably or superior to other algorithms. Notably, MaMotif is able to successfully discover the transcription factors' binding sites in the chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-Seq) data, correctly uncover the RNA splicing signals in gene expression, and precisely find the highly conserved helix motif in the transmembrane protein sequences, as well as rightly detect the palindromic segments in the primary microRNA sequences. The memetic motif-finding algorithm is effectively designed and implemented, and its applications demonstrate it is not only time-efficient, but also exhibits excellent performance while compared with other popular algorithms. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kawaguchi, Yuko; Sugino, Tomohiro; Yang, Yinjie; Yoshimura, Yoshitaka; Tsuji, Takashi; Kobayashi, Kensei; Tabata, Makoto; Hashimoto, Hirofumi; Mita, Hajime; Imai, Eiichi; Kawai, Hideyuki; Okudaira, Kyoko; Hasegawa, Sunao; Yamashita, Masamichi; Yano, Hajime; Yokobori, Shin-Ichi; Yamagishi, Akihiko
Terrestrial life may fly off into outer space by volcanic eruption meteorological impacts, and so on. Microbes have been collected from high altitude up to 70 km since 1936 [1]. We also isolated microbes at high altitude up to 35 km using an airplane and balloons [2, 3]. The two isolates of these microbes are new species, one of which shows higher UV ray tolerance than Deinococcus radiodurans [2, 3]. On the other hand, there is a hypothesis on the origin of terrestrial life called panspermia [4, 5], in which terrestrial life is thought to have come from space (or astronomical bodies other than Earth). This hypothesis suggests that life may migrate between Earth and other planets. If microbes were to exist at the high altitude of low earth orbit (400 km), it would endorse the possibility of interplanetary migration of terrestrial lifeWe proposed, the Tanpopo mission to examine interplanetary migration of microbes and organic compounds on Japan Experimental Module (JEM) of the International Space Station (ISS). We will capture micro-particles including microbes and micro-meteoroids at the altitude of ISS orbit (400 km) with ultra low-density aerogel exposed to space for a given period of time. After retreaving the aerogel, we will investigate captured micro particles and tracks followed by microbiological, organic chemical and mineralogical analyses.Captured particles will be analyzed after the initial curation of the aerogel and tracks. Particles potentially containing microbes will be used for PCR amplification of small subunit (ss) rRNA gene followed by DNA sequencing. Comparision between the determined sequences and known ss rRNA gene sequences of terrestrial organisms will suggest the origin and properties of the organism.The density of microbes at the ISS altitude might be quite low, and microbe cell number on each captured particle may be quite limited. Therefore, it is necessary to establish the effective PCR procedure for quite small amount of DNA template in the presence of other materials such as clay and aerogel.We will report current status of the PCR identification of microbes from test samples. The PCR conditions to amplify ss rRNA gene from quite small number of cells and quite low concentration of genomic DNA with/without clay and aerogel are examined. References. [1] Y. Yang et al. (2009) Biol. Sci. in Space, 23, 151-163[2] Y. Yang et al. (2009) Int. J. Syst. Evol. Microbiol, 59, 1862-1866[3] Y. Yang et al. (2010) Int. J. Syst. Evol. Microbiol, (in press)[4] S. Arrhenius (1908) Worlds in the Making-the Evolution of the Universe. Harper and Brothers Publishers.[5] F. Crick (1981) Life Itself. Simon Schuster.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
2014-01-01
Background RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. Results We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification” includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module “mRNA identification” includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module “Target screening” provides expression profiling analyses and graphic visualization. The module “Self-testing” offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program’s functionality. Conclusions eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory. PMID:24593312
Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang
2014-03-05
RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.
Novel Approach to Analyzing MFE of Noncoding RNA Sequences
George, Tina P.; Thomas, Tessamma
2016-01-01
Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers. PMID:27695341
Novel Approach to Analyzing MFE of Noncoding RNA Sequences.
George, Tina P; Thomas, Tessamma
2016-01-01
Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.
Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O
2010-10-01
Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.
Polymerase ribozyme efficiency increased by G/T-rich DNA oligonucleotides
Yao, Chengguo; Müller, Ulrich F.
2011-01-01
The RNA world hypothesis states that the early evolution of life went through a stage where RNA served as genome and as catalyst. The replication of RNA world organisms would have been facilitated by ribozymes that catalyze RNA polymerization. To recapitulate an RNA world in the laboratory, a series of RNA polymerase ribozymes was developed previously. However, these ribozymes have a polymerization efficiency that is too low for self-replication, and the most efficient ribozymes prefer one specific template sequence. The limiting factor for polymerization efficiency is the weak sequence-independent binding to its primer/template substrate. Most of the known polymerase ribozymes bind an RNA heptanucleotide to form the P2 duplex on the ribozyme. By modifying this heptanucleotide, we were able to significantly increase polymerization efficiency. Truncations at the 3′-terminus of this heptanucleotide increased full-length primer extension by 10-fold, on a specific template sequence. In contrast, polymerization on several different template sequences was improved dramatically by replacing the RNA heptanucleotide with DNA oligomers containing randomized sequences of 15 nt. The presence of G and T in the random sequences was sufficient for this effect, with an optimal composition of 60% G and 40% T. Our results indicate that these DNA sequences function by establishing many weak and nonspecific base-pairing interactions to the single-stranded portion of the template. Such low-specificity interactions could have had important functions in an RNA world. PMID:21622900
Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V
2016-01-01
Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.
Nawrocki, Eric P.; Burge, Sarah W.
2013-01-01
The development of RNA bioinformatic tools began more than 30 y ago with the description of the Nussinov and Zuker dynamic programming algorithms for single sequence RNA secondary structure prediction. Since then, many tools have been developed for various RNA sequence analysis problems such as homology search, multiple sequence alignment, de novo RNA discovery, read-mapping, and many more. In this issue, we have collected a sampling of reviews and original research that demonstrate some of the many ways bioinformatics is integrated with current RNA biology research. PMID:23948768
High-throughput illumina strand-specific RNA sequencing library preparation
USDA-ARS?s Scientific Manuscript database
Conventional Illumina RNA-Seq does not have the resolution to decode the complex eukaryote transcriptome due to the lack of RNA polarity information. Strand-specific RNA sequencing (ssRNA-Seq) can overcome these limitations and as such is better suited for genome annotation, de novo transcriptome as...
YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs
Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G.; Rigoutsos, Isidore
2017-01-01
Abstract Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. PMID:28108659
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Kanhayuwa, Lakkhana; Coutts, Robert H. A.
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
miR-MaGiC improves quantification accuracy for small RNA-seq.
Russell, Pamela H; Vestal, Brian; Shi, Wen; Rudra, Pratyaydipta D; Dowell, Robin; Radcliffe, Richard; Saba, Laura; Kechris, Katerina
2018-05-15
Many tools have been developed to profile microRNA (miRNA) expression from small RNA-seq data. These tools must contend with several issues: the small size of miRNAs, the small number of unique miRNAs, the fact that similar miRNAs can be transcribed from multiple loci, and the presence of miRNA isoforms known as isomiRs. Methods failing to address these issues can return misleading information. We propose a novel quantification method designed to address these concerns. We present miR-MaGiC, a novel miRNA quantification method, implemented as a cross-platform tool in Java. miR-MaGiC performs stringent mapping to a core region of each miRNA and defines a meaningful set of target miRNA sequences by collapsing the miRNA space to "functional groups". We hypothesize that these two features, mapping stringency and collapsing, provide more optimal quantification to a more meaningful unit (i.e., miRNA family). We test miR-MaGiC and several published methods on 210 small RNA-seq libraries, evaluating each method's ability to accurately reflect global miRNA expression profiles. We define accuracy as total counts close to the total number of input reads originating from miRNAs. We find that miR-MaGiC, which incorporates both stringency and collapsing, provides the most accurate counts.
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in most performance measures. To the best of our knowledge, this is the first sequence-based prediction of protein-binding nucleotides in RNA which considers the binding partner of RNA. The new model will provide valuable information for designing biochemical experiments to find putative protein-binding sites in RNA with unknown structure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Free energy minimization to predict RNA secondary structures and computational RNA design.
Churkin, Alexander; Weinbrand, Lina; Barash, Danny
2015-01-01
Determining the RNA secondary structure from sequence data by computational predictions is a long-standing problem. Its solution has been approached in two distinctive ways. If a multiple sequence alignment of a collection of homologous sequences is available, the comparative method uses phylogeny to determine conserved base pairs that are more likely to form as a result of billions of years of evolution than by chance. In the case of single sequences, recursive algorithms that compute free energy structures by using empirically derived energy parameters have been developed. This latter approach of RNA folding prediction by energy minimization is widely used to predict RNA secondary structure from sequence. For a significant number of RNA molecules, the secondary structure of the RNA molecule is indicative of its function and its computational prediction by minimizing its free energy is important for its functional analysis. A general method for free energy minimization to predict RNA secondary structures is dynamic programming, although other optimization methods have been developed as well along with empirically derived energy parameters. In this chapter, we introduce and illustrate by examples the approach of free energy minimization to predict RNA secondary structures.
Zhang, Lu; Xu, Jinhao; Ma, Jinbiao
2016-07-25
RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.
3D RNA and functional interactions from evolutionary couplings
Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.
2016-01-01
Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444
Introduction to Single-Cell RNA Sequencing.
Olsen, Thale Kristin; Baryawno, Ninib
2018-04-01
During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells; this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.
Knotty: Efficient and Accurate Prediction of Complex RNA Pseudoknot Structures.
Jabbari, Hosna; Wark, Ian; Montemagno, Carlo; Will, Sebastian
2018-06-01
The computational prediction of RNA secondary structure by free energy minimization has become an important tool in RNA research. However in practice, energy minimization is mostly limited to pseudoknot-free structures or rather simple pseudoknots, not covering many biologically important structures such as kissing hairpins. Algorithms capable of predicting sufficiently complex pseudoknots (for sequences of length n) used to have extreme complexities, e.g. Pknots (Rivas and Eddy, 1999) has O(n6) time and O(n4) space complexity. The algorithm CCJ (Chen et al., 2009) dramatically improves the asymptotic run time for predicting complex pseudoknots (handling almost all relevant pseudoknots, while being slightly less general than Pknots), but this came at the cost of large constant factors in space and time, which strongly limited its practical application (∼200 bases already require 256GB space). We present a CCJ-type algorithm, Knotty, that handles the same comprehensive pseudoknot class of structures as CCJ with improved space complexity of Θ(n3 + Z)-due to the applied technique of sparsification, the number of "candidates", Z, appears to grow significantly slower than n4 on our benchmark set (which include pseudoknotted RNAs up to 400 nucleotides). In terms of run time over this benchmark, Knotty clearly outperforms Pknots and the original CCJ implementation, CCJ 1.0; Knotty's space consumption fundamentally improves over CCJ 1.0, being on a par with the space-economic Pknots. By comparing to CCJ 2.0, our unsparsified Knotty variant, we demonstrate the isolated effect of sparsification. Moreover, Knotty employs the state-of-the-art energy model of "HotKnots DP09", which results in superior prediction accuracy over Pknots. Our software is available at https://github.com/HosnaJabbari/Knotty. will@tbi.unvie.ac.at. Supplementary data are available at Bioinformatics online.
Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.
Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi
2016-11-15
Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.
Lee, James W.; Thundat, Thomas G.
2005-06-14
An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.
Plant MicroRNA Prediction by Supervised Machine Learning Using C5.0 Decision Trees.
Williams, Philip H; Eyles, Rod; Weiller, Georg
2012-01-01
MicroRNAs (miRNAs) are nonprotein coding RNAs between 20 and 22 nucleotides long that attenuate protein production. Different types of sequence data are being investigated for novel miRNAs, including genomic and transcriptomic sequences. A variety of machine learning methods have successfully predicted miRNA precursors, mature miRNAs, and other nonprotein coding sequences. MirTools, mirDeep2, and miRanalyzer require "read count" to be included with the input sequences, which restricts their use to deep-sequencing data. Our aim was to train a predictor using a cross-section of different species to accurately predict miRNAs outside the training set. We wanted a system that did not require read-count for prediction and could therefore be applied to short sequences extracted from genomic, EST, or RNA-seq sources. A miRNA-predictive decision-tree model has been developed by supervised machine learning. It only requires that the corresponding genome or transcriptome is available within a sequence window that includes the precursor candidate so that the required sequence features can be collected. Some of the most critical features for training the predictor are the miRNA:miRNA(∗) duplex energy and the number of mismatches in the duplex. We present a cross-species plant miRNA predictor with 84.08% sensitivity and 98.53% specificity based on rigorous testing by leave-one-out validation.
NASA Technical Reports Server (NTRS)
1997-01-01
It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith developed synthesis & purification protocols in order to obtain large quantities of RNA oligomers for NMR studies. He succeeded in obtaining preliminary one dimensional spectra for an analog of the helix II/loop B/helix III domain of 5S rRNAs well as a 29mer which includes helix III and the highly characteristic 13 nucleotide loop C. Significant progress in laying the required groundwork for this work has been accomplished during the past year. A plasmid, pLeuS-1, carrying the E. coli leucine tRNA synthetase gene (LeuRS) has been obtained and used to overexpressed the leucine synthetase. A T7 runoff transcription has been established in our laboratory and successfully used to make both minihelix RNAs and tRNAs. In addition, encapsulation studies have been conducted and we have successfully encapsulated tRNA in lipid vesicles. Initial efforts to obtain peptide bond synthesis will be underway over the next several moths.
Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan
2016-10-07
RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential information pertaining to an RBP, like overall function annotations, are provided. The web server can be accessed at the following link: http://caps.ncbs.res.in/rstrucfam .
RNAcentral: an international database of ncRNA sequences
Williams, Kelly Porter
2014-10-28
The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia
2014-08-01
We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.
srRNA evolution and phylogenetic relationships of the genus Naegleria (Protista: Rhizopoda).
Baverstock, P R; Illana, S; Christy, P E; Robinson, B S; Johnson, A M
1989-05-01
A rapid RNA sequencing technique was used to partially sequence the small-subunit ribosomal RNA (srRNA) of four species of the amoeboid genus Naegleria. The extent of nucleotide sequence divergence between the two most divergent species was roughly similar to that found between mammals and frogs. However, the pattern of variation among the Naegleria species was quite different from that found for those species of tetrapods characterized to date. A phylogenetic analysis of the consensus Naegleria sequence showed that Naegleria was not monophyletic with either Acanthamoeba castellanii or Dictyostelium discoideum, two other amoebas for which sequences were available. It was shown that the semiconserved regions of the srRNA molecule evolve in a clocklike fashion and that the clock is time dependent rather than generation dependent.
A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.
Álvarez-Martos, Isabel; Ferapontova, Elena E
2017-08-05
A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.
Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA
Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong
2006-01-01
RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690
PlantRNA, a database for tRNAs of photosynthetic eukaryotes.
Cognat, Valérie; Pawlak, Gaël; Duchêne, Anne-Marie; Daujat, Magali; Gigant, Anaïs; Salinas, Thalia; Michaud, Morgane; Gutmann, Bernard; Giegé, Philippe; Gobert, Anthony; Maréchal-Drouard, Laurence
2013-01-01
PlantRNA database (http://plantrna.ibmp.cnrs.fr/) compiles transfer RNA (tRNA) gene sequences retrieved from fully annotated plant nuclear, plastidial and mitochondrial genomes. The set of annotated tRNA gene sequences has been manually curated for maximum quality and confidence. The novelty of this database resides in the inclusion of biological information relevant to the function of all the tRNAs entered in the library. This includes 5'- and 3'-flanking sequences, A and B box sequences, region of transcription initiation and poly(T) transcription termination stretches, tRNA intron sequences, aminoacyl-tRNA synthetases and enzymes responsible for tRNA maturation and modification. Finally, data on mitochondrial import of nuclear-encoded tRNAs as well as the bibliome for the respective tRNAs and tRNA-binding proteins are also included. The current annotation concerns complete genomes from 11 organisms: five flowering plants (Arabidopsis thaliana, Oryza sativa, Populus trichocarpa, Medicago truncatula and Brachypodium distachyon), a moss (Physcomitrella patens), two green algae (Chlamydomonas reinhardtii and Ostreococcus tauri), one glaucophyte (Cyanophora paradoxa), one brown alga (Ectocarpus siliculosus) and a pennate diatom (Phaeodactylum tricornutum). The database will be regularly updated and implemented with new plant genome annotations so as to provide extensive information on tRNA biology to the research community.
Limits of neutral drift: lessons from the in vitro evolution of two ribozymes.
Petrie, Katherine L; Joyce, Gerald F
2014-10-01
The relative contributions of adaptive selection and neutral drift to genetic change are unknown but likely depend on the inherent abundance of functional genotypes in sequence space and how accessible those genotypes are to one another. To better understand the relative roles of selection and drift in evolution, local fitness landscapes for two different RNA ligase ribozymes were examined using a continuous in vitro evolution system under conditions that foster the capacity for neutral drift to mediate genetic change. The exploration of sequence space was accelerated by increasing the mutation rate using mutagenic nucleotide analogs. Drift was encouraged by carrying out evolution within millions of separate compartments to exploit the founder effect. Deep sequencing of individuals from the evolved populations revealed that the distribution of genotypes did not escape the starting local fitness peak, remaining clustered around the sequence used to initiate evolution. This is consistent with a fitness landscape where high-fitness genotypes are sparse and well isolated, and suggests, at least in this context, that neutral drift alone is not a primary driver of genetic change. Neutral drift does, however, provide a repository of genetic variation upon which adaptive selection can act.
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pedersen, A.G.; Engelbrecht, J.
1995-12-31
In this paper we present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced along the promoter region. The spacing of all signals correspond to the helical periodicity of DNA, meaning that the signals are all present on the same face of the DNA helix in the promoter region. This is consistent with a model where the RNA polymerase contacts the promoter onmore » one side of the DNA, and suggests that the regions important for promoter recognition may include more positions on the DNA than usually assumed. We furthermore analyze the E.coli promoters by calculating the Kullback Leibler distance, and by constructing sequence logos.« less
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.
Gustafson, G; Armour, S L
1986-01-01
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962
Functions of the 3′ and 5′ genome RNA regions of members of the genus Flavivirus
Brinton, Margo A.; Basu, Mausumi
2015-01-01
The positive sense genomes of members of the genus Flavivirus in the family Flaviviridae are ~11 kb nts in length and have a 5′ type I cap but no 3′ poly A. The 5′ and 3′ terminal regions contain short conserved sequences that are proposed to be repeated remnants of an ancient sequence. However, the functions of most of these conserved sequences have not yet been determined. The terminal regions of the genome also contain multiple conserved RNA structures. Functional data for many of these structures has been obtained. Three sets of complementary 3′ and 5′ terminal region sequences, some of which are located in conserved RNA structures, interact to form a panhandle structure that is required for initiation of minus strand RNA synthesis with the 5′ terminal structure functioning as the promoter. How the switch from the terminal RNA structure base pairing to the long distance RNA-RNA interaction is triggered and regulated is not well understood but evidence suggests involvement of a cell protein binding to three sites on the 3′ terminal RNA structures and a cis-acting metastable 3′ RNA element in the 3′ terminal structure. Cell proteins may also be involved in facilitating exponential replication of nascent genomic RNA within replication vesicles at later times of infection cycle. Other conserved RNA structures and/or sequences in the 5′ and 3′ terminal regions have been proposed to regulate genome translation. Additional functions of the 5′ and 3′ terminal sequences have also been reported. PMID:25683510
NASA Astrophysics Data System (ADS)
Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.
2011-10-01
Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.
Kogelman, Lisette J A; Zhernakova, Daria V; Westra, Harm-Jan; Cirera, Susanna; Fredholm, Merete; Franke, Lude; Kadarmideen, Haja N
2015-10-20
Obesity is a multi-factorial health problem in which genetic factors play an important role. Limited results have been obtained in single-gene studies using either genomic or transcriptomic data. RNA sequencing technology has shown its potential in gaining accurate knowledge about the transcriptome, and may reveal novel genes affecting complex diseases. Integration of genomic and transcriptomic variation (expression quantitative trait loci [eQTL] mapping) has identified causal variants that affect complex diseases. We integrated transcriptomic data from adipose tissue and genomic data from a porcine model to investigate the mechanisms involved in obesity using a systems genetics approach. Using a selective gene expression profiling approach, we selected 36 animals based on a previously created genomic Obesity Index for RNA sequencing of subcutaneous adipose tissue. Differential expression analysis was performed using the Obesity Index as a continuous variable in a linear model. eQTL mapping was then performed to integrate 60 K porcine SNP chip data with the RNA sequencing data. Results were restricted based on genome-wide significant single nucleotide polymorphisms, detected differentially expressed genes, and previously detected co-expressed gene modules. Further data integration was performed by detecting co-expression patterns among eQTLs and integration with protein data. Differential expression analysis of RNA sequencing data revealed 458 differentially expressed genes. The eQTL mapping resulted in 987 cis-eQTLs and 73 trans-eQTLs (false discovery rate < 0.05), of which the cis-eQTLs were associated with metabolic pathways. We reduced the eQTL search space by focusing on differentially expressed and co-expressed genes and disease-associated single nucleotide polymorphisms to detect obesity-related genes and pathways. Building a co-expression network using eQTLs resulted in the detection of a module strongly associated with lipid pathways. Furthermore, we detected several obesity candidate genes, for example, ENPP1, CTSL, and ABHD12B. To our knowledge, this is the first study to perform an integrated genomics and transcriptomics (eQTL) study using, and modeling, genomic and subcutaneous adipose tissue RNA sequencing data on obesity in a porcine model. We detected several pathways and potential causal genes for obesity. Further validation and investigation may reveal their exact function and association with obesity.
Duesberg, Peter H.; Vogt, Peter K.
1979-01-01
The genome of the defective avian tumor virus MH2 was identified as a RNA of 5.7 kilobases by its presence in different MH2-helper virus complexes and its absence from pure helper virus, by its unique fingerprint pattern of RNase T1-resistant (T1) oligonucleotides that differed from those of two helper virus RNAs, and by its structural analogy to the RNA of MC29, another avian acute leukemia virus. Two sets of sequences were distinguished in MH2 RNA: 66% hybridized with DNA complementary to helper-independent avian tumor viruses, termed group-specific, and 34% were specific. The percentage of specific sequences is considered a minimal estimate because the MH2 RNA used was about 30% contaminated by helper virus RNA. No sequences related to the transforming src gene of avian sarcoma viruses were found in MH2. MH2 shared three large T1 oligonucleotides with MC29, two of which could also be isolated from a RNase A- and T1-resistant hybrid formed between MH2 RNA and MC29 specific cDNA. These oligonucleotides belong to a group of six that define the specific segment of MC29 RNA described previously. The group-specific sequences of MH2 and MC29 RNA shared only the two smallest out of about 20 T1 oligonucleotides associated with MH2 RNA. It is concluded that the specific sequences of MH2 and MC29 are related, and it is proposed that they are necessary for, or identical with, the onc genes of these viruses. These sequences would define a related class of transforming genes in avian tumor viruses that differs from the src genes of avian sarcoma viruses. Images PMID:221900
Janssen, Stefan; Schudoma, Christian; Steger, Gerhard; Giegerich, Robert
2011-11-03
Many bioinformatics tools for RNA secondary structure analysis are based on a thermodynamic model of RNA folding. They predict a single, "optimal" structure by free energy minimization, they enumerate near-optimal structures, they compute base pair probabilities and dot plots, representative structures of different abstract shapes, or Boltzmann probabilities of structures and shapes. Although all programs refer to the same physical model, they implement it with considerable variation for different tasks, and little is known about the effects of heuristic assumptions and model simplifications used by the programs on the outcome of the analysis. We extract four different models of the thermodynamic folding space which underlie the programs RNAFOLD, RNASHAPES, and RNASUBOPT. Their differences lie within the details of the energy model and the granularity of the folding space. We implement probabilistic shape analysis for all models, and introduce the shape probability shift as a robust measure of model similarity. Using four data sets derived from experimentally solved structures, we provide a quantitative evaluation of the model differences. We find that search space granularity affects the computed shape probabilities less than the over- or underapproximation of free energy by a simplified energy model. Still, the approximations perform similar enough to implementations of the full model to justify their continued use in settings where computational constraints call for simpler algorithms. On the side, we observe that the rarely used level 2 shapes, which predict the complete arrangement of helices, multiloops, internal loops and bulges, include the "true" shape in a rather small number of predicted high probability shapes. This calls for an investigation of new strategies to extract high probability members from the (very large) level 2 shape space of an RNA sequence. We provide implementations of all four models, written in a declarative style that makes them easy to be modified. Based on our study, future work on thermodynamic RNA folding may make a choice of model based on our empirical data. It can take our implementations as a starting point for further program development.
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng
2014-01-01
ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian
2015-01-15
All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.
Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R
1987-01-01
The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.
RNA sequencing: current and prospective uses in metabolic research.
Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay
2014-10-01
Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.
Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.
2015-01-01
Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423
Tomcho, Jeremy C; Tillman, Magdalena R; Znosko, Brent M
2015-09-01
Predicting the secondary structure of RNA is an intermediate in predicting RNA three-dimensional structure. Commonly, determining RNA secondary structure from sequence uses free energy minimization and nearest neighbor parameters. Current algorithms utilize a sequence-independent model to predict free energy contributions of dinucleotide bulges. To determine if a sequence-dependent model would be more accurate, short RNA duplexes containing dinucleotide bulges with different sequences and nearest neighbor combinations were optically melted to derive thermodynamic parameters. These data suggested energy contributions of dinucleotide bulges were sequence-dependent, and a sequence-dependent model was derived. This model assigns free energy penalties based on the identity of nucleotides in the bulge (3.06 kcal/mol for two purines, 2.93 kcal/mol for two pyrimidines, 2.71 kcal/mol for 5'-purine-pyrimidine-3', and 2.41 kcal/mol for 5'-pyrimidine-purine-3'). The predictive model also includes a 0.45 kcal/mol penalty for an A-U pair adjacent to the bulge and a -0.28 kcal/mol bonus for a G-U pair adjacent to the bulge. The new sequence-dependent model results in predicted values within, on average, 0.17 kcal/mol of experimental values, a significant improvement over the sequence-independent model. This model and new experimental values can be incorporated into algorithms that predict RNA stability and secondary structure from sequence.
Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi
2011-09-01
Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.
YAMAT-seq: an efficient method for high-throughput sequencing of mature transfer RNAs.
Shigematsu, Megumi; Honda, Shozo; Loher, Phillipe; Telonis, Aristeidis G; Rigoutsos, Isidore; Kirino, Yohei
2017-05-19
Besides translation, transfer RNAs (tRNAs) play many non-canonical roles in various biological pathways and exhibit highly variable expression profiles. To unravel the emerging complexities of tRNA biology and molecular mechanisms underlying them, an efficient tRNA sequencing method is required. However, the rigid structure of tRNA has been presenting a challenge to the development of such methods. We report the development of Y-shaped Adapter-ligated MAture TRNA sequencing (YAMAT-seq), an efficient and convenient method for high-throughput sequencing of mature tRNAs. YAMAT-seq circumvents the issue of inefficient adapter ligation, a characteristic of conventional RNA sequencing methods for mature tRNAs, by employing the efficient and specific ligation of Y-shaped adapter to mature tRNAs using T4 RNA Ligase 2. Subsequent cDNA amplification and next-generation sequencing successfully yield numerous mature tRNA sequences. YAMAT-seq has high specificity for mature tRNAs and high sensitivity to detect most isoacceptors from minute amount of total RNA. Moreover, YAMAT-seq shows quantitative capability to estimate expression levels of mature tRNAs, and has high reproducibility and broad applicability for various cell lines. YAMAT-seq thus provides high-throughput technique for identifying tRNA profiles and their regulations in various transcriptomes, which could play important regulatory roles in translation and other biological processes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Multicore and GPU algorithms for Nussinov RNA folding
2014-01-01
Background One segment of a RNA sequence might be paired with another segment of the same RNA sequence due to the force of hydrogen bonds. This two-dimensional structure is called the RNA sequence's secondary structure. Several algorithms have been proposed to predict an RNA sequence's secondary structure. These algorithms are referred to as RNA folding algorithms. Results We develop cache efficient, multicore, and GPU algorithms for RNA folding using Nussinov's algorithm. Conclusions Our cache efficient algorithm provides a speedup between 1.6 and 3.0 relative to a naive straightforward single core code. The multicore version of the cache efficient single core algorithm provides a speedup, relative to the naive single core algorithm, between 7.5 and 14.0 on a 6 core hyperthreaded CPU. Our GPU algorithm for the NVIDIA C2050 is up to 1582 times as fast as the naive single core algorithm and between 5.1 and 11.2 times as fast as the fastest previously known GPU algorithm for Nussinov RNA folding. PMID:25082539
Searching RNA motifs and their intermolecular contacts with constraint networks.
Thébault, P; de Givry, S; Schiex, T; Gaspin, C
2006-09-01
Searching RNA gene occurrences in genomic sequences is a task whose importance has been renewed by the recent discovery of numerous functional RNA, often interacting with other ligands. Even if several programs exist for RNA motif search, none exists that can represent and solve the problem of searching for occurrences of RNA motifs in interaction with other molecules. We present a constraint network formulation of this problem. RNA are represented as structured motifs that can occur on more than one sequence and which are related together by possible hybridization. The implemented tool MilPat is used to search for several sRNA families in genomic sequences. Results show that MilPat allows to efficiently search for interacting motifs in large genomic sequences and offers a simple and extensible framework to solve such problems. New and known sRNA are identified as H/ACA candidates in Methanocaldococcus jannaschii. http://carlit.toulouse.inra.fr/MilPaT/MilPat.pl.
Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.
Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming
2012-05-01
We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.
bpRNA: large-scale automated annotation and analysis of RNA secondary structure.
Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David
2018-05-09
While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.
Kramer, Marianne C; Anderson, Stephen J; Gregory, Brian D
2018-06-05
During and after transcription, the fate of an RNA molecule is almost entirely directed by the cohorts of interacting RNA-binding proteins (RBPs). RBPs regulate all stages of the life cycle of a messenger RNA (mRNA) molecule, including splicing, polyadenylation, transport out of the nucleus, RNA stability, and translation. In addition to these functions, RBPs can function to modify or edit the sequences encoded by the RNA. While the sequence for each transcript is determined in the genome, by the time an RNA reaches its final fate, the sequence may have been edited, where one nucleotide is converted to another, or modified, where a chemical group, or sometimes others moieties, are covalently linked to a nucleotide base. These changes to the RNA sequence have major consequences on the function of the RNA. Additionally, variation in the levels of the RBPs that perform the editing or modification can drastically affect the fitness of an organism. Here, we review RBPs that are known to edit or modify RNA ribonucleotides, focusing on the RNA editing ability of the pentatricopeptide repeat (PPR) proteins and the RBPs that modify adenosine to N 6 - methyladenosine. Copyright © 2018 Elsevier Ltd. All rights reserved.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from <1 ng of plasma RNA in <5 h. TGIRT-seq of RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Samad, Abdul Fatah A; Nazaruddin, Nazaruddin; Murad, Abdul Munir Abdul; Jani, Jaeyres; Zainal, Zamri; Ismail, Ismanizan
2018-03-01
In current era, majority of microRNA (miRNA) are being discovered through computational approaches which are more confined towards model plants. Here, for the first time, we have described the identification and characterization of novel miRNA in a non-model plant, Persicaria minor ( P . minor ) using computational approach. Unannotated sequences from deep sequencing were analyzed based on previous well-established parameters. Around 24 putative novel miRNAs were identified from 6,417,780 reads of the unannotated sequence which represented 11 unique putative miRNA sequences. PsRobot target prediction tool was deployed to identify the target transcripts of putative novel miRNAs. Most of the predicted target transcripts (mRNAs) were known to be involved in plant development and stress responses. Gene ontology showed that majority of the putative novel miRNA targets involved in cellular component (69.07%), followed by molecular function (30.08%) and biological process (0.85%). Out of 11 unique putative miRNAs, 7 miRNAs were validated through semi-quantitative PCR. These novel miRNAs discoveries in P . minor may develop and update the current public miRNA database.
Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.
Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W
2010-04-01
Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.
Internal control regions for transcription of eukaryotic tRNA genes.
Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D
1981-01-01
We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245
Demongeot, Jacques; Glade, Nicolas; Moreira, Andrés; Vial, Laurent
2009-01-01
A number of small RNA sequences, located in different non-coding sequences and highly preserved across the tree of life, have been suggested to be molecular fossils, of ancient (and possibly primordial) origin. On the other hand, recent years have revealed the existence of ubiquitous roles for small RNA sequences in modern organisms, in functions ranging from cell regulation to antiviral activity. We propose that a single thread can be followed from the beginning of life in RNA structures selected only for stability reasons through the RNA relics and up to the current coevolution of RNA sequences; such an understanding would shed light both on the history and on the present development of the RNA machinery and interactions. After presenting the evidence (by comparing their sequences) that points toward a common thread, we discuss a scenario of genome coevolution (with emphasis on viral infectious processes) and finally propose a plan for the reevaluation of the stereochemical theory of the genetic code; we claim that it may still be relevant, and not only for understanding the origin of life, but also for a comprehensive picture of regulation in present-day cells. PMID:20111682
Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R
2015-01-01
Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.
Swenson, Luke C; Moores, Andrew; Low, Andrew J; Thielen, Alexander; Dong, Winnie; Woods, Conan; Jensen, Mark A; Wynhoven, Brian; Chan, Dennison; Glascock, Christopher; Harrigan, P Richard
2010-08-01
Tropism testing should rule out CXCR4-using HIV before treatment with CCR5 antagonists. Currently, the recombinant phenotypic Trofile assay (Monogram) is most widely utilized; however, genotypic tests may represent alternative methods. Independent triplicate amplifications of the HIV gp120 V3 region were made from either plasma HIV RNA or proviral DNA. These underwent standard, population-based sequencing with an ABI3730 (RNA n = 63; DNA n = 40), or "deep" sequencing with a Roche/454 Genome Sequencer-FLX (RNA n = 12; DNA n = 12). Position-specific scoring matrices (PSSMX4/R5) (-6.96 cutoff) and geno2pheno[coreceptor] (5% false-positive rate) inferred tropism from V3 sequence. These methods were then independently validated with a separate, blinded dataset (n = 278) of screening samples from the maraviroc MOTIVATE trials. Standard sequencing of HIV RNA with PSSM yielded 69% sensitivity and 91% specificity, relative to Trofile. The validation dataset gave 75% sensitivity and 83% specificity. Proviral DNA plus PSSM gave 77% sensitivity and 71% specificity. "Deep" sequencing of HIV RNA detected >2% inferred-CXCR4-using virus in 8/8 samples called non-R5 by Trofile, and <2% in 4/4 samples called R5. Triplicate analyses of V3 standard sequence data detect greater proportions of CXCR4-using samples than previously achieved. Sequencing proviral DNA and "deep" V3 sequencing may also be useful tools for assessing tropism.
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.
2013-01-01
We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231
Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts
Jukam, David; Teran, Nicole A; Risca, Viviana I; Smith, Owen K; Johnson, Whitney L; Skotheim, Jan M; Greenleaf, William James
2018-01-01
RNA is a critical component of chromatin in eukaryotes, both as a product of transcription, and as an essential constituent of ribonucleoprotein complexes that regulate both local and global chromatin states. Here, we present a proximity ligation and sequencing method called Chromatin-Associated RNA sequencing (ChAR-seq) that maps all RNA-to-DNA contacts across the genome. Using Drosophila cells, we show that ChAR-seq provides unbiased, de novo identification of targets of chromatin-bound RNAs including nascent transcripts, chromosome-specific dosage compensation ncRNAs, and genome-wide trans-associated RNAs involved in co-transcriptional RNA processing. PMID:29648534
Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki
2015-06-01
Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.
Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif
2018-07-01
Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.
Zhang, Fantao; Luo, Xiangdong; Zhou, Yi; Xie, Jiankun
2016-04-01
To identify drought stress-responsive conserved microRNA (miRNA) from Dongxiang wild rice (Oryza rufipogon Griff., DXWR) on a genome-wide scale, high-throughput sequencing technology was used to sequence libraries of DXWR samples, treated with and without drought stress. 505 conserved miRNAs corresponding to 215 families were identified. 17 were significantly down-regulated and 16 were up-regulated under drought stress. Stem-loop qRT-PCR revealed the same expression patterns as high-throughput sequencing, suggesting the accuracy of the sequencing result was high. Potential target genes of the drought-responsive miRNA were predicted to be involved in diverse biological processes. Furthermore, 16 miRNA families were first identified to be involved in drought stress response from plants. These results present a comprehensive view of the conserved miRNA and their expression patterns under drought stress for DXWR, which will provide valuable information and sequence resources for future basis studies.
Transcription profile of boar spermatozoa as revealed by RNA-sequencing
USDA-ARS?s Scientific Manuscript database
High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...
Characterization of circulating transfer RNA-Derived RNA fragments in cattle
USDA-ARS?s Scientific Manuscript database
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA Fragments (tRFs) in cattle. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences a...
Characterization of Human Salivary Extracellular RNA by Next-generation Sequencing.
Li, Feng; Kaczor-Urbanowicz, Karolina Elżbieta; Sun, Jie; Majem, Blanca; Lo, Hsien-Chun; Kim, Yong; Koyano, Kikuye; Liu Rao, Shannon; Young Kang, So; Mi Kim, Su; Kim, Kyoung-Mee; Kim, Sung; Chia, David; Elashoff, David; Grogan, Tristan R; Xiao, Xinshu; Wong, David T W
2018-04-23
It was recently discovered that abundant and stable extracellular RNA (exRNA) species exist in bodily fluids. Saliva is an emerging biofluid for biomarker development for noninvasive detection and screening of local and systemic diseases. Use of RNA-Sequencing (RNA-Seq) to profile exRNA is rapidly growing; however, no single preparation and analysis protocol can be used for all biofluids. Specifically, RNA-Seq of saliva is particularly challenging owing to high abundance of bacterial contents and low abundance of salivary exRNA. Given the laborious procedures needed for RNA-Seq library construction, sequencing, data storage, and data analysis, saliva-specific and optimized protocols are essential. We compared different RNA isolation methods and library construction kits for long and small RNA sequencing. The role of ribosomal RNA (rRNA) depletion also was evaluated. The miRNeasy Micro Kit (Qiagen) showed the highest total RNA yield (70.8 ng/mL cell-free saliva) and best small RNA recovery, and the NEBNext library preparation kits resulted in the highest number of detected human genes [5649-6813 at 1 reads per kilobase RNA per million mapped (RPKM)] and small RNAs [482-696 microRNAs (miRNAs) and 190-214 other small RNAs]. The proportion of human RNA-Seq reads was much higher in rRNA-depleted saliva samples (41%) than in samples without rRNA depletion (14%). In addition, the transfer RNA (tRNA)-derived RNA fragments (tRFs), a novel class of small RNAs, were highly abundant in human saliva, specifically tRF-4 (4%) and tRF-5 (15.25%). Our results may help in selection of the best adapted methods of RNA isolation and small and long RNA library constructions for salivary exRNA studies. © 2018 American Association for Clinical Chemistry.
Sequence specificity of the human mRNA N6-adenosine methylase in vitro.
Harper, J E; Miceli, S M; Roberts, R J; Manley, J L
1990-01-01
N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767
Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.
Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A
2016-05-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Skin microbiome surveys are strongly influenced by experimental design
Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.
2016-01-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039
USDA-ARS?s Scientific Manuscript database
This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...
Armored RNA Technology for Production of Ribonuclease-Resistant Viral RNA Controls and Standards
Pasloske, Brittan L.; Walkerpeach, Cindy R.; Obermoeller, R. Dawn; Winkler, Matthew; DuBois, Dwight B.
1998-01-01
The widespread use of sensitive assays for the detection of viral and cellular RNA sequences has created a need for stable, well-characterized controls and standards. We describe the development of a versatile, novel system for creating RNase-resistant RNA. “Armored RNA” is a complex of MS2 bacteriophage coat protein and RNA produced in Escherichia coli by the induction of an expression plasmid that encodes the coat protein and an RNA standard sequence. The RNA sequences are completely protected from RNase digestion within the bacteriophage-like complexes. As a prototype, a 172-base consensus sequence from a portion of the human immunodeficiency virus type 1 (HIV-1) gag gene was synthesized and cloned into the packaging vector used to produce the bacteriophage-like particles. After production and purification, the resulting HIV-1 Armored RNA particles were shown to be resistant to degradation in human plasma and produced reproducible results in the Amplicor HIV-1 Monitor assay for 180 days when stored at −20°C or for 60 days at 4°C. Additionally, Armored RNA preparations are homogeneous and noninfectious. PMID:9817878
Kim, Jung-Mi; Yun, Suk-Hyun; Park, Seung-Moon; Ko, Han-Gyu; Kim, Dae-Hyuk
2013-01-01
dsRNA was found in malformed cultures of Lentinula edodes strain FMRI0339, one of the three most popular sawdust cultivated commercial strains of shiitake, and was also found in healthy-looking fruiting bodies and actively growing mycelia. Cloning of the partial genome of the dsRNA revealed the presence of the RdRp sequence of a novel L. edodes mycovirus (LeV), and sequence comparison of the cloned amplicon showed identical sequences sequence to known RNA-dependent RNA polymerase genes of LeV found in strain HKA. The meiotic stability of dsRNA was examined by measuring the ratio of the presence of dsRNA among sexual monokaryotic progeny. More than 40% of the monokaryotic progeny still contained the dsRNA, indicating the persistence of dsRNA during sexual reproduction. Comparing the mycelia growth of monokaryotic progeny suggested that there appeared to be a tendency toward a lower frequency of virus incidence in actively growing progeny. PMID:25288977
Detection of PIWI and piRNAs in the mitochondria of mammalian cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, ChangHyuk, E-mail: netbuyer@hanmail.net; Tak, Hyosun, E-mail: chuberry@naver.com; Rho, Mina, E-mail: minarho@hanyang.ac.kr
2014-03-28
Highlights: • piRNA sequences were mapped to human mitochondrial (mt) genome. • We inspected small RNA-Seq datasets from somatic cell mt subcellular fractions. • Piwi and piRNA transcripts are present in mammalian somatic cancer cell mt fractions. - Abstract: Piwi-interacting RNAs (piRNAs) are 26–31 nt small noncoding RNAs that are processed from their longer precursor transcripts by Piwi proteins. Localization of Piwi and piRNA has been reported mostly in nucleus and cytoplasm of higher eukaryotes germ-line cells, where it is believed that known piRNA sequences are located in repeat regions of nuclear genome in germ-line cells. However, localization of PIWImore » and piRNA in mammalian somatic cell mitochondria yet remains largely unknown. We identified 29 piRNA sequence alignments from various regions of the human mitochondrial genome. Twelve out 29 piRNA sequences matched stem-loop fragment sequences of seven distinct tRNAs. We observed their actual expression in mitochondria subcellular fractions by inspecting mitochondrial-specific small RNA-Seq datasets. Of interest, the majority of the 29 piRNAs overlapped with multiple longer transcripts (expressed sequence tags) that are unique to the human mitochondrial genome. The presence of mature piRNAs in mitochondria was detected by qRT-PCR of mitochondrial subcellular RNAs. Further validation showed detection of Piwi by colocalization using anti-Piwil1 and mitochondria organelle-specific protein antibodies.« less
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.
Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A
2018-05-01
Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Advances in single-cell RNA sequencing and its applications in cancer research.
Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming
2017-08-08
Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years' development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5.
Advances in single-cell RNA sequencing and its applications in cancer research
Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming
2017-01-01
Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years’ development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5. Perspectives PMID:28881849
Gautam, Aarti; Kumar, Raina; Dimitrov, George; Hoke, Allison; Hammamieh, Rasha; Jett, Marti
2016-10-01
miRNAs act as important regulators of gene expression by promoting mRNA degradation or by attenuating protein translation. Since miRNAs are stably expressed in bodily fluids, there is growing interest in profiling these miRNAs, as it is minimally invasive and cost-effective as a diagnostic matrix. A technical hurdle in studying miRNA dynamics is the ability to reliably extract miRNA as small sample volumes and low RNA abundance create challenges for extraction and downstream applications. The purpose of this study was to develop a pipeline for the recovery of miRNA using small volumes of archived serum samples. The RNA was extracted employing several widely utilized RNA isolation kits/methods with and without addition of a carrier. The small RNA library preparation was carried out using Illumina TruSeq small RNA kit and sequencing was carried out using Illumina platform. A fraction of five microliters of total RNA was used for library preparation as quantification is below the detection limit. We were able to profile miRNA levels in serum from all the methods tested. We found out that addition of nucleic acid based carrier molecules had higher numbers of processed reads but it did not enhance the mapping of any miRBase annotated sequences. However, some of the extraction procedures offer certain advantages: RNA extracted by TRIzol seemed to align to the miRBase best; extractions using TRIzol with carrier yielded higher miRNA-to-small RNA ratios. Nuclease free glycogen can be carrier of choice for miRNA sequencing. Our findings illustrate that miRNA extraction and quantification is influenced by the choice of methodologies. Addition of nucleic acid- based carrier molecules during extraction procedure is not a good choice when assaying miRNA using sequencing. The careful selection of an extraction method permits the archived serum samples to become valuable resources for high-throughput applications.
Mustoe, Anthony M.; Brooks, Charles L.; Al-Hashimi, Hashim M.
2014-01-01
Recent studies have shown that basic steric and connectivity constraints encoded at the secondary structure level are key determinants of 3D structure and dynamics in simple two-way RNA junctions. However, the role of these topological constraints in higher order RNA junctions remains poorly understood. Here, we use a specialized coarse-grained molecular dynamics model to directly probe the thermodynamic contributions of topological constraints in defining the 3D architecture and dynamics of transfer RNA (tRNA). Topological constraints alone restrict tRNA's allowed conformational space by over an order of magnitude and strongly discriminate against formation of non-native tertiary contacts, providing a sequence independent source of folding specificity. Topological constraints also give rise to long-range correlations between the relative orientation of tRNA's helices, which in turn provides a mechanism for encoding thermodynamic cooperativity between distinct tertiary interactions. These aspects of topological constraints make it such that only several tertiary interactions are needed to confine tRNA to its native global structure and specify functionally important 3D dynamics. We further show that topological constraints are conserved across tRNA's different naturally occurring secondary structures. Taken together, our results emphasize the central role of secondary-structure-encoded topological constraints in defining RNA 3D structure, dynamics and folding. PMID:25217593
A comparison of RNA with DNA in template-directed synthesis
NASA Technical Reports Server (NTRS)
Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
2000-01-01
Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.
Wang, Zheng Jia; Huang, Jian Qin; Huang, You Jun; Li, Zheng; Zheng, Bing Song
2012-08-01
Hickory (Carya cathayensis Sarg.) is an economically important woody plant in China, but its long juvenile phase delays yield. MicroRNAs (miRNAs) are critical regulators of genes and important for normal plant development and physiology, including flower development. We used Solexa technology to sequence two small RNA libraries from two floral differentiation stages in hickory to identify miRNAs related to flower development. We identified 39 conserved miRNA sequences from 114 loci belonging to 23 families as well as two novel and ten potential novel miRNAs belonging to nine families. Moreover, 35 conserved miRNA*s and two novel miRNA*s were detected. Twenty miRNA sequences from 49 loci belonging to 11 families were differentially expressed; all were up-regulated at the later stage of flower development in hickory. Quantitative real-time PCR of 12 conserved miRNA sequences, five novel miRNA families, and two novel miRNA*s validated that all were expressed during hickory flower development, and the expression patterns were similar to those detected with Solexa sequencing. Finally, a total of 146 targets of the novel and conserved miRNAs were predicted. This study identified a diverse set of miRNAs that were closely related to hickory flower development and that could help in plant floral induction.
Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny
2015-01-01
Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619
Woo, Jiwon; Yu, Kyung Lee; Lee, Sun Hee; You, Ji Chang
2015-02-06
Although cis-acting packaging signal RNA sequences for the influenza virus NP encoding vRNA have been identified recently though genetic studies, little is known about the interaction between NP and the vRNA packaging signals either in vivo or in vitro. Here, we provide evidence that NP is able to interact specifically with the vRNA packaging sequence RNA within living cells and that the specific RNA binding activity of NP in vivo requires both the N-terminal and central region of the protein. This assay established would be a valuable tool for further detailed studies of the NP-packaging signal RNA interaction in living cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Genomic Sequence of the WHO International Standard for Hepatitis A Virus RNA.
Jenkins, Adrian; Minhas, Rehan; Morris, Clare; Berry, Neil
2018-05-10
The World Health Organization (WHO) international standard for hepatitis A virus (HAV) RNA nucleic acid assays was characterized by complete genome sequencing. The entire coding sequence and noncoding regions were assigned HAV genotype IB. This information will aid the design, development, and evaluation of HAV RNA amplification assays. Copyright © 2018 Jenkins et al.
Zhang, Hanyuan; Vieira Resende E Silva, Bruno; Cui, Juan
2018-05-01
Small RNA sequencing is the most widely used tool for microRNA (miRNA) discovery, and shows great potential for the efficient study of miRNA cross-species transport, i.e., by detecting the presence of exogenous miRNA sequences in the host species. Because of the increased appreciation of dietary miRNAs and their far-reaching implication in human health, research interests are currently growing with regard to exogenous miRNAs bioavailability, mechanisms of cross-species transport and miRNA function in cellular biological processes. In this article, we present microRNA Discovery (miRDis), a new small RNA sequencing data analysis pipeline for both endogenous and exogenous miRNA detection. Specifically, we developed and deployed a Web service that supports the annotation and expression profiling data of known host miRNAs and the detection of novel miRNAs, other noncoding RNAs, and the exogenous miRNAs from dietary species. As a proof-of-concept, we analyzed a set of human plasma sequencing data from a milk-feeding study where 225 human miRNAs were detected in the plasma samples and 44 show elevated expression after milk intake. By examining the bovine-specific sequences, data indicate that three bovine miRNAs (bta-miR-378, -181* and -150) are present in human plasma possibly because of the dietary uptake. Further evaluation based on different sets of public data demonstrates that miRDis outperforms other state-of-the-art tools in both detection and quantification of miRNA from either animal or plant sources. The miRDis Web server is available at: http://sbbi.unl.edu/miRDis/index.php.
Pragmatic turn in biology: From biological molecules to genetic content operators.
Witzany, Guenther
2014-08-26
Erwin Schrödinger's question "What is life?" received the answer for decades of "physics + chemistry". The concepts of Alain Turing and John von Neumann introduced a third term: "information". This led to the understanding of nucleic acid sequences as a natural code. Manfred Eigen adapted the concept of Hammings "sequence space". Similar to Hilbert space, in which every ontological entity could be defined by an unequivocal point in a mathematical axiomatic system, in the abstract "sequence space" concept each point represents a unique syntactic structure and the value of their separation represents their dissimilarity. In this concept molecular features of the genetic code evolve by means of self-organisation of matter. Biological selection determines the fittest types among varieties of replication errors of quasi-species. The quasi-species concept dominated evolution theory for many decades. In contrast to this, recent empirical data on the evolution of DNA and its forerunners, the RNA-world and viruses indicate cooperative agent-based interactions. Group behaviour of quasi-species consortia constitute de novo and arrange available genetic content for adaptational purposes within real-life contexts that determine epigenetic markings. This review focuses on some fundamental changes in biology, discarding its traditional status as a subdiscipline of physics and chemistry.
Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren
2016-11-01
Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is usually limited by sampling size. Sequence conservation-based methods are further confounded by structural constraints and multifunctionality of proteins. Here we present a method that can systematically identify and annotate functional residues of a given protein. We used a high-throughput functional profiling platform to identify essential residues. Coupling it with homologous-structure comparison, we were able to annotate multiple functions of proteins. We demonstrated the method with the PB1 protein of influenza A virus and identified novel functional residues in addition to its canonical function as an RNA-dependent RNA polymerase. Not limited to virology, this method is generally applicable to other proteins that can be functionally selected and about which homologous-structure information is available. Copyright © 2016 Du et al.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
NASA Technical Reports Server (NTRS)
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Research Techniques Made Simple: Single-Cell RNA Sequencing and its Applications in Dermatology.
Wu, Xiaojun; Yang, Bin; Udo-Inyang, Imo; Ji, Suyun; Ozog, David; Zhou, Li; Mi, Qing-Sheng
2018-05-01
RNA sequencing is one of the most highly reliable and reproducible methods of assessing the cell transcriptome. As high-throughput RNA sequencing libraries at the single cell level have recently developed, single cell RNA sequencing has become more feasible and popular in biology research. Single cell RNA sequencing allows investigators to evaluate cell transcriptional profiles at the single cell level. It has become a very useful tool to perform investigations that could not be addressed by other methodologies, such as the assessment of cell-to-cell variation, the identification of rare populations, and the determination of heterogeneity within a cell population. So far, the single cell RNA sequencing technique has been widely applied to embryonic development, immune cell development, and human disease progress and treatment. Here, we describe the history of single cell technology development and its potential application in the field of dermatology. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred
2014-11-20
Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
An Accurate Scalable Template-based Alignment Algorithm
Gardner, David P.; Xu, Weijia; Miranker, Daniel P.; Ozer, Stuart; Cannone, Jamie J.; Gutell, Robin R.
2013-01-01
The rapid determination of nucleic acid sequences is increasing the number of sequences that are available. Inherent in a template or seed alignment is the culmination of structural and functional constraints that are selecting those mutations that are viable during the evolution of the RNA. While we might not understand these structural and functional, template-based alignment programs utilize the patterns of sequence conservation to encapsulate the characteristics of viable RNA sequences that are aligned properly. We have developed a program that utilizes the different dimensions of information in rCAD, a large RNA informatics resource, to establish a profile for each position in an alignment. The most significant include sequence identity and column composition in different phylogenetic taxa. We have compared our methods with a maximum of eight alternative alignment methods on different sets of 16S and 23S rRNA sequences with sequence percent identities ranging from 50% to 100%. The results showed that CRWAlign outperformed the other alignment methods in both speed and accuracy. A web-based alignment server is available at http://www.rna.ccbb.utexas.edu/SAE/2F/CRWAlign. PMID:24772376
Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences
NASA Technical Reports Server (NTRS)
Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.
1995-01-01
Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.
Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas
2010-08-01
We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.
Comprehensive discovery of noncoding RNAs in acute myeloid leukemia cell transcriptomes.
Zhang, Jin; Griffith, Malachi; Miller, Christopher A; Griffith, Obi L; Spencer, David H; Walker, Jason R; Magrini, Vincent; McGrath, Sean D; Ly, Amy; Helton, Nichole M; Trissal, Maria; Link, Daniel C; Dang, Ha X; Larson, David E; Kulkarni, Shashikant; Cordes, Matthew G; Fronick, Catrina C; Fulton, Robert S; Klco, Jeffery M; Mardis, Elaine R; Ley, Timothy J; Wilson, Richard K; Maher, Christopher A
2017-11-01
To detect diverse and novel RNA species comprehensively, we compared deep small RNA and RNA sequencing (RNA-seq) methods applied to a primary acute myeloid leukemia (AML) sample. We were able to discover previously unannotated small RNAs using deep sequencing of a library method using broader insert size selection. We analyzed the long noncoding RNA (lncRNA) landscape in AML by comparing deep sequencing from multiple RNA-seq library construction methods for the sample that we studied and then integrating RNA-seq data from 179 AML cases. This identified lncRNAs that are completely novel, differentially expressed, and associated with specific AML subtypes. Our study revealed the complexity of the noncoding RNA transcriptome through a combined strategy of strand-specific small RNA and total RNA-seq. This dataset will serve as an invaluable resource for future RNA-based analyses. Copyright © 2017 ISEH – Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.
Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H
2005-01-01
To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.
Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing
Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...
Mollusk genes encoding lysine tRNA (UUU) contain introns.
Matsuo, M; Abe, Y; Saruta, Y; Okada, N
1995-11-20
New intron-containing genes encoding tRNAs were discovered when genomic DNA isolated from various animal species was amplified by the polymerase chain reaction (PCR) with primers based on sequences of rabbit tRNA(Lys). From sequencing analysis of the products of PCR, we found that introns are present in several genes encoding tRNA(Lys) in mollusks, such as Loligo bleekeri (squid) and Octopus vulgaris (octopus). These introns were specific to genes encoding tRNA(Lys)(CUU) and were not present in genes encoding tRNA(Lys)(CUU). In addition, the sequences of the introns were different from one another. To confirm the results of our initial experiments, we isolated and sequenced genes encoding tRNA(Lys)(CUU) and tRNA(Lys)(UUU). The gene for tRNA(Lys)(UUU) from squid contained an intron, whose sequence was the same as that identified by PCR, and the gene formed a cluster with a corresponding pseudogene. Several DNA regions of 2.1 kb containing this cluster appeared to be tandemly arrayed in the squid genome. By contrast, the gene encoding tRNA(Lys)(CUU) did not contain an intron, as shown also by PCR. The tRNA(Lys)(UUU) that corresponded to the analyzed gene was isolated and characterized. The present study provides the first example of an intron-containing gene encoding a tRNA in mollusks and suggests the universality of introns in such genes in higher eukaryotes.
Bazak, Lily; Haviv, Ami; Barak, Michal; Jacob-Hirsch, Jasmine; Deng, Patricia; Zhang, Rui; Isaacs, Farren J; Rechavi, Gideon; Li, Jin Billy; Eisenberg, Eli; Levanon, Erez Y
2014-03-01
RNA molecules transmit the information encoded in the genome and generally reflect its content. Adenosine-to-inosine (A-to-I) RNA editing by ADAR proteins converts a genomically encoded adenosine into inosine. It is known that most RNA editing in human takes place in the primate-specific Alu sequences, but the extent of this phenomenon and its effect on transcriptome diversity are not yet clear. Here, we analyzed large-scale RNA-seq data and detected ∼1.6 million editing sites. As detection sensitivity increases with sequencing coverage, we performed ultradeep sequencing of selected Alu sequences and showed that the scope of editing is much larger than anticipated. We found that virtually all adenosines within Alu repeats that form double-stranded RNA undergo A-to-I editing, although most sites exhibit editing at only low levels (<1%). Moreover, using high coverage sequencing, we observed editing of transcripts resulting from residual antisense expression, doubling the number of edited sites in the human genome. Based on bioinformatic analyses and deep targeted sequencing, we estimate that there are over 100 million human Alu RNA editing sites, located in the majority of human genes. These findings set the stage for exploring how this primate-specific massive diversification of the transcriptome is utilized.
Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu
2016-12-01
RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.
A deep learning method for lincRNA detection using auto-encoder algorithm.
Yu, Ning; Yu, Zeng; Pan, Yi
2017-12-06
RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly annotated lincRNA data, deep learning methods based on auto-encoder algorithm can exert their capability in knowledge learning in order to capture the useful features and the information correlation along DNA genome sequences for lincRNA detection. As our knowledge, this is the first application to adopt the deep learning techniques for identifying lincRNA transcription sequences.
Engineered proteins with PUF scaffold to manipulate RNA metabolism
Wang, Yang; Wang, Zefeng; Tanaka Hall, Traci M.
2013-01-01
Pumilio/fem-3 mRNA binding factor (FBF) proteins are characterized by a sequence-specific RNA-binding domain. This unique single-stranded RNA recognition module, whose sequence specificity can be reprogrammed, has been fused with functional modules to engineer protein factors with various functions. Here we summarize the advancement in developing RNA regulatory tools and opportunities for the future. PMID:23731364
How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity
NASA Technical Reports Server (NTRS)
Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr
1992-01-01
16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.
INFO-RNA--a fast approach to inverse RNA folding.
Busch, Anke; Backofen, Rolf
2006-08-01
The structure of RNA molecules is often crucial for their function. Therefore, secondary structure prediction has gained much interest. Here, we consider the inverse RNA folding problem, which means designing RNA sequences that fold into a given structure. We introduce a new algorithm for the inverse folding problem (INFO-RNA) that consists of two parts; a dynamic programming method for good initial sequences and a following improved stochastic local search that uses an effective neighbor selection method. During the initialization, we design a sequence that among all sequences adopts the given structure with the lowest possible energy. For the selection of neighbors during the search, we use a kind of look-ahead of one selection step applying an additional energy-based criterion. Afterwards, the pre-ordered neighbors are tested using the actual optimization criterion of minimizing the structure distance between the target structure and the mfe structure of the considered neighbor. We compared our algorithm to RNAinverse and RNA-SSD for artificial and biological test sets. Using INFO-RNA, we performed better than RNAinverse and in most cases, we gained better results than RNA-SSD, the probably best inverse RNA folding tool on the market. www.bioinf.uni-freiburg.de?Subpages/software.html.
Brown, Roger B; Madrid, Nathaniel J; Suzuki, Hideaki; Ness, Scott A
2017-01-01
RNA-sequencing (RNA-seq) has become the standard method for unbiased analysis of gene expression but also provides access to more complex transcriptome features, including alternative RNA splicing, RNA editing, and even detection of fusion transcripts formed through chromosomal translocations. However, differences in library methods can adversely affect the ability to recover these different types of transcriptome data. For example, some methods have bias for one end of transcripts or rely on low-efficiency steps that limit the complexity of the resulting library, making detection of rare transcripts less likely. We tested several commonly used methods of RNA-seq library preparation and found vast differences in the detection of advanced transcriptome features, such as alternatively spliced isoforms and RNA editing sites. By comparing several different protocols available for the Ion Proton sequencer and by utilizing detailed bioinformatics analysis tools, we were able to develop an optimized random primer based RNA-seq technique that is reliable at uncovering rare transcript isoforms and RNA editing features, as well as fusion reads from oncogenic chromosome rearrangements. The combination of optimized libraries and rapid Ion Proton sequencing provides a powerful platform for the transcriptome analysis of research and clinical samples.
Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P
1984-01-01
The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550
A tale of two sequences: microRNA-target chimeric reads.
Broughton, James P; Pasquinelli, Amy E
2016-04-04
In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.
RECOVIR Software for Identifying Viruses
NASA Technical Reports Server (NTRS)
Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui
2013-01-01
Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.
Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter
2014-01-13
Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.
GobyWeb: Simplified Management and Analysis of Gene Expression and DNA Methylation Sequencing Data
Dorff, Kevin C.; Chambwe, Nyasha; Zeno, Zachary; Simi, Manuele; Shaknovich, Rita; Campagne, Fabien
2013-01-01
We present GobyWeb, a web-based system that facilitates the management and analysis of high-throughput sequencing (HTS) projects. The software provides integrated support for a broad set of HTS analyses and offers a simple plugin extension mechanism. Analyses currently supported include quantification of gene expression for messenger and small RNA sequencing, estimation of DNA methylation (i.e., reduced bisulfite sequencing and whole genome methyl-seq), or the detection of pathogens in sequenced data. In contrast to previous analysis pipelines developed for analysis of HTS data, GobyWeb requires significantly less storage space, runs analyses efficiently on a parallel grid, scales gracefully to process tens or hundreds of multi-gigabyte samples, yet can be used effectively by researchers who are comfortable using a web browser. We conducted performance evaluations of the software and found it to either outperform or have similar performance to analysis programs developed for specialized analyses of HTS data. We found that most biologists who took a one-hour GobyWeb training session were readily able to analyze RNA-Seq data with state of the art analysis tools. GobyWeb can be obtained at http://gobyweb.campagnelab.org and is freely available for non-commercial use. GobyWeb plugins are distributed in source code and licensed under the open source LGPL3 license to facilitate code inspection, reuse and independent extensions http://github.com/CampagneLaboratory/gobyweb2-plugins. PMID:23936070
2013-09-01
sequence dataset. All procedures were performed by personnel in the IIMT UT Southwestern Genomics and Microarray Core using standard protocols. More... sequencing run, samples were demultiplexed using standard algorithms in the Genomics and Microarray Core and processed into individual sample Illumina single... Sequencing (RNA-Seq), using Illumina’s multiplexing mRNA-Seq to generate full sequence libraries from the poly-A tailed RNA to a read depth of 30
2018-01-01
FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722
Long-term forest soil warming alters microbial communities in temperate forest soils
DeAngelis, Kristen M.; Pold, Grace; Topçuoğlu, Begüm D.; van Diepen, Linda T. A.; Varney, Rebecca M.; Blanchard, Jeffrey L.; Melillo, Jerry; Frey, Serita D.
2015-01-01
Soil microbes are major drivers of soil carbon cycling, yet we lack an understanding of how climate warming will affect microbial communities. Three ongoing field studies at the Harvard Forest Long-term Ecological Research (LTER) site (Petersham, MA) have warmed soils 5°C above ambient temperatures for 5, 8, and 20 years. We used this chronosequence to test the hypothesis that soil microbial communities have changed in response to chronic warming. Bacterial community composition was studied using Illumina sequencing of the 16S ribosomal RNA gene, and bacterial and fungal abundance were assessed using quantitative PCR. Only the 20-year warmed site exhibited significant change in bacterial community structure in the organic soil horizon, with no significant changes in the mineral soil. The dominant taxa, abundant at 0.1% or greater, represented 0.3% of the richness but nearly 50% of the observations (sequences). Individual members of the Actinobacteria, Alphaproteobacteria and Acidobacteria showed strong warming responses, with one Actinomycete decreasing from 4.5 to 1% relative abundance with warming. Ribosomal RNA copy number can obfuscate community profiles, but is also correlated with maximum growth rate or trophic strategy among bacteria. Ribosomal RNA copy number correction did not affect community profiles, but rRNA copy number was significantly decreased in warming plots compared to controls. Increased bacterial evenness, shifting beta diversity, decreased fungal abundance and increased abundance of bacteria with low rRNA operon copy number, including Alphaproteobacteria and Acidobacteria, together suggest that more or alternative niche space is being created over the course of long-term warming. PMID:25762989
Identifying novel sequence variants of RNA 3D motifs
Zirbel, Craig L.; Roll, James; Sweeney, Blake A.; Petrov, Anton I.; Pirrung, Meg; Leontis, Neocles B.
2015-01-01
Predicting RNA 3D structure from sequence is a major challenge in biophysics. An important sub-goal is accurately identifying recurrent 3D motifs from RNA internal and hairpin loop sequences extracted from secondary structure (2D) diagrams. We have developed and validated new probabilistic models for 3D motif sequences based on hybrid Stochastic Context-Free Grammars and Markov Random Fields (SCFG/MRF). The SCFG/MRF models are constructed using atomic-resolution RNA 3D structures. To parameterize each model, we use all instances of each motif found in the RNA 3D Motif Atlas and annotations of pairwise nucleotide interactions generated by the FR3D software. Isostericity relations between non-Watson–Crick basepairs are used in scoring sequence variants. SCFG techniques model nested pairs and insertions, while MRF ideas handle crossing interactions and base triples. We use test sets of randomly-generated sequences to set acceptance and rejection thresholds for each motif group and thus control the false positive rate. Validation was carried out by comparing results for four motif groups to RMDetect. The software developed for sequence scoring (JAR3D) is structured to automatically incorporate new motifs as they accumulate in the RNA 3D Motif Atlas when new structures are solved and is available free for download. PMID:26130723
Single-Cell RNA-Sequencing: Assessment of Differential Expression Analysis Methods.
Dal Molin, Alessandra; Baruzzo, Giacomo; Di Camillo, Barbara
2017-01-01
The sequencing of the transcriptomes of single-cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types and for the study of stochastic gene expression. In recent years, various tools for analyzing single-cell RNA-sequencing data have been proposed, many of them with the purpose of performing differentially expression analysis. In this work, we compare four different tools for single-cell RNA-sequencing differential expression, together with two popular methods originally developed for the analysis of bulk RNA-sequencing data, but largely applied to single-cell data. We discuss results obtained on two real and one synthetic dataset, along with considerations about the perspectives of single-cell differential expression analysis. In particular, we explore the methods performance in four different scenarios, mimicking different unimodal or bimodal distributions of the data, as characteristic of single-cell transcriptomics. We observed marked differences between the selected methods in terms of precision and recall, the number of detected differentially expressed genes and the overall performance. Globally, the results obtained in our study suggest that is difficult to identify a best performing tool and that efforts are needed to improve the methodologies for single-cell RNA-sequencing data analysis and gain better accuracy of results.
BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.
Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun
2015-01-15
It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Han, Limin; Chen, Chen; Wang, Zhezhi
2018-01-01
Epipremnum aureum is an important foliage plant in the Araceae family. In this study, we have sequenced the complete chloroplast genome of E. aureum by using Illumina Hiseq sequencing platforms. This genome is a double-stranded circular DNA sequence of 164,831 bp that contains 35.8% GC. The two inverted repeats (IRa and IRb; 26,606 bp) are spaced by a small single-copy region (22,868 bp) and a large single-copy region (88,751 bp). The chloroplast genome has 131 (113 unique) functional genes, including 86 (79 unique) protein-coding genes, 37 (30 unique) tRNA genes, and eight (four unique) rRNA genes. Tandem repeats comprise the majority of the 43 long repetitive sequences. In addition, 111 simple sequence repeats are present, with mononucleotides being the most common type and di- and tetranucleotides being infrequent events. Positive selection pressure on rps12 in the E. aureum chloroplast has been demonstrated via synonymous and nonsynonymous substitution rates and selection pressure sites analyses. Ycf15 and infA are pseudogenes in this species. We constructed a Maximum Likelihood phylogenetic tree based on the complete chloroplast genomes of 38 species from 13 families. Those results strongly indicated that E. aureum is positioned as the sister of Colocasia esculenta within the Araceae family. This work may provide information for further study of the molecular phylogenetic relationships within Araceae, as well as molecular markers and breeding novel varieties by chloroplast genetic-transformation of E. aureum in particular. PMID:29529038
Du, Yushen; Wu, Nicholas C.; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting
2016-01-01
ABSTRACT Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. PMID:27803181
Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado
Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.
2012-01-01
A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720
NASA Technical Reports Server (NTRS)
Fox, G. E.
1985-01-01
Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
A phase transition in energy-filtered RNA secondary structures.
Han, Hillary S W; Reidys, Christian M
2012-10-01
In this article we study the effect of energy parameters on minimum free energy (mfe) RNA secondary structures. Employing a simplified combinatorial energy model that is only dependent on the diagram representation and is not sequence-specific, we prove the following dichotomy result. Mfe structures derived via the Turner energy parameters contain only finitely many complex irreducible substructures, and just minor parameter changes produce a class of mfe structures that contain a large number of small irreducibles. We localize the exact point at which the distribution of irreducibles experiences this phase transition from a discrete limit to a central limit distribution and, subsequently, put our result into the context of quantifying the effect of sparsification of the folding of these respective mfe structures. We show that the sparsification of realistic mfe structures leads to a constant time and space reduction, and that the sparsification of the folding of structures with modified parameters leads to a linear time and space reduction. We, furthermore, identify the limit distribution at the phase transition as a Rayleigh distribution.
Self-Organizing Hidden Markov Model Map (SOHMMM).
Ferles, Christos; Stafylopatis, Andreas
2013-12-01
A hybrid approach combining the Self-Organizing Map (SOM) and the Hidden Markov Model (HMM) is presented. The Self-Organizing Hidden Markov Model Map (SOHMMM) establishes a cross-section between the theoretic foundations and algorithmic realizations of its constituents. The respective architectures and learning methodologies are fused in an attempt to meet the increasing requirements imposed by the properties of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein chain molecules. The fusion and synergy of the SOM unsupervised training and the HMM dynamic programming algorithms bring forth a novel on-line gradient descent unsupervised learning algorithm, which is fully integrated into the SOHMMM. Since the SOHMMM carries out probabilistic sequence analysis with little or no prior knowledge, it can have a variety of applications in clustering, dimensionality reduction and visualization of large-scale sequence spaces, and also, in sequence discrimination, search and classification. Two series of experiments based on artificial sequence data and splice junction gene sequences demonstrate the SOHMMM's characteristics and capabilities. Copyright © 2013 Elsevier Ltd. All rights reserved.
Library construction for next-generation sequencing: Overviews and challenges
Head, Steven R.; Komori, H. Kiyomi; LaMere, Sarah A.; Whisenant, Thomas; Van Nieuwerburgh, Filip; Salomon, Daniel R.; Ordoukhanian, Phillip
2014-01-01
High-throughput sequencing, also known as next-generation sequencing (NGS), has revolutionized genomic research. In recent years, NGS technology has steadily improved, with costs dropping and the number and range of sequencing applications increasing exponentially. Here, we examine the critical role of sequencing library quality and consider important challenges when preparing NGS libraries from DNA and RNA sources. Factors such as the quantity and physical characteristics of the RNA or DNA source material as well as the desired application (i.e., genome sequencing, targeted sequencing, RNA-seq, ChIP-seq, RIP-seq, and methylation) are addressed in the context of preparing high quality sequencing libraries. In addition, the current methods for preparing NGS libraries from single cells are also discussed. PMID:24502796
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
The complete mitochondrial genome of Lota lota (Gadiformes: Gadidae) from the Burqin River in China.
Lu, Zhichuang; Zhang, Nan; Song, Na; Gao, Tianxiang
2016-05-01
In this study, the complete mitochondrial genome (mitogenome) sequence of Lota lota has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,519 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).
Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Terry, Richard; Turczyk, Brian M.; Yang, Joyce L.; Lee, Ho Suk; Aach, John; Zhang, Kun; Church, George M.
2014-01-01
RNA sequencing measures the quantitative change in gene expression over the whole transcriptome, but it lacks spatial context. On the other hand, in situ hybridization provides the location of gene expression, but only for a small number of genes. Here we detail a protocol for genome-wide profiling of gene expression in situ in fixed cells and tissues, in which RNA is converted into cross-linked cDNA amplicons and sequenced manually on a confocal microscope. Unlike traditional RNA-seq our method enriches for context-specific transcripts over house-keeping and/or structural RNA, and it preserves the tissue architecture for RNA localization studies. Our protocol is written for researchers experienced in cell microscopy with minimal computing skills. Library construction and sequencing can be completed within 14 d, with image analysis requiring an additional 2 d. PMID:25675209
RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.
Widmer, G
1993-03-01
Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.
The rRNA evolution and procaryotic phylogeny
NASA Technical Reports Server (NTRS)
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
RNA2DMut: a web tool for the design and analysis of RNA structure mutations.
Moss, Walter N
2018-03-01
With the widespread application of high-throughput sequencing, novel RNA sequences are being discovered at an astonishing rate. The analysis of function, however, lags behind. In both the cis - and trans -regulatory functions of RNA, secondary structure (2D base-pairing) plays essential regulatory roles. In order to test RNA function, it is essential to be able to design and analyze mutations that can affect structure. This was the motivation for the creation of the RNA2DMut web tool. With RNA2DMut, users can enter in RNA sequences to analyze, constrain mutations to specific residues, or limit changes to purines/pyrimidines. The sequence is analyzed at each base to determine the effect of every possible point mutation on 2D structure. The metrics used in RNA2DMut rely on the calculation of the Boltzmann structure ensemble and do not require a robust 2D model of RNA structure for designing mutations. This tool can facilitate a wide array of uses involving RNA: for example, in designing and evaluating mutants for biological assays, interrogating RNA-protein interactions, identifying key regions to alter in SELEX experiments, and improving RNA folding and crystallization properties for structural biology. Additional tools are available to help users introduce other mutations (e.g., indels and substitutions) and evaluate their effects on RNA structure. Example calculations are shown for five RNAs that require 2D structure for their function: the MALAT1 mascRNA, an influenza virus splicing regulatory motif, the EBER2 viral noncoding RNA, the Xist lncRNA repA region, and human Y RNA 5. RNA2DMut can be accessed at https://rna2dmut.bb.iastate.edu/. © 2018 Moss; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
VaDiR: an integrated approach to Variant Detection in RNA.
Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy
2018-02-01
Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.
miRNEST database: an integrative approach in microRNA search and annotation
Szcześniak, Michał Wojciech; Deorowicz, Sebastian; Gapski, Jakub; Kaczyński, Łukasz; Makałowska, Izabela
2012-01-01
Despite accumulating data on animal and plant microRNAs and their functions, existing public miRNA resources usually collect miRNAs from a very limited number of species. A lot of microRNAs, including those from model organisms, remain undiscovered. As a result there is a continuous need to search for new microRNAs. We present miRNEST (http://mirnest.amu.edu.pl), a comprehensive database of animal, plant and virus microRNAs. The core part of the database is built from our miRNA predictions conducted on Expressed Sequence Tags of 225 animal and 202 plant species. The miRNA search was performed based on sequence similarity and as many as 10 004 miRNA candidates in 221 animal and 199 plant species were discovered. Out of them only 299 have already been deposited in miRBase. Additionally, miRNEST has been integrated with external miRNA data from literature and 13 databases, which includes miRNA sequences, small RNA sequencing data, expression, polymorphisms and targets data as well as links to external miRNA resources, whenever applicable. All this makes miRNEST a considerable miRNA resource in a sense of number of species (544) that integrates a scattered miRNA data into a uniform format with a user-friendly web interface. PMID:22135287
Transcriptome and Small RNA Deep Sequencing Reveals Deregulation of miRNA Biogenesis in Human Glioma
Moore, Lynette M.; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N.; Zhang, Wei; Nykter, Matti
2013-01-01
Altered expression of oncogenic and tumor-suppressing microRNAs (miRNAs) is widely associated with tumorigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumors. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and interrogated expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression. PMID:23007860
FastRNABindR: Fast and Accurate Prediction of Protein-RNA Interface Residues.
El-Manzalawy, Yasser; Abbas, Mostafa; Malluhi, Qutaibah; Honavar, Vasant
2016-01-01
A wide range of biological processes, including regulation of gene expression, protein synthesis, and replication and assembly of many viruses are mediated by RNA-protein interactions. However, experimental determination of the structures of protein-RNA complexes is expensive and technically challenging. Hence, a number of computational tools have been developed for predicting protein-RNA interfaces. Some of the state-of-the-art protein-RNA interface predictors rely on position-specific scoring matrix (PSSM)-based encoding of the protein sequences. The computational efforts needed for generating PSSMs severely limits the practical utility of protein-RNA interface prediction servers. In this work, we experiment with two approaches, random sampling and sequence similarity reduction, for extracting a representative reference database of protein sequences from more than 50 million protein sequences in UniRef100. Our results suggest that random sampled databases produce better PSSM profiles (in terms of the number of hits used to generate the profile and the distance of the generated profile to the corresponding profile generated using the entire UniRef100 data as well as the accuracy of the machine learning classifier trained using these profiles). Based on our results, we developed FastRNABindR, an improved version of RNABindR for predicting protein-RNA interface residues using PSSM profiles generated using 1% of the UniRef100 sequences sampled uniformly at random. To the best of our knowledge, FastRNABindR is the only protein-RNA interface residue prediction online server that requires generation of PSSM profiles for query sequences and accepts hundreds of protein sequences per submission. Our approach for determining the optimal BLAST database for a protein-RNA interface residue classification task has the potential of substantially speeding up, and hence increasing the practical utility of, other amino acid sequence based predictors of protein-protein and protein-DNA interfaces.
Sharma, Davinder; Golla, Naresh; Singh, Dheer; Onteru, Suneel K
2018-03-01
The next-generation sequencing (NGS) based RNA sequencing (RNA-Seq) and transcriptome profiling offers an opportunity to unveil complex biological processes. Successful RNA-Seq and transcriptome profiling requires a large amount of high-quality RNA. However, NGS-quality RNA isolation is extremely difficult from recalcitrant adipose tissue (AT) with high lipid content and low cell numbers. Further, the amount and biochemical composition of AT lipid varies depending upon the animal species which can pose different degree of resistance to RNA extraction. Currently available approaches may work effectively in one species but can be almost unproductive in another species. Herein, we report a two step protocol for the extraction of NGS quality RNA from AT across a broad range of animal species. © 2017 Wiley Periodicals, Inc.
Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B
2014-10-01
This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.
1995-01-01
Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.
USDA-ARS?s Scientific Manuscript database
Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...
Office space bacterial abundance and diversity in three metropolitan areas.
Hewitt, Krissi M; Gerba, Charles P; Maxwell, Sheri L; Kelley, Scott T
2012-01-01
People in developed countries spend approximately 90% of their lives indoors, yet we know little about the source and diversity of microbes in built environments. In this study, we combined culture-based cell counting and multiplexed pyrosequencing of environmental ribosomal RNA (rRNA) gene sequences to investigate office space bacterial diversity in three metropolitan areas. Five surfaces common to all offices were sampled using sterile double-tipped swabs, one tip for culturing and one for DNA extraction, in 30 different offices per city (90 offices, 450 total samples). 16S rRNA gene sequences were PCR amplified using bar-coded "universal" bacterial primers from 54 of the surfaces (18 per city) and pooled for pyrosequencing. A three-factorial Analysis of Variance (ANOVA) found significant differences in viable bacterial abundance between offices inhabited by men or women, among the various surface types, and among cities. Multiplex pyrosequencing identified more than 500 bacterial genera from 20 different bacterial divisions. The most abundant of these genera tended to be common inhabitants of human skin, nasal, oral or intestinal cavities. Other commonly occurring genera appeared to have environmental origins (e.g., soils). There were no significant differences in the bacterial diversity between offices inhabited by men or women or among surfaces, but the bacterial community diversity of the Tucson samples was clearly distinguishable from that of New York and San Francisco, which were indistinguishable. Overall, our comprehensive molecular analysis of office building microbial diversity shows the potential of these methods for studying patterns and origins of indoor bacterial contamination. "[H]umans move through a sea of microbial life that is seldom perceived except in the context of potential disease and decay." - Feazel et al. (2009).
Alam, Syed Benazir; Reade, Ron; Theilmann, Jane; Rochon, D'Ann
2017-12-01
Cucumber necrosis virus (CNV) is a T = 3 icosahedral virus with a (+)ssRNA genome. The N-terminal CNV coat protein arm contains a conserved, highly basic sequence ("KGRKPR"), which we postulate is involved in RNA encapsidation during virion assembly. Seven mutants were constructed by altering the CNV "KGRKPR" sequence; the four basic residues were mutated to alanine individually, in pairs, or in total. Virion accumulation and vRNA encapsidation were significantly reduced in mutants containing two or four substitutions and virion morphology was also affected, where both T = 1 and intermediate-sized particles were produced. Mutants with two or four substitutions encapsidated significantly greater levels of truncated RNA than that of WT, suggesting that basic residues in the "KGRKPR" sequence are important for encapsidation of full-length CNV RNA. Interestingly, "KGRKPR" mutants also encapsidated relatively higher levels of host RNA, suggesting that the "KGRKPR" sequence also contributes to selective encapsidation of CNV RNA. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
Optimization of conditions to sequence long cDNAs from viruses
USDA-ARS?s Scientific Manuscript database
Fourth generation sequencing with the Minion nanopore sequencer provides opportunity to obtain deep coverage and long read for single molecules. This will benefit studies on RNA viruses. In the past, Sanger, Illumina, and Ion Torrent sequencing have been utilized to study RNA viruses. Both technique...
Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi
2008-03-31
With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules.
Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi
2008-01-01
Background With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. Results RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. Conclusion A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules. PMID:18373878
Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T
2014-06-01
RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.
Wu, Chung Wah; Evans, Jared M; Huang, Shengbing; Mahoney, Douglas W; Dukek, Brian A; Taylor, William R; Yab, Tracy C; Smyrk, Thomas C; Jen, Jin; Kisiel, John B; Ahlquist, David A
2018-05-25
MicroRNA (miRNA) profiling is an important step in studying biological associations and identifying marker candidates. miRNA exists in isoforms, called isomiRs, which may exhibit distinct properties. With conventional profiling methods, limitations in assay and analysis platforms may compromise isomiR interrogation. We introduce a comprehensive approach to sequence-oriented isomiR annotation (CASMIR) to allow unbiased identification of global isomiRs from small RNA sequencing data. In this approach, small RNA reads are maintained as independent sequences instead of being summarized under miRNA names. IsomiR features are identified through step-wise local alignment against canonical forms and precursor sequences. Through customizing the reference database, CASMIR is applicable to isomiR annotation across species. To demonstrate its application, we investigated isomiR profiles in normal and neoplastic human colorectal epithelia. We also ran miRDeep2, a popular miRNA analysis algorithm to validate isomiRs annotated by CASMIR. With CASMIR, specific and biologically relevant isomiR patterns could be identified. We note that specific isomiRs are often more abundant than their canonical forms. We identify isomiRs that are commonly up-regulated in both colorectal cancer and advanced adenoma, and illustrate advantages in targeting isomiRs as potential biomarkers over canonical forms. Studying miRNAs at the isomiR level could reveal new insight into miRNA biology and inform assay design for specific isomiRs. CASMIR facilitates comprehensive annotation of isomiR features in small RNA sequencing data for isomiR profiling and differential expression analysis.
Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.
2017-01-01
Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287
Li, Ying; Shi, Xiaohu; Liang, Yanchun; Xie, Juan; Zhang, Yu; Ma, Qin
2017-01-21
RNAs have been found to carry diverse functionalities in nature. Inferring the similarity between two given RNAs is a fundamental step to understand and interpret their functional relationship. The majority of functional RNAs show conserved secondary structures, rather than sequence conservation. Those algorithms relying on sequence-based features usually have limitations in their prediction performance. Hence, integrating RNA structure features is very critical for RNA analysis. Existing algorithms mainly fall into two categories: alignment-based and alignment-free. The alignment-free algorithms of RNA comparison usually have lower time complexity than alignment-based algorithms. An alignment-free RNA comparison algorithm was proposed, in which novel numerical representations RNA-TVcurve (triple vector curve representation) of RNA sequence and corresponding secondary structure features are provided. Then a multi-scale similarity score of two given RNAs was designed based on wavelet decomposition of their numerical representation. In support of RNA mutation and phylogenetic analysis, a web server (RNA-TVcurve) was designed based on this alignment-free RNA comparison algorithm. It provides three functional modules: 1) visualization of numerical representation of RNA secondary structure; 2) detection of single-point mutation based on secondary structure; and 3) comparison of pairwise and multiple RNA secondary structures. The inputs of the web server require RNA primary sequences, while corresponding secondary structures are optional. For the primary sequences alone, the web server can compute the secondary structures using free energy minimization algorithm in terms of RNAfold tool from Vienna RNA package. RNA-TVcurve is the first integrated web server, based on an alignment-free method, to deliver a suite of RNA analysis functions, including visualization, mutation analysis and multiple RNAs structure comparison. The comparison results with two popular RNA comparison tools, RNApdist and RNAdistance, showcased that RNA-TVcurve can efficiently capture subtle relationships among RNAs for mutation detection and non-coding RNA classification. All the relevant results were shown in an intuitive graphical manner, and can be freely downloaded from this server. RNA-TVcurve, along with test examples and detailed documents, are available at: http://ml.jlu.edu.cn/tvcurve/ .
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš
2013-01-01
There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757
Kudsiova, Laila; Welser, Katharina; Campbell, Frederick; Mohammadi, Atefeh; Dawson, Natalie; Cui, Lili; Hailes, Helen C; Lawrence, M Jayne; Tabor, Alethea B
2016-03-01
Ternary nanocomplexes, composed of bifunctional cationic peptides, lipids and siRNA, as delivery vehicles for siRNA have been investigated. The study is the first to determine the optimal sequence and architecture of the bifunctional cationic peptide used for siRNA packaging and delivery using lipopolyplexes. Specifically three series of cationic peptides of differing sequence, degrees of branching and cell-targeting sequences were co-formulated with siRNA and vesicles prepared from a 1 : 1 molar ratio of the cationic lipid DOTMA and the helper lipid, DOPE. The level of siRNA knockdown achieved in the human alveolar cell line, A549-luc cells, in both reduced serum and in serum supplemented media was evaluated, and the results correlated to the nanocomplex structure (established using a range of physico-chemical tools, namely small angle neutron scattering, transmission electron microscopy, dynamic light scattering and zeta potential measurement); the conformational properties of each component (circular dichroism); the degree of protection of the siRNA in the lipopolyplex (using gel shift assays) and to the cellular uptake, localisation and toxicity of the nanocomplexes (confocal microscopy). Although the size, charge, structure and stability of the various lipopolyplexes were broadly similar, it was clear that lipopolyplexes formulated from branched peptides containing His-Lys sequences perform best as siRNA delivery agents in serum, with protection of the siRNA in serum balanced against efficient release of the siRNA into the cytoplasm of the cell.
DDM1 represses noncoding RNA expression and RNA-directed DNA methylation in heterochromatin.
Tan, Feng; Lu, Yue; Jiang, Wei; Zhao, Yu; Wu, Tian; Zhang, Ruoyu; Zhou, Dao-Xiu
2018-05-24
Cytosine methylation of DNA, which occurs at CG, CHG, and CHH (H=A, C, or T) sequences in plants, is a hallmark for epigenetic repression of repetitive sequences. The chromatin remodeling factor DECREASE IN DNA METHYLATION1 (DDM1) is essential for DNA methylation, especially at CG and CHG sequences. However, its potential role in RNA-directed DNA methylation (RdDM) and in chromatin function is not completely understood in rice (Oryza sativa). In this work, we used high-throughput approaches to study the function of rice DDM1 (OsDDM1) in RdDM and the expression of non-coding RNA (ncRNA). We show that loss of function of OsDDM1 results in ectopic CHH methylation of transposable elements and repeats. The ectopic CHH methylation was dependent on rice DOMAINS REARRANGED METHYLTRANSFERASE2 (OsDRM2), a DNA methyltransferase involved in RdDM. Mutations in OsDDM1 lead to decreases of histone H3K9me2 and increases in the levels of heterochromatic small RNA (sRNA) and long noncoding RNA (lncRNA). In particular, OsDDM1 was found to be essential to repress transcription of the two repetitive sequences, Centromeric Retrotransposons of Rice1 (CRR1) and the dominant centromeric CentO repeats. These results suggest that OsDDM1 antagonizes RdDM at heterochromatin and represses tissue-specific expression of ncRNA from repetitive sequences in the rice genome. {copyright, serif} 2018 American Society of Plant Biologists. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Complete genome sequence of a double-stranded RNA (dsRNA) virus, southern tomato virus (STV), on tomatoes in China, was elucidated using small RNAs deep sequencing. The identified STV_CN12 shares 99% sequence identity to other isolates from Mexico, France, Spain, and U.S. This is the first report ...
Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok
2016-04-01
Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.
Spliced synthetic genes as internal controls in RNA sequencing experiments.
Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R
2016-09-01
RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.
SELEX-Based Screening of Exosome-Tropic RNA.
Yamashita, Takuma; Shinotsuka, Haruka; Takahashi, Yuki; Kato, Kana; Nishikawa, Makiya; Takakura, Yoshinobu
2017-01-01
Cell-derived nanosized vesicles or exosomes are expected to become delivery carriers for functional RNAs, such as small interfering RNA (siRNA). A method to efficiently load functional RNAs into exosomes is required for the development of exosome-based delivery carriers of functional RNAs. However, there is no method to find exosome-tropic exogenous RNA sequences. In this study, we used a systematic evolution of ligands by exponential enrichment (SELEX) method to screen exosome-tropic RNAs that can be used to load functional RNAs into exosomes by conjugation. Pooled single stranded 80-base RNAs, each of which contains a randomized 40-base sequence, were transfected into B16-BL6 murine melanoma cells and exosomes were collected from the cells. RNAs extracted from the exosomes were subjected to next round of SELEX. Cloning and sequencing of RNAs in SELEX-screened RNA pools showed that 29 of 56 clones had a typical RNA sequence. The sequence found by SELEX was enriched in exosomes after transfection to B16-BL6 cells. The results show that the SELEX-based method can be used for screening of exosome-tropic RNAs.
mESAdb: microRNA Expression and Sequence Analysis Database
Kaya, Koray D.; Karakülah, Gökhan; Yakıcıer, Cengiz M.; Acar, Aybar C.; Konu, Özlen
2011-01-01
microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data. PMID:21177657
NASA Technical Reports Server (NTRS)
Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.
1985-01-01
The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.
mESAdb: microRNA expression and sequence analysis database.
Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen
2011-01-01
microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.
Reiman, Mario; Laan, Maris; Rull, Kristiina; Sõber, Siim
2017-08-01
RNA degradation is a ubiquitous process that occurs in living and dead cells, as well as during handling and storage of extracted RNA. Reduced RNA quality caused by degradation is an established source of uncertainty for all RNA-based gene expression quantification techniques. RNA sequencing is an increasingly preferred method for transcriptome analyses, and dependence of its results on input RNA integrity is of significant practical importance. This study aimed to characterize the effects of varying input RNA integrity [estimated as RNA integrity number (RIN)] on transcript level estimates and delineate the characteristic differences between transcripts that differ in degradation rate. The study used ribodepleted total RNA sequencing data from a real-life clinically collected set ( n = 32) of human solid tissue (placenta) samples. RIN-dependent alterations in gene expression profiles were quantified by using DESeq2 software. Our results indicate that small differences in RNA integrity affect gene expression quantification by introducing a moderate and pervasive bias in expression level estimates that significantly affected 8.1% of studied genes. The rapidly degrading transcript pool was enriched in pseudogenes, short noncoding RNAs, and transcripts with extended 3' untranslated regions. Typical slowly degrading transcripts (median length, 2389 nt) represented protein coding genes with 4-10 exons and high guanine-cytosine content.-Reiman, M., Laan, M., Rull, K., Sõber, S. Effects of RNA integrity on transcript quantification by total RNA sequencing of clinically collected human placental samples. © FASEB.
Designing highly active siRNAs for therapeutic applications.
Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina
2010-12-01
The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.
YM500: a small RNA sequencing (smRNA-seq) database for microRNA research
Cheng, Wei-Chung; Chung, I-Fang; Huang, Tse-Shun; Chang, Shih-Ting; Sun, Hsing-Jen; Tsai, Cheng-Fong; Liang, Muh-Lii; Wong, Tai-Tong; Wang, Hsei-Wei
2013-01-01
MicroRNAs (miRNAs) are small RNAs ∼22 nt in length that are involved in the regulation of a variety of physiological and pathological processes. Advances in high-throughput small RNA sequencing (smRNA-seq), one of the next-generation sequencing applications, have reshaped the miRNA research landscape. In this study, we established an integrative database, the YM500 (http://ngs.ym.edu.tw/ym500/), containing analysis pipelines and analysis results for 609 human and mice smRNA-seq results, including public data from the Gene Expression Omnibus (GEO) and some private sources. YM500 collects analysis results for miRNA quantification, for isomiR identification (incl. RNA editing), for arm switching discovery, and, more importantly, for novel miRNA predictions. Wetlab validation on >100 miRNAs confirmed high correlation between miRNA profiling and RT-qPCR results (R = 0.84). This database allows researchers to search these four different types of analysis results via our interactive web interface. YM500 allows researchers to define the criteria of isomiRs, and also integrates the information of dbSNP to help researchers distinguish isomiRs from SNPs. A user-friendly interface is provided to integrate miRNA-related information and existing evidence from hundreds of sequencing datasets. The identified novel miRNAs and isomiRs hold the potential for both basic research and biotech applications. PMID:23203880
Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok
2011-02-01
RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Simulations Using Random-Generated DNA and RNA Sequences
ERIC Educational Resources Information Center
Bryce, C. F. A.
1977-01-01
Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…
High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.
Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M
2016-09-07
Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.
Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions
Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.
2011-01-01
SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
Tian, Yao; Smith, David Roy
2016-05-01
Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Making sense of deep sequencing
Goldman, D.; Domschke, K.
2016-01-01
This review, the first of an occasional series, tries to make sense of the concepts and uses of deep sequencing of polynucleic acids (DNA and RNA). Deep sequencing, synonymous with next-generation sequencing, high-throughput sequencing and massively parallel sequencing, includes whole genome sequencing but is more often and diversely applied to specific parts of the genome captured in different ways, for example the highly expressed portion of the genome known as the exome and portions of the genome that are epigenetically marked either by DNA methylation, the binding of proteins including histones, or that are in different configurations and thus more or less accessible to enzymes that cleave DNA. Deep sequencing of RNA (RNASeq) reverse-transcribed to complementary DNA is invaluable for measuring RNA expression and detecting changes in RNA structure. Important concepts in deep sequencing include the length and depth of sequence reads, mapping and assembly of reads, sequencing error, haplotypes, and the propensity of deep sequencing, as with other types of ‘big data’, to generate large numbers of errors, requiring monitoring for methodologic biases and strategies for replication and validation. Deep sequencing yields a unique genetic fingerprint that can be used to identify a person, and a trove of predictors of genetic medical diseases. Deep sequencing to identify epigenetic events including changes in DNA methylation and RNA expression can reveal the history and impact of environmental exposures. Because of the power of sequencing to identify and deliver biomedically significant information about a person and their blood relatives, it creates ethical dilemmas and practical challenges in research and clinical care, for example the decision and procedures to report incidental findings that will increasingly and frequently be discovered. PMID:24925306
probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016
Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas
2016-01-01
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809
Identifying functional cancer-specific miRNA-mRNA interactions in testicular germ cell tumor.
Sedaghat, Nafiseh; Fathy, Mahmood; Modarressi, Mohammad Hossein; Shojaie, Ali
2016-09-07
Testicular cancer is the most common cancer in men aged between 15 and 35 and more than 90% of testicular neoplasms are originated at germ cells. Recent research has shown the impact of microRNAs (miRNAs) in different types of cancer, including testicular germ cell tumor (TGCT). MicroRNAs are small non-coding RNAs which affect the development and progression of cancer cells by binding to mRNAs and regulating their expressions. The identification of functional miRNA-mRNA interactions in cancers, i.e. those that alter the expression of genes in cancer cells, can help delineate post-regulatory mechanisms and may lead to new treatments to control the progression of cancer. A number of sequence-based methods have been developed to predict miRNA-mRNA interactions based on the complementarity of sequences. While necessary, sequence complementarity is, however, not sufficient for presence of functional interactions. Alternative methods have thus been developed to refine the sequence-based interactions using concurrent expression profiles of miRNAs and mRNAs. This study aims to find functional cancer-specific miRNA-mRNA interactions in TGCT. To this end, the sequence-based predicted interactions are first refined using an ensemble learning method, based on two well-known methods of learning miRNA-mRNA interactions, namely, TaLasso and GenMiR++. Additional functional analyses were then used to identify a subset of interactions to be most likely functional and specific to TGCT. The final list of 13 miRNA-mRNA interactions can be potential targets for identifying TGCT-specific interactions and future laboratory experiments to develop new therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.
CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.
Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E
2018-05-03
Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Leong, Wai-Mun; Ripen, Adiratna Mat; Mirsafian, Hoda; Mohamad, Saharuddin Bin; Merican, Amir Feisal
2018-06-07
High-depth next generation sequencing data provide valuable insights into the number and distribution of RNA editing events. Here, we report the RNA editing events at cellular level of human primary monocyte using high-depth whole genomic and transcriptomic sequencing data. We identified over a ten thousand putative RNA editing sites and 69% of the sites were A-to-I editing sites. The sites enriched in repetitive sequences and intronic regions. High-depth sequencing datasets revealed that 90% of the canonical sites were edited at lower frequencies (<0.7). Single and multiple human monocytes and brain tissues samples were analyzed through genome sequence independent approach. The later approach was observed to identify more editing sites. Monocytes was observed to contain more C-to-U editing sites compared to brain tissues. Our results establish comparable pipeline that can address current limitations as well as demonstrate the potential for highly sensitive detection of RNA editing events in single cell type. Copyright © 2018 Elsevier Inc. All rights reserved.
An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.
Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J
2014-11-01
The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Total Extracellular Small RNA Profiles from Plasma, Saliva, and Urine of Healthy Subjects
Yeri, Ashish; Courtright, Amanda; Reiman, Rebecca; Carlson, Elizabeth; Beecroft, Taylor; Janss, Alex; Siniard, Ashley; Richholt, Ryan; Balak, Chris; Rozowsky, Joel; Kitchen, Robert; Hutchins, Elizabeth; Winarta, Joseph; McCoy, Roger; Anastasi, Matthew; Kim, Seungchan; Huentelman, Matthew; Van Keuren-Jensen, Kendall
2017-01-01
Interest in circulating RNAs for monitoring and diagnosing human health has grown significantly. There are few datasets describing baseline expression levels for total cell-free circulating RNA from healthy control subjects. In this study, total extracellular RNA (exRNA) was isolated and sequenced from 183 plasma samples, 204 urine samples and 46 saliva samples from 55 male college athletes ages 18–25 years. Many participants provided more than one sample, allowing us to investigate variability in an individual’s exRNA expression levels over time. Here we provide a systematic analysis of small exRNAs present in each biofluid, as well as an analysis of exogenous RNAs. The small RNA profile of each biofluid is distinct. We find that a large number of RNA fragments in plasma (63%) and urine (54%) have sequences that are assigned to YRNA and tRNA fragments respectively. Surprisingly, while many miRNAs can be detected, there are few miRNAs that are consistently detected in all samples from a single biofluid, and profiles of miRNA are different for each biofluid. Not unexpectedly, saliva samples have high levels of exogenous sequence that can be traced to bacteria. These data significantly contribute to the current number of sequenced exRNA samples from normal healthy individuals. PMID:28303895
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
Cleavage of rRNA ensures translational cessation in sperm at fertilization
Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.
2011-01-01
Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882
2014-01-01
Background Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Results Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. Conclusion The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification. PMID:24418292
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Single-Cell RNA-Sequencing in Glioma.
Johnson, Eli; Dickerson, Katherine L; Connolly, Ian D; Hayden Gephart, Melanie
2018-04-10
In this review, we seek to summarize the literature concerning the use of single-cell RNA-sequencing for CNS gliomas. Single-cell analysis has revealed complex tumor heterogeneity, subpopulations of proliferating stem-like cells and expanded our view of tumor microenvironment influence in the disease process. Although bulk RNA-sequencing has guided our initial understanding of glioma genetics, this method does not accurately define the heterogeneous subpopulations found within these tumors. Single-cell techniques have appealing applications in cancer research, as diverse cell types and the tumor microenvironment have important implications in therapy. High cost and difficult protocols prevent widespread use of single-cell RNA-sequencing; however, continued innovation will improve accessibility and expand our of knowledge gliomas.
van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A
1993-01-01
Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G
2018-01-01
Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.
Genetic relatedness of orbiviruses by RNA-RNA blot hybridization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bodkin, D.K.
1985-01-01
RNA-RNA blot hybridization was developed in order to identify type-specific genes among double-stranded (ds) RNA viruses, to assess the genetic relatedness of dsRNA viruses and to classify new strains. Viral dsRNA segments were electrophoresed through 10% polyacrylamide gels, transferred to membranes, and hybridized to (5'/sup 32/P)-pCp labeled genomic RNA from a related strain. Hybridization was performed at 52/sup 0/C, 50% formamide, 5X SSC. Under these conditions heterologous RNA species must share greater than or equal to 74% sequence homology in order to form stable dsRNA hybrids. Cognate genes of nine members of the Palyam serogroup of orbiviruses were identified andmore » their sequence relatedness to the prototype. Palyam virus, was determined. Reciprocal blot hybridizations were performed using radiolabeled genomic RNA of all members of the Palyam serogroup. Unique and variant genes were identified by lack of cross-homology or by weak homology between segments. Since genes 2 and 6 exhibited the highest degree of sequence variability, response to the vertebrate immune system may be a major cause of sequence divergence among members of a single serogroup. Changuinola serogroup isolates were compared by dot-blot hybridization, while Colorado tick fever (CTF) serogroup isolates were compared by the RNA-RNA blot hybridization procedure described for reovirus and Palyam serogroup isolates. Preliminary blot hybridization data were also obtained on the relatedness of members of different Orbivirus serogroups.« less
Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H
1996-01-01
Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607
Pan, Xiaoyong; Shen, Hong-Bin
2018-05-02
RNA-binding proteins (RBPs) take over 5∼10% of the eukaryotic proteome and play key roles in many biological processes, e.g. gene regulation. Experimental detection of RBP binding sites is still time-intensive and high-costly. Instead, computational prediction of the RBP binding sites using pattern learned from existing annotation knowledge is a fast approach. From the biological point of view, the local structure context derived from local sequences will be recognized by specific RBPs. However, in computational modeling using deep learning, to our best knowledge, only global representations of entire RNA sequences are employed. So far, the local sequence information is ignored in the deep model construction process. In this study, we present a computational method iDeepE to predict RNA-protein binding sites from RNA sequences by combining global and local convolutional neural networks (CNNs). For the global CNN, we pad the RNA sequences into the same length. For the local CNN, we split a RNA sequence into multiple overlapping fixed-length subsequences, where each subsequence is a signal channel of the whole sequence. Next, we train deep CNNs for multiple subsequences and the padded sequences to learn high-level features, respectively. Finally, the outputs from local and global CNNs are combined to improve the prediction. iDeepE demonstrates a better performance over state-of-the-art methods on two large-scale datasets derived from CLIP-seq. We also find that the local CNN run 1.8 times faster than the global CNN with comparable performance when using GPUs. Our results show that iDeepE has captured experimentally verified binding motifs. https://github.com/xypan1232/iDeepE. xypan172436@gmail.com or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online.
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
High-Throughput, Data-Rich Cellular RNA Device Engineering
Townshend, Brent; Kennedy, Andrew B.; Xiang, Joy S.; Smolke, Christina D.
2015-01-01
Methods for rapidly assessing sequence-structure-function landscapes and developing conditional gene-regulatory devices are critical to our ability to manipulate and interface with biology. We describe a framework for engineering RNA devices from preexisting aptamers that exhibit ligand-responsive ribozyme tertiary interactions. Our methodology utilizes cell sorting, high-throughput sequencing, and statistical data analyses to enable parallel measurements of the activities of hundreds of thousands of sequences from RNA device libraries in the absence and presence of ligands. Our tertiary interaction RNA devices exhibit improved performance in terms of gene silencing, activation ratio, and ligand sensitivity as compared to optimized RNA devices that rely on secondary structure changes. We apply our method to building biosensors for diverse ligands and determine consensus sequences that enable ligand-responsive tertiary interactions. These methods advance our ability to develop broadly applicable genetic tools and to elucidate understanding of the underlying sequence-structure-function relationships that empower rational design of complex biomolecules. PMID:26258292
Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R
2007-05-24
The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.
The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.
Zubiaga, A M; Belasco, J G; Greenberg, M E
1995-01-01
Labile mRNAs that encode cytokine and immediate-early gene products often contain AU-rich sequences within their 3' untranslated region (UTR). These AU-rich sequences appear to be key determinants of the short half-lives of these mRNAs, although the sequence features of these elements and the mechanism by which they target mRNAs for rapid decay have not been fully defined. We have examined the features of AU-rich elements (AREs) that are crucial for their function as determinants of mRNA instability in mammalian cells by testing the ability of various mutant c-fos AREs and synthetic AREs to direct rapid mRNA deadenylation and decay when inserted within the 3' UTR of the normally stable beta-globin mRNA. Evidence is presented that the pentamer AUUUA, which previously was suggested to be the minimal determinant of instability present in mammalian AREs, cannot direct rapid mRNA deadenylation and decay. Instead, the nonomer UUAUUUAUU is the elemental AU-rich sequence motif that destabilizes mRNA. Removal of one uridine residue from either end of the nonamer (UUAUUUAU or UAUUUAUU) results in a decrease of potency of the element, while removal of a uridine residue from both ends of the nonamer (UAUUUAU) eliminates detectable destabilizing activity. The inclusion of an additional uridine residue at both ends of the nonamer (UUUAUUUAUUU) does not further increase the efficacy of the element. Taken together, these findings suggest that the nonamer UUAUUUAUU is the minimal AU-rich motif that effectively destabilizes mRNA. Additional ARE potency is achieved by combining multiple copies of this nonamer in a single mRNA 3' UTR. Furthermore, analysis of poly(A) shortening rates for ARE-containing mRNAs reveals that the UUAUUUAUU sequence also accelerates mRNA deadenylation and suggests that the UUAUUUAUU motif targets mRNA for rapid deadenylation as an early step in the mRNA decay process. PMID:7891716
Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N
1991-11-20
A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.
G4RNA: an RNA G-quadruplex database
Garant, Jean-Michel; Luce, Mikael J.; Scott, Michelle S.
2015-01-01
Abstract G-quadruplexes (G4) are tetrahelical structures formed from planar arrangement of guanines in nucleic acids. A simple, regular motif was originally proposed to describe G4-forming sequences. More recently, however, formation of G4 was discovered to depend, at least in part, on the contextual backdrop of neighboring sequences. Prediction of G4 folding is thus becoming more challenging as G4 outlier structures, not described by the originally proposed motif, are increasingly reported. Recent observations thus call for a comprehensive tool, capable of consolidating the expanding information on tested G4s, in order to conduct systematic comparative analyses of G4-promoting sequences. The G4RNA Database we propose was designed to help meet the need for easily-retrievable data on known RNA G4s. A user-friendly, flexible query system allows for data retrieval on experimentally tested sequences, from many separate genes, to assess G4-folding potential. Query output sorts data according to sequence position, G4 likelihood, experimental outcomes and associated bibliographical references. G4RNA also provides an ideal foundation to collect and store additional sequence and experimental data, considering the growing interest G4s currently generate. Database URL: scottgroup.med.usherbrooke.ca/G4RNA PMID:26200754
Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong
2013-07-04
Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.
A new version of the RDP (Ribosomal Database Project)
NASA Technical Reports Server (NTRS)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique
2015-01-01
RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.
Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David
2015-01-01
RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316
Lücke, S; Xu, G L; Palfi, Z; Cross, M; Bellofatto, V; Bindereif, A
1996-01-01
In trypanosomes mRNAs are generated through trans splicing. The spliced leader (SL) RNA, which donates the 5'-terminal mini-exon to each of the protein coding exons, plays a central role in the trans splicing process. We have established in vivo assays to study in detail trans splicing, cap4 modification, and RNP assembly of the SL RNA in the trypanosomatid species Leptomonas seymouri. First, we found that extensive sequences within the mini-exon are required for SL RNA function in vivo, although a conserved length of 39 nt is not essential. In contrast, the intron sequence appears to be surprisingly tolerant to mutation; only the stem-loop II structure is indispensable. The asymmetry of the sequence requirements in the stem I region suggests that this domain may exist in different functional conformations. Second, distinct mini-exon sequences outside the modification site are important for efficient cap4 formation. Third, all SL RNA mutations tested allowed core RNP assembly, suggesting flexible requirements for core protein binding. In sum, the results of our mutational analysis provide evidence for a discrete domain structure of the SL RNA and help to explain the strong phylogenetic conservation of the mini-exon sequence and of the overall SL RNA secondary structure; they also suggest that there may be certain differences between trans splicing in nematodes and trypanosomes. This approach provides a basis for studying RNA-RNA interactions in the trans spliceosome. Images PMID:8861965
Error baseline rates of five sample preparation methods used to characterize RNA virus populations.
Kugelman, Jeffrey R; Wiley, Michael R; Nagle, Elyse R; Reyes, Daniel; Pfeffer, Brad P; Kuhn, Jens H; Sanchez-Lockhart, Mariano; Palacios, Gustavo F
2017-01-01
Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic "no amplification" method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a "targeted" amplification method, sequence-independent single-primer amplification (SISPA) as a "random" amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced "no amplification" method, and Illumina TruSeq RNA Access as a "targeted" enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4-5) of all compared methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
Error baseline rates of five sample preparation methods used to characterize RNA virus populations
Kugelman, Jeffrey R.; Wiley, Michael R.; Nagle, Elyse R.; Reyes, Daniel; Pfeffer, Brad P.; Kuhn, Jens H.; Sanchez-Lockhart, Mariano; Palacios, Gustavo F.
2017-01-01
Individual RNA viruses typically occur as populations of genomes that differ slightly from each other due to mutations introduced by the error-prone viral polymerase. Understanding the variability of RNA virus genome populations is critical for understanding virus evolution because individual mutant genomes may gain evolutionary selective advantages and give rise to dominant subpopulations, possibly even leading to the emergence of viruses resistant to medical countermeasures. Reverse transcription of virus genome populations followed by next-generation sequencing is the only available method to characterize variation for RNA viruses. However, both steps may lead to the introduction of artificial mutations, thereby skewing the data. To better understand how such errors are introduced during sample preparation, we determined and compared error baseline rates of five different sample preparation methods by analyzing in vitro transcribed Ebola virus RNA from an artificial plasmid-based system. These methods included: shotgun sequencing from plasmid DNA or in vitro transcribed RNA as a basic “no amplification” method, amplicon sequencing from the plasmid DNA or in vitro transcribed RNA as a “targeted” amplification method, sequence-independent single-primer amplification (SISPA) as a “random” amplification method, rolling circle reverse transcription sequencing (CirSeq) as an advanced “no amplification” method, and Illumina TruSeq RNA Access as a “targeted” enrichment method. The measured error frequencies indicate that RNA Access offers the best tradeoff between sensitivity and sample preparation error (1.4−5) of all compared methods. PMID:28182717
Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch
Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J.; Henkin, Tina M.
2015-01-01
Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the “Specifier Sequence,” in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNAGly anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3′ of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system. PMID:26229106
Homology of aspartyl- and lysyl-tRNA synthetases.
Gampel, A; Tzagoloff, A
1989-01-01
The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951
Pickard, Mark R.; Williams, Gwyn T.
2016-01-01
Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727
Schnare, Murray N.; Collings, James C.; Spencer, David F.; Gray, Michael W.
2000-01-01
In Crithidia fasciculata, the ribosomal RNA (rRNA) gene repeats range in size from ∼11 to 12 kb. This length heterogeneity is localized to a region of the intergenic spacer (IGS) that contains tandemly repeated copies of a 19mer sequence. The IGS also contains four copies of an ∼55 nt repeat that has an internal inverted repeat and is also present in the IGS of Leishmania species. We have mapped the C.fasciculata transcription initiation site as well as two other reverse transcriptase stop sites that may be analogous to the A0 and A′ pre-rRNA processing sites within the 5′ external transcribed spacer (ETS) of other eukaryotes. Features that could influence processing at these sites include two stretches of conserved primary sequence and three secondary structure elements present in the 5′ ETS. We also characterized the C.fasciculata U3 snoRNA, which has the potential for base-pairing with pre-rRNA sequences. Finally, we demonstrate that biosynthesis of large subunit rRNA in both C.fasciculata and Trypanosoma brucei involves 3′-terminal addition of three A residues that are not present in the corresponding DNA sequences. PMID:10982863
Bipartite recognition of target RNAs activates DNA cleavage by the Type III-B CRISPR–Cas system
Elmore, Joshua R.; Sheppard, Nolan F.; Ramia, Nancy; Deighan, Trace; Li, Hong; Terns, Rebecca M.; Terns, Michael P.
2016-01-01
CRISPR–Cas systems eliminate nucleic acid invaders in bacteria and archaea. The effector complex of the Type III-B Cmr system cleaves invader RNAs recognized by the CRISPR RNA (crRNA ) of the complex. Here we show that invader RNAs also activate the Cmr complex to cleave DNA. As has been observed for other Type III systems, Cmr eliminates plasmid invaders in Pyrococcus furiosus by a mechanism that depends on transcription of the crRNA target sequence within the plasmid. Notably, we found that the target RNA per se induces DNA cleavage by the Cmr complex in vitro. DNA cleavage activity does not depend on cleavage of the target RNA but notably does require the presence of a short sequence adjacent to the target sequence within the activating target RNA (rPAM [RNA protospacer-adjacent motif]). The activated complex does not require a target sequence (or a PAM) in the DNA substrate. Plasmid elimination by the P. furiosus Cmr system also does not require the Csx1 (CRISPR-associated Rossman fold [CARF] superfamily) protein. Plasmid silencing depends on the HD nuclease and Palm domains of the Cmr2 (Cas10 superfamily) protein. The results establish the Cmr complex as a novel DNA nuclease activated by invader RNAs containing a crRNA target sequence and a rPAM. PMID:26848045
Gaynor, R; Soultanakis, E; Kuwabara, M; Garcia, J; Sigman, D S
1989-01-01
The transactivator protein, tat, encoded by the human immunodeficiency virus is a key regulator of viral transcription. Activation by the tat protein requires sequences downstream of the transcription initiation site called the transactivating region (TAR). RNA derived from the TAR is capable of forming a stable stem-loop structure and the maintenance of both the stem structure and the loop sequences located between +19 and +44 is required for complete in vivo activation by tat. Gel retardation assays with RNA from both wild-type and mutant TAR constructs generated in vitro with SP6 polymerase indicated specific binding of HeLa nuclear proteins to the TAR. To characterize this RNA-protein interaction, a method of chemical "imprinting" has been developed using photoactivated uranyl acetate as the nucleolytic agent. This reagent nicks RNA under physiological conditions at all four nucleotides in a reaction that is independent of sequence and secondary structure. Specific interaction of cellular proteins with TAR RNA could be detected by enhanced cleavages or imprints surrounding the loop region. Mutations that either disrupted stem base-pairing or extensively changed the primary sequence resulted in alterations in the cleavage pattern of the TAR RNA. Structural features of the TAR RNA stem-loop essential for tat activation are also required for specific binding of the HeLa cell nuclear protein. Images PMID:2544877
RISC RNA sequencing for context-specific identification of in vivo miR targets
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2010-01-01
Rationale MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. Objective To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). Methods and Results We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias, and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1,645 mRNAs consistently targeted to mouse cardiac RISCs. We employed this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing ‘seed’ sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. Conclusions RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context, and is applicable to any tissue and any disease state. Summary MicroRNAs (miRs) are key regulators of mRNA translation in health and disease. While bioinformatic predictions suggest that a single miR may target hundreds of mRNAs, the number of experimentally verified targets of miRs is low. To enable comprehensive, unbiased examination of miR targets, we have performed deep RNA sequencing of cardiac transcriptomes in parallel with cardiac RNA-induced silencing complex (RISC)-associated RNAs (the RISCome), called RISC sequencing. We developed methods that did not require cross-linking of RNAs to RISCs or amplification of mRNA prior to sequencing, making it possible to rapidly perform RISC sequencing from intact tissue while avoiding amplification bias. Comparison of RISCome with transcriptome expression defined the degree of RISC enrichment for each mRNA. The majority of the mRNAs enriched in wild-type cardiac RISComes compared to transcriptomes were bioinformatically predicted to be targets of at least 1 of 139 cardiac-expressed miRs. Programming cardiomyocyte RISCs via transgenic overexpression in adult hearts of miR-133a or miR-499, two miRs that contain entirely different ‘seed’ sequences, elicited differing profiles of RISC-targeted mRNAs. Thus, RISC sequencing represents a highly sensitive method for general RISC profiling and individual miR target identification in biological context. PMID:21030712
Qiu, Gui-Hua; Weng, Zi-Hua; Hu, Pei-Pei; Duan, Wen-Jun; Xie, Bao-Ping; Sun, Bin; Tang, Xiao-Yan; Chen, Jin-Xiang
2018-04-01
From a three-dimensional (3D) metal-organic framework (MOF) of {[Cu(Cmdcp)(phen)(H 2 O)] 2 ·9H 2 O} n (1, H 3 CmdcpBr = N-carboxymethyl-(3,5-dicarboxyl)pyridinium bromide, phen = phenanthroline), a sensitive and selective fluorescence sensor has been developed for the simultaneous detection of ebolavirus conserved RNA sequences and ebolavirus-encoded microRNA-like (miRNA-like) fragment. The results from molecular dynamics simulation confirmed that MOF 1 absorbs carboxyfluorescein (FAM)-tagged and 5(6)-carboxyrhodamine, triethylammonium salt (ROX)-tagged probe ss-DNA (probe DNA, P-DNA) by π … π stacking and hydrogen bonding, as well as additional electrostatic interactions to form a sensing platform of P-DNAs@1 with quenched FAM and ROX fluorescence. In the presence of targeted ebolavirus conserved RNA sequences or ebolavirus-encoded miRNA-like fragment, the fluorophore-labeled P-DNA hybridizes with the analyte to give a P-DNA@RNA duplex and released from MOF 1, triggering a fluorescence recovery. Simultaneous detection of two target RNAs has also been realized by single and synchronous fluorescence analysis. The formed sensing platform shows high sensitivity for ebolavirus conserved RNA sequences and ebolavirus-encoded miRNA-like fragment with detection limits at the picomolar level and high selectivity without cross-reaction between the two probes. MOF 1 thus shows the potential as an effective fluorescent sensing platform for the synchronous detection of two ebolavirus-related sequences, and offer improved diagnostic accuracy of Ebola virus disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Emergence of a replicating species from an in vitro RNA evolution reaction
NASA Technical Reports Server (NTRS)
Breaker, R. R.; Joyce, G. F.
1994-01-01
The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.
Kurtz, David T.; Feigelson, Philip
1977-01-01
A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184
Bacillus horneckiae sp. nov., isolated from a spacecraft-assembly clean room.
Vaishampayan, Parag; Probst, Alexander; Krishnamurthi, Srinivasan; Ghosh, Sudeshna; Osman, Shariff; McDowall, Alasdair; Ruckmani, Arunachalam; Mayilraj, Shanmugam; Venkateswaran, Kasthuri
2010-05-01
Five Gram-stain-positive, motile, aerobic strains were isolated from a clean room of the Kennedy Space Center where the Phoenix spacecraft was assembled. All strains are rod-shaped, spore-forming bacteria, whose spores were resistant to UV radiation up to 1000 J m(-2). The spores were subterminally positioned and produced an external layer. A polyphasic taxonomic study including traditional biochemical tests, fatty acid analysis, cell-wall typing, lipid analyses, 16S rRNA gene sequencing and DNA-DNA hybridization studies was performed to characterize these novel strains. 16S rRNA gene sequencing and lipid analyses convincingly grouped these novel strains within the genus Bacillus as a cluster separate from already described species. The similarity of 16S rRNA gene sequences among the novel strains was >99 %, but the similarity was only about 97 % with their nearest neighbours Bacillus pocheonensis, Bacillus firmus and Bacillus bataviensis. DNA-DNA hybridization dissociation values were <24 % to the closest related type strains. The novel strains had a G+C content 35.6+/-0.5 mol% and could liquefy gelatin but did not utilize or produce acids from any of the carbon substrates tested. The major fatty acids were iso-C(15 : 0) and anteiso-C(15 : 0) and the cell-wall diamino acid was meso-diaminopimelic acid. Based on phylogenetic and phenotypic results, it is concluded that these strains represent a novel species of the genus Bacillus, for which the name Bacillus horneckiae sp. nov. is proposed. The type strain is 1P01SC(T) (=NRRL B-59162(T) =MTCC 9535(T)).
Sequence-based design of bioactive small molecules that target precursor microRNAs.
Velagapudi, Sai Pradeep; Gallo, Steven M; Disney, Matthew D
2014-04-01
Oligonucleotides are designed to target RNA using base pairing rules, but they can be hampered by poor cellular delivery and nonspecific stimulation of the immune system. Small molecules are preferred as lead drugs or probes but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA hairpin precursors, and it identified bioactive small molecules that inhibit biogenesis by binding nuclease-processing sites (44% hit rate). Among 27 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Markedly, microRNA profiling shows that 1 only affects microRNA-96 biogenesis and is at least as selective as an oligonucleotide.
Sequence-based design of bioactive small molecules that target precursor microRNAs
Velagapudi, Sai Pradeep; Gallo, Steven M.; Disney, Matthew D.
2014-01-01
Oligonucleotides are designed to target RNA using base pairing rules, however, they are hampered by poor cellular delivery and non-specific stimulation of the immune system. Small molecules are preferred as lead drugs or probes, but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA precursors and identified bioactive small molecules that inhibit biogenesis by binding to nuclease processing sites (41% hit rate). Amongst 29 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Importantly, microRNA profiling shows that 1 only significantly effects microRNA-96 biogenesis and is more selective than an oligonucleotide. PMID:24509821
RNA 3D Structural Motifs: Definition, Identification, Annotation, and Database Searching
NASA Astrophysics Data System (ADS)
Nasalean, Lorena; Stombaugh, Jesse; Zirbel, Craig L.; Leontis, Neocles B.
Structured RNA molecules resemble proteins in the hierarchical organization of their global structures, folding and broad range of functions. Structured RNAs are composed of recurrent modular motifs that play specific functional roles. Some motifs direct the folding of the RNA or stabilize the folded structure through tertiary interactions. Others bind ligands or proteins or catalyze chemical reactions. Therefore, it is desirable, starting from the RNA sequence, to be able to predict the locations of recurrent motifs in RNA molecules. Conversely, the potential occurrence of one or more known 3D RNA motifs may indicate that a genomic sequence codes for a structured RNA molecule. To identify known RNA structural motifs in new RNA sequences, precise structure-based definitions are needed that specify the core nucleotides of each motif and their conserved interactions. By comparing instances of each recurrent motif and applying base pair isosteriCity relations, one can identify neutral mutations that preserve its structure and function in the contexts in which it occurs.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
Haeseler, Arndt Von
2017-01-01
Abstract RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment. PMID:27661099
Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie
2010-01-01
Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262
Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie
2010-06-01
Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.
The bench scientist's guide to RNA-Seq analysis
USDA-ARS?s Scientific Manuscript database
RNA sequencing (RNA-Seq) is emerging as a highly accurate method to quantify transcript abundance. However, analyses of the large data sets obtained by sequencing the entire transcriptome of organisms have generally been performed by bioinformatic specialists. Here we outline a methods strategy desi...
Morelli, M; Chiumenti, M; De Stradis, A; La Notte, P; Minafra, A
2015-02-01
Through the application of next generation sequencing, in synergy with conventional cloning of DOP-PCR fragments, two double-stranded RNA (dsRNA) molecules of about 1.5 kbp in size were isolated from leaf tissue of a Japanese persimmon (accession SSPI) from Apulia (southern Italy) showing veinlets necrosis. High-throughput sequencing allowed whole genome sequence assembly, yielding a 1,577 and a 1,491 bp contigs identified as dsRNA-1 and dsRNA-2 of a previously undescribed virus, provisionally named as Persimmon cryptic virus (PeCV). In silico analysis showed that both dsRNA fragments were monocistronic and comprised the RNA-dependent RNA polymerase (RdRp) and the capsid protein (CP) genes, respectively. Phylogenetic reconstruction revealed a close relationship of these dsRNAs with those of cryptoviruses described in woody and herbaceous hosts, recently gathered in genus Deltapartitivirus. Virus-specific primers for RT-PCR, designed in the CP cistron, detected viral RNAs also in symptomless persimmon trees sampled from the same geographical area of SSPI, thus proving that PeCV infection may be fairly common and presumably latent.
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Identification and characterization of microRNAs in Phaseolus vulgaris by high-throughput sequencing
2012-01-01
Background MicroRNAs (miRNAs) are endogenously encoded small RNAs that post-transcriptionally regulate gene expression. MiRNAs play essential roles in almost all plant biological processes. Currently, few miRNAs have been identified in the model food legume Phaseolus vulgaris (common bean). Recent advances in next generation sequencing technologies have allowed the identification of conserved and novel miRNAs in many plant species. Here, we used Illumina's sequencing by synthesis (SBS) technology to identify and characterize the miRNA population of Phaseolus vulgaris. Results Small RNA libraries were generated from roots, flowers, leaves, and seedlings of P. vulgaris. Based on similarity to previously reported plant miRNAs,114 miRNAs belonging to 33 conserved miRNA families were identified. Stem-loop precursors and target gene sequences for several conserved common bean miRNAs were determined from publicly available databases. Less conserved miRNA families and species-specific common bean miRNA isoforms were also characterized. Moreover, novel miRNAs based on the small RNAs were found and their potential precursors were predicted. In addition, new target candidates for novel and conserved miRNAs were proposed. Finally, we studied organ-specific miRNA family expression levels through miRNA read frequencies. Conclusions This work represents the first massive-scale RNA sequencing study performed in Phaseolus vulgaris to identify and characterize its miRNA population. It significantly increases the number of miRNAs, precursors, and targets identified in this agronomically important species. The miRNA expression analysis provides a foundation for understanding common bean miRNA organ-specific expression patterns. The present study offers an expanded picture of P. vulgaris miRNAs in relation to those of other legumes. PMID:22394504
Amino acid signature enables proteins to recognize modified tRNA.
Spears, Jessica L; Xiao, Xingqing; Hall, Carol K; Agris, Paul F
2014-02-25
Human tRNA(Lys3)UUU is the primer for HIV replication. The HIV-1 nucleocapsid protein, NCp7, facilitates htRNA(Lys3)UUU recruitment from the host cell by binding to and remodeling the tRNA structure. Human tRNA(Lys3)UUU is post-transcriptionally modified, but until recently, the importance of those modifications in tRNA recognition by NCp7 was unknown. Modifications such as the 5-methoxycarbonylmethyl-2-thiouridine at anticodon wobble position-34 and 2-methylthio-N(6)-threonylcarbamoyladenosine, adjacent to the anticodon at position-37, are important to the recognition of htRNA(Lys3)UUU by NCp7. Several short peptides selected from phage display libraries were found to also preferentially recognize these modifications. Evolutionary algorithms (Monte Carlo and self-consistent mean field) and assisted model building with energy refinement were used to optimize the peptide sequence in silico, while fluorescence assays were developed and conducted to verify the in silico results and elucidate a 15-amino acid signature sequence (R-W-Q/N-H-X2-F-Pho-X-G/A-W-R-X2-G, where X can be most amino acids, and Pho is hydrophobic) that recognized the tRNA's fully modified anticodon stem and loop domain, hASL(Lys3)UUU. Peptides of this sequence specifically recognized and bound modified htRNA(Lys3)UUU with an affinity 10-fold higher than that of the starting sequence. Thus, this approach provides an effective means of predicting sequences of RNA binding peptides that have better binding properties. Such peptides can be used in cell and molecular biology as well as biochemistry to explore RNA binding proteins and to inhibit those protein functions.
Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina
2013-01-01
Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734
Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel
2010-01-01
The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585
Kesanakurti, Prasad; Belton, Mark; Saeed, Hanaa; Rast, Heidi; Boyes, Ian; Rott, Michael
2016-10-01
The majority of plant viruses contain RNA genomes. Detection of viral RNA genomes in infected plant material by next generation sequencing (NGS) is possible through the extraction and sequencing of total RNA, total RNA devoid of ribosomal RNA, small RNA interference (RNAi) molecules, or double stranded RNA (dsRNA). Plants do not typically produce high molecular weight dsRNA, therefore the presence of dsRNA makes it an attractive target for plant virus diagnostics. The sensitivity of NGS as a diagnostic method demands an effective dsRNA protocol that is both representative of the sample and minimizes sample cross contamination. We have developed a modified dsRNA extraction protocol that is more efficient compared to traditional protocols, requiring reduced amounts of starting material, that is less prone to sample cross contamination. This was accomplished by using bead based homogenization of plant material in closed, disposable 50ml tubes. To assess the quality of extraction, we also developed an internal control by designing a real-time (quantitative) PCR (qPCR) assay that targets endornaviruses present in Phaseolus vulgaris cultivar Black Turtle Soup (BTS). Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
RNA-SSPT: RNA Secondary Structure Prediction Tools.
Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad
2013-01-01
The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.
RNA-SSPT: RNA Secondary Structure Prediction Tools
Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad
2013-01-01
The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes. PMID:24250115
Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan
2018-04-25
Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.
Exome capture from the spruce and pine giga-genomes.
Suren, H; Hodgins, K A; Yeaman, S; Nurkowski, K A; Smets, P; Rieseberg, L H; Aitken, S N; Holliday, J A
2016-09-01
Sequence capture is a flexible tool for generating reduced representation libraries, particularly in species with massive genomes. We used an exome capture approach to sequence the gene space of two of the dominant species in Canadian boreal and montane forests - interior spruce (Picea glauca x engelmanii) and lodgepole pine (Pinus contorta). Transcriptome data generated with RNA-seq were coupled with draft genome sequences to design baits corresponding to 26 824 genes from pine and 28 649 genes from spruce. A total of 579 samples for spruce and 631 samples for pine were included, as well as two pine congeners and six spruce congeners. More than 50% of targeted regions were sequenced at >10× depth in each species, while ~12% captured near-target regions within 500 bp of a bait position were sequenced to a depth >10×. Much of our read data arose from off-target regions, which was likely due to the fragmented and incomplete nature of the draft genome assemblies. Capture in general was successful for the related species, suggesting that baits designed for a single species are likely to successfully capture sequences from congeners. From these data, we called approximately 10 million SNPs and INDELs in each species from coding regions, introns, untranslated and flanking regions, as well as from the intergenic space. Our study demonstrates the utility of sequence capture for resequencing in complex conifer genomes, suggests guidelines for improving capture efficiency and provides a rich resource of genetic variants for studies of selection and local adaptation in these species. © 2016 John Wiley & Sons Ltd.
Wolff, G; Kück, U
1990-04-01
The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1987-10-07
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1990-10-09
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.
1990-01-01
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.
RNA-Seq Technology and Its Application in Fish Transcriptomics
Ba, Yi; Zhuang, Qianfeng
2014-01-01
Abstract High-throughput sequencing technologies, also known as next-generation sequencing (NGS) technologies, have revolutionized the way that genomic research is advancing. In addition to the static genome, these state-of-art technologies have been recently exploited to analyze the dynamic transcriptome, and the resulting technology is termed RNA sequencing (RNA-seq). RNA-seq is free from many limitations of other transcriptomic approaches, such as microarray and tag-based sequencing method. Although RNA-seq has only been available for a short time, studies using this method have completely changed our perspective of the breadth and depth of eukaryotic transcriptomes. In terms of the transcriptomics of teleost fishes, both model and non-model species have benefited from the RNA-seq approach and have undergone tremendous advances in the past several years. RNA-seq has helped not only in mapping and annotating fish transcriptome but also in our understanding of many biological processes in fish, such as development, adaptive evolution, host immune response, and stress response. In this review, we first provide an overview of each step of RNA-seq from library construction to the bioinformatic analysis of the data. We then summarize and discuss the recent biological insights obtained from the RNA-seq studies in a variety of fish species. PMID:24380445
Identification and characterization of circular RNAs in zebrafish.
Shen, Yudong; Guo, Xianwu; Wang, Weimin
2017-01-01
Circular RNA (circRNA), a class of RNAs with circular structure, has received little attention until recently, when some new features and functions were discovered. In the present study, we sequenced circRNAs in zebrafish (Danio rerio) and identified 3868 circRNAs using three algorithms (find_circ, CIRI, segemehl). The analysis of microRNA target sites on circRNAs shows that some circRNAs may function as miRNA sponges. Furthermore, we identified the existence of reverse complementary sequences in the flanking regions of only 25 (2.64%) exonic circRNAs, indicating that the mechanism of zebrafish exonic circRNA biogenesis might be different from that in mammals. Moreover, 1122 (29%) zebrafish circRNA sequences showed homology with human, mouse and coelacanth circRNAs. © 2016 Federation of European Biochemical Societies.
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
High-throughput detection of RNA processing in bacteria.
Gill, Erin E; Chan, Luisa S; Winsor, Geoffrey L; Dobson, Neil; Lo, Raymond; Ho Sui, Shannan J; Dhillon, Bhavjinder K; Taylor, Patrick K; Shrestha, Raunak; Spencer, Cory; Hancock, Robert E W; Unrau, Peter J; Brinkman, Fiona S L
2018-03-27
Understanding the RNA processing of an organism's transcriptome is an essential but challenging step in understanding its biology. Here we investigate with unprecedented detail the transcriptome of Pseudomonas aeruginosa PAO1, a medically important and innately multi-drug resistant bacterium. We systematically mapped RNA cleavage and dephosphorylation sites that result in 5'-monophosphate terminated RNA (pRNA) using monophosphate RNA-Seq (pRNA-Seq). Transcriptional start sites (TSS) were also mapped using differential RNA-Seq (dRNA-Seq) and both datasets were compared to conventional RNA-Seq performed in a variety of growth conditions. The pRNA-Seq library revealed known tRNA, rRNA and transfer-messenger RNA (tmRNA) processing sites, together with previously uncharacterized RNA cleavage events that were found disproportionately near the 5' ends of transcripts associated with basic bacterial functions such as oxidative phosphorylation and purine metabolism. The majority (97%) of the processed mRNAs were cleaved at precise codon positions within defined sequence motifs indicative of distinct endonucleolytic activities. The most abundant of these motifs corresponded closely to an E. coli RNase E site previously established in vitro. Using the dRNA-Seq library, we performed an operon analysis and predicted 3159 potential TSS. A correlation analysis uncovered 105 antiparallel pairs of TSS that were separated by 18 bp from each other and were centered on single palindromic TAT(A/T)ATA motifs (likely - 10 promoter elements), suggesting that, consistent with previous in vitro experimentation, these sites can initiate transcription bi-directionally and may thus provide a novel form of transcriptional regulation. TSS and RNA-Seq analysis allowed us to confirm expression of small non-coding RNAs (ncRNAs), many of which are differentially expressed in swarming and biofilm formation conditions. This study uses pRNA-Seq, a method that provides a genome-wide survey of RNA processing, to study the bacterium Pseudomonas aeruginosa and discover extensive transcript processing not previously appreciated. We have also gained novel insight into RNA maturation and turnover as well as a potential novel form of transcription regulation. NOTE: All sequence data has been submitted to the NCBI sequence read archive. Accession numbers are as follows: [NCBI sequence read archive: SRX156386, SRX157659, SRX157660, SRX157661, SRX157683 and SRX158075]. The sequence data is viewable using Jbrowse on www.pseudomonas.com .
Garcia-Martin, Juan Antonio; Bayegan, Amir H; Dotu, Ivan; Clote, Peter
2016-10-19
RNA inverse folding is the problem of finding one or more sequences that fold into a user-specified target structure s 0 , i.e. whose minimum free energy secondary structure is identical to the target s 0 . Here we consider the ensemble of all RNA sequences that have low free energy with respect to a given target s 0 . We introduce the program RNAdualPF, which computes the dual partition function Z ∗ , defined as the sum of Boltzmann factors exp(-E(a,s 0 )/RT) of all RNA nucleotide sequences a compatible with target structure s 0 . Using RNAdualPF, we efficiently sample RNA sequences that approximately fold into s 0 , where additionally the user can specify IUPAC sequence constraints at certain positions, and whether to include dangles (energy terms for stacked, single-stranded nucleotides). Moreover, since we also compute the dual partition function Z ∗ (k) over all sequences having GC-content k, the user can require that all sampled sequences have a precise, specified GC-content. Using Z ∗ , we compute the dual expected energy 〈E ∗ 〉, and use it to show that natural RNAs from the Rfam 12.0 database have higher minimum free energy than expected, thus suggesting that functional RNAs are under evolutionary pressure to be only marginally thermodynamically stable. We show that C. elegans precursor microRNA (pre-miRNA) is significantly non-robust with respect to mutations, by comparing the robustness of each wild type pre-miRNA sequence with 2000 [resp. 500] sequences of the same GC-content generated by RNAdualPF, which approximately [resp. exactly] fold into the wild type target structure. We confirm and strengthen earlier findings that precursor microRNAs and bacterial small noncoding RNAs display plasticity, a measure of structural diversity. We describe RNAdualPF, which rapidly computes the dual partition function Z ∗ and samples sequences having low energy with respect to a target structure, allowing sequence constraints and specified GC-content. Using different inverse folding software, another group had earlier shown that pre-miRNA is mutationally robust, even controlling for compositional bias. Our opposite conclusion suggests a cautionary note that computationally based insights into molecular evolution may heavily depend on the software used. C/C++-software for RNAdualPF is available at http://bioinformatics.bc.edu/clotelab/RNAdualPF .
RISC RNA sequencing for context-specific identification of in vivo microRNA targets.
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2011-01-07
MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.
How to design a single-cell RNA-sequencing experiment: pitfalls, challenges and perspectives.
Dal Molin, Alessandra; Di Camillo, Barbara
2018-01-31
The sequencing of the transcriptome of single cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types in heterogeneous cell populations or for the study of stochastic gene expression. In recent years, various experimental methods and computational tools for analysing single-cell RNA-sequencing data have been proposed. However, most of them are tailored to different experimental designs or biological questions, and in many cases, their performance has not been benchmarked yet, thus increasing the difficulty for a researcher to choose the optimal single-cell transcriptome sequencing (scRNA-seq) experiment and analysis workflow. In this review, we aim to provide an overview of the current available experimental and computational methods developed to handle single-cell RNA-sequencing data and, based on their peculiarities, we suggest possible analysis frameworks depending on specific experimental designs. Together, we propose an evaluation of challenges and open questions and future perspectives in the field. In particular, we go through the different steps of scRNA-seq experimental protocols such as cell isolation, messenger RNA capture, reverse transcription, amplification and use of quantitative standards such as spike-ins and Unique Molecular Identifiers (UMIs). We then analyse the current methodological challenges related to preprocessing, alignment, quantification, normalization, batch effect correction and methods to control for confounding effects. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer
2016-09-01
AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR...PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release...SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-14-1-0080 GRANT11489
Highly multiplexed subcellular RNA sequencing in situ
Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Yang, Joyce L.; Terry, Richard; Jeanty, Sauveur S. F.; Li, Chao; Amamoto, Ryoji; Peters, Derek T.; Turczyk, Brian M.; Marblestone, Adam H.; Inverso, Samuel A.; Bernard, Amy; Mali, Prashant; Rios, Xavier; Aach, John; Church, George M.
2014-01-01
Understanding the spatial organization of gene expression with single nucleotide resolution requires localizing the sequences of expressed RNA transcripts within a cell in situ. Here we describe fluorescent in situ RNA sequencing (FISSEQ), in which stably cross-linked cDNA amplicons are sequenced within a biological sample. Using 30-base reads from 8,742 genes in situ, we examined RNA expression and localization in human primary fibroblasts using a simulated wound healing assay. FISSEQ is compatible with tissue sections and whole mount embryos, and reduces the limitations of optical resolution and noisy signals on single molecule detection. Our platform enables massively parallel detection of genetic elements, including gene transcripts and molecular barcodes, and can be used to investigate cellular phenotype, gene regulation, and environment in situ. PMID:24578530
Detection of PIWI and piRNAs in the mitochondria of mammalian cancer cells.
Kwon, ChangHyuk; Tak, Hyosun; Rho, Mina; Chang, Hae Ryung; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Lee, Eun Kyung; Nam, Seungyoon
2014-03-28
Piwi-interacting RNAs (piRNAs) are 26-31 nt small noncoding RNAs that are processed from their longer precursor transcripts by Piwi proteins. Localization of Piwi and piRNA has been reported mostly in nucleus and cytoplasm of higher eukaryotes germ-line cells, where it is believed that known piRNA sequences are located in repeat regions of nuclear genome in germ-line cells. However, localization of PIWI and piRNA in mammalian somatic cell mitochondria yet remains largely unknown. We identified 29 piRNA sequence alignments from various regions of the human mitochondrial genome. Twelve out 29 piRNA sequences matched stem-loop fragment sequences of seven distinct tRNAs. We observed their actual expression in mitochondria subcellular fractions by inspecting mitochondrial-specific small RNA-Seq datasets. Of interest, the majority of the 29 piRNAs overlapped with multiple longer transcripts (expressed sequence tags) that are unique to the human mitochondrial genome. The presence of mature piRNAs in mitochondria was detected by qRT-PCR of mitochondrial subcellular RNAs. Further validation showed detection of Piwi by colocalization using anti-Piwil1 and mitochondria organelle-specific protein antibodies. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
RNA-Seq Atlas of Glycine max: a guide to the soybean transcriptome
USDA-ARS?s Scientific Manuscript database
A first analysis of the Glycine max (L.) Merr. (soybean) transcriptome using next generation sequencing technology and RNA-Sequencing (RNA-Seq) is presented. This analysis will provide an important resource for understanding transcription and gene co-regulatory networks in soybean, the most economic...
Self-Assembly of Measles Virus Nucleocapsid-like Particles: Kinetics and RNA Sequence Dependence.
Milles, Sigrid; Jensen, Malene Ringkjøbing; Communie, Guillaume; Maurin, Damien; Schoehn, Guy; Ruigrok, Rob W H; Blackledge, Martin
2016-08-01
Measles virus RNA genomes are packaged into helical nucleocapsids (NCs), comprising thousands of nucleo-proteins (N) that bind the entire genome. N-RNA provides the template for replication and transcription by the viral polymerase and is a promising target for viral inhibition. Elucidation of mechanisms regulating this process has been severely hampered by the inability to controllably assemble NCs. Here, we demonstrate self-organization of N into NC-like particles in vitro upon addition of RNA, providing a simple and versatile tool for investigating assembly. Real-time NMR and fluorescence spectroscopy reveals biphasic assembly kinetics. Remarkably, assembly depends strongly on the RNA-sequence, with the genomic 5' end and poly-Adenine sequences assembling efficiently, while sequences such as poly-Uracil are incompetent for NC formation. This observation has important consequences for understanding the assembly process. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Sela, Noa; Lachman, Oded; Reingold, Victoria; Dombrovsky, Aviv
2013-10-01
A novel virus was detected in watermelon plants (Citrullus lanatus Thunb.) infected with Melon necrotic spot virus (MNSV) using SOLiD next-generation sequence analysis. In addition to the expected MSNV genome, two double-stranded RNA (dsRNA) segments of 1,312 and 1,118 bp were also identified and sequenced from the purified virus preparations. These two dsRNA segments encode two putative partitivirus-related proteins, an RNA-dependent RNA polymerase (RdRP) and a capsid protein, which were sequenced. Genomic-sequence analysis and analysis of phylogenetic relationships indicate that these two dsRNAs together make up the genome of a novel Partitivirus. This virus was found to be closely related to the Pepper cryptic virus 1 and Raphanus sativus cryptic virus. It is suggested that this novel virus putatively named Citrullus lanatus cryptic virus be considered as a new member of the family Partitiviridae.
Complete genome sequence of a Watermelon silver mottle virus isolate from China.
Rao, Xueqin; Wu, Zhuyan; Li, Yuan
2013-06-01
The complete genome of a Watermelon silver mottle virus (WSMoV) (genus Tospovirus, family Bunyaviridae) isolate (WSMoV-GZ) from Guangdong province, China was sequenced. The genomes of WSMoV-GZ contained 3,603, 4,909, and 8,914 nt of small (S), medium (M), and large (L) RNA segments, respectively, and had a genomic organization characteristic of members of the genus Tospovirus. The amino acid sequence of the nucleocapsid (N) protein, S RNA-encoded nonstructural (NSs) protein, M RNA-encoded nonstructural (NSm) protein, Gn/Gc glycoprotein precursor, and RNA-dependent RNA polymerase (RdRp) protein showed 94.3-97.5 % identity with those of other WSMoV isolates. Phylogenetic analysis showed that the N protein of WSMoV-GZ was clustered together with those of the WSMoV isolates. The full sequence of WSMoV-GZ provides a reference genome for comparison with other tospoviruses.
Mapping RNA-seq Reads with STAR
Dobin, Alexander; Gingeras, Thomas R.
2015-01-01
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, signal visualization, and so forth. In this unit we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is Open Source software that can be run on Unix, Linux or Mac OS X systems. PMID:26334920
Mapping RNA-seq Reads with STAR.
Dobin, Alexander; Gingeras, Thomas R
2015-09-03
Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates, providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, and signal visualization. In this unit, we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is open source software that can be run on Unix, Linux, or Mac OS X systems. Copyright © 2015 John Wiley & Sons, Inc.
REDO: RNA Editing Detection in Plant Organelles Based on Variant Calling Results.
Wu, Shuangyang; Liu, Wanfei; Aljohi, Hasan Awad; Alromaih, Sarah A; Alanazi, Ibrahim O; Lin, Qiang; Yu, Jun; Hu, Songnian
2018-05-01
RNA editing is a post-transcriptional or cotranscriptional process that changes the sequence of the precursor transcript by substitutions, insertions, or deletions. Almost all of the land plants undergo RNA editing in organelles (plastids and mitochondria). Although several software tools have been developed to identify RNA editing events, there has been a great challenge to distinguish true RNA editing events from genome variation, sequencing errors, and other factors. Here we introduce REDO, a comprehensive application tool for identifying RNA editing events in plant organelles based on variant call format files from RNA-sequencing data. REDO is a suite of Perl scripts that illustrate a bunch of attributes of RNA editing events in figures and tables. REDO can also detect RNA editing events in multiple samples simultaneously and identify the significant differential proportion of RNA editing loci. Comparing with similar tools, such as REDItools, REDO runs faster with higher accuracy, and more specificity at the cost of slightly lower sensitivity. Moreover, REDO annotates each RNA editing site in RNAs, whereas REDItools reports only possible RNA editing sites in genome, which need additional steps to obtain RNA editing profiles for RNAs. Overall, REDO can identify potential RNA editing sites easily and provide several functions such as detailed annotations, statistics, figures, and significantly differential proportion of RNA editing sites among different samples.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chojnowski, Grzegorz, E-mail: gchojnowski@genesilico.pl; Waleń, Tomasz; University of Warsaw, Banacha 2, 02-097 Warsaw
2015-03-01
A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure ismore » RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx.« less
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Complete genome sequence of a novel genotype of squash mosaic virus
USDA-ARS?s Scientific Manuscript database
Complete genome sequence of a novel genotype of Squash mosaic virus (SqMV) infecting squash plants in Spain was obtained using deep sequencing of small ribonucleic acids and assembly. The low nucleotide sequence identities, with 87-88% on RNA1 and 84-86% on RNA2 to known SqMV isolates, suggest a new...
Tolson, D A; Nicholson, N H
1998-01-01
The determination of DNA sequences by partial exonuclease digestion followed by Matrix-Assisted Laser Desorption Time of Flight Mass Spectrometry (MALDI-TOF) is a well established method. When the same procedure is applied to RNA, difficulties arise due to the small (1 Da) mass difference between the nucleotides U and C, which makes unambiguous assignment difficult using a MALDI-TOF instrument. Here we report our experiences with sequence specific endonucleases and chemical methods followed by MALDI-TOF to resolve these sequence ambiguities. We have found chemical methods superior to endonucleases both in terms of correct specificity and extent of sequence coverage. This methodology can be used in combination with exonuclease digestion to rapidly assign RNA sequences. PMID:9421498
Pan, W J; Blackburn, E H
1995-01-01
The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211
Accurate identification of RNA editing sites from primitive sequence with deep neural networks.
Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie
2018-04-16
RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.
Study design requirements for RNA sequencing-based breast cancer diagnostics.
Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias
2016-02-01
Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.
A practical guide to single-cell RNA-sequencing for biomedical research and clinical applications.
Haque, Ashraful; Engel, Jessica; Teichmann, Sarah A; Lönnberg, Tapio
2017-08-18
RNA sequencing (RNA-seq) is a genomic approach for the detection and quantitative analysis of messenger RNA molecules in a biological sample and is useful for studying cellular responses. RNA-seq has fueled much discovery and innovation in medicine over recent years. For practical reasons, the technique is usually conducted on samples comprising thousands to millions of cells. However, this has hindered direct assessment of the fundamental unit of biology-the cell. Since the first single-cell RNA-sequencing (scRNA-seq) study was published in 2009, many more have been conducted, mostly by specialist laboratories with unique skills in wet-lab single-cell genomics, bioinformatics, and computation. However, with the increasing commercial availability of scRNA-seq platforms, and the rapid ongoing maturation of bioinformatics approaches, a point has been reached where any biomedical researcher or clinician can use scRNA-seq to make exciting discoveries. In this review, we present a practical guide to help researchers design their first scRNA-seq studies, including introductory information on experimental hardware, protocol choice, quality control, data analysis and biological interpretation.
Microprocessor activity controls differential miRNA biogenesis In Vivo.
Conrad, Thomas; Marsico, Annalisa; Gehre, Maja; Orom, Ulf Andersson
2014-10-23
In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.
2014-01-01
Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355
Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I
2001-01-01
A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988
Colored petri net modeling of small interfering RNA-mediated messenger RNA degradation.
Nickaeen, Niloofar; Moein, Shiva; Heidary, Zarifeh; Ghaisari, Jafar
2016-01-01
Mathematical modeling of biological systems is an attractive way for studying complex biological systems and their behaviors. Petri Nets, due to their ability to model systems with various levels of qualitative information, have been wildly used in modeling biological systems in which enough qualitative data may not be at disposal. These nets have been used to answer questions regarding the dynamics of different cell behaviors including the translation process. In one stage of the translation process, the RNA sequence may be degraded. In the process of degradation of RNA sequence, small-noncoding RNA molecules known as small interfering RNA (siRNA) match the target RNA sequence. As a result of this matching, the target RNA sequence is destroyed. In this context, the process of matching and destruction is modeled using Colored Petri Nets (CPNs). The model is constructed using CPNs which allow tokens to have a value or type on them. Thus, CPN is a suitable tool to model string structures in which each element of the string has a different type. Using CPNs, long RNA, and siRNA strings are modeled with a finite set of colors. The model is simulated via CPN Tools. A CPN model of the matching between RNA and siRNA strings is constructed in CPN Tools environment. In previous studies, a network of stoichiometric equations was modeled. However, in this particular study, we modeled the mechanism behind the silencing process. Modeling this kind of mechanisms provides us with a tool to examine the effects of different factors such as mutation or drugs on the process.
Robbins, Marjorie; Judge, Adam; MacLachlan, Ian
2009-06-01
Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.
Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne
2011-06-01
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Modeling bias and variation in the stochastic processes of small RNA sequencing
Etheridge, Alton; Sakhanenko, Nikita; Galas, David
2017-01-01
Abstract The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. PMID:28369495
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
RNA catalysis and the origins of life
NASA Technical Reports Server (NTRS)
Orgel, Leslie E.
1986-01-01
The role of RNA catalysis in the origins of life is considered in connection with the discovery of riboszymes, which are RNA molecules that catalyze sequence-specific hydrolysis and transesterification reactions of RNA substrates. Due to this discovery, theories positing protein-free replication as preceding the appearance of the genetic code are more plausible. The scope of RNA catalysis in biology and chemistry is discussed, and it is noted that the development of methods to select (or predict) RNA sequences with preassigned catalytic functions would be a major contribution to the study of life's origins.
Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.
2013-01-01
We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463
Strategies for Protein Overproduction in Escherichia coli.
ERIC Educational Resources Information Center
Mott, John E.
1984-01-01
Examines heterologous expression in Escherichia coli and the role of regulatory sequences which control gene expression at transcription resulting in abundant production of messenger RNA and regulatory sequences in mRNA which promote efficient translation. Also examines the role of E. coli cells in stabilizing mRNA and protein that is…
Archaeon and archaeal virus diversity classification via sequence entropy and fractal dimension
NASA Astrophysics Data System (ADS)
Tremberger, George, Jr.; Gallardo, Victor; Espinoza, Carola; Holden, Todd; Gadura, N.; Cheung, E.; Schneider, P.; Lieberman, D.; Cheung, T.
2010-09-01
Archaea are important potential candidates in astrobiology as their metabolism includes solar, inorganic and organic energy sources. Archaeal viruses would also be expected to be present in a sustainable archaeal exobiological community. Genetic sequence Shannon entropy and fractal dimension can be used to establish a two-dimensional measure for classification and phylogenetic study of these organisms. A sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. Archaeal 16S and 23S ribosomal RNA sequences were studied. Outliers in the 16S rRNA fractal dimension and entropy plot were found to be halophilic archaea. Positive correlation (R-square ~ 0.75, N = 18) was observed between fractal dimension and entropy across the studied species. The 16S ribosomal RNA sequence entropy correlates with the 23S ribosomal RNA sequence entropy across species with R-square 0.93, N = 18. Entropy values correspond positively with branch lengths of a published phylogeny. The studied archaeal virus sequences have high fractal dimensions of 2.02 or more. A comparison of selected extremophile sequences with archaeal sequences from the Humboldt Marine Ecosystem database (Wood-Hull Oceanography Institute, MIT) suggests the presence of continuous sequence expression as inferred from distributions of entropy and fractal dimension, consistent with the diversity expected in an exobiological archaeal community.
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences
NASA Astrophysics Data System (ADS)
Regoli, Massimo
2009-02-01
The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.
The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.
Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene
2014-01-01
T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.
The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain
Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene
2014-01-01
T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein–nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5′ TOPs (5′ terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations. PMID:24824036
He, Yaodong; Ma, Tiantian; Zhang, Xiaobo
2017-01-01
MicroRNAs (miRNAs), important factors in animal innate immunity, suppress the expressions of their target genes by binding to target mRNA’s 3′ untranslated regions (3′UTRs). However, the mechanism of synchronous regulation of multiple targets by a single miRNA remains unclear. In this study, the interaction between a white spot syndrome virus (WSSV) miRNA (WSSV-miR-N32) and its two viral targets (wsv459 and wsv322) was characterized in WSSV-infected shrimp. The outcomes indicated that WSSV-encoded miRNA (WSSV-miR-N32) significantly inhibited virus infection by simultaneously targeting wsv459 and wsv322. The silencing of wsv459 or wsv322 by siRNA led to significant decrease of WSSV copies in shrimp, showing that the two viral genes were required for WSSV infection. WSSV-miR-N32 could mediate 5′–3′ exonucleolytic digestion of its target mRNAs, which stopped at the sites of target mRNA 3′UTRs close to the sequence complementary to the miRNA seed sequence. The complementary bases (to the target mRNA sequence) of a miRNA 9th–18th non-seed sequence were essential for the miRNA targeting. Therefore, our findings presented novel insights into the mechanism of miRNA-mediated suppression of target gene expressions, which would be helpful for understanding the roles of miRNAs in innate immunity of invertebrate. PMID:29230209
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Modeling Evolution on Nearly Neutral Network Fitness Landscapes
NASA Astrophysics Data System (ADS)
Yakushkina, Tatiana; Saakian, David B.
2017-08-01
To describe virus evolution, it is necessary to define a fitness landscape. In this article, we consider the microscopic models with the advanced version of neutral network fitness landscapes. In this problem setting, we suppose a fitness difference between one-point mutation neighbors to be small. We construct a modification of the Wright-Fisher model, which is related to ordinary infinite population models with nearly neutral network fitness landscape at the large population limit. From the microscopic models in the realistic sequence space, we derive two versions of nearly neutral network models: with sinks and without sinks. We claim that the suggested model describes the evolutionary dynamics of RNA viruses better than the traditional Wright-Fisher model with few sequences.
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons
Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.
2017-01-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
Exploration of RNA structure spaces
NASA Technical Reports Server (NTRS)
Fox, G. E.
1991-01-01
In order to understand the structure of real structure spaces, we are studying the 5S rRNA structure space experimentally. A plasmid containing a synthetic 5S rRNA gene, two rRNA promoters, and transcription terminators has been assembled. Assays are conducted to determine if the foreign 5S rRNA is expressed, and to see whether or not it is incorporated into ribosomes. Evolutionary competition is used to determine the relative fitness of strains containing the foreign 5S rRNA and a control 5S rRNA. By using site directed mutagenesis, a number of mutants can be made in order to study the boundaries of the structure space and how sharply defined they are. By making similar studies in the vicinity of structure space, it will be possible to determine how homogeneous the 5S rRNA structure space is. Useable experimental protocols have been developed, and a number of mutants have already been studied. Initial results suggest an explanation of why single stranded regions of the RNA are less subject to mutation than double stranded regions.
SRD: a Staphylococcus regulatory RNA database.
Sassi, Mohamed; Augagneur, Yoann; Mauro, Tony; Ivain, Lorraine; Chabelskaya, Svetlana; Hallier, Marc; Sallou, Olivier; Felden, Brice
2015-05-01
An overflow of regulatory RNAs (sRNAs) was identified in a wide range of bacteria. We designed and implemented a new resource for the hundreds of sRNAs identified in Staphylococci, with primary focus on the human pathogen Staphylococcus aureus. The "Staphylococcal Regulatory RNA Database" (SRD, http://srd.genouest.org/) compiled all published data in a single interface including genetic locations, sequences and other features. SRD proposes novel and simplified identifiers for Staphylococcal regulatory RNAs (srn) based on the sRNA's genetic location in S. aureus strain N315 which served as a reference. From a set of 894 sequences and after an in-depth cleaning, SRD provides a list of 575 srn exempt of redundant sequences. For each sRNA, their experimental support(s) is provided, allowing the user to individually assess their validity and significance. RNA-seq analysis performed on strains N315, NCTC8325, and Newman allowed us to provide further details, upgrade the initial annotation, and identified 159 RNA-seq independent transcribed sRNAs. The lists of 575 and 159 sRNAs sequences were used to predict the number and location of srns in 18 S. aureus strains and 10 other Staphylococci. A comparison of the srn contents within 32 Staphylococcal genomes revealed a poor conservation between species. In addition, sRNA structure predictions obtained with MFold are accessible. A BLAST server and the intaRNA program, which is dedicated to target prediction, were implemented. SRD is the first sRNA database centered on a genus; it is a user-friendly and scalable device with the possibility to submit new sequences that should spread in the literature. © 2015 Sassi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-01-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency. PMID:29399550
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.
2011-01-01
Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774
Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J
2010-04-01
This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.
Small RNA profiling of low biomass samples: identification and removal of contaminants.
Heintz-Buschart, Anna; Yusuf, Dilmurat; Kaysen, Anne; Etheridge, Alton; Fritz, Joëlle V; May, Patrick; de Beaufort, Carine; Upadhyaya, Bimal B; Ghosal, Anubrata; Galas, David J; Wilmes, Paul
2018-05-14
Sequencing-based analyses of low-biomass samples are known to be prone to misinterpretation due to the potential presence of contaminating molecules derived from laboratory reagents and environments. DNA contamination has been previously reported, yet contamination with RNA is usually considered to be very unlikely due to its inherent instability. Small RNAs (sRNAs) identified in tissues and bodily fluids, such as blood plasma, have implications for physiology and pathology, and therefore the potential to act as disease biomarkers. Thus, the possibility for RNA contaminants demands careful evaluation. Herein, we report on the presence of small RNA (sRNA) contaminants in widely used microRNA extraction kits and propose an approach for their depletion. We sequenced sRNAs extracted from human plasma samples and detected important levels of non-human (exogenous) sequences whose source could be traced to the microRNA extraction columns through a careful qPCR-based analysis of several laboratory reagents. Furthermore, we also detected the presence of artefactual sequences related to these contaminants in a range of published datasets, thereby arguing in particular for a re-evaluation of reports suggesting the presence of exogenous RNAs of microbial and dietary origin in blood plasma. To avoid artefacts in future experiments, we also devise several protocols for the removal of contaminant RNAs, define minimal amounts of starting material for artefact-free analyses, and confirm the reduction of contaminant levels for identification of bona fide sequences using 'ultra-clean' extraction kits. This is the first report on the presence of RNA molecules as contaminants in RNA extraction kits. The described protocols should be applied in the future to avoid confounding sRNA studies.
Miras, Manuel; Rodríguez-Hernández, Ana M; Romero-López, Cristina; Berzal-Herranz, Alfredo; Colchero, Jaime; Aranda, Miguel A; Truniger, Verónica
2018-01-01
In eukaryotes, the formation of a 5'-cap and 3'-poly(A) dependent protein-protein bridge is required for translation of its mRNAs. In contrast, several plant virus RNA genomes lack both of these mRNA features, but instead have a 3'-CITE (for cap-independent translation enhancer), a RNA element present in their 3'-untranslated region that recruits translation initiation factors and is able to control its cap-independent translation. For several 3'-CITEs, direct RNA-RNA long-distance interactions based on sequence complementarity between the 5'- and 3'-ends are required for efficient translation, as they bring the translation initiation factors bound to the 3'-CITE to the 5'-end. For the carmovirus melon necrotic spot virus (MNSV), a 3'-CITE has been identified, and the presence of its 5'-end in cis has been shown to be required for its activity. Here, we analyze the secondary structure of the 5'-end of the MNSV RNA genome and identify two highly conserved nucleotide sequence stretches that are complementary to the apical loop of its 3'-CITE. In in vivo cap-independent translation assays with mutant constructs, by disrupting and restoring sequence complementarity, we show that the interaction between the 3'-CITE and at least one complementary sequence in the 5'-end is essential for virus RNA translation, although efficient virus translation and multiplication requires both connections. The complementary sequence stretches are invariant in all MNSV isolates, suggesting that the dual 5'-3' RNA:RNA interactions are required for optimal MNSV cap-independent translation and multiplication.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
FunGene: the functional gene pipeline and repository.
Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R
2013-01-01
Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.
Roux, Pierre-François; Frésard, Laure; Boutin, Morgane; Leroux, Sophie; Klopp, Christophe; Djari, Anis; Esquerré, Diane; Martin, Pascal G P; Zerjal, Tatiana; Gourichon, David; Pitel, Frédérique; Lagarrigue, Sandrine
2015-12-04
RNA editing is a posttranscriptional process leading to differences between genomic DNA and transcript sequences, potentially enhancing transcriptome diversity. With recent advances in high-throughput sequencing, many efforts have been made to describe mRNA editing at the transcriptome scale, especially in mammals, yielding contradictory conclusions regarding the extent of this phenomenon. We show, by detailed description of the 25 studies focusing so far on mRNA editing at the whole-transcriptome scale, that systematic sequencing artifacts are considered in most studies whereas biological replication is often neglected and multi-alignment not properly evaluated, which ultimately impairs the legitimacy of results. We recently developed a rigorous strategy to identify mRNA editing using mRNA and genomic DNA sequencing, taking into account sequencing and mapping artifacts, and biological replicates. We applied this method to screen for mRNA editing in liver and white adipose tissue from eight chickens and confirm the small extent of mRNA recoding in this species. Among the 25 unique edited sites identified, three events were previously described in mammals, attesting that this phenomenon is conserved throughout evolution. Deeper investigations on five sites revealed the impact of tissular context, genotype, age, feeding conditions, and sex on mRNA editing levels. More specifically, this analysis highlighted that the editing level at the site located on COG3 was strongly regulated by four of these factors. By comprehensively characterizing the mRNA editing landscape in chickens, our results highlight how this phenomenon is limited and suggest regulation of editing levels by various genetic and environmental factors. Copyright © 2016 Roux et al.
Roux, Pierre-François; Frésard, Laure; Boutin, Morgane; Leroux, Sophie; Klopp, Christophe; Djari, Anis; Esquerré, Diane; Martin, Pascal GP; Zerjal, Tatiana; Gourichon, David; Pitel, Frédérique; Lagarrigue, Sandrine
2015-01-01
RNA editing is a posttranscriptional process leading to differences between genomic DNA and transcript sequences, potentially enhancing transcriptome diversity. With recent advances in high-throughput sequencing, many efforts have been made to describe mRNA editing at the transcriptome scale, especially in mammals, yielding contradictory conclusions regarding the extent of this phenomenon. We show, by detailed description of the 25 studies focusing so far on mRNA editing at the whole-transcriptome scale, that systematic sequencing artifacts are considered in most studies whereas biological replication is often neglected and multi-alignment not properly evaluated, which ultimately impairs the legitimacy of results. We recently developed a rigorous strategy to identify mRNA editing using mRNA and genomic DNA sequencing, taking into account sequencing and mapping artifacts, and biological replicates. We applied this method to screen for mRNA editing in liver and white adipose tissue from eight chickens and confirm the small extent of mRNA recoding in this species. Among the 25 unique edited sites identified, three events were previously described in mammals, attesting that this phenomenon is conserved throughout evolution. Deeper investigations on five sites revealed the impact of tissular context, genotype, age, feeding conditions, and sex on mRNA editing levels. More specifically, this analysis highlighted that the editing level at the site located on COG3 was strongly regulated by four of these factors. By comprehensively characterizing the mRNA editing landscape in chickens, our results highlight how this phenomenon is limited and suggest regulation of editing levels by various genetic and environmental factors. PMID:26637431
miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction
Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A
2015-01-01
RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908