Sample records for rna-homology shows triplex

  1. RNA-DNA Triplex Formation by Long Noncoding RNAs.

    PubMed

    Li, Yue; Syed, Junetha; Sugiyama, Hiroshi

    2016-11-17

    Long noncoding RNAs (lncRNAs) play a pivotal role in the regulation of biological processes through various mechanisms that are not fully understood. Proposed mechanisms include regulation based on RNA-protein interactions, as well as RNA-RNA interactions and RNA-DNA interactions. Here, we focus on one possible mechanism that lncRNA might be using to impact biological function, the RNA-DNA triplex formation. We summarize currently available examples of lncRNA triplex formation and discuss the details surrounding orientation of triplex formation as one of the key properties guiding this process. We propose that symmetrical triplex-forming motifs, especially those in cis-acting lncRNAs, favor triplex formation. We also consider the effects of lncRNA structures, protein or ligand binding, and chromatin structures on the lncRNAs triplex formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Sensitive and label-free detection of miRNA-145 by triplex formation.

    PubMed

    Aviñó, Anna; Huertas, César S; Lechuga, Laura M; Eritja, Ramon

    2016-01-01

    The development of new strategies for detecting microRNAs (miRNAs) has become a crucial step in the diagnostic field. miRNA profiles depend greatly on the sample and the analytical platform employed, leading sometimes to contradictory results. In this work, we study the use of modified parallel tail-clamps to detect a miRNA sequence involved in tumor suppression by triplex formation. Thermal denaturing curves and circular dichroism (CD) measurements have been performed to confirm that parallel clamps carrying 8-aminoguanine form the most stable triplex structures with their target miRNA. The modified tail-clamps have been tested as bioreceptors in a surface plasmon resonance (SPR) biosensor for the detection of miRNA-145. The detection limit was improved 2.4 times demonstrating that a stable triplex structure is formed between target miRNA and 8-aminoguanine tail-clamp bioreceptor. This new approach is an essential step toward the label-free and reliable detection of miRNA signatures for diagnostic purposes.

  3. 5. EXTERIOR OF TRIPLEX COTTAGE ROOF SHOWING MANVILLE COMPOSITION SHINGLES, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. EXTERIOR OF TRIPLEX COTTAGE ROOF SHOWING MANVILLE COMPOSITION SHINGLES, POURED CONCRETE CHIMNEYS, AND TRANSLUCENT PLASTIC COVERING OVER WALKWAY AT REAR OF HOUSE (PHOTO LEFT). VIEW TO NORTHWEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  4. Super-lncRNAs: identification of lncRNAs that target super-enhancers via RNA:DNA:DNA triplex formation.

    PubMed

    Soibam, Benjamin

    2017-11-01

    Super-enhancers are characterized by high levels of Mediator binding and are major contributors to the expression of their associated genes. They exhibit high levels of local chromatin interactions and a higher order of local chromatin organization. On the other hand, lncRNAs can localize to specific DNA sites by forming a RNA:DNA:DNA triplex, which in turn can contribute to local chromatin organization. In this paper, we characterize a new class of lncRNAs called super-lncRNAs that target super-enhancers and which can contribute to the local chromatin organization of the super-enhancers. Using a logistic regression model based on the number of RNA:DNA:DNA triplex sites a lncRNA forms within the super-enhancer, we identify 442 unique super-lncRNA transcripts in 27 different human cell and tissue types; 70% of these super-lncRNAs were tissue restricted. They primarily harbor a single triplex-forming repeat domain, which forms an RNA:DNA:DNA triplex with multiple anchor DNA sites (originating from transposable elements) within the super-enhancers. Super-lncRNAs can be grouped into 17 different clusters based on the tissue or cell lines they target. Super-lncRNAs in a particular cluster share common short structural motifs and their corresponding super-enhancer targets are associated with gene ontology terms pertaining to the tissue or cell line. Super-lncRNAs may use these structural motifs to recruit and transport necessary regulators (such as transcription factors and Mediator complexes) to super-enhancers, influence chromatin organization, and act as spatial amplifiers for key tissue-specific genes associated with super-enhancers. © 2017 Soibam; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  5. Binding properties of chiral ruthenium(II) complexes Λ- and Δ-[Ru(bpy)2dppz-11-CO2Me]2+ toward the triplex RNA poly(U)•poly(A)*poly(U).

    PubMed

    Ni, Wen; Liu, Xiaohua; Tan, Lifeng

    2018-05-24

    Two chiral ruthenium(II) complexes containing ligand dppz-CO 2 Me (dppz-11-CO 2 Me = dipyrido[3,2-a,2',3'-c]phenazine-11-carboxylic acid methyl ester), Δ-[Ru(bpy) 2 dppz-11-CO 2 Me] 2+ (bpy = 2,2'-bipyridine; Δ-1) and Λ-[Ru(bpy) 2 dppz-11-CO 2 Me] 2+ (Λ-1), were synthesized and characterized. The binding of the two enantiomers with the triplex RNA poly(U)•poly(A)*poly(U) was carried out by various biophysical techniques. Analysis of the absorption and fluorescence features indicates that the binding strengths of the two enantiomers toward the triplex RNA differ only slightly from each other. The total increase in viscosity and shape of the curves for the triplex RNA with Λ-1 is similar to that with Δ-1, suggesting the binding modes of two enantiomers with the triplex RNA are intercalation. Thermal melting measurements indicate that the stabilization effects clearly depended on the concentrations of Λ-1 and Δ-1. However, the third-strand stabilizing effect of Δ-1 dramatically differs from that of Λ-1 when they interact with the chiral environment of the RNA triple at pH = 7.0 and [Na + ] = 35 mM. Combined with the CD (CD = circular dichroism) variations of the triplex RNA with either Λ-1 or Δ-1, the reason for their different triplex stabilization effects may originate from the two enantiomers through different orientations intercalating into nucleobases of the triplex. In addition, effects of higher ionic strengths on the triplex stabilization in the absence and presence of the two enantiomers have also been studied. The results presented here may be useful for understanding the binding properties of the triplex RNA with small molecule, particularly chiral ruthenium(II) complexes. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Biophysical Characterization of the Strong Stabilization of the RNA Triplex poly(U)•poly(A)*poly(U) by 9-O-(ω-amino) Alkyl Ether Berberine Analogs

    PubMed Central

    Hossain, Maidul; Haq, Lucy; Suresh Kumar, Gopinatha

    2012-01-01

    Background Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)•poly(A)*poly(U) was studied by various biophysical techniques. Methodology/Principal Findings Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5°C compared to a 17.5°C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. Conclusions/Significance Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena. PMID:22666416

  7. A triplex ribozyme expression system based on a single hairpin ribozyme.

    PubMed

    Aquino-Jarquin, Guillermo; Benítez-Hess, María Luisa; DiPaolo, Joseph A; Alvarez-Salas, Luis M

    2008-09-01

    Triplex ribozyme (RZ) configurations allow for the individual activity of trans-acting RZs in multiple expression cassettes (multiplex), thereby increasing target cleavage relative to conventionally expressed RZs. Although hairpin RZs have been advantageously compared to hammerhead RZs, their longer size and structural features complicated triplex design. We present a triplex expression system based on a single hairpin RZ with transcleavage capability and simple engineering. The system was tested in vitro using cis- and trans-cleavage kinetic assays against a known target RNA from HPV-16 E6/E7 mRNA. Single and multiplex triplex RZ constructs were more efficient in cleaving the target than tandem-cloned hairpin RZs, suggesting that the release of individual RZs enhanced trans-cleavage kinetics. Multiplex systems constructed with two different hairpin RZs resulted in better trans-cleavage compared to standard double-RZ constructs. In addition, the triplex RZ performed cis- and trans-cleavage in cervical cancer cells. The use of triplex configurations with multiplex RZs permit differential targeting of the same or different RNA, thus improving potential use against unstable targets. This prototype will provide the basis for the development of future RZ-based therapies and technologies.

  8. Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.

    PubMed

    Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi

    2017-03-23

    A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  10. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  11. 2. OVERVIEW OF TRIPLEX COTTAGE IN POOLE POWERHOUSE SETTING. TRIPLEX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. OVERVIEW OF TRIPLEX COTTAGE IN POOLE POWERHOUSE SETTING. TRIPLEX COTTAGE IS VISIBLE AT PHOTO CENTER LEFT. POOLE POWERHOUSE IS ADJACENT TRIPLEX COTTAGE AT PHOTO CENTER RIGHT. SWITCHRACKS ARE VISIBLE ADJACENT TO POWERHOUSE BUILDING. VIEW TO SOUTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  12. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  13. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    NASA Technical Reports Server (NTRS)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

    1999-01-01

    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  14. G-triplex structure and formation propensity

    PubMed Central

    Cerofolini, Linda; Amato, Jussara; Giachetti, Andrea; Limongelli, Vittorio; Novellino, Ettore; Parrinello, Michele; Fragai, Marco; Randazzo, Antonio; Luchinat, Claudio

    2014-01-01

    The occurrence of a G-triplex folding intermediate of thrombin binding aptamer (TBA) has been recently predicted by metadynamics calculations, and experimentally supported by Nuclear Magnetic Resonance (NMR), Circular Dichroism (CD) and Differential Scanning Calorimetry (DSC) data collected on a 3′ end TBA-truncated 11-mer oligonucleotide (11-mer-3′-t-TBA). Here we present the solution structure of 11-mer-3′-t-TBA in the presence of potassium ions. This structure is the first experimental example of a G-triplex folding, where a network of Hoogsteen-like hydrogen bonds stabilizes six guanines to form two G:G:G triad planes. The G-triplex folding of 11-mer-3′-t-TBA is stabilized by the potassium ion and destabilized by increasing the temperature. The superimposition of the experimental structure with that predicted by metadynamics shows a great similarity, with only significant differences involving two loops. These new structural data show that 11-mer-3′-t-TBA assumes a G-triplex DNA conformation as its stable form, reinforcing the idea that G-triplex folding intermediates may occur in vivo in human guanine-rich sequences. NMR and CD screening of eight different constructs obtained by removing from one to four bases at either the 3′ and the 5′ ends show that only the 11-mer-3′-t-TBA yields a relatively stable G-triplex. PMID:25378342

  15. Triplexer Monitor Design for Failure Detection in FTTH System

    NASA Astrophysics Data System (ADS)

    Fu, Minglei; Le, Zichun; Hu, Jinhua; Fei, Xia

    2012-09-01

    Triplexer was one of the key components in FTTH systems, which employed an analog overlay channel for video broadcasting in addition to bidirectional digital transmission. To enhance the survivability of triplexer as well as the robustness of FTTH system, a multi-ports device named triplexer monitor was designed and realized, by which failures at triplexer ports can be detected and localized. Triplexer monitor was composed of integrated circuits and its four input ports were connected with the beam splitter whose power division ratio was 95∶5. By means of detecting the sampled optical signal from the beam splitters, triplexer monitor tracked the status of the four ports in triplexer (e.g. 1310 nm, 1490 nm, 1550 nm and com ports). In this paper, the operation scenario of the triplexer monitor with external optical devices was addressed. And the integrated circuit structure of the triplexer monitor was also given. Furthermore, a failure localization algorithm was proposed, which based on the state transition diagram. In order to measure the failure detection and localization time under the circumstance of different failed ports, an experimental test-bed was built. Experiment results showed that the detection time for the failure at 1310 nm port by the triplexer monitor was less than 8.20 ms. For the failure at 1490 nm or 1550 nm port it was less than 8.20 ms and for the failure at com port it was less than 7.20 ms.

  16. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    NASA Technical Reports Server (NTRS)

    Baharaeen, S.; Vishniac, H. S.

    1984-01-01

    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  17. Draft Genome Sequence of Mycobacterium triplex DSM 44626.

    PubMed

    Sassi, Mohamed; Croce, Olivier; Robert, Catherine; Raoult, Didier; Drancourt, Michel

    2014-05-29

    We announce the draft genome sequence of Mycobacterium triplex strain DSM 44626, a nontuberculosis species responsible for opportunistic infections. The genome described here is composed of 6,382,840 bp, with a G+C content of 66.57%, and contains 5,988 protein-coding genes and 81 RNA genes. Copyright © 2014 Sassi et al.

  18. Archaeal Tuc1/Ncs6 homolog required for wobble uridine tRNA thiolation is associated with ubiquitin-proteasome, translation, and RNA processing system homologs.

    PubMed

    Chavarria, Nikita E; Hwang, Sungmin; Cao, Shiyun; Fu, Xian; Holman, Mary; Elbanna, Dina; Rodriguez, Suzanne; Arrington, Deanna; Englert, Markus; Uthandi, Sivakumar; Söll, Dieter; Maupin-Furlow, Julie A

    2014-01-01

    While cytoplasmic tRNA 2-thiolation protein 1 (Tuc1/Ncs6) and ubiquitin-related modifier-1 (Urm1) are important in the 2-thiolation of 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U) at wobble uridines of tRNAs in eukaryotes, the biocatalytic roles and properties of Ncs6/Tuc1 and its homologs are poorly understood. Here we present the first report of an Ncs6 homolog of archaea (NcsA of Haloferax volcanii) that is essential for maintaining cellular pools of thiolated tRNA(Lys)UUU and for growth at high temperature. When purified from Hfx. volcanii, NcsA was found to be modified at Lys204 by isopeptide linkage to polymeric chains of the ubiquitin-fold protein SAMP2. The ubiquitin-activating E1 enzyme homolog of archaea (UbaA) was required for this covalent modification. Non-covalent protein partners that specifically associated with NcsA were also identified including UbaA, SAMP2, proteasome activating nucleotidase (PAN)-A/1, translation elongation factor aEF-1α and a β-CASP ribonuclease homolog of the archaeal cleavage and polyadenylation specificity factor 1 family (aCPSF1). Together, our study reveals that NcsA is essential for growth at high temperature, required for formation of thiolated tRNA(Lys)UUU and intimately linked to homologs of ubiquitin-proteasome, translation and RNA processing systems.

  19. XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

    PubMed Central

    Kaushik Tiwari, Meetu; Rogers, Faye A.

    2013-01-01

    DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

  20. DNA triplex structure, thermodynamics, and destabilisation: insight from molecular simulations.

    PubMed

    Boehm, Belinda J; Whidborne, Charles; Button, Alexander L; Pukala, Tara L; Huang, David M

    2018-05-23

    Molecular dynamics simulations are used to elucidate the structure and thermodynamics of DNA triplexes associated with the neurodegenerative disease Friedreich's ataxia (FRDA), as well as complexes of these triplexes with the small molecule netropsin, which is known to destabilise triplexes. The ability of molecular simulations in explicit solvent to accurately capture triplex thermodynamics is verified for the first time, with the free energy to dissociate a 15-base antiparallel purine triplex-forming oligomer (TFO) from the duplex found to be slightly higher than reported experimentally. The presence of netropsin in the minor groove destabilises the triplex as expected, reducing the dissociation free energy by approximately 50%. Netropsin binding is associated with localised narrowing of the minor groove near netropsin, an effect that has previously been under contention. This leads to localised widening of the major groove, weakening hydrogen bonds between the TFO and duplex. Consequently, destabilisation is found to be highly localised, occurring only when netropsin is bound directly opposite the TFO. The simulations also suggest that near saturation of the minor groove with ligand is required for complete triplex dissociation. A structural analysis of the DNA triplexes that can form with the FRDA-related duplex sequence indicates that the triplex with a parallel homopyrimidine TFO is likely to be more stable than the antiparallel homopurine-TFO triplex, which may have implications for disease onset and treatment.

  1. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    PubMed

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by <25% in sequence identity fold into very similar structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  2. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

    PubMed

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

    2017-11-17

    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  3. Archaeal Tuc1/Ncs6 Homolog Required for Wobble Uridine tRNA Thiolation Is Associated with Ubiquitin-Proteasome, Translation, and RNA Processing System Homologs

    PubMed Central

    Chavarria, Nikita E.; Hwang, Sungmin; Cao, Shiyun; Fu, Xian; Holman, Mary; Elbanna, Dina; Rodriguez, Suzanne; Arrington, Deanna; Englert, Markus; Uthandi, Sivakumar; Söll, Dieter; Maupin-Furlow, Julie A.

    2014-01-01

    While cytoplasmic tRNA 2-thiolation protein 1 (Tuc1/Ncs6) and ubiquitin-related modifier-1 (Urm1) are important in the 2-thiolation of 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U) at wobble uridines of tRNAs in eukaryotes, the biocatalytic roles and properties of Ncs6/Tuc1 and its homologs are poorly understood. Here we present the first report of an Ncs6 homolog of archaea (NcsA of Haloferax volcanii) that is essential for maintaining cellular pools of thiolated tRNALys UUU and for growth at high temperature. When purified from Hfx. volcanii, NcsA was found to be modified at Lys204 by isopeptide linkage to polymeric chains of the ubiquitin-fold protein SAMP2. The ubiquitin-activating E1 enzyme homolog of archaea (UbaA) was required for this covalent modification. Non-covalent protein partners that specifically associated with NcsA were also identified including UbaA, SAMP2, proteasome activating nucleotidase (PAN)-A/1, translation elongation factor aEF-1α and a β-CASP ribonuclease homolog of the archaeal cleavage and polyadenylation specificity factor 1 family (aCPSF1). Together, our study reveals that NcsA is essential for growth at high temperature, required for formation of thiolated tRNALys UUU and intimately linked to homologs of ubiquitin-proteasome, translation and RNA processing systems. PMID:24906001

  4. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  5. Noncoding transcripts in sense and antisense orientation regulate the epigenetic state of ribosomal RNA genes.

    PubMed

    Bierhoff, H; Schmitz, K; Maass, F; Ye, J; Grummt, I

    2010-01-01

    Alternative transcription of the same gene in sense and antisense orientation regulates expression of protein-coding genes. Here we show that noncoding RNA (ncRNA) in sense and antisense orientation also controls transcription of rRNA genes (rDNA). rDNA exists in two types of chromatin--a euchromatic conformation that is permissive to transcription and a heterochromatic conformation that is transcriptionally silent. Silencing of rDNA is mediated by NoRC, a chromatin-remodeling complex that triggers heterochromatin formation. NoRC function requires RNA that is complementary to the rDNA promoter (pRNA). pRNA forms a DNA:RNA triplex with a regulatory element in the rDNA promoter, and this triplex structure is recognized by DNMT3b. The results imply that triplex-mediated targeting of DNMT3b to specific sequences may be a common pathway in epigenetic regulation. We also show that rDNA is transcribed in antisense orientation. The level of antisense RNA (asRNA) is down-regulated in cancer cells and up-regulated in senescent cells. Ectopic asRNA triggers trimethylation of histone H4 at lysine 20 (H4K20me3), suggesting that antisense transcripts guide the histone methyltransferase Suv4-20 to rDNA. The results reveal that noncoding RNAs in sense and antisense orientation are important determinants of the epigenetic state of rDNA.

  6. Crystal structures of trypanosomal histidyl-tRNA synthetase illuminate differences between eukaryotic and prokaryotic homologs

    PubMed Central

    Merritt, Ethan A; Arakaki, Tracy L; Gillespie, J Robert; Larson, Eric T; Kelley, Angela; Mueller, Natascha; Napuli, Alberto J; Kim, Jessica; Zhang, Li; Verlinde, Christophe L M J; Fan, Erkang; Zucker, Frank; Buckner, Frederick S; Van Voorhis, Wesley C; Hol, Wim G J

    2010-01-01

    Crystal structures of histidyl-tRNA synthetase from the eukaryotic parasites Trypanosoma brucei and Trypanosoma cruzi provide a first structural view of a eukaryotic form of this enzyme, and reveal differences from bacterial homologs. Histidyl-tRNA synthetases in general contain an extra domain inserted between conserved motifs 2 and 3 of the Class II aminoacyl-tRNA synthetase catalytic core. The current structures show that the three dimensional topology of this domain is very different in bacterial and archaeal/eukaryotic forms of the enzyme. Comparison of apo and histidine-bound trypanosomal structures indicates substantial active site rearrangement upon histidine binding, but relatively little subsequent rearrangement after reaction of histidine with ATP to form the enzyme’s first reaction product, histidyladenylate. The specific residues involved in forming the binding pocket for the adenine moiety differ substantially both from the previously characterized binding site in bacterial structures and from the homologous residues in human histidyl-tRNA synthetases. The essentiality of the single histidyl-tRNA synthetase gene in T. brucei is shown by a severe depression of parasite growth rate that results from even partial suppression of expression by RNA interference. PMID:20132829

  7. Analysis of GAA/TTC DNA triplexes using nuclear magnetic resonance and electrospray ionization mass spectrometry.

    PubMed

    Mariappan, S V Santhana; Cheng, Xun; van Breemen, Richard B; Silks, Louis A; Gupta, Goutam

    2004-11-15

    The formation of a GAA/TTC DNA triplex has been implicated in Friedreich's ataxia. The destabilization of GAA/TTC DNA triplexes either by pH or by binding to appropriate ligands was analyzed by nuclear magnetic resonance (NMR) and positive-ion electrospray mass spectrometry. The triplexes and duplexes were identified by changes in the NMR chemical shifts of H8, H1, H4, 15N7, and 15N4. The lowest pH at which the duplex is detectable depends upon the overall stability and the relative number of Hoogsteen C composite function G to T composite function A basepairs. A melting pH (pHm) of 7.6 was observed for the destabilization of the (GAA)2T4(TTC)2T4(CTT)2 triplex to the corresponding Watson-Crick duplex and the T4(CTT)2 overhang. The mass spectrometric analyses of (TTC)6.(GAA)6 composite function(TTC)6 triplex detected ions due to both triplex and single-stranded oligonucleotides under acidic conditions. The triplex ions disappeared completely at alkaline pH. Duplex and single strands were detectable only at neutral and alkaline pH values. Mass spectrometric analyses also showed that minor groove-binding ligands berenil, netropsin, and distamycin and the intercalating ligand acridine orange destabilize the (TTC)6.(GAA)6 composite function (TTC)6 triplex. These NMR and mass spectrometric methods may function as screening assays for the discovery of agents that destabilize GAA/TTC triplexes and as general methods for the characterization of structure, dynamics, and stability of DNA and DNA-ligand complexes.

  8. The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

    PubMed Central

    Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

    1986-01-01

    The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

  9. Assembly of the Herpes Simplex Virus Capsid: Preformed Triplexes Bind to the Nascent Capsid

    PubMed Central

    Spencer, Juliet V.; Newcomb, William W.; Thomsen, Darrell R.; Homa, Fred L.; Brown, Jay C.

    1998-01-01

    The herpes simplex virus type 1 (HSV-1) capsid is a T=16 icosahedral shell that forms in the nuclei of infected cells. Capsid assembly also occurs in vitro in reaction mixtures created from insect cell extracts containing recombinant baculovirus-expressed HSV-1 capsid proteins. During capsid formation, the major capsid protein, VP5, and the scaffolding protein, pre-VP22a, condense to form structures that are extended into procapsids by addition of the triplex proteins, VP19C and VP23. We investigated whether triplex proteins bind to the major capsid-scaffold protein complexes as separate polypeptides or as preformed triplexes. Assembly products from reactions lacking one triplex protein were immunoprecipitated and examined for the presence of the other. The results showed that neither triplex protein bound unless both were present, suggesting that interaction between VP19C and VP23 is required before either protein can participate in the assembly process. Sucrose density gradient analysis was employed to determine the sedimentation coefficients of VP19C, VP23, and VP19C-VP23 complexes. The results showed that the two proteins formed a complex with a sedimentation coefficient of 7.2S, a value that is consistent with formation of a VP19C-VP232 heterotrimer. Furthermore, VP23 was observed to have a sedimentation coefficient of 4.9S, suggesting that this protein exists as a dimer in solution. Deletion analysis of VP19C revealed two domains that may be required for attachment of the triplex to major capsid-scaffold protein complexes; none of the deletions disrupted interaction of VP19C with VP23. We propose that preformed triplexes (VP19C-VP232 heterotrimers) interact with major capsid-scaffold protein complexes during assembly of the HSV-1 capsid. PMID:9557680

  10. Divalent cations and molecular crowding buffers stabilize G-triplex at physiologically relevant temperatures

    PubMed Central

    Jiang, Hong-Xin; Cui, Yunxi; Zhao, Ting; Fu, Hai-Wei; Koirala, Deepak; Punnoose, Jibin Abraham; Kong, De-Ming; Mao, Hanbin

    2015-01-01

    G-triplexes are non-canonical DNA structures formed by G-rich sequences with three G-tracts. Putative G-triplex-forming sequences are expected to be more prevalent than putative G-quadruplex-forming sequences. However, the research on G-triplexes is rare. In this work, the effects of molecular crowding and several physiologically important metal ions on the formation and stability of G-triplexes were examined using a combination of circular dichroism, thermodynamics, optical tweezers and calorimetry techniques. We determined that molecular crowding conditions and cations, such as Na+, K+, Mg2+ and Ca2+, promote the formation of G-triplexes and stabilize these structures. Of these four metal cations, Ca2+ has the strongest stabilizing effect, followed by K+, Mg2+, and Na+ in a decreasing order. The binding of K+ to G-triplexes is accompanied by exothermic heats, and the binding of Ca2+ with G-triplexes is characterized by endothermic heats. G-triplexes formed from two G-triad layers are not stable at physiological temperatures; however, G-triplexes formed from three G-triads exhibit melting temperatures higher than 37°C, especially under the molecular crowding conditions and in the presence of K+ or Ca2+. These observations imply that stable G-triplexes may be formed under physiological conditions. PMID:25787838

  11. The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition.

    PubMed

    Tamayo, Joel V; Teramoto, Takamasa; Chatterjee, Seema; Hall, Traci M Tanaka; Gavis, Elizabeth R

    2017-04-04

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo's RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subset of Glo's functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

    DOE PAGES

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema; ...

    2017-04-04

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  13. The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  14. The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  15. Homologous SV40 RNA trans-splicing

    PubMed Central

    Eul, Joachim; Patzel, Volker

    2013-01-01

    Simian Virus 40 (SV40) is a polyomavirus found in both monkeys and humans, which causes cancer in some animal models. In humans, SV40 has been reported to be associated with cancers but causality has not been proven yet. The transforming activity of SV40 is mainly due to its 94-kD large T antigen, which binds to the retinoblastoma (pRb) and p53 tumor suppressor proteins, and thereby perturbs their functions. Here we describe a 100 kD super T antigen harboring a duplication of the pRB binding domain that was associated with unusual high cell transformation activity and that was generated by a novel mechanism involving homologous RNA trans-splicing of SV40 early transcripts in transformed rodent cells. Enhanced trans-splice activity was observed in clones carrying a single point mutation in the large T antigen 5′ donor splice site (ss). This mutation impaired cis-splicing in favor of an alternative trans-splice reaction via a cryptic 5′ss within a second cis-spliced SV40 pre-mRNA molecule and enabled detectable gene expression. Next to the cryptic 5′ss we identified additional trans-splice helper functions, including putative dimerization domains and a splice enhancer sequence. Our findings suggest RNA trans-splicing as a SV40-intrinsic mechanism that supports the diversification of viral RNA and phenotypes. PMID:24178438

  16. Cooperative gene regulation by microRNA pairs and their identification using a computational workflow

    PubMed Central

    Schmitz, Ulf; Lai, Xin; Winter, Felix; Wolkenhauer, Olaf; Vera, Julio; Gupta, Shailendra K.

    2014-01-01

    MicroRNAs (miRNAs) are an integral part of gene regulation at the post-transcriptional level. Recently, it has been shown that pairs of miRNAs can repress the translation of a target mRNA in a cooperative manner, which leads to an enhanced effectiveness and specificity in target repression. However, it remains unclear which miRNA pairs can synergize and which genes are target of cooperative miRNA regulation. In this paper, we present a computational workflow for the prediction and analysis of cooperating miRNAs and their mutual target genes, which we refer to as RNA triplexes. The workflow integrates methods of miRNA target prediction; triplex structure analysis; molecular dynamics simulations and mathematical modeling for a reliable prediction of functional RNA triplexes and target repression efficiency. In a case study we analyzed the human genome and identified several thousand targets of cooperative gene regulation. Our results suggest that miRNA cooperativity is a frequent mechanism for an enhanced target repression by pairs of miRNAs facilitating distinctive and fine-tuned target gene expression patterns. Human RNA triplexes predicted and characterized in this study are organized in a web resource at www.sbi.uni-rostock.de/triplexrna/. PMID:24875477

  17. Long Noncoding RNA MEG3 Is an Epigenetic Determinant of Oncogenic Signaling in Functional Pancreatic Neuroendocrine Tumor Cells

    PubMed Central

    Iyer, Sucharitha; Modali, Sita D.

    2017-01-01

    ABSTRACT The long noncoding RNA (lncRNA) MEG3 is significantly downregulated in pancreatic neuroendocrine tumors (PNETs). MEG3 loss corresponds with aberrant upregulation of the oncogenic hepatocyte growth factor (HGF) receptor c-MET in PNETs. Meg3 overexpression in a mouse insulin-secreting PNET cell line, MIN6, downregulates c-Met expression. However, the molecular mechanism by which MEG3 regulates c-MET is not known. Using chromatin isolation by RNA purification and sequencing (ChIRP-Seq), we identified Meg3 binding to unique genomic regions in and around the c-Met gene. In the absence of Meg3, these c-Met regions displayed distinctive enhancer-signature histone modifications. Furthermore, Meg3 relied on functional enhancer of zeste homolog 2 (EZH2), a component of polycomb repressive complex 2 (PRC2), to inhibit c-Met expression. Another mechanism of lncRNA-mediated regulation of gene expression utilized triplex-forming GA-GT rich sequences. Transfection of such motifs from Meg3 RNA, termed triplex-forming oligonucleotides (TFOs), in MIN6 cells suppressed c-Met expression and enhanced cell proliferation, perhaps by modulating other targets. This study comprehensively establishes epigenetic mechanisms underlying Meg3 control of c-Met and the oncogenic consequences of Meg3 loss or c-Met gain. These findings have clinical relevance for targeting c-MET in PNETs. There is also the potential for pancreatic islet β-cell expansion through c-MET regulation to ameliorate β-cell loss in diabetes. PMID:28847847

  18. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    PubMed

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  19. Ultra compact triplexing filters based on SOI nanowire AWGs

    NASA Astrophysics Data System (ADS)

    Jiashun, Zhang; Junming, An; Lei, Zhao; Shijiao, Song; Liangliang, Wang; Jianguang, Li; Hongjie, Wang; Yuanda, Wu; Xiongwei, Hu

    2011-04-01

    An ultra compact triplexing filter was designed based on a silicon on insulator (SOI) nanowire arrayed waveguide grating (AWG) for fiber-to-the-home FTTH. The simulation results revealed that the design performed well in the sense of having a good triplexing function. The designed SOI nanowire AWGs were fabricated using ultraviolet lithography and induced coupler plasma etching. The experimental results showed that the crosstalk was less than -15 dB, and the 3 dB-bandwidth was 11.04 nm. The peak wavelength output from ports a, c, and b were 1455, 1510 and 1300 nm, respectively, which deviated from our original expectations. The deviation of the wavelength is mainly caused by 45 nm width deviation of the arrayed waveguides during the course of the fabrication process and partly caused by material dispersion.

  20. Bi-directional triplexer with butterfly MMI coupler using SU-8 polymer waveguides

    NASA Astrophysics Data System (ADS)

    Mareš, David; Jeřábek, Vítězslav; Prajzler, Václav

    2015-01-01

    We report about a design of a bi-directional planar optical multiplex/demultiplex filter (triplexer) for the optical part of planar hybrid WDM bi-directional transceiver in fiber-to-the-home (FTTH) PON applications. The triplex lightwave circuit is based on the Epoxy Novolak Resin SU-8 waveguides on the silica-on-silicon substrate with Polymethylmethacrylate cladding layer. The triplexer is comprised of a linear butterfly concept of multimode interference (MMI) coupler separating downstream optical signals of 1490 nm and 1550 nm. For the upstream channel of 1310 nm, an additional directional coupler (DC) is used to add optical signal of 1310 nm propagating in opposite direction. The optical triplexer was designed and optimized using beam propagation method. The insertion losses, crosstalk attenuation, and extinction ratio for all three inputs/outputs were investigated. The intended triplexer was designed using the parameters of the separated DC and MMI filter to approximate the idealized direct connection of both devices.

  1. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  2. Identification of the human homolog of the imprinted mouse Air non-coding RNA

    PubMed Central

    Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

    2010-01-01

    Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

  3. Secondary binding sites for heavily modified triplex forming oligonucleotides

    PubMed Central

    Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

    2012-01-01

    In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

  4. Intrastrand triplex DNA repeats in bacteria: a source of genomic instability

    PubMed Central

    Holder, Isabelle T.; Wagner, Stefanie; Xiong, Peiwen; Sinn, Malte; Frickey, Tancred; Meyer, Axel; Hartig, Jörg S.

    2015-01-01

    Repetitive nucleic acid sequences are often prone to form secondary structures distinct from B-DNA. Prominent examples of such structures are DNA triplexes. We observed that certain intrastrand triplex motifs are highly conserved and abundant in prokaryotic genomes. A systematic search of 5246 different prokaryotic plasmids and genomes for intrastrand triplex motifs was conducted and the results summarized in the ITxF database available online at http://bioinformatics.uni-konstanz.de/utils/ITxF/. Next we investigated biophysical and biochemical properties of a particular G/C-rich triplex motif (TM) that occurs in many copies in more than 260 bacterial genomes by CD and nuclear magnetic resonance spectroscopy as well as in vivo footprinting techniques. A characterization of putative properties and functions of these unusually frequent nucleic acid motifs demonstrated that the occurrence of the TM is associated with a high degree of genomic instability. TM-containing genomic loci are significantly more rearranged among closely related Escherichia coli strains compared to control sites. In addition, we found very high frequencies of TM motifs in certain Enterobacteria and Cyanobacteria that were previously described as genetically highly diverse. In conclusion we link intrastrand triplex motifs with the induction of genomic instability. We speculate that the observed instability might be an adaptive feature of these genomes that creates variation for natural selection to act upon. PMID:26450966

  5. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  6. Studies on the formation and stability of triplex DNA using fluorescence correlation spectroscopy.

    PubMed

    Hu, Hongyan; Huang, Xiangyi; Ren, Jicun

    2016-05-01

    Triplex DNA has become one of the most useful recognition motifs in the design of new molecular biology tools, therapeutic agents and sophisticated DNA-based nanomaterials because of its direct recognition of natural double-stranded DNA. In this paper, we developed a sensitive and microscale method to study the formation and stability characterization of triplex DNA using fluorescence correlation spectroscopy (FCS). The principle of this method is mainly based on the excellent capacity of FCS for sensitively distinguishing between free single-strand DNA (ssDNA) fluorescent probes and fluorescent probe-double-strand DNA (dsDNA) hybridized complexes. First, we systematically investigated the experimental conditions of triplex DNA formation. Then, we evaluated the equilibrium association constants (K(a)) under different ssDNA probe lengths, composition and pH. Finally, we used FCS to measure the hybridization fraction of a 20-mer perfectly matched ssDNA probe and three single-base mismatched ssDNA probes with 146-mer dsDNA. Our data illustrated that FCS is a useful tool for the direct determination of the thermodynamic parameters of triplex DNA formation and discrimination of a single-base mismatch of triplex DNA without denaturation. Compared with current methods, our method is characterized by high sensitivity, good universality and small sample and reagent requirements. More importantly, our method has the potential to become a platform for triplex DNA research in vitro. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

    PubMed Central

    Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

    2008-01-01

    We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

  8. Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

    PubMed

    Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

    2014-01-18

    Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

  9. Self-assembled RNA-triple-helix hydrogel scaffold for microRNA modulation in the tumour microenvironment

    NASA Astrophysics Data System (ADS)

    Conde, João; Oliva, Nuria; Atilano, Mariana; Song, Hyun Seok; Artzi, Natalie

    2016-03-01

    The therapeutic potential of miRNA (miR) in cancer is limited by the lack of efficient delivery vehicles. Here, we show that a self-assembled dual-colour RNA-triple-helix structure comprising two miRNAs--a miR mimic (tumour suppressor miRNA) and an antagomiR (oncomiR inhibitor)--provides outstanding capability to synergistically abrogate tumours. Conjugation of RNA triple helices to dendrimers allows the formation of stable triplex nanoparticles, which form an RNA-triple-helix adhesive scaffold upon interaction with dextran aldehyde, the latter able to chemically interact and adhere to natural tissue amines in the tumour. We also show that the self-assembled RNA-triple-helix conjugates remain functional in vitro and in vivo, and that they lead to nearly 90% levels of tumour shrinkage two weeks post-gel implantation in a triple-negative breast cancer mouse model. Our findings suggest that the RNA-triple-helix hydrogels can be used as an efficient anticancer platform to locally modulate the expression of endogenous miRs in cancer.

  10. Crystal structure and RNA-binding properties of an Hfq homolog from the deep-branching Aquificae: conservation of the lateral RNA-binding mode

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stanek, Kimberly A.; Patterson-West, Jennifer; Randolph, Peter S.

    The host factor Hfq, as the bacterial branch of the Sm family, is an RNA-binding protein involved in the post-transcriptional regulation of mRNA expression and turnover. Hfq facilitates pairing between small regulatory RNAs (sRNAs) and their corresponding mRNA targets by binding both RNAs and bringing them into close proximity. Hfq homologs self-assemble into homo-hexameric rings with at least two distinct surfaces that bind RNA. Recently, another binding site, dubbed the `lateral rim', has been implicated in sRNA·mRNA annealing; the RNA-binding properties of this site appear to be rather subtle, and its degree of evolutionary conservation is unknown. An Hfq homologmore » has been identified in the phylogenetically deep-branching thermophileAquifex aeolicus(Aae), but little is known about the structure and function of Hfq from basal bacterial lineages such as the Aquificae. Therefore,AaeHfq was cloned, overexpressed, purified, crystallized and biochemically characterized. Structures ofAaeHfq were determined in space groupsP1 andP6, both to 1.5 Å resolution, and nanomolar-scale binding affinities for uridine- and adenosine-rich RNAs were discovered. Co-crystallization with U 6RNA reveals that the outer rim of theAaeHfq hexamer features a well defined binding pocket that is selective for uracil. ThisAaeHfq structure, combined with biochemical and biophysical characterization of the homolog, reveals deep evolutionary conservation of the lateral RNA-binding mode, and lays a foundation for further studies of Hfq-associated RNA biology in ancient bacterial phyla.« less

  11. Cospeciation in the triplex symbiosis of termite gut protists (Pseudotrichonympha spp.), their hosts, and their bacterial endosymbionts.

    PubMed

    Noda, S; Kitade, O; Inoue, T; Kawai, M; Kanuka, M; Hiroshima, K; Hongoh, Y; Constantino, R; Uys, V; Zhong, J; Kudo, T; Ohkuma, M

    2007-03-01

    A number of cophylogenetic relationships between two organisms namely a host and a symbiont or parasite have been studied to date; however, organismal interactions in nature usually involve multiple members. Here, we investigated the cospeciation of a triplex symbiotic system comprising a hierarchy of three organisms -- termites of the family Rhinotermitidae, cellulolytic protists of the genus Pseudotrichonympha in the guts of these termites, and intracellular bacterial symbionts of the protists. The molecular phylogeny was inferred based on two mitochondrial genes for the termites and nuclear small-subunit rRNA genes for the protists and their endosymbionts, and these were compared. Although intestinal microorganisms are generally considered to have looser associations with the host than intracellular symbionts, the Pseudotrichonympha protists showed almost complete codivergence with the host termites, probably due to strict transmissions by proctodeal trophallaxis or coprophagy based on the social behaviour of the termites. Except for one case, the endosymbiotic bacteria of the protists formed a monophyletic lineage in the order Bacteroidales, and the branching pattern was almost identical to those of the protists and the termites. However, some non-codivergent evolutionary events were evident. The members of this triplex symbiotic system appear to have cospeciated during their evolution with minor exceptions; the evolutionary relationships were probably established by termite sociality and the complex microbial community in the gut.

  12. Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

    PubMed

    Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

    2015-05-14

    G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

  13. Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

    PubMed

    Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

    2017-12-14

    The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

  14. Long-Term Observation of Triplex Surgery for Cataract after Phakic 6H Implantation for Super High Myopia

    PubMed Central

    Liu, Xin; Wang, Xiaoying; Lu, Yi; Zheng, Tianyu; Zhou, Xingtao

    2016-01-01

    Purpose. To analyze the safety, effectiveness, and stability of triplex surgery for phakic 6H anterior chamber phakic intraocular lens explantation and phacoemulsification with in-the-bag IOL implantation for super high myopia in long-term observations. Methods. This retrospective case series evaluated 16 eyes of 10 patients who underwent triplex surgery. Best corrected visual acuity (BCVA), endothelial cell density (ECD), and associated adverse events were evaluated. Results. The mean follow-up time after the triplex surgery was 46 ± 14 months. The mean logMAR BCVA was significantly improved after triplex surgery (P = 0.047). One eye developed endophthalmitis five days postoperatively and underwent pars plana vitrectomy (PPV). Five eyes with preoperative severe endothelial cell loss developed corneal decompensation and underwent keratoplasty at a mean time of 9.4 ± 2.6 months after the triplex surgery. One eye had graft failure and underwent a second keratoplasty. The eye developed rhegmatogenous retinal detachment and underwent PPV with silicone oil 18 months later. ECD before the triplex surgery was not significantly different compared with that at last follow-up (P = 0.495) apart from these five eyes. Three eyes (18.8%) developed posterior capsule opacification. Conclusions. Triplex surgery was safe and effective for phakic 6H related complicated cataracts. Early extraction before severe ECD loss is recommended. PMID:27190642

  15. Conferring virus resistance in tomato by independent RNA silencing of three tomato homologs of Arabidopsis TOM1.

    PubMed

    Ali, Md Emran; Ishii, Yuko; Taniguchi, Jyun-Ichi; Waliullah, Sumyya; Kobayashi, Kappei; Yaeno, Takashi; Yamaoka, Naoto; Nishiguchi, Masamichi

    2018-05-01

    The TOM1/TOM3 genes from Arabidopsis are involved in the replication of tobamoviruses. Tomato homologs of these genes, LeTH1, LeTH2 and LeTH3, are known. In this study, we examined transgenic tomato lines where inverted repeats of either LeTH1, LeTH2 or LeTH3 were introduced by Agrobacterium. Endogenous mRNA expression for each gene was detected in non-transgenic control plants, whereas a very low level of each of the three genes was found in the corresponding line. Small interfering RNA was detected in the transgenic lines. Each silenced line showed similar levels of tobamovirus resistance, indicating that each gene is similarly involved in virus replication.

  16. Single step production of Cas9 mRNA for zygote injection.

    PubMed

    Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

    2018-03-01

    Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

  17. Duodenal atresia in an infant with triple-X syndrome: a new associated malformation in 47,XXX.

    PubMed

    Rolle, Udo; Linse, Barbara; Glasow, Simone; Sandig, Klaus Rainer; Richter, Thomas; Till, Holger

    2007-08-01

    An association between the triple-X syndrome (47,XXX) and gastrointestinal malformations is extremely rare. Most 47,XXX patients present with a normal phenotype, but genitourinary malformations have been described. We report a case of a child with 47,XXX and duodenal atresia. Antenatal ultrasound scan showed a dilated fetal stomach and upper part of the duodenum (double bubble phenomenon) at 31 weeks of gestation in a 31-year-old woman with polyhydramnion. The amniotic fluid karyotype showed 47,XXX. After a scheduled delivery, duodenal atresia was confirmed and treated with duodeno-duodenostomy. The possible association of gastrointestinal and genitourinary tract anomalies requires a detailed postnatal clinical investigation and ultrasonographic examination of the abdomen, retroperitoneum, and pelvis on all triple-X syndrome patients. 2007 Wiley-Liss, Inc.

  18. Experimental RNomics in Aquifex aeolicus: identification of small non-coding RNAs and the putative 6S RNA homolog

    PubMed Central

    Willkomm, Dagmar K.; Minnerup, Jens; Hüttenhofer, Alexander; Hartmann, Roland K.

    2005-01-01

    By an experimental RNomics approach, we have generated a cDNA library from small RNAs expressed from the genome of the hyperthermophilic bacterium Aquifex aeolicus. The library included RNAs that were antisense to mRNAs and tRNAs as well as RNAs encoded in intergenic regions. Substantial steady-state levels in A.aeolicus cells were confirmed for several of the cloned RNAs by northern blot analysis. The most abundant intergenic RNA of the library was identified as the 6S RNA homolog of A.aeolicus. Although shorter in size (150 nt) than its γ-proteobacterial homologs (∼185 nt), it is predicted to have the most stable structure among known 6S RNAs. As in the γ-proteobacteria, the A.aeolicus 6S RNA gene (ssrS) is located immediately upstream of the ygfA gene encoding a widely conserved 5-formyltetrahydrofolate cyclo-ligase. We identifed novel 6S RNA candidates within the γ-proteobacteria but were unable to identify reasonable 6S RNA candidates in other bacterial branches, utilizing mfold analyses of the region immediately upstream of ygfA combined with 6S RNA blastn searches. By RACE experiments, we mapped the major transcription initiation site of A.aeolicus 6S RNA primary transcripts, located within the pheT gene preceding ygfA, as well as three processing sites. PMID:15814812

  19. Monolithically integrated fiber-to-the-home diplexers and triplexers using a bilevel etched 2 x 2 optical coupler.

    PubMed

    Zhang, Li; Wang, Lei; He, Jian-Jun

    2009-09-01

    A novel design of monolithically integrated diplexers and triplexers for fiber-to-the-home applications is presented. A bilevel etched asymmetrical 2 x 2 optical coupler is analyzed for efficient couplings of both upstream and downstream signals. The design of the diplexer is extended to a triplexer by adding an etched diffraction grating as an additional downstream demultiplexing element. The total size of the integrated diplexer and triplexer is smaller than 500 microm x 500 microm.

  20. Effect of competing self-structure on triplex formation with purine-rich oligodeoxynucleotides containing GA repeats.

    PubMed Central

    Noonberg, S B; François, J C; Garestier, T; Hélène, C

    1995-01-01

    Competition between triplex formation with double-stranded DNA and oligonucleotide self-association was investigated in 23mer GA and GT oligonucleotides containing d(GA)5 or d(GT)5 repeats. Whereas triplex formation with GT oligonucleotides was diminished when temperature increased from 4 to 37 degrees C, triplex formation with GA oligonucleotides was enhanced when temperature increased within the same range due to the presence of competing intermolecular GA oligonucleotide self-structure. This self-structure was determined to be a homoduplex stabilized by the internal GA repeats. UV spectroscopy of these homoduplexes demonstrated a single sharp transition with rapid kinetics (Tm = 38.5-43.5 degrees C over strand concentrations of 0.5-4 microM, respectively, with transition enthalpy, delta H = -89 +/- 7 kcal/mol) in 10 mM MgCl2, 100 mM NaCl, pH 7.0. Homoduplex formation was strongly stabilized by multivalent cations (spermine > Mg2+ = Ca2+) and destabilized by low concentrations of monovalent cations (K+ = Li+ = Na+) in the presence of divalent cations. However, unlike GA or GT oligonucleotide-containing triplexes, the homoduplex formed even in the absence of multivalent cations, stabilized by only moderate concentrations of monovalent cations (Li+ > Na+ > K+). Through the development of multiple equilibrium states and the resulting depletion of free oligonucleotide, it was found that the presence of competing self-structure could decrease triplex formation under a variety of experimental conditions. Images PMID:7596824

  1. Usefulness of FC-TRIPLEX Chagas/Leish IgG1 as confirmatory assay for non-negative results in blood bank screening of Chagas disease.

    PubMed

    Campos, Fernanda Magalhães Freire; Repoles, Laura Cotta; de Araújo, Fernanda Fortes; Peruhype-Magalhães, Vanessa; Xavier, Marcelo Antônio Pascoal; Sabino, Ester Cerdeira; de Freitas Carneiro Proietti, Anna Bárbara; Andrade, Mariléia Chaves; Teixeira-Carvalho, Andréa; Martins-Filho, Olindo Assis; Gontijo, Célia Maria Ferreira

    2018-04-01

    A relevant issue in Chagas disease serological diagnosis regards the requirement of using several confirmatory methods to elucidate the status of non-negative results from blood bank screening. The development of a single reliable method may potentially contribute to distinguish true and false positive results. Our aim was to evaluate the performance of the multiplexed flow-cytometry anti-T. cruzi/Leishmania IgG1 serology/(FC-TRIPLEX Chagas/Leish IgG1) with three conventional confirmatory criteria (ELISA-EIA, Immunofluorescence assay-IIF and EIA/IIF consensus criterion) to define the final status of samples with actual/previous non-negative results during anti-T. cruzi ELISA-screening in blood banks. Apart from inconclusive results, the FC-TRIPLEX presented a weak agreement index with EIA, while a strong agreement was observed when either IIF or EIA/IIF consensus criteria were applied. Discriminant analysis and Spearman's correlation further corroborates the agreement scores. ROC curve analysis showed that FC-TRIPLEX performance indexes were higher when IIF and EIA/IIF consensus were used as a confirmatory criterion. Logistic regression analysis further demonstrated that the probability of FC-TRIPLEX to yield positive results was higher for inconclusive results from IIF and EIA/IIF consensus. Machine learning tools illustrated the high level of categorical agreement between FC-TRIPLEX versus IIF or EIA/IIF consensus. Together, these findings demonstrated the usefulness of FC-TRIPLEX as a tool to elucidate the status of non-negative results in blood bank screening of Chagas disease. Copyright © 2018. Published by Elsevier B.V.

  2. Riboregulation of the bacterial actin-homolog MreB by DsrA small noncoding RNA.

    PubMed

    Cayrol, Bastien; Fortas, Emilie; Martret, Claire; Cech, Grzegorz; Kloska, Anna; Caulet, Stephane; Barbet, Marion; Trépout, Sylvain; Marco, Sergio; Taghbalout, Aziz; Busi, Florent; Wegrzyn, Grzegorz; Arluison, Véronique

    2015-01-01

    The bacterial actin-homolog MreB is a key player in bacterial cell-wall biosynthesis and is required for the maintenance of the rod-like morphology of Escherichia coli. However, how MreB cellular levels are adjusted to growth conditions is poorly understood. Here, we show that DsrA, an E. coli small noncoding RNA (sRNA), is involved in the post-transcriptional regulation of mreB. DsrA is required for the downregulation of MreB cellular concentration during environmentally induced slow growth-rates, mainly growth at low temperature and during the stationary phase. DsrA interacts in an Hfq-dependent manner with the 5' region of mreB mRNA, which contains signals for translation initiation and thereby affects mreB translation and stability. Moreover, as DsrA is also involved in the regulation of two transcriptional regulators, σ(S) and the nucleoid associated protein H-NS, which negatively regulate mreB transcription, it also indirectly contributes to mreB transcriptional down-regulation. By using quantitative analyses, our results evidence the complexity of this regulation and the tangled interplay between transcriptional and post-transcriptional control. As transcription factors and sRNA-mediated post-transcriptional regulators use different timescales, we propose that the sRNA pathway helps to adapt to changes in temperature, but also indirectly mediates long-term regulation of MreB concentration. The tight regulation and fine-tuning of mreB gene expression in response to cellular stresses is discussed in regard to the effect of the MreB protein on cell elongation.

  3. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lazarus, Kyren A.; Environmental and Biotechnology Centre, Swinburne University, Hawthorn, Victoria 3122; Zhao, Zhe

    2013-08-30

    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E{sub 2}), with LRH-1 mRNA transcript levels highermore » in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E{sub 2}, showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E{sub 2} treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer.« less

  4. Fluorescent triplex-forming DNA oligonucleotides labeled with a thiazole orange dimer unit

    PubMed Central

    Ikeda, Shuji; Yanagisawa, Hiroyuki; Yuki, Mizue; Okamoto, Akimitsu

    2013-01-01

    Fluorescent probes for the detection of a double-stranded DNA were prepared by labeling a triplex-forming DNA oligonucleotide with a thiazole orange (TO) dimer unit. They belong to ECHO (exciton-controlled hybridization-sensitive fluorescent oligonucleotide) probes which we have previously reported. The excitonic interaction between the two TO molecules was expected to effectively suppress the background fluorescence of the probes. The applicability of the ECHO probes for the detection of double-stranded DNA was confirmed by examining the thermal stability and photophysical and kinetic properties of the DNA triplexes formed by the ECHO probes. PMID:23445822

  5. A role for a rat homolog of staufen in the transport of RNA to neuronal dendrites.

    PubMed

    Tang, S J; Meulemans, D; Vazquez, L; Colaco, N; Schuman, E

    2001-11-08

    RNAs are present in dendrites and may be used for local protein synthesis in response to synaptic activity. To begin to understand dendritic RNA targeting, we cloned a rat homolog of staufen, a Drosophila gene that participates in mRNA targeting during development. In hippocampal neurons, rat staufen protein displays a microtubule-dependent somatodendritic distribution pattern that overlaps with dendritic RNAs. To determine whether r-staufen is required for dendritic RNA targeting, we constructed a mutant version containing the RNA binding domains (stau-RBD) but lacking the C-terminal portion potentially involved in dendritic targeting. Stau-RBD expression was restricted to the cell bodies and proximal dendrites. Expression of stau-RBD significantly decreased, while overexpression of wild-type r-staufen increased, the amount of dendritic mRNA. Taken together, these results suggest that the rat staufen protein plays an important role in the delivery of RNA to dendrites.

  6. Suppression of liver receptor homolog-1 by microRNA-451 represses the proliferation of osteosarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zhiyong; Wu, Shuwen; Lv, Shouzheng

    2015-06-05

    Liver receptor homolog-1 (LRH-1) plays an important role in the onset and progression of many cancer types. However, the role of LRH-1 in osteosarcoma has not been well investigated. In this study, the critical role of LRH-1 in osteosarcoma cells was described. Quantitative polymerase chain reaction and Western blot analysis results revealed that LRH-1 was highly overexpressed in osteosarcoma cells. LRH-1 was knocked down by small interfering RNA (siRNA), and this phenomenon significantly inhibited osteosarcoma cell proliferation. Bioinformatics analysis results showed that LRH-1 contained putative binding sites of microRNA-451 (miR-451); this result was further validated through a dual-luciferase activity reportermore » assay. miR-451 was overexpressed in osteosarcoma cells through transfection of miR-451 mimics; miR-451 overexpression then significantly inhibited LRH-1 expression and cell proliferation. The loss of LRH-1 by siRNA or miR-451 mimics significantly impaired Wnt/β-catenin activity, leading to G0/G1 cell cycle arrest. Results showed that LRH-1 is implicated in osteosarcoma. Therefore, miR-451-induced suppression of LRH-1 can be a novel therapy to treat osteosarcoma. - Highlights: • LRH-1 was highly overexpressed in osteosarcoma cells. • Knockdown of LRH-1 inhibited osteosarcoma cell proliferation. • miR-451 directly targeted and regulated LRH-1 expression. • Overexpression of miR-451 suppressed Wnt activity.« less

  7. Accumulation of RNA homologous to human papillomavirus type 16 open reading frames in genital precancers.

    PubMed Central

    Crum, C P; Nuovo, G; Friedman, D; Silverstein, S J

    1988-01-01

    The accumulation of human papillomavirus type 16 (HPV-16)-specific RNAs in tissue sections from biopsies of patients with genital precancers was studied by in situ hybridization with single-stranded 35S-labeled RNA. These analyses revealed that the most abundant early-region RNAs were derived from the E4 and E5 open reading frames (ORFs). RNAs homologous to the E6/E7 ORFs were also detected, whereas RNAs homologous to the intervening E1 ORF were not. This suggests that the E4 and E5 mRNAs are derived by splicing to the upstream E6/E7 ORFs, consistent with studies of HPV-11 in condylomata (L. T. Chow et al., Cancer Cells (Cold Spring Harbor) 5:55-72, 1987). Abundant RNAs homologous to the 5' portion of L1 were also detected. These RNAs were localized to the apical strata of the epithelium. HPV-16 RNAs accumulated in discrete regions of these lesions, and when present were most abundant in the upper cell layers of the precancerous epithelium. RNAs homologous to early ORFs were also detected in some germinal cells within the basal layer of the epithelium. Images PMID:2824859

  8. Accumulation of RNA homologous to human papillomavirus type 16 open reading frames in genital precancers.

    PubMed

    Crum, C P; Nuovo, G; Friedman, D; Silverstein, S J

    1988-01-01

    The accumulation of human papillomavirus type 16 (HPV-16)-specific RNAs in tissue sections from biopsies of patients with genital precancers was studied by in situ hybridization with single-stranded 35S-labeled RNA. These analyses revealed that the most abundant early-region RNAs were derived from the E4 and E5 open reading frames (ORFs). RNAs homologous to the E6/E7 ORFs were also detected, whereas RNAs homologous to the intervening E1 ORF were not. This suggests that the E4 and E5 mRNAs are derived by splicing to the upstream E6/E7 ORFs, consistent with studies of HPV-11 in condylomata (L. T. Chow et al., Cancer Cells (Cold Spring Harbor) 5:55-72, 1987). Abundant RNAs homologous to the 5' portion of L1 were also detected. These RNAs were localized to the apical strata of the epithelium. HPV-16 RNAs accumulated in discrete regions of these lesions, and when present were most abundant in the upper cell layers of the precancerous epithelium. RNAs homologous to early ORFs were also detected in some germinal cells within the basal layer of the epithelium.

  9. Accumulation of RNA homologous to human papillomavirus type 16 open reading frames in genital precancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crum, C.P.; Nuovo, G.; Friedman, D.

    1988-01-01

    The accumulation of human papillomavirus type 16 (HPV-16)-specific RNAs in tissue sections from biopsies of patients with genital precancers was studied by in situ hybridization with single-stranded /sup 35/S-labeled RNA. These analyses revealed that the most abundant early-region RNAs were derived from the E4 and E5 open reading frames (ORFs). RNAs homologous to the E6/E7 ORFs were also detected, whereas RNAs homologous to the intervening E1 ORF were not. This suggest that the E4 and E5 mRNAs are derived by splicing to the upstream E6/E7 ORFs, consistent with studies of HPV-11 in condylomata. Abundant RNAs homologous to the 5' portionmore » of L1 were also detected. These RNAs were localized to the apical strata of the epithelium. HPV-16 RNAs accumulated in discrete regions of these lesions, and when present were most abundant in the upper cell layers of the precancerous epithelium. RNAs homologous to early ORFs were also detected in some germinal cells within the basal layer of the epithelium.« less

  10. Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

    PubMed Central

    Hall, L; Laird, J E; Craig, R K

    1984-01-01

    Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

  11. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer

    PubMed Central

    2012-01-01

    Background Tri- and tetra-nucleotide repeats in mammalian genomes can induce formation of alternative non-B DNA structures such as triplexes and guanine (G)-quadruplexes. These structures can induce mutagenesis, chromosomal translocations and genomic instability. We wanted to determine if proteins that bind triplex DNA structures are quantitatively or qualitatively different between colorectal tumor and adjacent normal tissue and if this binding activity correlates with patient clinical characteristics. Methods Extracts from 63 human colorectal tumor and adjacent normal tissues were examined by gel shifts (EMSA) for triplex DNA-binding proteins, which were correlated with clinicopathological tumor characteristics using the Mann-Whitney U, Spearman’s rho, Kaplan-Meier and Mantel-Cox log-rank tests. Biotinylated triplex DNA and streptavidin agarose affinity binding were used to purify triplex-binding proteins in RKO cells. Western blotting and reverse-phase protein array were used to measure protein expression in tissue extracts. Results Increased triplex DNA-binding activity in tumor extracts correlated significantly with lymphatic disease, metastasis, and reduced overall survival. We identified three multifunctional splicing factors with biotinylated triplex DNA affinity: U2AF65 in cytoplasmic extracts, and PSF and p54nrb in nuclear extracts. Super-shift EMSA with anti-U2AF65 antibodies produced a shifted band of the major EMSA H3 complex, identifying U2AF65 as the protein present in the major EMSA band. U2AF65 expression correlated significantly with EMSA H3 values in all extracts and was higher in extracts from Stage III/IV vs. Stage I/II colon tumors (p = 0.024). EMSA H3 values and U2AF65 expression also correlated significantly with GSK3 beta, beta-catenin, and NF- B p65 expression, whereas p54nrb and PSF expression correlated with c-Myc, cyclin D1, and CDK4. EMSA values and expression of all three splicing factors correlated with ErbB1, mTOR, PTEN, and

  12. Triplex-forming oligonucleotides: a third strand for DNA nanotechnology

    PubMed Central

    2018-01-01

    Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337

  13. Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

    NASA Astrophysics Data System (ADS)

    Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

    2015-09-01

    The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

  14. Sindbis virus proteins nsP1 and nsP2 contain homology to nonstructural proteins from several RNA plant viruses.

    PubMed Central

    Ahlquist, P; Strauss, E G; Rice, C M; Strauss, J H; Haseloff, J; Zimmern, D

    1985-01-01

    Although the genetic organization of tobacco mosaic virus (TMV) differs considerably from that of the tripartite viruses (alfalfa mosaic virus [AlMV] and brome mosaic virus [BMV]), all of these RNA plant viruses share three domains of homology among their nonstructural proteins. One such domain, common to the AlMV and BMV 2a proteins and the readthrough portion of TMV p183, is also homologous to the readthrough protein nsP4 of Sindbis virus (Haseloff et al., Proc. Natl. Acad. Sci. U.S.A. 81:4358-4362, 1984). Two more domains are conserved among the AlMV and BMV 1a proteins and TMV p126. We show here that these domains have homology with portions of the Sindbis proteins nsP1 and nsP2, respectively. These results strengthen the view that the four viruses share mechanistic similarities in their replication strategies and may be evolutionarily related. These results also suggest that either the AlMV 1a, BMV 1a, and TMV p126 proteins are multifunctional or Sindbis proteins nsP1 and nsP2 function together as subunits in a single complex. PMID:3968720

  15. A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

    PubMed

    Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

    1997-07-01

    A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

  16. Lack of close relationship between three strains of human rhinoviruses as determined by their RNA sequences.

    PubMed

    Yin, F H; Lonberg-Holm, K; Chan, S P

    1973-07-01

    The possible genomic homologies between three serotypes of human rhinoviruses (HRV 1A, HRV 2, and HRV 14) were investigated. First we confirmed that these viruses were unrelated by the criterion of the absence of common antigenic determinants on the surfaces of the native virions, as detected by cross-neutralization of complementfixation. RNA-RNA hybridization was then examined with purified, highly radioactive, double-stranded, replicative-form RNA and excess single-stranded virion RNA. Single-stranded RNA showed 100% homology with the minus strand from the replicative-form RNA of the same type of virus. HRV 1A, HRV 2, and HRV 14 showed low intertypic homologies; these were not significantly greater than those found between the rhinoviruses and polivirus, which were used as a negative control. The immunological relationship and the RNA homology between HRV 1A and HRV 1B were also examined by the above techniques. It was confirmed that HRV 1A and HRV 1B share some surface determinants and it was also found that HRV 1B RNA shares 70% homology with HRV 1A RNA.

  17. Novel electrochemiluminescence of silver nanoclusters fabricated on triplex DNA scaffolds for label-free detection of biothiols.

    PubMed

    Feng, Lingyan; Wu, Li; Xing, Feifei; Hu, Lianzhe; Ren, Jinsong; Qu, Xiaogang

    2017-12-15

    Electrochemiluminescence (ECL) of metal nanoclusters and their application have been widely reported due to the good biocompatibility, fascinating electrocatalytic activity and so on. Using DNA as synthesis template opens new opportunities to modulate the physical properties of AgNCs. Triplex DNA has been reported for the site-specific, homogeneous and highly stable silver nanoclusters (AgNCs) fabrication from our recent research. Here we further explore their extraordinary ECL properties and applications in biosensor utilization. By reasonable design of DNA sequence, AgNCs were obtained in the predefined position of CG.C + sites of triplex DNA, and the ECL emission at a low potential was observed with this novel DNA template. Finally, a simple and label-free method was developed for biothiols detection based on the enhanced catalytic reaction and a robust interaction between the triplex-AgNCs and cysteine, by influencing the microenvironment provided by DNA template. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Archaeal and eukaryotic homologs of Hfq

    PubMed Central

    Mura, Cameron; Randolph, Peter S.; Patterson, Jennifer; Cozen, Aaron E.

    2013-01-01

    Hfq and other Sm proteins are central in RNA metabolism, forming an evolutionarily conserved family that plays key roles in RNA processing in organisms ranging from archaea to bacteria to human. Sm-based cellular pathways vary in scope from eukaryotic mRNA splicing to bacterial quorum sensing, with at least one step in each of these pathways being mediated by an RNA-associated molecular assembly built upon Sm proteins. Though the first structures of Sm assemblies were from archaeal systems, the functions of Sm-like archaeal proteins (SmAPs) remain murky. Our ignorance about SmAP biology, particularly vis-à-vis the eukaryotic and bacterial Sm homologs, can be partly reduced by leveraging the homology between these lineages to make phylogenetic inferences about Sm functions in archaea. Nevertheless, whether SmAPs are more eukaryotic (RNP scaffold) or bacterial (RNA chaperone) in character remains unclear. Thus, the archaeal domain of life is a missing link, and an opportunity, in Sm-based RNA biology. PMID:23579284

  19. Bladder exstrophy-epispadias complex and triple-X syndrome: incidental finding or causality?

    PubMed

    Ramaekers, Paul; Loeys, Bart; von Lowtzow, Catharina; Reutter, Heiko; Leroy, Yves; Colpaert, Cécile; Blaumeiser, Bettina; Janssens, Katrien; Parizel, Maxim; Jacquemyn, Yves

    2014-10-01

    Bladder exstrophy is a rare malformation. Prenatal diagnosis is usually an incidental finding on routine ultrasound examination. Triple-X syndrome (karyotype 47,XXX) is the most frequent sex chromosome aneuploidy in live-born females (approximately 1 in 1000). The diagnosis is often not made because women with 47,XXX karyotype have no or hardly any clinical symptoms during life. Prenatal diagnosis of triple X karyotype is usually an incidental finding when an invasive prenatal diagnosis is performed for other reasons. Here, we report on two cases with bladder exstrophy and triple-X syndrome, one in a fetus and one in an adult. In view of two previous reports of this association in literature, causality of these two conditions should be considered. A gene dosage effect as possible underlying mechanisms will be discussed. © 2014 Wiley Periodicals, Inc.

  20. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    PubMed

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  1. RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins.

    PubMed

    Walia, Rasna R; Xue, Li C; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

    2014-01-01

    Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence

  2. Lack of a Close Relationship Between Three Strains of Human Rhinoviruses as Determined by Their RNA Sequences 1

    PubMed Central

    Yin, Fay H.; Lonberg-Holm, K.; Chan, S. P.

    1973-01-01

    The possible genomic homologies between three serotypes of human rhinoviruses (HRV 1A, HRV 2, and HRV 14) were investigated. First we confirmed that these viruses were unrelated by the criterion of the absence of common antigenic determinants on the surfaces of the native virions, as detected by cross-neutralization of complementfixation. RNA-RNA hybridization was then examined with purified, highly radioactive, double-stranded, replicative-form RNA and excess single-stranded virion RNA. Single-stranded RNA showed 100% homology with the minus strand from the replicative-form RNA of the same type of virus. HRV 1A, HRV 2, and HRV 14 showed low intertypic homologies; these were not significantly greater than those found between the rhinoviruses and polivirus, which were used as a negative control. The immunological relationship and the RNA homology between HRV 1A and HRV 1B were also examined by the above techniques. It was confirmed that HRV 1A and HRV 1B share some surface determinants and it was also found that HRV 1B RNA shares 70% homology with HRV 1A RNA. PMID:4126194

  3. MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.

    PubMed

    Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F

    2010-04-08

    RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.

  4. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

    PubMed

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-06-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

  5. Modeling Global Soil Carbon and Soil Microbial Carbon by Integrating Microbial Processes into the Ecosystem Process Model TRIPLEX-GHG

    DOE PAGES

    Wang, Kefeng; Peng, Changhui; Zhu, Qiuan; ...

    2017-09-28

    Microbial physiology plays a critical role in the biogeochemical cycles of the Earth system. However, most traditional soil carbon models are lacking in terms of the representation of key microbial processes that control the soil carbon response to global climate change. In this study, the improved process-based model TRIPLEX-GHG was developed by coupling it with the new MEND (Microbial-ENzyme-mediated Decomposition) model to estimate total global soil organic carbon (SOC) and global soil microbial carbon. The new model (TRIPLEX-MICROBE) shows considerable improvement over the previous version (TRIPLEX-GHG) in simulating SOC. We estimated the global soil carbon stock to be approximately 1195more » Pg C, with 348 Pg C located in the high northern latitudes, which is in good agreement with the well-regarded Harmonized World Soil Database (HWSD) and the Northern Circumpolar Soil Carbon Database (NCSCD). We also estimated the global soil microbial carbon to be 21 Pg C, similar to the 23 Pg C estimated. We found that the microbial carbon quantity in the latitudinal direction showed reversions at approximately 30°N, near the equator and at 25°S. A sensitivity analysis suggested that the tundra ecosystem exhibited the highest sensitivity to a 1°C increase or decrease in temperature in terms of dissolved organic carbon (DOC), microbial biomass carbon (MBC) and mineral-associated organic carbon (MOC). Furthermore, our work represents the first step towards a new generation of ecosystem process models capable of integrating key microbial processes into soil carbon cycles.« less

  6. Modeling Global Soil Carbon and Soil Microbial Carbon by Integrating Microbial Processes into the Ecosystem Process Model TRIPLEX-GHG

    NASA Astrophysics Data System (ADS)

    Wang, Kefeng; Peng, Changhui; Zhu, Qiuan; Zhou, Xiaolu; Wang, Meng; Zhang, Kerou; Wang, Gangsheng

    2017-10-01

    Microbial physiology plays a critical role in the biogeochemical cycles of the Earth system. However, most traditional soil carbon models are lacking in terms of the representation of key microbial processes that control the soil carbon response to global climate change. In this study, the improved process-based model TRIPLEX-GHG was developed by coupling it with the new MEND (Microbial-ENzyme-mediated Decomposition) model to estimate total global soil organic carbon (SOC) and global soil microbial carbon. The new model (TRIPLEX-MICROBE) shows considerable improvement over the previous version (TRIPLEX-GHG) in simulating SOC. We estimated the global soil carbon stock to be approximately 1195 Pg C, with 348 Pg C located in the high northern latitudes, which is in good agreement with the well-regarded Harmonized World Soil Database (HWSD) and the Northern Circumpolar Soil Carbon Database (NCSCD). We also estimated the global soil microbial carbon to be 21 Pg C, similar to the 23 Pg C estimated by Xu et al. (2014). We found that the microbial carbon quantity in the latitudinal direction showed reversions at approximately 30°N, near the equator and at 25°S. A sensitivity analysis suggested that the tundra ecosystem exhibited the highest sensitivity to a 1°C increase or decrease in temperature in terms of dissolved organic carbon (DOC), microbial biomass carbon (MBC), and mineral-associated organic carbon (MOC). However, our work represents the first step toward a new generation of ecosystem process models capable of integrating key microbial processes into soil carbon cycles.

  7. Modeling Global Soil Carbon and Soil Microbial Carbon by Integrating Microbial Processes into the Ecosystem Process Model TRIPLEX-GHG

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Kefeng; Peng, Changhui; Zhu, Qiuan

    Microbial physiology plays a critical role in the biogeochemical cycles of the Earth system. However, most traditional soil carbon models are lacking in terms of the representation of key microbial processes that control the soil carbon response to global climate change. In this study, the improved process-based model TRIPLEX-GHG was developed by coupling it with the new MEND (Microbial-ENzyme-mediated Decomposition) model to estimate total global soil organic carbon (SOC) and global soil microbial carbon. The new model (TRIPLEX-MICROBE) shows considerable improvement over the previous version (TRIPLEX-GHG) in simulating SOC. We estimated the global soil carbon stock to be approximately 1195more » Pg C, with 348 Pg C located in the high northern latitudes, which is in good agreement with the well-regarded Harmonized World Soil Database (HWSD) and the Northern Circumpolar Soil Carbon Database (NCSCD). We also estimated the global soil microbial carbon to be 21 Pg C, similar to the 23 Pg C estimated. We found that the microbial carbon quantity in the latitudinal direction showed reversions at approximately 30°N, near the equator and at 25°S. A sensitivity analysis suggested that the tundra ecosystem exhibited the highest sensitivity to a 1°C increase or decrease in temperature in terms of dissolved organic carbon (DOC), microbial biomass carbon (MBC) and mineral-associated organic carbon (MOC). Furthermore, our work represents the first step towards a new generation of ecosystem process models capable of integrating key microbial processes into soil carbon cycles.« less

  8. Ultra-fast analog-to-digital converter based on a nonlinear triplexer and an optical coder with a photonic crystal structure.

    PubMed

    Mehdizadeh, Farhad; Soroosh, Mohammad; Alipour-Banaei, Hamed; Farshidi, Ebrahim

    2017-03-01

    In this paper, we propose what we believe is a novel all-optical analog-to-digital converter (ADC) based on photonic crystals. The proposed structure is composed of a nonlinear triplexer and an optical coder. The nonlinear triplexer is for creating discrete levels in the continuous optical input signal, and the optical coder is for generating a 2-bit standard binary code out of the discrete levels coming from the nonlinear triplexer. Controlling the resonant mode of the resonant rings through optical intensity is the main objective and working mechanism of the proposed structure. The maximum delay time obtained for the proposed structure was about 5 ps and the total footprint is about 1520  μm2.

  9. Four base recognition by triplex-forming oligonucleotides at physiological pH

    PubMed Central

    Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.

    2005-01-01

    We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633

  10. Screening and investigation of triplex DNA binders from Stephania tetrandra S. Moore by a combination of peak area-fading UHPLC with orbitrap MS and optical spectroscopies.

    PubMed

    Yang, Hongmei; Wang, Yihan; Yu, Wenjing; Shi, Lei; Wang, Hongfeng; Su, Rui; Chen, Changbao; Liu, Shuying

    2018-05-15

    The identification and screening of triplex DNA binders are important because these compounds, in many cases, are potential anticancer agents as well as promising drug candidates. Therefore, the ability to screen for these compounds in a high-throughput mode could dramatically improve the drug screening process. A method involving a combination of 96-well plate format and peak area-fading ultra high performance liquid chromatography coupled with Orbitrap mass spectrometry was employed for screening bioactive compounds binding to the triplex DNA from the extracts of Stephania tetrandra S. Moore. Two compounds were screened out and identified as fangchinoline and tetrandrine, based on the comparison of retention time and MS 2 data with those of standards. The binding mechanisms of fangchinoline and tetrandrine at the molecular level were explored using MS 2 , fluorescence spectroscopy, ultraviolet-visible spectroscopy, and circular dichroism. Collision-induced dissociation experiments showed that the complexes with fangchinoline and tetrandrine were dissociated by ligand elimination. According to these measurements, an intercalating binding is the most appropriate binding mode of these two alkaloids to the triplex DNA. The current work provides not only deep insight into alkaloid-triplex DNA complexes but also useful guidelines for the design of efficient anticancer agents. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  11. Effect of the 3-halo substitution of the 2'-deoxy aminopyridinyl-pseudocytidine derivatives on the selectivity and stability of antiparallel triplex DNA with a CG inversion site.

    PubMed

    Wang, Lei; Taniguchi, Yosuke; Okamura, Hidenori; Sasaki, Shigeki

    2017-07-15

    Triplex formation against a target duplex DNA has the potential to become a tool for the genome research. However, there is an intrinsic restriction on the duplex DNA sequences capable of forming the triplex DNA. Recently, we demonstrated the selective formation of the stable antiparallel triplexes containing the CG inversion sites using the 2'-deoxy-1-methylpseudocytidine derivative (ΨdC), whose amino group was conjugated with the 2-aminopyridine at its 5-position as an additional hydrogen bonding unit (AP-ΨdC). The 1-N of 2-aminopyridine was supposed to be protonated to form the hydrogen bond with the guanine of the CG inversion site. In this study, to test the effect of the 3-substitution of the 2-aminopyridine unit of AP-ΨdC on the triplex stability, we synthesized the 3-halogenated 2-aminopyridine derivatives of AP-ΨdC. The pKa values 1-N of the 2-aminopyridine unit of AP-ΨdC as the monomer nucleoside were determined to be 6.3 for 3-CH 3 ( Me AP-ΨdC), 6.1 for 3-H (AP-ΨdC), 4.3 for 3-Cl ( Cl AP-ΨdC), 4.4 for 3-Br ( Br AP-ΨdC), and 4.7 for 3-I ( I AP-ΨdC), suggesting that all the halogenated AP-ΨdCs are not protonated under neutral conditions. Interestingly, although the recognition selectivity depends on the sequence context, the TFO having the sequence of the 3'-G-( I AP-ΨdC)-A-5' context showed the selective triplex formation with the CG inversion site. These results suggest that the protonation at the 1-N position plays an important role in the stable and selective triplex formation of AP-ΨdC derivatives in any sequences. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. [Preimplantation genetic diagnosis of Duchenne muscular dystrophy by single cell triplex PCR].

    PubMed

    Wu, Yue-Li; Wu, Ling-Qian; Li, Yan-Ping; Liu, Dong-E; Zeng, Qiao; Zhu, Hai-Yan; Pan, Qian; Liang, De-Sheng; Hu, Hao; Long, Zhi-Gao; Li, Juan; Dai, He-Ping; Xia, Kun; Xia, Jia-Hui

    2007-04-01

    To detect two exons of Duchenne muscular dystrophy (DMD) gene and a gender discrimination locus amelogenin gene by single cell triplex PCR, and to evaluate the possibility of this technique for preimplantation genetic diagnosis (PGD) in DMD family with DMD deletion mutation. Single lymphocytes from a normal male, a normal female, two DMD patients (exon 8 and 47 deleted, respectively) and single blastomeres from the couples treated by the in vitro fertilization pre-embryo transfer (IVF-ET) and without family history of DMD were obtained. Exons 8 and 47 of DMD gene were amplified by a triplex PCR assay, the amelogenin gene on X and Y chromosomes were co-amplified to analyze the correlation between embryo gender and deletion status. In the normal single lymphocytes, the amplification rate of exons 8 and 47 of DMD and amelogenin gene were 93.8%, 93.8%, and 95.3% respectively. The false positive rate was 3.3%. In the exon 8 deleted DMD patient, the amplification rate of exon 47 of DMD and amelogenin gene was 95.8%, and the false positive rate was 3.3%. In the exon 47 deleted DMD patient, the amplification rate of exon 8 of DMD and amelogenin gene was 95.8%, and the false positive rate was 0. In the single blastomeres, the amplification rate of exons 8 and 47 of DMD and amelogenin gene was 82.5%, 80.0% and 77.5%, respectively, and the false positive rate was 0. The single cell triplex PCR protocol for the detection of DMD and amelogenin gene is highly sensitive, specific and reliable, and can be used for PGD in those DMD families with DMD deletion mutation.

  13. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

    PubMed Central

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-01-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

  14. Analyte-Triggered DNA-Probe Release from a Triplex Molecular Beacon for Nanopore Sensing.

    PubMed

    Guo, Bingyuan; Sheng, Yingying; Zhou, Ke; Liu, Quansheng; Liu, Lei; Wu, Hai-Chen

    2018-03-26

    A new nanopore sensing strategy based on triplex molecular beacon was developed for the detection of specific DNA or multivalent proteins. The sensor is composed of a triplex-forming molecular beacon and a stem-forming DNA component that is modified with a host-guest complex. Upon target DNA hybridizing with the molecular beacon loop or multivalent proteins binding to the recognition elements on the stem, the DNA probe is released and produces highly characteristic current signals when translocated through α-hemolysin. The frequency of current signatures can be used to quantify the concentrations of the target molecules. This sensing approach provides a simple, quick, and modular tool for the detection of specific macromolecules with high sensitivity and excellent selectivity. It may find useful applications in point-of-care diagnostics with a portable nanopore kit in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A zinc finger domain gene in the lizard, Calotes versicolor, shows extensive homology with the mammalian ZFX and is expressed embryonically.

    PubMed

    Ganesh, S; Choudhary, B; Raman, R

    1998-01-01

    A 590-bp long zinc finger domain DNA fragment has been isolated by polymerase chain reaction from the lizard, Calotes versicolor, employing the primers used for amplifying the zinc finger domain of the human Y-chromosomal gene, ZFY. Cloned in pUC18, the fragment, called CvZfa, was sequenced and its expression during development was studied. At the nucleotide and amino acid level CvZfa shows respectively 83% and 90% identity with the human ZFY, but its extent of homology is greater with the ZFX of human (86% at nucleotide and 92% at amino acid level) and the ZFY-like genes of turtle and chick. Similarly its homology with the mouse Zfx and Zfa is much greater than that with Zfy-1 and Zfy-2. It appears that the mammalian ZFX (Zfx) evolved from reptilian ancestors with a considerable degree of conservation, but the ZFX to ZFY divergence within the class mammalia was more rapid. The CvZfa transcripts were seen in all the embryonic stages from which RNA was analysed. The whole mount in situ hybridization with the posteriorly placed mesonephros and the gonadal primordia of 10 to 25 day old embryos showed signal selectively in mesonephros of the 20 and 25 day embryos. There was no signal in the genital ridge. Thus CvZfa may not have a direct role in gonadogenesis of C. versicolor, but the possibility of its inductive role in the formation of adreno-gonadal axis through mesonephros cannot be discounted.

  16. Genetic relatedness of orbiviruses by RNA-RNA blot hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bodkin, D.K.

    1985-01-01

    RNA-RNA blot hybridization was developed in order to identify type-specific genes among double-stranded (ds) RNA viruses, to assess the genetic relatedness of dsRNA viruses and to classify new strains. Viral dsRNA segments were electrophoresed through 10% polyacrylamide gels, transferred to membranes, and hybridized to (5'/sup 32/P)-pCp labeled genomic RNA from a related strain. Hybridization was performed at 52/sup 0/C, 50% formamide, 5X SSC. Under these conditions heterologous RNA species must share greater than or equal to 74% sequence homology in order to form stable dsRNA hybrids. Cognate genes of nine members of the Palyam serogroup of orbiviruses were identified andmore » their sequence relatedness to the prototype. Palyam virus, was determined. Reciprocal blot hybridizations were performed using radiolabeled genomic RNA of all members of the Palyam serogroup. Unique and variant genes were identified by lack of cross-homology or by weak homology between segments. Since genes 2 and 6 exhibited the highest degree of sequence variability, response to the vertebrate immune system may be a major cause of sequence divergence among members of a single serogroup. Changuinola serogroup isolates were compared by dot-blot hybridization, while Colorado tick fever (CTF) serogroup isolates were compared by the RNA-RNA blot hybridization procedure described for reovirus and Palyam serogroup isolates. Preliminary blot hybridization data were also obtained on the relatedness of members of different Orbivirus serogroups.« less

  17. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    USDA-ARS?s Scientific Manuscript database

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  18. TriPleX: a versatile dielectric photonic platform

    NASA Astrophysics Data System (ADS)

    Wörhoff, Kerstin; Heideman, René G.; Leinse, Arne; Hoekman, Marcel

    2015-04-01

    Photonic applications based on planar waveguide technology impose stringent requirements on properties such as optical propagation losses, light coupling to optical fibers, integration density, as well as on reliability and reproducibility. The latter is correlated to a high level of control of the refractive index and waveguide geometry. In this paper, we review a versatile dielectric waveguide platform, called TriPleX, which is based on alternating silicon nitride and silicon dioxide films. Fabrication with CMOS-compatible equipment based on low-pressure chemical vapor deposition enables the realization of stable material compositions being a prerequisite to the control of waveguide properties and modal shape. The transparency window of both materials allows for the realization of low-loss waveguides over a wide wavelength range (400 nm-2.35 μm). Propagation losses as low as 5×10-4 dB/cm are reported. Three basic geometries (box shell, double stripe, and filled box) can be distinguished. A specific tapering technology is developed for on-chip, low-loss (<0.1 dB) spotsize convertors, allowing for combining efficient fiber to chip coupling with high-contrast waveguides required for increased functional complexity as well as for hybrid integration with other photonic platforms such as InP and SOI. The functionality of the TriPleX platform is captured by verified basic building blocks. The corresponding library and associated design kit is available for multi-project wafer (MPW) runs. Several applications of this platform technology in communications, biomedicine, sensing, as well as a few special fields of photonics are treated in more detail.

  19. New design of a triplexer using ring resonator integrated with directional coupler based on photonic crystals

    NASA Astrophysics Data System (ADS)

    Wu, Yaw-Dong; Shih, Tien-Tsorng; Lee, Jian-Jang

    2009-11-01

    In this paper, we proposed the design of directional coupler integrated with ring resonator based on two-dimensional photonic crystals (2D PCs) to develop a triplexer filter. It can be widely used as the fiber access network element for multiplexer-demultiplexer wavelength selective in fiber-to-the-home (FTTH) communication systems. The directional coupler is chosen to separate the wavelengths of 1490nm and 1310nm. The ring resonator separates the wavelength of 1550nm. The transmission efficiency is larger than 90%. Besides, the total size of propose triplexer is only 19μm×12μm. We present simulation results using the finite-difference time-domain (FDTD) method for the proposed structure.

  20. PARRoT- a homology-based strategy to quantify and compare RNA-sequencing from non-model organisms.

    PubMed

    Gan, Ruei-Chi; Chen, Ting-Wen; Wu, Timothy H; Huang, Po-Jung; Lee, Chi-Ching; Yeh, Yuan-Ming; Chiu, Cheng-Hsun; Huang, Hsien-Da; Tang, Petrus

    2016-12-22

    Next-generation sequencing promises the de novo genomic and transcriptomic analysis of samples of interests. However, there are only a few organisms having reference genomic sequences and even fewer having well-defined or curated annotations. For transcriptome studies focusing on organisms lacking proper reference genomes, the common strategy is de novo assembly followed by functional annotation. However, things become even more complicated when multiple transcriptomes are compared. Here, we propose a new analysis strategy and quantification methods for quantifying expression level which not only generate a virtual reference from sequencing data, but also provide comparisons between transcriptomes. First, all reads from the transcriptome datasets are pooled together for de novo assembly. The assembled contigs are searched against NCBI NR databases to find potential homolog sequences. Based on the searched result, a set of virtual transcripts are generated and served as a reference transcriptome. By using the same reference, normalized quantification values including RC (read counts), eRPKM (estimated RPKM) and eTPM (estimated TPM) can be obtained that are comparable across transcriptome datasets. In order to demonstrate the feasibility of our strategy, we implement it in the web service PARRoT. PARRoT stands for Pipeline for Analyzing RNA Reads of Transcriptomes. It analyzes gene expression profiles for two transcriptome sequencing datasets. For better understanding of the biological meaning from the comparison among transcriptomes, PARRoT further provides linkage between these virtual transcripts and their potential function through showing best hits in SwissProt, NR database, assigning GO terms. Our demo datasets showed that PARRoT can analyze two paired-end transcriptomic datasets of approximately 100 million reads within just three hours. In this study, we proposed and implemented a strategy to analyze transcriptomes from non-reference organisms which offers

  1. A high-throughput assay for DNA topoisomerases and other enzymes, based on DNA triplex formation.

    PubMed

    Burrell, Matthew R; Burton, Nicolas P; Maxwell, Anthony

    2010-01-01

    We have developed a rapid, high-throughput assay for measuring the catalytic activity (DNA supercoiling or relaxation) of topoisomerase enzymes that is also capable of monitoring the activity of other enzymes that alter the topology of DNA. The assay utilises intermolecular triplex formation to resolve supercoiled and relaxed forms of DNA, the principle being the greater efficiency of a negatively supercoiled plasmid to form an intermolecular triplex with an immobilised oligonucleotide than the relaxed form. The assay provides a number of advantages over the standard gel-based methods, including greater speed of analysis, reduced sample handling, better quantitation and improved reliability and accuracy of output data. The assay is performed in microtitre plates and can be adapted to high-throughput screening of libraries of potential inhibitors of topoisomerases including bacterial DNA gyrase.

  2. Orchestration of Structural, Stereoelectronic, and Hydrogen-Bonding Effects in Stabilizing Triplexes from Engineered Chimeric Collagen Peptides (Pro(X)-Pro(Y)-Gly)6 Incorporating 4(R/S)-Aminoproline.

    PubMed

    Umashankara, Muddegowda; Sonar, Mahesh V; Bansode, Nitin D; Ganesh, Krishna N

    2015-09-04

    Collagens are an important family of structural proteins found in the extracellular matrix with triple helix as the characteristic structural motif. The collagen triplex is made of three left-handed polyproline II (PPII) helices with each PPII strand consisting of repetitive units of the tripeptide motif X-Y-Gly, where the amino acids X and Y are most commonly proline (Pro) and 4R-hydroxyproline (Hyp), respectively. A C4-endo pucker at X-site and C4-exo pucker at Y-site have been proposed to be the key for formation of triplex, and the nature of pucker is dependent on both the electronegativity and stereochemistry of the substituent. The present manuscript describes a new class of collagen analogues-chimeric cationic collagens-wherein both X- and Y-sites in collagen triad are simultaneously substituted by a combination of 4(R/S)-(OH/NH2/NH3(+)/NHCHO)-prolyl units and triplex stabilities measured at different pHs and in EG:H2O. Based on the results a model has been proposed with the premise that any factors which specifically favor the ring puckers of C4-endo at X-site and C4-exo at Y-site stabilize the PPII conformation and hence the derived triplexes. The pH-dependent triplex stability uniquely observed with ionizable 4-amino substituent on proline enables one to define the critical combination of factors C4-(exo/endo), intraresidue H-bonding, stereoelectronic (R/S) and n → π* interactions in dictating the triplex strength. The ionizable NH2 substituent at C4 in R/S configuration is thus a versatile probe for delineating the triplex stabilizing factors and the results have potential for designing of collagen analogues with customized properties for material and biological applications.

  3. Multiple homologous genes knockout (KO) by CRISPR/Cas9 system in rabbit.

    PubMed

    Liu, Huan; Sui, Tingting; Liu, Di; Liu, Tingjun; Chen, Mao; Deng, Jichao; Xu, Yuanyuan; Li, Zhanjun

    2018-03-20

    The CRISPR/Cas9 system is a highly efficient and convenient genome editing tool, which has been widely used for single or multiple gene mutation in a variety of organisms. Disruption of multiple homologous genes, which have similar DNA sequences and gene function, is required for the study of the desired phenotype. In this study, to test whether the CRISPR/Cas9 system works on the mutation of multiple homologous genes, a single guide RNA (sgRNA) targeting three fucosyltransferases encoding genes (FUT1, FUT2 and SEC1) was designed. As expected, triple gene mutation of FUT1, FUT2 and SEC1 could be achieved simultaneously via a sgRNA mediated CRISPR/Cas9 system. Besides, significantly reduced serum fucosyltransferases enzymes activity was also determined in those triple gene mutation rabbits. Thus, we provide the first evidence that multiple homologous genes knockout (KO) could be achieved efficiently by a sgRNA mediated CRISPR/Cas9 system in mammals, which could facilitate the genotype to phenotype studies of homologous genes in future. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

    PubMed Central

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

  5. Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

    PubMed

    Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

    2006-01-01

    The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

  6. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    PubMed

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  7. Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.

    PubMed

    Gaspin, C; Cavaillé, J; Erauso, G; Bachellerie, J P

    2000-04-07

    Ribose methylation is a prevalent type of nucleotide modification in rRNA. Eukaryotic rRNAs display a complex pattern of ribose methylations, amounting to 55 in yeast Saccharomyces cerevisiae and about 100 in vertebrates. Ribose methylations of eukaryotic rRNAs are each guided by a cognate small RNA, belonging to the family of box C/D antisense snoRNAs, through transient formation of a specific base-pairing at the rRNA modification site. In prokaryotes, the pattern of rRNA ribose methylations has been fully characterized in a single species so far, Escherichia coli, which contains only four ribose methylated rRNA nucleotides. However, the hyperthermophile archaeon Sulfolobus solfataricus contains, like eukaryotes, a large number of (yet unmapped) rRNA ribose methylations and homologs of eukaryotic box C/D small nucleolar ribonuclear proteins have been identified in archaeal genomes. We have therefore searched archaeal genomes for potential homologs of eukaryotic methylation guide small nucleolar RNAs, by combining searches for structured motifs with homology searches. We have identified a family of 46 small RNAs, conserved in the genomes of three hyperthermophile Pyrococcus species, which we have experimentally characterized in Pyrococcus abyssi. The Pyrococcus small RNAs, the first reported homologs of methylation guide small nucleolar RNAs in organisms devoid of a nucleus, appear as a paradigm of minimalist box C/D antisense RNAs. They differ from their eukaryotic homologs by their outstanding structural homogeneity, extended consensus box motifs and the quasi-systematic presence of two (instead of one) rRNA antisense elements. Remarkably, for each small RNA the two antisense elements always match rRNA sequences close to each other in rRNA structure, suggesting an important role in rRNA folding. Only a few of the predicted P. abyssi rRNA ribose methylations have been detected so far. Further analysis of these archaeal small RNAs could provide new insights into

  8. Elongated Hypocotyl 5-Homolog (HYH) Negatively Regulates Expression of the Ambient Temperature-Responsive MicroRNA Gene MIR169

    PubMed Central

    Serivichyaswat, Phanu T.; Susila, Hendry; Ahn, Ji Hoon

    2017-01-01

    Arabidopsis microRNA169 (miR169) is an ambient temperature-responsive microRNA that plays an important role in stress responses and the floral transition. However, the transcription factors that regulate the expression of MIR169 have remained unknown. In this study, we show that Elongated Hypocotyl 5-Homolog (HYH) directly binds to the promoter of MIR169a and negatively regulates its expression. Absolute quantification identified MIR169a as the major locus producing miR169. GUS reporter assays revealed that the deletion of a 498-bp fragment (–1,505 to –1,007, relative to the major transcriptional start site) of MIR169a abolished its ambient temperature-responsive expression. DNA-affinity chromatography followed by liquid chromatography-mass spectrometry analysis identified transcription factor HYH as a trans-acting factor that binds to the 498-bp promoter fragment of pri-miR169a. Electrophoretic mobility shift assays and chromatin immunoprecipitation–quantitative PCR demonstrated that the HYH.2 protein, a predominant isoform of HYH, directly associated with a G-box-like motif in the 498-bp fragment of pri-miR169a. Higher enrichment of HYH.2 protein on the promoter region of MIR169a was seen at 23°C, consistent with the presence of more HYH.2 protein in the cell at the temperature. Transcript levels of pri-miR169a increased in hyh mutants and decreased in transgenic plants overexpressing HYH. Consistent with the negative regulation of MIR169a by HYH, the diurnal levels of HYH mRNA and pri-miR169a showed opposite patterns. Taken together, our results suggest that HYH is a transcription factor that binds to a G-box-like motif in the MIR169a promoter and negatively regulates ambient temperature-responsive expression of MIR169a at higher temperatures in Arabidopsis. PMID:29270188

  9. Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

    PubMed

    Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

    2011-08-05

    5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

  10. Thermodynamic contributions for the incorporation of GTA triplets within canonical TAT/TAT and C+GC/C+GC base-triplet stacks of DNA triplexes.

    PubMed

    Soto, Ana Maria; Marky, Luis A

    2002-10-15

    Nucleic acid triple helices may be used in the control of gene expression. One limitation of using triplex-forming oligonucleotides as therapeutic agents is that their target sequences are limited to homopurine tracts. To increase the repertoire of sequences that can be targeted, it has been postulated that a guanine can target a thymidine forming a stable GTA mismatch triplet. In this work, we have used a combination of optical and calorimetric techniques to determine thermodynamic unfolding profiles of two triplexes containing a single GTA triplet, d(A(3)TA(3)C(5)T(3)AT(3)C(5)T(3)GT(3)) (ATA) and d(AGTGAC(5)TCACTC(5)TCGCT) (GTG), and their control triplexes, d(A(7)C(5)T(7)C(5)T(7)) (TAT7) and d(AGAGAC(5)TCTCTC(5)TCTCT) (AG5T). In general, the presence of a GTA mismatch in DNA triplexes is destabilizing; however, this destabilization is greater when placed in a C(+)GC/C(+)GC base-triplet stack than between a TAT/TAT stack. These destabilizations are accompanied by a reduced unfolding enthalpy of approximately 10 kcal/mol, suggesting a decrease in the base stacking contributions surrounding the mismatch. Relative to their corresponding control triplexes, the folding of ATA is accompanied by a lower counterion uptake and a similar proton uptake, while GTG folding is accompanied by an increase in the counterion and proton uptakes. These effects are consistent with the observed decrease in stacking interactions. The overall results indicate that the main difficulty of targeting pyrimidine interruptions is that the decrease in stacking contributions, due to the incorporation of a GTA mismatch, affects the stability of the neighboring base triplets. This suggests that nucleotide analogues that increase the strength of these base-triplet stacks will result in a more effective targeting of pyrimidine interruptions.

  11. 22. FIRST FLOOR APARTMENT SOUTH BEDROOM INTERIOR SHOWING PAIRED 6LIGHT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. FIRST FLOOR APARTMENT SOUTH BEDROOM INTERIOR SHOWING PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAMED WINDOWS. VIEW TO SOUTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  12. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    PubMed Central

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  13. 24. SECOND FLOOR EAST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    24. SECOND FLOOR EAST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING DOORWAY INTO KITCHEN AT PHOTO CENTER LEFT AND OPEN DOORWAY INTO BATHROOM AT PHOTO RIGHT. VIEW TO SOUTHWEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  14. 32. SECOND FLOOR WEST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. SECOND FLOOR WEST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING DOORWAY INTO KITCHEN AT PHOTO CENTER RIGHT, AND OPEN DOORWAY IN BATHROOM AT PHOTO LEFT. VIEW TO SOUTHWEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  15. 37. SECOND FLOOR WEST SIDE APARTMENT EAST BEDROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    37. SECOND FLOOR WEST SIDE APARTMENT EAST BEDROOM INTERIOR SHOWING PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS ON NORTH WALL. VIEW TO NORTHEAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  16. TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p.

    PubMed

    Bodem, J; Dobreva, G; Hoffmann-Rohrer, U; Iben, S; Zentgraf, H; Delius, H; Vingron, M; Grummt, I

    2000-08-01

    Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro.

  17. Design optimization of integrated BiDi triplexer optical filter based on planar lightwave circuit.

    PubMed

    Xu, Chenglin; Hong, Xiaobin; Huang, Wei-Ping

    2006-05-29

    Design optimization of a novel integrated bi-directional (BiDi) triplexer filter based on planar lightwave circuit (PLC) for fiber-to-the premise (FTTP) applications is described. A multi-mode interference (MMI) device is used to filter the up-stream 1310nm signal from the down-stream 1490nm and 1555nm signals. An array waveguide grating (AWG) device performs the dense WDM function by further separating the two down-stream signals. The MMI and AWG are built on the same substrate with monolithic integration. The design is validated by simulation, which shows excellent performance in terms of filter spectral characteristics (e.g., bandwidth, cross-talk, etc.) as well as insertion loss.

  18. Design optimization of integrated BiDi triplexer optical filter based on planar lightwave circuit

    NASA Astrophysics Data System (ADS)

    Xu, Chenglin; Hong, Xiaobin; Huang, Wei-Ping

    2006-05-01

    Design optimization of a novel integrated bi-directional (BiDi) triplexer filter based on planar lightwave circuit (PLC) for fiber-to-the premise (FTTP) applications is described. A multi-mode interference (MMI) device is used to filter the up-stream 1310nm signal from the down-stream 1490nm and 1555nm signals. An array waveguide grating (AWG) device performs the dense WDM function by further separating the two down-stream signals. The MMI and AWG are built on the same substrate with monolithic integration. The design is validated by simulation, which shows excellent performance in terms of filter spectral characteristics (e.g., bandwidth, cross-talk, etc.) as well as insertion loss.

  19. Homology of aspartyl- and lysyl-tRNA synthetases.

    PubMed Central

    Gampel, A; Tzagoloff, A

    1989-01-01

    The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

  20. Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes

    PubMed Central

    Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.

    2016-01-01

    DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167

  1. 16. FIRST FLOOR APARTMENT KITCHEN INTERIOR SHOWING OPEN DOORWAY TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. FIRST FLOOR APARTMENT KITCHEN INTERIOR SHOWING OPEN DOORWAY TO LIVING ROOM AND PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS OVER SINK. VIEW TO EAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  2. CUS2, a Yeast Homolog of Human Tat-SF1, Rescues Function of Misfolded U2 through an Unusual RNA Recognition Motif

    PubMed Central

    Yan, Dong; Perriman, Rhonda; Igel, Haller; Howe, Kenneth J.; Neville, Megan; Ares, Manuel

    1998-01-01

    A screen for suppressors of a U2 snRNA mutation identified CUS2, an atypical member of the RNA recognition motif (RRM) family of RNA binding proteins. CUS2 protein is associated with U2 RNA in splicing extracts and interacts with PRP11, a subunit of the conserved splicing factor SF3a. Absence of CUS2 renders certain U2 RNA folding mutants lethal, arguing that a normal activity of CUS2 is to help refold U2 into a structure favorable for its binding to SF3b and SF3a prior to spliceosome assembly. Both CUS2 function in vivo and the in vitro RNA binding activity of CUS2 are disrupted by mutation of the first RRM, suggesting that rescue of misfolded U2 involves the direct binding of CUS2. Human Tat-SF1, reported to stimulate Tat-specific, transactivating region-dependent human immunodeficiency virus transcription in vitro, is structurally similar to CUS2. Anti-Tat-SF1 antibodies coimmunoprecipitate SF3a66 (SAP62), the human homolog of PRP11, suggesting that Tat-SF1 has a parallel function in splicing in human cells. PMID:9710584

  3. GTSF-1 is required for formation of a functional RNA-dependent RNA Polymerase complex in Caenorhabditis elegans.

    PubMed

    Almeida, Miguel Vasconcelos; Dietz, Sabrina; Redl, Stefan; Karaulanov, Emil; Hildebrandt, Andrea; Renz, Christian; Ulrich, Helle D; König, Julian; Butter, Falk; Ketting, René F

    2018-05-16

    Argonaute proteins and their associated small RNAs (sRNAs) are evolutionarily conserved regulators of gene expression. Gametocyte-specific factor 1 (Gtsf1) proteins, characterized by two tandem CHHC zinc fingers and an unstructured C-terminal tail, are conserved in animals and have been shown to interact with Piwi clade Argonautes, thereby assisting their activity. We identified the Caenorhabditis elegans Gtsf1 homolog, named it gtsf-1 and characterized it in the context of the sRNA pathways of C. elegans We report that GTSF-1 is not required for Piwi-mediated gene silencing. Instead, gtsf-1 mutants show a striking depletion of 26G-RNAs, a class of endogenous sRNAs, fully phenocopying rrf-3 mutants. We show, both in vivo and in vitro , that GTSF-1 interacts with RRF-3 via its CHHC zinc fingers. Furthermore, we demonstrate that GTSF-1 is required for the assembly of a larger RRF-3 and DCR-1-containing complex (ERIC), thereby allowing for 26G-RNA generation. We propose that GTSF-1 homologs may act to drive the assembly of larger complexes that act in sRNA production and/or in imposing sRNA-mediated silencing activities. © 2018 The Authors.

  4. TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p

    PubMed Central

    Bodem, Jochen; Dobreva, Gergana; Hoffmann-Rohrer, Urs; Iben, Sebastian; Zentgraf, Hanswalter; Delius, Hajo; Vingron, Martin; Grummt, Ingrid

    2000-01-01

    Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro. PMID:11265758

  5. Drosha drives the formation of DNA:RNA hybrids around DNA break sites to facilitate DNA repair.

    PubMed

    Lu, Wei-Ting; Hawley, Ben R; Skalka, George L; Baldock, Robert A; Smith, Ewan M; Bader, Aldo S; Malewicz, Michal; Watts, Felicity Z; Wilczynska, Ania; Bushell, Martin

    2018-02-07

    The error-free and efficient repair of DNA double-stranded breaks (DSBs) is extremely important for cell survival. RNA has been implicated in the resolution of DNA damage but the mechanism remains poorly understood. Here, we show that miRNA biogenesis enzymes, Drosha and Dicer, control the recruitment of repair factors from multiple pathways to sites of damage. Depletion of Drosha significantly reduces DNA repair by both homologous recombination (HR) and non-homologous end joining (NHEJ). Drosha is required within minutes of break induction, suggesting a central and early role for RNA processing in DNA repair. Sequencing of DNA:RNA hybrids reveals RNA invasion around DNA break sites in a Drosha-dependent manner. Removal of the RNA component of these structures results in impaired repair. These results show how RNA can be a direct and critical mediator of DNA damage repair in human cells.

  6. 38. SECOND FLOOR WEST SIDE APARTMENT WEST BEDROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. SECOND FLOOR WEST SIDE APARTMENT WEST BEDROOM INTERIOR SHOWING PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS ON WEST WALL AND OPEN DOORWAY TO LIVING ROOM. VIEW TO WEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  7. Cellular RNA-dependent RNA polymerase involved in posttranscriptional gene silencing has two distinct activity modes.

    PubMed

    Makeyev, Eugene V; Bamford, Dennis H

    2002-12-01

    Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.

  8. Monitoring DNA triplex formation using multicolor fluorescence and application to insulin-like growth factor I promoter downregulation.

    PubMed

    Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe

    2014-03-01

    Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. © 2014 FEBS.

  9. New Approaches Towards Recognition of Nucleic Acid Triple Helices

    PubMed Central

    Arya, Dev P.

    2012-01-01

    We show that groove recognition of nucleic acid triple helices can be achieved with aminosugars. Among these aminosugars, neomycin is the most effective aminoglycoside (groove binder) for stabilizing a DNA triple helix. It stabilizes both the T·A·T triplex and mixed-base DNA triplexes better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (T·A·T and mixed base) without any effect on the DNA duplex. The selectivity of neomycin likely originates from its potential and shape complementarity to the triplex Watson–Hoogsteen groove, making it the first molecule that selectively recognizes a triplex groove over a duplex groove. The groove recognition of aminoglycosides is not limited to DNA triplexes, but also extends to RNA and hybrid triple helical structures. Intercalator–neomycin conjugates are shown to simultaneously probe the base stacking and groove surface in the DNA triplex. Calorimetric and spectrosocopic studies allow the quantification of the effect of surface area of the intercalating moiety on binding to the triplex. These studies outline a novel approach to the recognition of DNA triplexes that incorporates the use of non-competing binding sites. These principles of dual recognition should be applicable to the design of ligands that can bind any given nucleic acid target with nanomolar affinities and with high selectivity. PMID:21073199

  10. Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

    PubMed Central

    Benslimane, A A; Dron, M; Hartmann, C; Rode, A

    1986-01-01

    Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

  11. Transposable element-associated microRNA hairpins produce 21-nt sRNAs integrated into typical microRNA pathways in rice

    PubMed Central

    Ou-Yang, Fangqian; Luo, Qing-Jun; Zhang, Yue; Richardson, Casey R.; Jiang, Yingwen; Rock, Christopher D.

    2013-01-01

    microRNAs (miRNAs) are a class of small RNAs (sRNAs) of ~21 nucleotides (nt) in length processed from foldback hairpins by DICER-LIKE1 (DCL1) or DCL4. They regulate the expression of target mRNAs by base pairing through RNA-Induced Silencing Complex (RISC). In the RISC, ARGONAUTE1 (AGO1) is the key protein that cleaves miRNA targets at position ten of a miRNA:target duplex. The authenticity of many annotated rice miRNA hairpins is under debate because of their homology to repeat sequences. Some of them, like miR1884b, have been removed from the current release of miRBase based on incomplete information. In this study, we investigated the association of transposable element (TE)-derived miRNAs with typical miRNA pathways (DCL1/4- and AGO1-dependent) using publicly available deep sequencing datasets. Seven miRNA hairpins with 13 unique sRNAs were specifically enriched in AGO1 immunoprecipitation samples and relatively reduced in DCL1/4 knockdown genotypes. Interestingly, these species are ~21-nt long, instead of 24-nt as annotated in miRBase and the literature. Their expression profiles meet current criteria for functional annotation of miRNAs. In addition, diagnostic cleavage tags were found in degradome datasets for predicted target mRNAs. Most of these miRNA hairpins share significant homology with miniature inverted-repeat transposable elements (MITEs), one type of abundant DNA transposons in rice. Finally, the root-specific production of a 24 nt miRNA-like sRNA was confirmed by RNA blot for a novel EST that maps to the 3'-UTR of a candidate pseudogene showing extensive sequence homology to miR1884b hairpin. Our data are consistent with the hypothesis that TEs can serve as a driving force for the evolution of some MIRNAs, where co-opting of DICER-LIKE1/4 processing and integration into AGO1 could exapt transcribed TE-associated hairpins into typical miRNA pathways. PMID:23420033

  12. 30. SECOND FLOOR EAST SIDE APARTMENT WEST BEDROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. SECOND FLOOR EAST SIDE APARTMENT WEST BEDROOM INTERIOR SHOWING PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS THROUGH NORTH WALL. ORIGINAL LOUVERED DOORS FRAME CLOSET AT PHOTO LEFT. VIEW TO NORTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  13. Relative stabilities of triple helices composed of combinations of DNA, RNA and 2'-O-methyl-RNA backbones: chimeric circular oligonucleotides as probes.

    PubMed

    Wang, S; Kool, E T

    1995-04-11

    Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.

  14. Recognition of Double Stranded RNA by Guanidine-Modified Peptide Nucleic Acids (GPNA)

    PubMed Central

    Gupta, Pankaj; Muse, Oluwatoyosi; Rozners, Eriks

    2011-01-01

    Double helical RNA has become an attractive target for molecular recognition because many non-coding RNAs play important roles in control of gene expression. Recently, we discovered that short peptide nucleic acids (PNA) bind strongly and sequence selectively to a homopurine tract of double helical RNA via triple helix formation. Herein we tested if the molecular recognition of RNA can be enhanced by α-guanidine modification of PNA. Our study was motivated by the discovery of Ly and co-workers that the guanidine modification greatly enhances the cellular delivery of PNA. Isothermal titration calorimetry showed that the guanidine-modified PNA (GPNA) had reduced affinity and sequence selectivity for triple helical recognition of RNA. The data suggested that in contrast to unmodified PNA, which formed a 1:1 PNA-RNA triple helix, GPNA preferred a 2:1 GPNA-RNA triplex-invasion complex. Nevertheless, promising results were obtained for recognition of biologically relevant double helical RNA. Consistent with enhanced strand invasion ability, GPNA derived from D-arginine recognized the transactivation response element (TAR) of HIV-1 with high affinity and sequence selectivity, presumably via Watson-Crick duplex formation. On the other hand, strong and sequence selective triple helices were formed by unmodified and nucelobase-modified PNAs and the purine rich strand of bacterial A-site. These results suggest that appropriate chemical modifications of PNA may enhance molecular recognition of complex non-coding RNAs. PMID:22146072

  15. Role of RNase MRP in viral RNA degradation and RNA recombination.

    PubMed

    Jaag, Hannah M; Lu, Qiasheng; Schmitt, Mark E; Nagy, Peter D

    2011-01-01

    RNA degradation, together with RNA synthesis, controls the steady-state level of viral RNAs in infected cells. The endoribonucleolytic cleavage of viral RNA is important not only for viral RNA degradation but for RNA recombination as well, due to the participation of some RNA degradation products in the RNA recombination process. To identify host endoribonucleases involved in degradation of Tomato bushy stunt virus (TBSV) in a Saccharomyces cerevisiae model host, we tested eight known endoribonucleases. Here we report that downregulation of SNM1, encoding a component of the RNase MRP, and a temperature-sensitive mutation in the NME1 gene, coding for the RNA component of RNase MRP, lead to reduced production of the endoribonucleolytically cleaved TBSV RNA in yeast. We also show that the highly purified yeast RNase MRP cleaves the TBSV RNA in vitro, resulting in TBSV RNA degradation products similar in size to those observed in yeast cells. Knocking down the NME1 homolog in Nicotiana benthamiana also led to decreased production of the cleaved TBSV RNA, suggesting that in plants, RNase MRP is involved in TBSV RNA degradation. Altogether, this work suggests a role for the host endoribonuclease RNase MRP in viral RNA degradation and recombination.

  16. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'

    PubMed Central

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum (‘Ca. P. prunorum’) detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor ‘Ca. P. prunorum’ infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect ‘Ca. P. prunorum’ and Plum pox virus (PPV) in Prunus. PMID:26742106

  17. Coenzymes, Viruses and the RNA World

    NASA Astrophysics Data System (ADS)

    Reyes-Prieto, F.; Hernández-Morales, R.; Jácome, R.; Becerra, A.; Lazcano, A.

    2017-07-01

    Bioinformatic search for homologous sequences involved in ribonucleotidyl-coenzyme biosynthesis has shown that they are absent in RNA viral genomes, indicating that RNA viruses may not be direct holdovers from an ancient RNA/protein world.

  18. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

    PubMed

    Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

    2017-02-07

    We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

  20. 31. SECOND FLOOR WEST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. SECOND FLOOR WEST SIDE APARTMENT LIVING ROOM INTERIOR SHOWING PAIRED 4-LIGHT OVER 4-LIGHT DOUBLE-HUNG, WOOD-FRAME WINDOWS FLANKING ENTRY DOOR WITH UNUSUAL 8-LIGHT WINDOW. OPEN DOORWAY TO PHOTO LEFT LEADS TO KITCHEN. VIEW TO WEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  1. 4-amino-1H-benzo[g]quinazoline-2-one: a fluorescent analog of cytosine to probe protonation sites in triplex forming oligonucleotides.

    PubMed

    Godde, F; Toulmé, J J; Moreau, S

    2000-08-01

    We developed a new fluorescent analog of cytosine, the 4-amino-1H-benzo[g]quinazoline-2-one, which constitute a probe sensitive to pH. The 2'-O-Me ribonucleoside derivative of this heterocycle was synthesized and exhibited a fluorescence emission centered at 456 nm, characterized by four major excitation maxima (250, 300, 320 and 370 nm) and a fluorescence quantum yield of Phi = 0.62 at pH 7.1. The fluorescence emission maximum shifted from 456 to 492 nm when pH was decreased from 7.1 to 2.1. The pK(a) (4) was close to that of cytosine (4.17). When introduced in triplex forming oligonucleotides this new nucleoside can be used to reveal the protonation state of triplets in triple-stranded structures. Complex formation was detected by a significant quenching of fluorescence emission (approximately 88%) and the N-3 protonation of the quinazoline ring by a shift of the emission maximum from 485 to 465 nm. Using this probe we unambiguously showed that triplex formation of the pyrimidine motif does not require the protonation of all 4-amino-2-one pyrimidine rings.

  2. Experimental and density functional theory (DFT) studies on the interactions of Ru(II) polypyridyl complexes with the RAN triplex poly(U)˙poly(A)*poly(U).

    PubMed

    Zhang, Hong; Liu, Xuewen; He, Xiaojun; Liu, Ying; Tan, Lifeng

    2014-11-01

    There is renewed interest in investigating triple helices because these novel structures have been implicated as a possible means of controlling cellular processes by endogenous or exogenous mechanisms. Due to the Hoogsteen base pairing, triple helices are, however, thermodynamically less stable than the corresponding duplexes. The poor stability of triple helices limits their practical applications under physiological conditions. In contrast to DNA triple helices, small molecules stabilizing RNA triple helices at present are less well established. Furthermore, most of these studies are limited to organic compounds and, to a far lesser extent, to metal complexes. In this work, two Ru(II) complexes, [Ru(bpy)2(btip)](2+) (Ru1) and [Ru(phen)2(btip)](2+) (Ru2), have been synthesized and characterized. The binding properties of the two metal complexes with the triple RNA poly(U)˙poly(A)*poly(U) were studied by various biophysical and density functional theory methods. The main results obtained here suggest that the slight binding difference in Ru1 and Ru2 may be attributed to the planarity of the intercalative ligand and the LUMO level of Ru(II) complexes. This study further advances our knowledge on the triplex RNA-binding by metal complexes, particularly Ru(II) complexes.

  3. MicroRNA–Directed siRNA Biogenesis in Caenorhabditis elegans

    PubMed Central

    Corrêa, Régis L.; Steiner, Florian A.; Berezikov, Eugene; Ketting, René F.

    2010-01-01

    RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi–related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer. PMID:20386745

  4. A magnesium-induced triplex pre-organizes the SAM-II riboswitch

    PubMed Central

    Roy, Susmita; Lammert, Heiko; Dayie, T. Kwaku; Sanbonmatsu, Karissa Y.

    2017-01-01

    Our 13C- and 1H-chemical exchange saturation transfer (CEST) experiments previously revealed a dynamic exchange between partially closed and open conformations of the SAM-II riboswitch in the absence of ligand. Here, all-atom structure-based molecular simulations, with the electrostatic effects of Manning counter-ion condensation and explicit magnesium ions are employed to calculate the folding free energy landscape of the SAM-II riboswitch. We use this analysis to predict that magnesium ions remodel the landscape, shifting the equilibrium away from the extended, partially unfolded state towards a compact, pre-organized conformation that resembles the ligand-bound state. Our CEST and SAXS experiments, at different magnesium ion concentrations, quantitatively confirm our simulation results, demonstrating that magnesium ions induce collapse and pre-organization. Agreement between theory and experiment bolsters microscopic interpretation of our simulations, which shows that triplex formation between helix P2b and loop L1 is highly sensitive to magnesium and plays a key role in pre-organization. Pre-organization of the SAM-II riboswitch allows rapid detection of ligand with high selectivity, which is important for biological function. PMID:28248966

  5. DSAP: deep-sequencing small RNA analysis pipeline.

    PubMed

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  6. Structural and functional homology between the RNAPI subunits A14/A43 and the archaeal RNAP subunits E/F

    PubMed Central

    Meka, Hedije; Daoust, Gregoire; Bourke Arnvig, Kristine; Werner, Finn; Brick, Peter; Onesti, Silvia

    2003-01-01

    In the archaeal RNA polymerase and the eukaryotic RNA polymerase II, two subunits (E/F and RPB4/RPB7, respectively) form a heterodimer that reversibly associates with the core of the enzyme. Recently it has emerged that this heterodimer also has a counterpart in the other eukaryotic RNA polymerases: in particular two subunits of RNA polymerase I (A14 and A43) display genetic and biochemical characteristics that are similar to those of the RPB4 and RPB7 subunits, despite the fact that only A43 shows some sequence homology to RPB7. We demonstrate that the sequence of A14 strongly suggests the presence of a HRDC domain, a motif that is found at the C-terminus of a number of helicases and RNases. The same motif is also seen in the structure of the F subunit, suggesting a structural link between A14 and the RPB4/C17/subunit F family, even in the absence of direct sequence homology. We show that it is possible to co-express and co-purify large amounts of the recombinant A14/A43 heterodimer, indicating a tight and specific interaction between the two subunits. To shed light on the function of the heterodimer, we performed gel mobility shift assays and showed that the A14/A43 heterodimer binds single-stranded RNA in a similar way to the archaeal E/F complex. PMID:12888498

  7. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    PubMed

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  8. 25. SECOND FLOOR EAST SIDE APARTMENT KITCHEN INTERIOR SHOWING GROUP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. SECOND FLOOR EAST SIDE APARTMENT KITCHEN INTERIOR SHOWING GROUP OF THREE 6-LIGHT WOOD-FRAME CASEMENT WINDOWS OVER THE SINK, AND OPEN DOORWAY TO TOP OF EXTERIOR STAIR LANDING AND WALKWAY AT REAR OF HOUSE. WALKWAY IS VISIBLE THROUGH KITCHEN WINDOWS. VIEW TO SOUTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  9. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery.

    PubMed

    Gaj, Thomas; Staahl, Brett T; Rodrigues, Gonçalo M C; Limsirichai, Prajit; Ekman, Freja K; Doudna, Jennifer A; Schaffer, David V

    2017-06-20

    Realizing the full potential of genome editing requires the development of efficient and broadly applicable methods for delivering programmable nucleases and donor templates for homology-directed repair (HDR). The RNA-guided Cas9 endonuclease can be introduced into cells as a purified protein in complex with a single guide RNA (sgRNA). Such ribonucleoproteins (RNPs) can facilitate the high-fidelity introduction of single-base substitutions via HDR following co-delivery with a single-stranded DNA oligonucleotide. However, combining RNPs with transgene-containing donor templates for targeted gene addition has proven challenging, which in turn has limited the capabilities of the RNP-mediated genome editing toolbox. Here, we demonstrate that combining RNP delivery with naturally recombinogenic adeno-associated virus (AAV) donor vectors enables site-specific gene insertion by homology-directed genome editing. Compared to conventional plasmid-based expression vectors and donor templates, we show that combining RNP and AAV donor delivery increases the efficiency of gene addition by up to 12-fold, enabling the creation of lineage reporters that can be used to track the conversion of striatal neurons from human fibroblasts in real time. These results thus illustrate the potential for unifying nuclease protein delivery with AAV donor vectors for homology-directed genome editing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Homology of vanadium oxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasyutinskii, N.A.

    1987-05-01

    The authors examine the homology of vanadium oxide and note that data on the existence of phases and homogeneity limits in the V-O system are very contradictory. A graphical illustration shows the homologous series of vanadium oxides. The predominant part of the discrete formations in the system V-O is characterized by integral stoichiometry and forms six homologous series. It is found that homologous series of vanadium oxides are not only a basis for systematization of such oxides, but also may serve as a means for predicting the composition of new phases, limits of homogeneity, their structure, and properties.

  11. Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

    PubMed Central

    Dang, Que; Hu, Wei-Shau

    2001-01-01

    Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

  12. Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing

    PubMed Central

    Le Thomas, Adrien; Stuwe, Evelyn; Li, Sisi; Marinov, Georgi; Rozhkov, Nikolay; Chen, Yung-Chia Ariel; Luo, Yicheng; Sachidanandam, Ravi; Toth, Katalin Fejes; Patel, Dinshaw; Aravin, Alexei A.

    2014-01-01

    Small noncoding RNAs that associate with Piwi proteins, called piRNAs, serve as guides for repression of diverse transposable elements in germ cells of metazoa. In Drosophila, the genomic regions that give rise to piRNAs, the so-called piRNA clusters, are transcribed to generate long precursor molecules that are processed into mature piRNAs. How genomic regions that give rise to piRNA precursor transcripts are differentiated from the rest of the genome and how these transcripts are specifically channeled into the piRNA biogenesis pathway are not known. We found that transgenerationally inherited piRNAs provide the critical trigger for piRNA production from homologous genomic regions in the next generation by two different mechanisms. First, inherited piRNAs enhance processing of homologous transcripts into mature piRNAs by initiating the ping-pong cycle in the cytoplasm. Second, inherited piRNAs induce installment of the histone 3 Lys9 trimethylation (H3K9me3) mark on genomic piRNA cluster sequences. The heterochromatin protein 1 (HP1) homolog Rhino binds to the H3K9me3 mark through its chromodomain and is enriched over piRNA clusters. Rhino recruits the piRNA biogenesis factor Cutoff to piRNA clusters and is required for efficient transcription of piRNA precursors. We propose that transgenerationally inherited piRNAs act as an epigenetic memory for identification of substrates for piRNA biogenesis on two levels: by inducing a permissive chromatin environment for piRNA precursor synthesis and by enhancing processing of these precursors. PMID:25085419

  13. Freiburg RNA tools: a central online resource for RNA-focused research and teaching.

    PubMed

    Raden, Martin; Ali, Syed M; Alkhnbashi, Omer S; Busch, Anke; Costa, Fabrizio; Davis, Jason A; Eggenhofer, Florian; Gelhausen, Rick; Georg, Jens; Heyne, Steffen; Hiller, Michael; Kundu, Kousik; Kleinkauf, Robert; Lott, Steffen C; Mohamed, Mostafa M; Mattheis, Alexander; Miladi, Milad; Richter, Andreas S; Will, Sebastian; Wolff, Joachim; Wright, Patrick R; Backofen, Rolf

    2018-05-21

    The Freiburg RNA tools webserver is a well established online resource for RNA-focused research. It provides a unified user interface and comprehensive result visualization for efficient command line tools. The webserver includes RNA-RNA interaction prediction (IntaRNA, CopraRNA, metaMIR), sRNA homology search (GLASSgo), sequence-structure alignments (LocARNA, MARNA, CARNA, ExpaRNA), CRISPR repeat classification (CRISPRmap), sequence design (antaRNA, INFO-RNA, SECISDesign), structure aberration evaluation of point mutations (RaSE), and RNA/protein-family models visualization (CMV), and other methods. Open education resources offer interactive visualizations of RNA structure and RNA-RNA interaction prediction as well as basic and advanced sequence alignment algorithms. The services are freely available at http://rna.informatik.uni-freiburg.de.

  14. Characterization of a calcium/calmodulin-dependent protein kinase homolog from maize roots showing light-regulated gravitropism

    NASA Technical Reports Server (NTRS)

    Lu, Y. T.; Hidaka, H.; Feldman, L. J.

    1996-01-01

    Roots of many species respond to gravity (gravitropism) and grow downward only if illuminated. This light-regulated root gravitropism is phytochrome-dependent, mediated by calcium, and inhibited by KN-93, a specific inhibitor of calcium/calmodulin-dependent protein kinase II (CaMK II). A cDNA encoding MCK1, a maize homolog of mammalian CaMK, has been isolated from roots of maize (Zea mays L.). The MCK1 gene is expressed in root tips, the site of perception for both light and gravity. Using the [35S]CaM gel-overlay assay we showed that calmodulin-binding activity of the MCK1 is abolished by 50 microM KN-93, but binding is not affected by 5 microM KN-93, paralleling physiological findings that light-regulated root gravitropism is inhibited by 50 microM KN-93, but not by 5 microM KN-93. KN-93 inhibits light-regulated gravitropism by interrupting transduction of the light signal, not light perception, suggesting that MCK1 may play a role in transducing light. This is the first report suggesting a physiological function for a CaMK homolog in light signal transduction.

  15. Mg(II) and Ni(II) induce aggregation of poly(rA)poly(rU) to either tetra-aggregate or triplex depending on the metal ion concentration.

    PubMed

    Biver, Tarita; Busto, Natalia; García, Begoña; Leal, José M; Menichetti, Luisa; Secco, Fernando; Venturini, Marcella

    2015-10-01

    The ability of magnesium(II) and nickel(II) to induce dramatic conformational changes in the synthetic RNA poly(rA)poly(rU) has been investigated. Kinetic experiments, spectrofluorometric titrations, melting experiments and DSC measurements contribute in shedding light on a complex behaviour where the action of metal ions (Na(+), Mg(2+), Ni(2+)), in synergism with other operators as the intercalating dye coralyne and temperature, all concur in stabilising a peculiar RNA form. Mg(2+) and Ni(2+) (M) bind rapidly and almost quantitatively to the duplex (AU) to give a RNA/metal ion complex (AUM). Then, by the union of two AUM units, an unstable tetra-aggregate (UAUA(M2)*) is formed which, in the presence of a relatively modest excess of metal, evolves to the UAUM triplex by releasing a single AM strand. On the other hand, under conditions of high metal content, the UAUA(M2)* intermediate rearranges to give a more stable tetra-aggregate (UAUA(M2)). As concerns the role of coralyne (D), it is found that D strongly interacts with UAUA(M2). Also, in the presence of coralyne, the ability of divalent ions to promote the transition of AUD into UAUD is enhanced, according to the efficiency sequence [Ni(2+)]≫[Mg(2+)]≫[Na(+)]. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    PubMed

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  17. The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ruiying; Zheng, Han; Preamplume, Gan

    The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of amore » noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.« less

  18. SnowyOwl: accurate prediction of fungal genes by using RNA-Seq and homology information to select among ab initio models

    PubMed Central

    2014-01-01

    Background Locating the protein-coding genes in novel genomes is essential to understanding and exploiting the genomic information but it is still difficult to accurately predict all the genes. The recent availability of detailed information about transcript structure from high-throughput sequencing of messenger RNA (RNA-Seq) delineates many expressed genes and promises increased accuracy in gene prediction. Computational gene predictors have been intensively developed for and tested in well-studied animal genomes. Hundreds of fungal genomes are now or will soon be sequenced. The differences of fungal genomes from animal genomes and the phylogenetic sparsity of well-studied fungi call for gene-prediction tools tailored to them. Results SnowyOwl is a new gene prediction pipeline that uses RNA-Seq data to train and provide hints for the generation of Hidden Markov Model (HMM)-based gene predictions and to evaluate the resulting models. The pipeline has been developed and streamlined by comparing its predictions to manually curated gene models in three fungal genomes and validated against the high-quality gene annotation of Neurospora crassa; SnowyOwl predicted N. crassa genes with 83% sensitivity and 65% specificity. SnowyOwl gains sensitivity by repeatedly running the HMM gene predictor Augustus with varied input parameters and selectivity by choosing the models with best homology to known proteins and best agreement with the RNA-Seq data. Conclusions SnowyOwl efficiently uses RNA-Seq data to produce accurate gene models in both well-studied and novel fungal genomes. The source code for the SnowyOwl pipeline (in Python) and a web interface (in PHP) is freely available from http://sourceforge.net/projects/snowyowl/. PMID:24980894

  19. Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture

    PubMed Central

    Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens

    2013-01-01

    Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants

  20. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  1. Optimization of pyDock for the new CAPRI challenges: Docking of homology-based models, domain-domain assembly and protein-RNA binding.

    PubMed

    Pons, Carles; Solernou, Albert; Perez-Cano, Laura; Grosdidier, Solène; Fernandez-Recio, Juan

    2010-11-15

    We describe here our results in the last CAPRI edition. We have participated in all targets, both as predictors and as scorers, using our pyDock docking methodology. The new challenges (homology-based modeling of the interacting subunits, domain-domain assembling, and protein-RNA interactions) have pushed our computer tools to the limits and have encouraged us to devise new docking approaches. Overall, the results have been quite successful, in line with previous editions, especially considering the high difficulty of some of the targets. Our docking approaches succeeded in five targets as predictors or as scorers (T29, T34, T35, T41, and T42). Moreover, with the inclusion of available information on the residues expected to be involved in the interaction, our protocol would have also succeeded in two additional cases (T32 and T40). In the remaining targets (except T37), results were equally poor for most of the groups. We submitted the best model (in ligand RMSD) among scorers for the unbound-bound target T29, the second best model among scorers for the protein-RNA target T34, and the only correct model among predictors for the domain assembly target T35. In summary, our excellent results for the new proposed challenges in this CAPRI edition showed the limitations and applicability of our approaches and encouraged us to continue developing methodologies for automated biomolecular docking. © 2010 Wiley-Liss, Inc.

  2. U6 small nuclear RNA is transcribed by RNA polymerase III.

    PubMed Central

    Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

    1986-01-01

    A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

  3. Triplex DNA formation-mediated strand displacement reaction for highly sensitive fluorescent detection of melamine.

    PubMed

    Liu, Xiaojuan; Xu, Ningning; Gai, Panpan; Li, Feng

    2018-08-01

    Since melamine is a strong hazard to human health, the development of new methods for highly sensitive detection of melamine is highly desirable. Herein, a novel fluorescent biosensing strategy was designed for sensitive and selective melamine assay based on the recognition ability of abasic (AP) site in triplex towards melamine and signal amplification by Mg 2+ -dependent DNAzyme. In this strategy, the melamine-induced formation of triplex DNA was employed to trigger the strand displacement reaction (SDR). The SDR process converted the specific target recognition into the release and activation of Mg 2+ -dependent DNAzyme, which could catalyze the cleavage of fluorophore/quencher labeled DNA substrate (FQ), resulting in a significantly increased fluorescent signal. Under the optimal conditions, the fluorescent signal has a linear relationship with the logarithm of the melamine concentration in a wide range of 0.005-50 μM. The detection limit was estimated to be 0.9 nM (0.1ppb), which is sufficiently sensitive for practical application. Furthermore, this strategy exhibits high selectivity against other potential interfering substances, and the practical application of this strategy for milk samples reveals that the proposed strategy works well for melamine assay in real samples. Therefore, this strategy presents a new method for the sensitive melamine assay and holds great promise for sensing applications in the environment and the food safety field. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    PubMed

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  5. Trans-Homolog Interactions Facilitating Paramutation in Maize

    PubMed Central

    2015-01-01

    Paramutations represent locus-specific trans-homolog interactions affecting the heritable silencing properties of endogenous alleles. Although examples of paramutation are well studied in maize (Zea mays), the responsible mechanisms remain unclear. Genetic analyses indicate roles for plant-specific DNA-dependent RNA polymerases that generate small RNAs, and current working models hypothesize that these small RNAs direct heritable changes at sequences often acting as transcriptional enhancers. Several studies have defined specific sequences that mediate paramutation behaviors, and recent results identify a diversity of DNA-dependent RNA polymerase complexes operating in maize. Other reports ascribe broader roles for some of these complexes in normal genome function. This review highlights recent research to understand the molecular mechanisms of paramutation and examines evidence relevant to small RNA-based modes of transgenerational epigenetic inheritance. PMID:26149572

  6. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  7. Cucumber Necrosis Virus Recruits Cellular Heat Shock Protein 70 Homologs at Several Stages of Infection

    PubMed Central

    Alam, Syed Benazir

    2015-01-01

    ABSTRACT RNA viruses often depend on host factors for multiplication inside cells due to the constraints of their small genome size and limited coding capacity. One such factor that has been exploited by several plant and animal viruses is heat shock protein 70 (HSP70) family homologs which have been shown to play roles for different viruses in viral RNA replication, viral assembly, disassembly, and cell-to-cell movement. Using next generation sequence analysis, we reveal that several isoforms of Hsp70 and Hsc70 transcripts are induced to very high levels during cucumber necrosis virus (CNV) infection of Nicotiana benthamiana and that HSP70 proteins are also induced by at least 10-fold. We show that HSP70 family protein homologs are co-opted by CNV at several stages of infection. We have found that overexpression of Hsp70 or Hsc70 leads to enhanced CNV genomic RNA, coat protein (CP), and virion accumulation, whereas downregulation leads to a corresponding decrease. Hsc70-2 was found to increase solubility of CNV CP in vitro and to increase accumulation of CNV CP independently of viral RNA replication during coagroinfiltration in N. benthamiana. In addition, virus particle assembly into virus-like particles in CP agroinfiltrated plants was increased in the presence of Hsc70-2. HSP70 was found to increase the targeting of CNV CP to chloroplasts during infection, reinforcing the role of HSP70 in chloroplast targeting of host proteins. Hence, our findings have led to the discovery of a highly induced host factor that has been co-opted to play multiple roles during several stages of the CNV infection cycle. IMPORTANCE Because of the small size of its RNA genome, CNV is dependent on interaction with host cellular components to successfully complete its multiplication cycle. We have found that CNV induces HSP70 family homologs to a high level during infection, possibly as a result of the host response to the high levels of CNV proteins that accumulate during infection

  8. Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

    PubMed Central

    Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

    2012-01-01

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

  9. A Specific Hepatic Transfer RNA for Phosphoserine*

    PubMed Central

    Mäenpää, Pekka H.; Bernfield, Merton R.

    1970-01-01

    Radioactive O-phosphoryl-L-serine was detected after alkaline deacylation of rat and rooster liver [3H]seryl-tRNA acylated in vitro with homologous synthetases. Ribonuclease treatment of this tRNA yielded a compound with the properties of phosphoseryl-adenosine. Benzoylated DEAE-cellulose chromatography of seryl-tRNA yielded four distinct peaks, only one of which contained phosphoserine. A unique fraction for phosphoserine was also found on chromatography of nonacylated tRNA. In ribosome binding studies, this fraction responded very slightly with poly(U,C), but not with any of the known serine trinucleotide codons. Substantial incorporation of [3H]-serine into protein from this tRNA species was observed in an aminoacyl-tRNA dependent polysomal system derived from chick oviducts. No phosphoserine was found in Escherichia coli or yeast seryl-tRNA acylated with homologous enzymes, nor in E. coli seryl-tRNA acylated with liver synthetase. In the absence of tRNA, free phosphoserine was not formed in reaction mixtures, which suggests that phosphoseryl-tRNA arises by phosphorylation of the unique seryl-tRNA species. These results demonstrate a discrete tRNASer species in rat and rooster liver containing phosphoserine and suggest that this tRNA is involved in ribosomal polypeptide synthesis. PMID:4943179

  10. Detecting false positive sequence homology: a machine learning approach.

    PubMed

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M

    2016-02-24

    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  11. Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Steven, Blaire; Hesse, Cedar; Soghigian, John

    The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

  12. Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

    DOE PAGES

    Steven, Blaire; Hesse, Cedar; Soghigian, John; ...

    2017-03-31

    The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

  13. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  14. Structure and Function of the N-Terminal Domain of the Vesicular Stomatitis Virus RNA Polymerase

    PubMed Central

    Qiu, Shihong; Ogino, Minako; Luo, Ming

    2015-01-01

    ABSTRACT Viruses have various mechanisms to duplicate their genomes and produce virus-specific mRNAs. Negative-strand RNA viruses encode their own polymerases to perform each of these processes. For the nonsegmented negative-strand RNA viruses, the polymerase is comprised of the large polymerase subunit (L) and the phosphoprotein (P). L proteins from members of the Rhabdoviridae, Paramyxoviridae, and Filoviridae share sequence and predicted secondary structure homology. Here, we present the structure of the N-terminal domain (conserved region I) of the L protein from a rhabdovirus, vesicular stomatitis virus, at 1.8-Å resolution. The strictly and strongly conserved residues in this domain cluster in a single area of the protein. Serial mutation of these residues shows that many of the amino acids are essential for viral transcription but not for mRNA capping. Three-dimensional alignments show that this domain shares structural homology with polymerases from other viral families, including segmented negative-strand RNA and double-stranded RNA (dsRNA) viruses. IMPORTANCE Negative-strand RNA viruses include a diverse set of viral families that infect animals and plants, causing serious illness and economic impact. The members of this group of viruses share a set of functionally conserved proteins that are essential to their replication cycle. Among this set of proteins is the viral polymerase, which performs a unique set of reactions to produce genome- and subgenome-length RNA transcripts. In this article, we study the polymerase of vesicular stomatitis virus, a member of the rhabdoviruses, which has served in the past as a model to study negative-strand RNA virus replication. We have identified a site in the N-terminal domain of the polymerase that is essential to viral transcription and that shares sequence homology with members of the paramyxoviruses and the filoviruses. Newly identified sites such as that described here could prove to be useful targets in the

  15. An aminoacylation-dependent nuclear tRNA export pathway in yeast.

    PubMed

    Grosshans, H; Hurt, E; Simos, G

    2000-04-01

    Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries.

  16. An aminoacylation-dependent nuclear tRNA export pathway in yeast

    PubMed Central

    Grosshans, Helge; Hurt, Ed; Simos, George

    2000-01-01

    Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries. PMID:10766739

  17. Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

    Treesearch

    Ningxia Du; Paula M. Pijut

    2010-01-01

    An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

  18. Discovery of novel cold-induced CISP genes encoding small RNA-binding proteins related to cold adaptation in barley.

    PubMed

    Ying, Mengchao; Kidou, Shin-Ichiro

    2017-07-01

    To adapt to cold conditions, barley plants rely on specific mechanisms, which have not been fully understood. In this study, we characterized a novel barley cold-induced gene identified using a PCR-based high coverage gene expression profiling method. The identified gene encodes a small protein that we named CISP1 (Cold-induced Small Protein 1). Homology searches of sequence databases revealed that CISP1 homologs (CISP2 and CISP3) exist in barley genome. Further database analyses showed that the CISP1 homologs were widely distributed in cold-tolerant plants such as wheat and rye. Quantitative reverse transcription PCR analyses indicated that the expression of barley CISP genes was markedly increased in roots exposed to cold conditions. In situ hybridization analyses showed that the CISP1 transcripts were localized in the root tip and lateral root primordium. We also demonstrated that the CISP1 protein bound to RNA. Taken together, these findings indicate that CISP1 and its homologs encoding small RNA-binding proteins may serve as RNA chaperones playing a vital role in the cold adaptation of barley root. This is the first report describing the likely close relationship between root-specific genes and the cold adaptation process, as well as the potential function of the identified genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Human homolog of the mouse sperm receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamberlin, M.E.; Dean, J.

    1990-08-01

    The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less

  20. Characterization of a novel eukaryal nick-sealing RNA ligase from Naegleria gruberi

    PubMed Central

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2015-01-01

    The proteome of the amoebo-flagellate protozoan Naegleria gruberi is rich in candidate RNA repair enzymes, including 15 putative RNA ligases, one of which, NgrRnl, is a eukaryal homolog of Deinococcus radiodurans RNA ligase, DraRnl. Here we report that purified recombinant NgrRnl seals nicked 3′-OH/5′-PO4 duplexes in which the 3′-OH strand is RNA. It does so via the “classic” ligase pathway, entailing reaction with ATP to form a covalent NgrRnl–AMP intermediate, transfer of AMP to the nick 5′-PO4, and attack of the RNA 3′-OH on the adenylylated nick to form a 3′–5′ phosphodiester. Unlike members of the four known families of ATP-dependent RNA ligases, NgrRnl lacks a carboxy-terminal appendage to its nucleotidyltransferase domain. Instead, it contains a defining amino-terminal domain that we show is important for 3′-OH/5′-PO4 nick-sealing and ligase adenylylation, but dispensable for phosphodiester synthesis at a preadenylylated nick. We propose that NgrRnl, DraRnl, and their homologs from diverse bacteria, viruses, and unicellular eukarya comprise a new “Rnl5 family” of nick-sealing ligases with a signature domain organization. PMID:25740837

  1. Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

    PubMed Central

    Qureshi, S A; Khoo, B; Baumann, P; Jackson, S P

    1995-01-01

    The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent. Images Fig. 2 Fig. 3 PMID:7597084

  2. High-throughput screening of triplex DNA binders from complicated samples by 96-well pate format in conjunction with peak area-fading UHPLC-Orbitrap MS.

    PubMed

    Yang, Hongmei; Yao, Wenbin; Wang, Yihan; Shi, Lei; Su, Rui; Wan, Debin; Xu, Niusheng; Lian, Wenhui; Chen, Changbao; Liu, Shuying

    2017-02-14

    Conventional strategies for the screening of DNA triplex binders cannot be used for complicated samples, such as ligand libraries created by combinatorial chemistry or from natural product extracts. In the current study, an ultra-high-performance liquid chromatography coupled with an Orbitrap mass spectrometry (UHPLC-Orbitrap-MS)-based approach, which we call peak area-fading (PAF) UHPLC-Orbitrap-MS and was designed for just such a purpose, is reported. The triplex DNA modified 96-well plate and the single stranded oligonucleotide modified 96-well plate (as control) were incubated with ligand libraries, and the unbound ligands were directly determined via UHPLC-ESI-MS. The binders were detected through the decrease (fading) in the peak areas compared to those of the control group. Several factors, such as incubation time, incubation temperature, and buffer, which might affect the binding affinity and reproducibility, were optimized. The potential of the approach was examined using the extracts of Rhizoma Coptidis and Phellodendron chinense Schneid cortexe. The triplex DNA-binding capabilities of the five components (epiberberine, coptisine, jatrorrhizine, berberrubine, and columbamine) were found for the first time, indicating their efficiency for the analysis of complicated samples. In contrast to our previous study, which suffered from a serious drawback of poor reproducibility, this method is more robust and more suitable for high-throughput measurements, opening a new experimental strategy in assessing large libraries of potential drug candidates that work by forming a drug/DNA complex.

  3. [Components and assembly of RNA-induced silencing complex].

    PubMed

    Song, Xue-Mei; Yan, Fei; Du, Li-Xin

    2006-06-01

    Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.

  4. Pleckstrin homology domain-interacting protein (PHIP) as a marker and mediator of melanoma metastasis

    PubMed Central

    De Semir, David; Nosrati, Mehdi; Bezrookove, Vladimir; Dar, Altaf A.; Federman, Scot; Bienvenu, Geraldine; Venna, Suraj; Rangel, Javier; Climent, Joan; Meyer Tamgüney, Tanja M.; Thummala, Suresh; Tong, Schuyler; Leong, Stanley P. L.; Haqq, Chris; Billings, Paul; Miller, James R.; Sagebiel, Richard W.; Debs, Robert; Kashani-Sabet, Mohammed

    2012-01-01

    Although melanomas with mutant v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) can now be effectively targeted, there is no molecular target for most melanomas expressing wild-type BRAF. Here, we show that the activation of Pleckstrin homology domain-interacting protein (PHIP), promotes melanoma metastasis, can be used to classify a subset of primary melanomas, and is a prognostic biomarker for melanoma. Systemic, plasmid-based shRNA targeting of Phip inhibited the metastatic progression of melanoma, whereas stable suppression of Phip in melanoma cell lines suppressed metastatic potential and prolonged the survival of tumor-bearing mice. The human PHIP gene resides on 6q14.1, and although 6q loss has been observed in melanoma, the PHIP locus was preserved in melanoma cell lines and patient samples, and its overexpression was an independent adverse predictor of survival in melanoma patients. In addition, a high proportion of PHIP-overexpressing melanomas harbored increased PHIP copy number. PHIP-overexpressing melanomas include tumors with wild-type BRAF, neuroblastoma RAS viral (v-ras) oncogene homolog, and phosphatase and tensin homolog, demonstrating PHIP activation in triple-negative melanoma. These results describe previously unreported roles for PHIP in predicting and promoting melanoma metastasis, and in the molecular classification of melanoma. PMID:22511720

  5. Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

    PubMed Central

    Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

    2016-01-01

    RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

  6. One-step cross-genogroup multiplex RT-qPCR with an internal control system for the detection of infectious pancreatic necrosis virus (IPNV).

    PubMed

    Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard

    2017-09-01

    Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. An on-chip silicon compact triplexer based on cascaded tilted multimode interference couplers

    NASA Astrophysics Data System (ADS)

    Chen, Jingye; Liu, Penghao; Shi, Yaocheng

    2018-03-01

    An on-chip triplexer based on cascaded tilted multimode interference (MMI) couplers has been demonstrated to separate the 1310 nm wavelength band into one port and 1490 nm and 1550 nm wavelength bands into the other two ports respectively. By utilizing the dispersive self-imaging and pseudo self-imaging, the device length is not critically determined by the common multiple of beat lengths for different wavelengths. The total device size can be reduced to ∼450 μm, which is half of the butterfly structure reported. The whole device, fabricated with only one fully-etching step, is characterized with <-15 dB low crosstalk (CT) and ∼1 dB insertion loss (IL).

  8. The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

    PubMed

    Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

    1993-05-03

    The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

  9. CodingQuarry: highly accurate hidden Markov model gene prediction in fungal genomes using RNA-seq transcripts.

    PubMed

    Testa, Alison C; Hane, James K; Ellwood, Simon R; Oliver, Richard P

    2015-03-11

    The impact of gene annotation quality on functional and comparative genomics makes gene prediction an important process, particularly in non-model species, including many fungi. Sets of homologous protein sequences are rarely complete with respect to the fungal species of interest and are often small or unreliable, especially when closely related species have not been sequenced or annotated in detail. In these cases, protein homology-based evidence fails to correctly annotate many genes, or significantly improve ab initio predictions. Generalised hidden Markov models (GHMM) have proven to be invaluable tools in gene annotation and, recently, RNA-seq has emerged as a cost-effective means to significantly improve the quality of automated gene annotation. As these methods do not require sets of homologous proteins, improving gene prediction from these resources is of benefit to fungal researchers. While many pipelines now incorporate RNA-seq data in training GHMMs, there has been relatively little investigation into additionally combining RNA-seq data at the point of prediction, and room for improvement in this area motivates this study. CodingQuarry is a highly accurate, self-training GHMM fungal gene predictor designed to work with assembled, aligned RNA-seq transcripts. RNA-seq data informs annotations both during gene-model training and in prediction. Our approach capitalises on the high quality of fungal transcript assemblies by incorporating predictions made directly from transcript sequences. Correct predictions are made despite transcript assembly problems, including those caused by overlap between the transcripts of adjacent gene loci. Stringent benchmarking against high-confidence annotation subsets showed CodingQuarry predicted 91.3% of Schizosaccharomyces pombe genes and 90.4% of Saccharomyces cerevisiae genes perfectly. These results are 4-5% better than those of AUGUSTUS, the next best performing RNA-seq driven gene predictor tested. Comparisons against

  10. dsRNA-protein interactions studied by molecular dynamics techniques. Unravelling dsRNA recognition by DCL1.

    PubMed

    Drusin, Salvador I; Suarez, Irina P; Gauto, Diego F; Rasia, Rodolfo M; Moreno, Diego M

    2016-04-15

    Double stranded RNA (dsRNA) participates in several biological processes, where RNA molecules acquire secondary structure inside the cell through base complementarity. The double stranded RNA binding domain (dsRBD) is one of the main protein folds that is able to recognize and bind to dsRNA regions. The N-terminal dsRBD of DCL1 in Arabidopsis thaliana (DCL1-1), in contrast to other studied dsRBDs, lacks a stable structure, behaving as an intrinsically disordered protein. DCL1-1 does however recognize dsRNA by acquiring a canonical fold in the presence of its substrate. Here we present a detailed modeling and molecular dynamics study of dsRNA recognition by DCL1-1. We found that DCL1-1 forms stable complexes with different RNAs and we characterized the residues involved in binding. Although the domain shows a binding loop substantially shorter than other homologs, it can still interact with the dsRNA and results in bending of the dsRNA A-type helix. Furthermore, we found that R8, a non-conserved residue located in the first dsRNA binding region, recognizes preferentially mismatched base pairs. We discuss our findings in the context of the function of DCL1-1 within the microRNA processing complex. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Phylogenetic distribution of plant snoRNA families.

    PubMed

    Patra Bhattacharya, Deblina; Canzler, Sebastian; Kehr, Stephanie; Hertel, Jana; Grosse, Ivo; Stadler, Peter F

    2016-11-24

    Small nucleolar RNAs (snoRNAs) are one of the most ancient families amongst non-protein-coding RNAs. They are ubiquitous in Archaea and Eukarya but absent in bacteria. Their main function is to target chemical modifications of ribosomal RNAs. They fall into two classes, box C/D snoRNAs and box H/ACA snoRNAs, which are clearly distinguished by conserved sequence motifs and the type of chemical modification that they govern. Similarly to microRNAs, snoRNAs appear in distinct families of homologs that affect homologous targets. In animals, snoRNAs and their evolution have been studied in much detail. In plants, however, their evolution has attracted comparably little attention. In order to chart the phylogenetic distribution of individual snoRNA families in plants, we applied a sophisticated approach for identifying homologs of known plant snoRNAs across the plant kingdom. In response to the relatively fast evolution of snoRNAs, information on conserved sequence boxes, target sequences, and secondary structure is combined to identify additional snoRNAs. We identified 296 families of snoRNAs in 24 species and traced their evolution throughout the plant kingdom. Many of the plant snoRNA families comprise paralogs. We also found that targets are well-conserved for most snoRNA families. The sequence conservation of snoRNAs is sufficient to establish homologies between phyla. The degree of this conservation tapers off, however, between land plants and algae. Plant snoRNAs are frequently organized in highly conserved spatial clusters. As a resource for further investigations we provide carefully curated and annotated alignments for each snoRNA family under investigation.

  12. Evolving the Concept of Homology

    ERIC Educational Resources Information Center

    Naples, Virginia L.; Miller, Jon S.

    2009-01-01

    Understanding homology is fundamental to learning about evolution. The present study shows an exercise that can be varied in complexity, for which students compile research illustrating the fate of homologous fish skull elements, and assemble a mural to serve as a learning aid. The skull of the most primitive living Actinopterygian (bony fish),…

  13. The homologous recombination machinery modulates the formation of RNA–DNA hybrids and associated chromosome instability

    PubMed Central

    Wahba, Lamia; Gore, Steven K; Koshland, Douglas

    2013-01-01

    Genome instability in yeast and mammals is caused by RNA–DNA hybrids that form as a result of defects in different aspects of RNA biogenesis. We report that in yeast mutants defective for transcription repression and RNA degradation, hybrid formation requires Rad51p and Rad52p. These proteins normally promote DNA–DNA strand exchange in homologous recombination. We suggest they also directly promote the DNA–RNA strand exchange necessary for hybrid formation since we observed accumulation of Rad51p at a model hybrid-forming locus. Furthermore, we provide evidence that Rad51p mediates hybridization of transcripts to homologous chromosomal loci distinct from their site of synthesis. This hybrid formation in trans amplifies the genome-destabilizing potential of RNA and broadens the exclusive co-transcriptional models that pervade the field. The deleterious hybrid-forming activity of Rad51p is counteracted by Srs2p, a known Rad51p antagonist. Thus Srs2p serves as a novel anti-hybrid mechanism in vivo. DOI: http://dx.doi.org/10.7554/eLife.00505.001 PMID:23795288

  14. Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae.

    PubMed

    Bao, Zehua; Xiao, Han; Liang, Jing; Zhang, Lu; Xiong, Xiong; Sun, Ning; Si, Tong; Zhao, Huimin

    2015-05-15

    One-step multiple gene disruption in the model organism Saccharomyces cerevisiae is a highly useful tool for both basic and applied research, but it remains a challenge. Here, we report a rapid, efficient, and potentially scalable strategy based on the type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated proteins (Cas) system to generate multiple gene disruptions simultaneously in S. cerevisiae. A 100 bp dsDNA mutagenizing homologous recombination donor is inserted between two direct repeats for each target gene in a CRISPR array consisting of multiple donor and guide sequence pairs. An ultrahigh copy number plasmid carrying iCas9, a variant of wild-type Cas9, trans-encoded RNA (tracrRNA), and a homology-integrated crRNA cassette is designed to greatly increase the gene disruption efficiency. As proof of concept, three genes, CAN1, ADE2, and LYP1, were simultaneously disrupted in 4 days with an efficiency ranging from 27 to 87%. Another three genes involved in an artificial hydrocortisone biosynthetic pathway, ATF2, GCY1, and YPR1, were simultaneously disrupted in 6 days with 100% efficiency. This homology-integrated CRISPR (HI-CRISPR) strategy represents a powerful tool for creating yeast strains with multiple gene knockouts.

  15. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  16. In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

    PubMed Central

    Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.

    2016-01-01

    The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

  17. Plant polycistronic precursors containing non-homologous microRNAs target transcripts encoding functionally related proteins

    PubMed Central

    2009-01-01

    Background MicroRNAs (miRNAs) are endogenous single-stranded small RNAs that regulate the expression of specific mRNAs involved in diverse biological processes. In plants, miRNAs are generally encoded as a single species in independent transcriptional units, referred to as MIRNA genes, in contrast to animal miRNAs, which are frequently clustered. Results We performed a comparative genomic analysis in three model plants (rice, poplar and Arabidopsis) and characterized miRNA clusters containing two to eight miRNA species. These clusters usually encode miRNAs of the same family and certain share a common evolutionary origin across monocot and dicot lineages. In addition, we identified miRNA clusters harboring miRNAs with unrelated sequences that are usually not evolutionarily conserved. Strikingly, non-homologous miRNAs from the same cluster were predicted to target transcripts encoding related proteins. At least four Arabidopsis non-homologous clusters were expressed as single transcriptional units. Overexpression of one of these polycistronic precursors, producing Ath-miR859 and Ath-miR774, led to the DCL1-dependent accumulation of both miRNAs and down-regulation of their different mRNA targets encoding F-box proteins. Conclusions In addition to polycistronic precursors carrying related miRNAs, plants also contain precursors allowing coordinated expression of non-homologous miRNAs to co-regulate functionally related target transcripts. This mechanism paves the way for using polycistronic MIRNA precursors as a new molecular tool for plant biologists to simultaneously control the expression of different genes. PMID:19951405

  18. Therapeutic opportunities of small interfering RNA.

    PubMed

    Goyal, Bhoomika R; Patel, Mayur M; Soni, Mithil K; Bhadada, Shraddha V

    2009-08-01

    Formation of small interfering RNA (siRNA) occurs in two steps involving binding of the RNA nucleases to a large double-stranded RNA (dsRNA) and its cleavage into fragments called siRNA. In the second step, these siRNAs join a multinuclease complex, which degrades the homologous single-stranded mRNAs. The delivery of siRNA involves viral- and non-viral-mediated delivery systems; the approaches for chemical modifications have also been developed. It has various therapeutic applications for disorders like cardiovascular diseases, central nervous system (CNS) disorders, cancer, human immunodeficiency virus (HIV), hepatic disorders, etc. The present review gives an overview of the applications of siRNA and their potential for treating many hitherto untreatable diseases.

  19. Structural insights into RNA processing by the human RISC-loading complex.

    PubMed

    Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

    2009-11-01

    Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

  20. Spt6 Association with RNA Polymerase II Directs mRNA Turnover During Transcription.

    PubMed

    Dronamraju, Raghuvar; Hepperla, Austin J; Shibata, Yoichiro; Adams, Alexander T; Magnuson, Terry; Davis, Ian J; Strahl, Brian D

    2018-06-21

    Spt6 is an essential histone chaperone that mediates nucleosome reassembly during gene transcription. Spt6 also associates with RNA polymerase II (RNAPII) via a tandem Src2 homology domain. However, the significance of Spt6-RNAPII interaction is not well understood. Here, we show that Spt6 recruitment to genes and the nucleosome reassembly functions of Spt6 can still occur in the absence of its association with RNAPII. Surprisingly, we found that Spt6-RNAPII association is required for efficient recruitment of the Ccr4-Not de-adenylation complex to transcribed genes for essential degradation of a range of mRNAs, including mRNAs required for cell-cycle progression. These findings reveal an unexpected control mechanism for mRNA turnover during transcription facilitated by a histone chaperone. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.

    PubMed

    Parsch, U; Engels, J W

    2000-07-03

    The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.

  2. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    PubMed

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  3. Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA

    PubMed Central

    Seligmann, Hervé; Raoult, Didier

    2018-01-01

    We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833

  4. Fivebranes and 3-manifold homology

    NASA Astrophysics Data System (ADS)

    Gukov, Sergei; Putrov, Pavel; Vafa, Cumrun

    2017-07-01

    Motivated by physical constructions of homological knot invariants, we study their analogs for closed 3-manifolds. We show that fivebrane compactifications provide a universal description of various old and new homological invariants of 3-manifolds. In terms of 3d/3d correspondence, such invariants are given by the Q-cohomology of the Hilbert space of partially topologically twisted 3d N=2 theory T[ M 3] on a Riemann surface with defects. We demonstrate this by concrete and explicit calculations in the case of monopole/Heegaard Floer homology and a 3-manifold analog of Khovanov-Rozansky link homology. The latter gives a categorification of Chern-Simons partition function. Some of the new key elements include the explicit form of the S-transform and a novel connection between categorification and a previously mysterious role of Eichler integrals in Chern-Simons theory.

  5. Mutations in the N Terminus of the Brome Mosaic Virus Polymerase Affect Genetic RNA-RNA Recombination

    PubMed Central

    Figlerowicz, M.; Nagy, P. D.; Tang, N.; Kao, C. C.; Bujarski, J. J.

    1998-01-01

    Previously, we have observed that mutations in proteins 1a and 2a, the two virally encoded components of the brome mosaic virus (BMV) replicase, can affect the frequency of recombination and the locations of RNA recombination sites (P. D. Nagy, A. Dzianott, P. Ahlquist, and J. J. Bujarski, J. Virol. 69:2547–2556, 1995; M. Figlerowicz, P. D. Nagy, and J. J. Bujarski, Proc. Natl. Acad. Sci. USA 94:2073–2078, 1997). Also, it was found before that the N-terminal domain of 2a, the putative RNA polymerase protein, participates in the interactions between 1a and 2a (C. C. Kao, R. Quadt, R. P. Hershberger, and P. Ahlquist, J. Virol. 66:6322–6329, 1992; E. O’Reilly, J. Paul, and C. C. Kao, J. Virol. 71:7526–7532, 1997). In this work, we examine how mutations within the N terminus of 2a influence RNA recombination in BMV. Because of the likely electrostatic character of 1a-2a interactions, five 2a mutants, MF1 to MF5, were generated by replacing clusters of acidic amino acids with their neutral counterparts. MF2 and MF5 retained nearly wild-type levels of 1a-2a interaction and were infectious in Chenopodium quinoa. However, compared to that in wild-type virus, the frequency of nonhomologous recombination in both MF2 and MF5 was markedly decreased. Only in MF2 was the frequency of homologous recombination reduced and the occurrence of imprecise homologous recombination increased. In MF5 there was also a 3′ shift in the positions of homologous crossovers. The observed effects of MF2 and MF5 reveal that the 2a N-terminal domain participates in different ways in homologous and in nonhomologous BMV RNA recombination. This work maps specific locations within the N terminus involved in 1a-2a interaction and in recombination and further suggests that the mechanisms of the two types of crossovers in BMV are different. PMID:9765466

  6. Mutations in the N terminus of the brome mosaic virus polymerase affect genetic RNA-RNA recombination.

    PubMed

    Figlerowicz, M; Nagy, P D; Tang, N; Kao, C C; Bujarski, J J

    1998-11-01

    Previously, we have observed that mutations in proteins 1a and 2a, the two virally encoded components of the brome mosaic virus (BMV) replicase, can affect the frequency of recombination and the locations of RNA recombination sites (P. D. Nagy, A. Dzianott, P. Ahlquist, and J. J. Bujarski, J. Virol. 69:2547-2556, 1995; M. Figlerowicz, P. D. Nagy, and J. J. Bujarski, Proc. Natl. Acad. Sci. USA 94:2073-2078, 1997). Also, it was found before that the N-terminal domain of 2a, the putative RNA polymerase protein, participates in the interactions between 1a and 2a (C. C. Kao, R. Quadt, R. P. Hershberger, and P. Ahlquist, J. Virol. 66:6322-6329, 1992; E. O'Reilly, J. Paul, and C. C. Kao, J. Virol. 71:7526-7532, 1997). In this work, we examine how mutations within the N terminus of 2a influence RNA recombination in BMV. Because of the likely electrostatic character of 1a-2a interactions, five 2a mutants, MF1 to MF5, were generated by replacing clusters of acidic amino acids with their neutral counterparts. MF2 and MF5 retained nearly wild-type levels of 1a-2a interaction and were infectious in Chenopodium quinoa. However, compared to that in wild-type virus, the frequency of nonhomologous recombination in both MF2 and MF5 was markedly decreased. Only in MF2 was the frequency of homologous recombination reduced and the occurrence of imprecise homologous recombination increased. In MF5 there was also a 3' shift in the positions of homologous crossovers. The observed effects of MF2 and MF5 reveal that the 2a N-terminal domain participates in different ways in homologous and in nonhomologous BMV RNA recombination. This work maps specific locations within the N terminus involved in 1a-2a interaction and in recombination and further suggests that the mechanisms of the two types of crossovers in BMV are different.

  7. Cytorhabdovirus phosphoprotein shows RNA silencing suppressor activity in plants, but not in insect cells.

    PubMed

    Mann, Krin S; Johnson, Karyn N; Dietzgen, Ralf G

    2015-02-01

    RNA silencing in plants and insects provides an antiviral defense and as a countermeasure most viruses encode RNA silencing suppressors (RSS). For the family Rhabdoviridae, no detailed functional RSS studies have been reported in plant hosts and insect vectors. In agroinfiltrated Nicotiana benthamiana leaves we show for the first time for a cytorhabdovirus, lettuce necrotic yellows virus (LNYV), that one of the nucleocapsid core proteins, phosphoprotein (P) has relatively weak local RSS activity and delays systemic silencing of a GFP reporter. Analysis of GFP small RNAs indicated that the P protein did not prevent siRNA accumulation. To explore RSS activity in insects, we used a Flock House virus replicon system in Drosophila S2 cells. In contrast to the plant host, LNYV P protein did not exhibit RSS activity in the insect cells. Taken together our results suggest that P protein may target plant-specific components of RNA silencing post siRNA biogenesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Assembly of Multi-tRNA Synthetase Complex via Heterotetrameric Glutathione Transferase-homology Domains.

    PubMed

    Cho, Ha Yeon; Maeng, Seo Jin; Cho, Hyo Je; Choi, Yoon Seo; Chung, Jeong Min; Lee, Sangmin; Kim, Hoi Kyoung; Kim, Jong Hyun; Eom, Chi-Yong; Kim, Yeon-Gil; Guo, Min; Jung, Hyun Suk; Kang, Beom Sik; Kim, Sunghoon

    2015-12-04

    Many multicomponent protein complexes mediating diverse cellular processes are assembled through scaffolds with specialized protein interaction modules. The multi-tRNA synthetase complex (MSC), consisting of nine different aminoacyl-tRNA synthetases and three non-enzymatic factors (AIMP1-3), serves as a hub for many signaling pathways in addition to its role in protein synthesis. However, the assembly process and structural arrangement of the MSC components are not well understood. Here we show the heterotetrameric complex structure of the glutathione transferase (GST) domains shared among the four MSC components, methionyl-tRNA synthetase (MRS), glutaminyl-prolyl-tRNA synthetase (EPRS), AIMP2 and AIMP3. The MRS-AIMP3 and EPRS-AIMP2 using interface 1 are bridged via interface 2 of AIMP3 and EPRS to generate a unique linear complex of MRS-AIMP3:EPRS-AIMP2 at the molar ratio of (1:1):(1:1). Interestingly, the affinity at interface 2 of AIMP3:EPRS can be varied depending on the occupancy of interface 1, suggesting the dynamic nature of the linear GST tetramer. The four components are optimally arranged for maximal accommodation of additional domains and proteins. These characteristics suggest the GST tetramer as a unique and dynamic structural platform from which the MSC components are assembled. Considering prevalence of the GST-like domains, this tetramer can also provide a tool for the communication of the MSC with other GST-containing cellular factors. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Fivebranes and 3-manifold homology

    DOE PAGES

    Gukov, Sergei; Putrov, Pavel; Vafa, Cumrun

    2017-07-14

    Motivated by physical constructions of homological knot invariants, we study their analogs for closed 3-manifolds. We show that vebrane compacti cations provide a universal description of various old and new homological invariants of 3-manifolds. In terms of 3d/3d correspondence, such invariants are given by the Q-cohomology of the Hilbert space of partially topologically twisted 3d N = 2 theory T[M 3] on a Riemann surface with defects. We demonstrate this by concrete and explicit calculations in the case of monopole/Heegaard Floer homology and a 3-manifold analog of Khovanov-Rozansky link homology. The latter gives a categori cation of Chern-Simons partition function.more » Finally, some of the new key elements include the explicit form of the S-transform and a novel connection between categori cation and a previously mysterious role of Eichler integrals in Chern-Simons theory.« less

  10. Analysis by RNA-RNA hybridization assay of intertypic rotaviruses suggests that gene reassortment occurs in vivo.

    PubMed Central

    Midthun, K; Valdesuso, J; Hoshino, Y; Flores, J; Kapikian, A Z; Chanock, R M

    1987-01-01

    Antigenic characterization of human and animal rotaviruses by the plaque reduction neutralization assay has shown the existence of naturally occurring intertypes. Antiserum to M37, a rotavirus strain isolated from an asymptomatic neonate, neutralizes both Wa and ST3 strains, which are classified as serotype 1 and serotype 4 human rotaviruses, respectively. Likewise, antiserum to SB-1A, a porcine rotavirus, neutralizes rotavirus strains belonging to serotype 4 or 5. Plaque reduction neutralization assay of reassortant rotaviruses produced in vitro from these intertypes indicates that these viruses share one antigenically related outer capsid protein, VP3, with one serotype and another antigenically related outer capsid protein, VP7, with the other serotype. Thus, M37 is related to ST3 on the basis of its fourth-gene product, VP3, and to Wa on the basis of its ninth-gene product, VP7, whereas SB-1A is related to Gottfried (serotype 4 porcine rotavirus) via VP7 and to OSU (serotype 5 porcine rotavirus) via VP3. RNA-RNA hybridization studies revealed a high degree of homology between the VP3 or VP7 gene segments responsible for shared serotype specificity. Thus, the fourth gene segments of M37 and ST3 were highly homologous, while M37 and Wa had homology between their ninth gene segments. SB-1A and Gottfried were homologous not only with respect to the ninth gene but had complete homology in all other genes except the fourth gene. The fourth gene of SB-1A was highly homologous with the fourth gene of OSU. These observations suggested that SB-1A was a naturally occurring reassortant between Gottfried-like and OSU-like porcine rotavirus strains. Our observations also suggested that intertypes may result from genetic reassortment in nature. Images PMID:3029162

  11. Arabidopsis homologs of retinoblastoma-associated protein 46/48 associate with a histone deacetylase to act redundantly in chromatin silencing.

    PubMed

    Gu, Xiaofeng; Jiang, Danhua; Yang, Wannian; Jacob, Yannick; Michaels, Scott D; He, Yuehui

    2011-11-01

    RNA molecules such as small-interfering RNAs (siRNAs) and antisense RNAs (asRNAs) trigger chromatin silencing of target loci. In the model plant Arabidopsis, RNA-triggered chromatin silencing involves repressive histone modifications such as histone deacetylation, histone H3 lysine-9 methylation, and H3 lysine-27 monomethylation. Here, we report that two Arabidopsis homologs of the human histone-binding proteins Retinoblastoma-Associated Protein 46/48 (RbAp46/48), known as MSI4 (or FVE) and MSI5, function in partial redundancy in chromatin silencing of various loci targeted by siRNAs or asRNAs. We show that MSI5 acts in partial redundancy with FVE to silence FLOWERING LOCUS C (FLC), which is a crucial floral repressor subject to asRNA-mediated silencing, FLC homologs, and other loci including transposable and repetitive elements which are targets of siRNA-directed DNA Methylation (RdDM). Both FVE and MSI5 associate with HISTONE DEACETYLASE 6 (HDA6) to form complexes and directly interact with the target loci, leading to histone deacetylation and transcriptional silencing. In addition, these two genes function in de novo CHH (H = A, T, or C) methylation and maintenance of symmetric cytosine methylation (mainly CHG methylation) at endogenous RdDM target loci, and they are also required for establishment of cytosine methylation in the previously unmethylated sequences directed by the RdDM pathway. This reveals an important functional divergence of the plant RbAp46/48 relatives from animal counterparts.

  12. Structure of Pseudoknot PK26 Shows 3D Domain Swapping in an RNA

    NASA Technical Reports Server (NTRS)

    Lietzke, Susan E; Barnes, Cindy L.

    1998-01-01

    3D domain swapping provides a facile pathway for the evolution of oligomeric proteins and allosteric mechanisms and a means for using monomer-oligomer equilibria to regulate biological activity. The term "3D domain swapping" describes the exchange of identical domains between two protein monomers to create an oligomer. 3D domain swapping has, so far, only been recognized in proteins. In this study, the structure of the pseudoknot PK26 is reported and it is a clear example of 3D domain swapping in RNA. PK26 was chosen for study because RNA pseudoknots are required structures in several biological processes and they arise frequently in in vitro selection experiments directed against protein targets. PK26 specifically inhibits HIV-1 reverse transcriptase with nanomolar affinity. We have now determined the 3.1 A resolution crystal structure of PK26 and find that it forms a 3D domain swapped dimer. PK26 shows extensive base pairing between and within strands. Formation of the dimer requires the linker region between the pseudoknot folds to adopt a unique conformation that allows a base within a helical stem to skip one base in the stacking register. Rearrangement of the linker would permit a monomeric pseudoknot to form. This structure shows how RNA can use 3D domain swapping to build large scale oligomers like the putative hexamer in the packaging RNA of bacteriophage Phi29.

  13. Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

    PubMed Central

    2010-01-01

    Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657

  14. The mRNA level of MLH1 in peripheral blood is a biomarker for the diagnosis of hereditary nonpolyposis colorectal cancer.

    PubMed

    Yu, Hong; Li, Hui; Cui, Yongan; Xiao, Wei; Dai, Guihong; Huang, Junxing; Wang, Chaofu

    2016-01-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is caused by functional defects in mismatch repair (MMR) genes, including mutL homolog 1 (MLH1) and mutS homolog 2 (MSH2). This study aimed to assess whether the mRNA expression of MLH1 in peripheral blood could be used as a biomarkers for the diagnosis of HNPCC. The mRNA level of MLH1 was determined in 19 HNPCC families (46 members) using real-time quantitative polymerase chain reaction (qPCR). The mRNA levels of MLH1 in HNPCC were significantly lower than controls (P < 0.001). Receiver operating characteristic (ROC) curve showed a high diagnostic value of the mRNA level of MLH1 for the diagnosis of HNPCC with the area under curve of 0.858. At an optimal cut-off value (0.511), the mRNA level of MLH1 had a sensitivity of 81.3% and a specificity of 86.7% for distinguishing HNPCC from controls. In conclusion, the mRNA expression of MLH1 in peripheral blood may serve as a biomarker for the diagnosis of HNPCC.

  15. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans

    PubMed Central

    Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei

    2016-01-01

    RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA. PMID:27306325

  16. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.

    PubMed

    Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei

    2016-06-16

    RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA.

  17. A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors

    PubMed Central

    Qin, Xin-Cheng; Shi, Mang; Tian, Jun-Hua; Lin, Xian-Dan; Gao, Dong-Ya; He, Jin-Rong; Wang, Jian-Bo; Li, Ci-Xiu; Kang, Yan-Jun; Yu, Bin; Zhou, Dun-Jin; Xu, Jianguo; Plyusnin, Alexander; Holmes, Edward C.; Zhang, Yong-Zhen

    2014-01-01

    Although segmented and unsegmented RNA viruses are commonplace, the evolutionary links between these two very different forms of genome organization are unclear. We report the discovery and characterization of a tick-borne virus—Jingmen tick virus (JMTV)—that reveals an unexpected connection between segmented and unsegmented RNA viruses. The JMTV genome comprises four segments, two of which are related to the nonstructural protein genes of the genus Flavivirus (family Flaviviridae), whereas the remaining segments are unique to this virus, have no known homologs, and contain a number of features indicative of structural protein genes. Remarkably, homology searching revealed that sequences related to JMTV were present in the cDNA library from Toxocara canis (dog roundworm; Nematoda), and that shared strong sequence and structural resemblances. Epidemiological studies showed that JMTV is distributed in tick populations across China, especially Rhipicephalus and Haemaphysalis spp., and experiences frequent host-switching and genomic reassortment. To our knowledge, JMTV is the first example of a segmented RNA virus with a genome derived in part from unsegmented viral ancestors. PMID:24753611

  18. Human XPA and RPA DNA repair proteins participate in specific recognition of triplex-induced helical distortions

    NASA Astrophysics Data System (ADS)

    Vasquez, Karen M.; Christensen, Jesper; Li, Lei; Finch, Rick A.; Glazer, Peter M.

    2002-04-01

    Nucleotide excision repair (NER) plays a central role in maintaining genomic integrity by detecting and repairing a wide variety of DNA lesions. Xeroderma pigmentosum complementation group A protein (XPA) is an essential component of the repair machinery, and it is thought to be involved in the initial step as a DNA damage recognition and/or confirmation factor. Human replication protein A (RPA) and XPA have been reported to interact to form a DNA damage recognition complex with greater specificity for damaged DNA than XPA alone. The mechanism by which these two proteins recognize such a wide array of structures resulting from different types of DNA damage is not known. One possibility is that they recognize a common feature of the lesions, such as distortions of the helical backbone. We have tested this idea by determining whether human XPA and RPA proteins can recognize the helical distortions induced by a DNA triple helix, a noncanonical DNA structure that has been shown to induce DNA repair, mutagenesis, and recombination. We measured binding of XPA and RPA, together or separately, to substrates containing triplexes with three, two, or no strands covalently linked by psoralen conjugation and photoaddition. We found that RPA alone recognizes all covalent triplex structures, but also forms multivalent nonspecific DNA aggregates at higher concentrations. XPA by itself does not recognize the substrates, but it binds them in the presence of RPA. Addition of XPA decreases the nonspecific DNA aggregate formation. These results support the hypothesis that the NER machinery is targeted to helical distortions and demonstrate that RPA can recognize damaged DNA even without XPA.

  19. ABCE1 Is a Highly Conserved RNA Silencing Suppressor

    PubMed Central

    Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

    2015-01-01

    ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

  20. Self-Amplifying mRNA Vaccines Expressing Multiple Conserved Influenza Antigens Confer Protection against Homologous and Heterosubtypic Viral Challenge

    PubMed Central

    Magini, Diletta; Giovani, Cinzia; Mangiavacchi, Simona; Maccari, Silvia; Cecchi, Raffaella; Ulmer, Jeffrey B.; De Gregorio, Ennio; Geall, Andrew J.; Brazzoli, Michela; Bertholet, Sylvie

    2016-01-01

    Current hemagglutinin (HA)-based seasonal influenza vaccines induce vaccine strain-specific neutralizing antibodies that usually fail to provide protection against mismatched circulating viruses. Inclusion in the vaccine of highly conserved internal proteins such as the nucleoprotein (NP) and the matrix protein 1 (M1) was shown previously to increase vaccine efficacy by eliciting cross-reactive T-cells. However, appropriate delivery systems are required for efficient priming of T-cell responses. In this study, we demonstrated that administration of novel self-amplifying mRNA (SAM®) vectors expressing influenza NP (SAM(NP)), M1 (SAM(M1)), and NP and M1 (SAM(M1-NP)) delivered with lipid nanoparticles (LNP) induced robust polyfunctional CD4 T helper 1 cells, while NP-containing SAM also induced cytotoxic CD8 T cells. Robust expansions of central memory (TCM) and effector memory (TEM) CD4 and CD8 T cells were also measured. An enhanced recruitment of NP-specific cytotoxic CD8 T cells was observed in the lungs of SAM(NP)-immunized mice after influenza infection that paralleled with reduced lung viral titers and pathology, and increased survival after homologous and heterosubtypic influenza challenge. Finally, we demonstrated for the first time that the co-administration of RNA (SAM(M1-NP)) and protein (monovalent inactivated influenza vaccine (MIIV)) was feasible, induced simultaneously NP-, M1- and HA-specific T cells and HA-specific neutralizing antibodies, and enhanced MIIV efficacy against a heterologous challenge. In conclusion, systemic administration of SAM vectors expressing conserved internal influenza antigens induced protective immune responses in mice, supporting the SAM® platform as another promising strategy for the development of broad-spectrum universal influenza vaccines. PMID:27525409

  1. Hormonal regulation of Drosophila microRNA let-7 and miR-125 that target innate immunity.

    PubMed

    Garbuzov, Alina; Tatar, Marc

    2010-01-01

    The steroid 20-hydroxy-ecdysone (20-HE) and the sesquiterpenoid Juvenile Hormone (JH) coordinate insect life stage transitions. 20-HE exerts these effects by the sequential induction of response genes. In the nematode Caenorhabditis elegans hormones also play a role in such transitions, but notably, microRNA such as let-7 and lin-4 have likewise been found to help order developmental steps. Little is known about the corresponding function of homologous microRNA in Drosophila melanogaster, and the way microRNA might be regulated by 20-HE in the fly is ambiguous. Here we used Drosophila S2 cells to analyze the effects of 20-HE on D. melanogaster microRNA let-7 and miR-125, the homolog of lin-4. The induction by 20-HE of let-7 and miR-125 in S2 cells is inhibited by RNAi knockdown of the ecdysone receptor and, as previously shown, by knockdown of its cofactor broad-complex C. To help resolve the currently ambiguous role of 20-HE in the control of microRNA, we show that nanomolar concentrations of 20-HE primes cells to subsequently express microRNA when exposed to micromolar levels of 20-HE. We then explore the role microRNA plays in the established relationship between 20-HE and the induction of innate immunity. We show that the 3'UTR of the antimicrobial peptide diptericin has a let-7 binding site and that let-7 represses translation from this site. We conclude that 20-HE facilitates the initial expression of innate immunity while it simultaneously induces negative regulation via microRNA control of antimicrobial peptide translation.

  2. Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

    NASA Technical Reports Server (NTRS)

    Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

    1993-01-01

    An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

  3. Co-chaperone Hsp70/Hsp90-organizing protein (Hop) is required for transposon silencing and Piwi-interacting RNA (piRNA) biogenesis.

    PubMed

    Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K

    2017-04-14

    Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Transforming growth factor β-regulated microRNA-29a promotes angiogenesis through targeting the phosphatase and tensin homolog in endothelium.

    PubMed

    Wang, Jun; Wang, Youliang; Wang, Yu; Ma, Ying; Lan, Yu; Yang, Xiao

    2013-04-12

    The TGF-β pathway plays an important role in physiological and pathological angiogenesis. MicroRNAs (miRNAs) are a class of 18- to 25-nucleotide, small, noncoding RNAs that function by regulating gene expression. A number of miRNAs have been found to be regulated by the TGF-β pathway. However, the role of endothelial miRNAs in the TGF-β-mediated control of angiogenesis is still largely unknown. Here we investigated the regulation of endothelial microRNA-29a (miR-29a) by TGF-β signaling and the potential role of miR-29a in angiogenesis. MiR-29a was directly up-regulated by TGF-β/Smad4 signaling in human and mice endothelial cells. In a chick chorioallantoic membrane assay, miR-29a overexpression promoted the formation of new blood vessels, and miR-29a suppression completely blocked TGF-β1-stimulated angiogenesis. Consistently, miR-29a overexpression increased tube formation and migration in endothelial cultures. Mechanistically, miR-29a directly targeted the phosphatase and tensin homolog (PTEN) in endothelial cells, leading to activation of the AKT pathway. PTEN knockdown recapitulated the role of miR-29a in endothelial migration, whereas AKT inhibition completely attenuated the stimulating role of miR-29a in angiogenesis. Taken together, these results reveal a crucial role of a TGF-β-regulated miRNA in promoting angiogenesis by targeting PTEN to stimulate AKT activity.

  5. Potential in vivo roles of nucleic acid triple-helices

    PubMed Central

    Buske, Fabian A

    2011-01-01

    The ability of double-stranded DNA to form a triple-helical structure by hydrogen bonding with a third strand is well established, but the biological functions of these structures remain largely unknown. There is considerable albeit circumstantial evidence for the existence of nucleic triplexes in vivo and their potential participation in a variety of biological processes including chromatin organization, DNA repair, transcriptional regulation and RNA processing has been investigated in a number of studies to date. There is also a range of possible mechanisms to regulate triplex formation through differential expression of triplex-forming RNAs, alteration of chromatin accessibility, sequence unwinding and nucleotide modifications. With the advent of next generation sequencing technology combined with targeted approaches to isolate triplexes, it is now possible to survey triplex formation with respect to their genomic context, abundance and dynamical changes during differentiation and development, which may open up new vistas in understanding genome biology and gene regulation. PMID:21525785

  6. Thermodynamic properties distinguish human mitochondrial aspartyl-tRNA synthetase from bacterial homolog with same 3D architecture.

    PubMed

    Neuenfeldt, Anne; Lorber, Bernard; Ennifar, Eric; Gaudry, Agnès; Sauter, Claude; Sissler, Marie; Florentz, Catherine

    2013-02-01

    In the mammalian mitochondrial translation apparatus, the proteins and their partner RNAs are coded by two genomes. The proteins are nuclear-encoded and resemble their homologs, whereas the RNAs coming from the rapidly evolving mitochondrial genome have lost critical structural information. This raises the question of molecular adaptation of these proteins to their peculiar partner RNAs. The crystal structure of the homodimeric bacterial-type human mitochondrial aspartyl-tRNA synthetase (DRS) confirmed a 3D architecture close to that of Escherichia coli DRS. However, the mitochondrial enzyme distinguishes by an enlarged catalytic groove, a more electropositive surface potential and an alternate interaction network at the subunits interface. It also presented a thermal stability reduced by as much as 12°C. Isothermal titration calorimetry analyses revealed that the affinity of the mitochondrial enzyme for cognate and non-cognate tRNAs is one order of magnitude higher, but with different enthalpy and entropy contributions. They further indicated that both enzymes bind an adenylate analog by a cooperative allosteric mechanism with different thermodynamic contributions. The larger flexibility of the mitochondrial synthetase with respect to the bacterial enzyme, in combination with a preserved architecture, may represent an evolutionary process, allowing nuclear-encoded proteins to cooperate with degenerated organelle RNAs.

  7. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  8. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    PubMed

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  9. Improved Force Fields for Peptide Nucleic Acids with Optimized Backbone Torsion Parameters.

    PubMed

    Jasiński, Maciej; Feig, Michael; Trylska, Joanna

    2018-06-06

    Peptide nucleic acids are promising nucleic acid analogs for antisense therapies as they can form stable duplex and triplex structures with DNA and RNA. Computational studies of PNA-containing duplexes and triplexes are an important component for guiding their design, yet existing force fields have not been well validated and parametrized with modern computational capabilities. We present updated CHARMM and Amber force fields for PNA that greatly improve the stability of simulated PNA-containing duplexes and triplexes in comparison with experimental structures and allow such systems to be studied on microsecond time scales. The force field modifications focus on reparametrized PNA backbone torsion angles to match high-level quantum mechanics reference energies for a model compound. The microsecond simulations of PNA-PNA, PNA-DNA, PNA-RNA, and PNA-DNA-PNA complexes also allowed a comprehensive analysis of hydration and ion interactions with such systems.

  10. Modeling RNA interference in mammalian cells

    PubMed Central

    2011-01-01

    Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of

  11. Double triplex real-time PCR assay for simultaneous detection of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hominis, and Staphylococcus haemolyticus and determination of their methicillin resistance directly from positive blood culture bottles.

    PubMed

    Kilic, Abdullah; Basustaoglu, A Celal

    2011-12-01

    We developed and validated here a double triplex real-time PCR assay to simultaneously detect and identify Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus haemolyticus and their methicillin resistance in a single reaction directly from Gram-positive cocci-in-clusters (GPCs)-positive blood culture bottles. From August 15, 2009 through February 15, 2010, 238 GPC-positive samples were collected and identified by conventional methods as 11 methicillin-resistant S. aureus (MRSA), 28 methicillin-susceptible S. aureus (MSSA), 176 MR coagulase-negative staphylococci (MRCoNS), 21 MSCoNS and two Enterococcus faecalis. The double triplex real-time PCR assay was targeted and detected tuf, nuc and mecA genes in the first tube and atlE, gap and mvaA genes in the second tube which could be run simultaneously. The detection limit of the assay was found at 10(3) CFU/ml for the atleE gene, 10(4) CFU/ml for the mva gene and 10(5) CFU/ml for gap, nuc, mecA and tuf genes based on seeding experiments. All Staphylococcus species except two S. epidermidis were correctly identified by the assay. The double triplex real-time PCR assay quickly and accurately detects S. aureus, S. epidermidis, S. hominis and S. haemolyticus and their methicillin resistance in a single reaction directly from positive blood culture bottles within 83 min. Copyright © 2011 Institut Pasteur. All rights reserved.

  12. Homologous upregulation of sst2 somatostatin receptor expression in the rat arcuate nucleus in vivo.

    PubMed

    Tannenbaum, G S; Turner, J; Guo, F; Videau, C; Epelbaum, J; Beaudet, A

    2001-07-01

    In vitro studies using various cell systems have provided conflicting results regarding homologous regulation of somatostatin (SRIH) receptors, and information on whether SRIH regulates the expression of its own receptors in vivo is lacking. In the present study we examined, by in situ hybridization, the effects of pretreatment with the sst2-preferring SRIH analog, octreotide, in vivo, on mRNA levels of two SRIH receptor subtypes, sst1 and sst2, in rat brain and pituitary. (125)I-[DTrp(8)]-SRIH binding was also measured in these regions. Three hours after the iv injection of 50 microg octreotide to conscious adult male rats, there was a 46% increase (p < 0.01) in the labeling density of sst2 mRNA-expressing cells in the hypothalamic arcuate nucleus compared to normal saline-pretreated controls, but not in any of the other brain regions examined. Computer-assisted image analysis revealed that 3 h exposure to octreotide significantly (p < 0.01) augmented both the number and labeling density of sst2 mRNA-expressing cells in the arcuate nucleus, compared to those in saline-treated controls. By contrast, within the anterior pituitary gland, in vivo exposure to octreotide did not affect the expression of sst2 mRNA. No changes in sst1 mRNA-expressing cells were observed after octreotide treatment in any of the regions measured, indicating that the observed effects were homologous, i.e. specific of the receptor subtype stimulated. Octreotide pretreatment was also without effect on the density of (125)I-[DTrp(8)]-SRIH binding in either the arcuate nucleus or pituitary. These results demonstrate, for the first time, that SRIH preexposure in vivo upregulates the expression of a subtype of its own receptors, sst2, within the central nervous system. They further suggest that pretreatment with SRIH in vivo does not cause sst2 receptor desensitization in arcuate nucleus and pituitary. Such homologous regulatory mechanisms may play an important role in the neuroendocrine control

  13. Drosophila Spag is the homolog of RNA polymerase II-associated protein 3 (RPAP3) and recruits the heat shock proteins 70 and 90 (Hsp70 and Hsp90) during the assembly of cellular machineries.

    PubMed

    Benbahouche, Nour El Houda; Iliopoulos, Ioannis; Török, István; Marhold, Joachim; Henri, Julien; Kajava, Andrey V; Farkaš, Robert; Kempf, Tore; Schnölzer, Martina; Meyer, Philippe; Kiss, István; Bertrand, Edouard; Mechler, Bernard M; Pradet-Balade, Bérengère

    2014-02-28

    The R2TP is a recently identified Hsp90 co-chaperone, composed of four proteins as follows: Pih1D1, RPAP3, and the AAA(+)-ATPases RUVBL1 and RUVBL2. In mammals, the R2TP is involved in the biogenesis of cellular machineries such as RNA polymerases, small nucleolar ribonucleoparticles and phosphatidylinositol 3-kinase-related kinases. Here, we characterize the spaghetti (spag) gene of Drosophila, the homolog of human RPAP3. This gene plays an essential function during Drosophila development. We show that Spag protein binds Drosophila orthologs of R2TP components and Hsp90, like its yeast counterpart. Unexpectedly, Spag also interacts and stimulates the chaperone activity of Hsp70. Using null mutants and flies with inducible RNAi, we show that spaghetti is necessary for the stabilization of snoRNP core proteins and target of rapamycin activity and likely the assembly of RNA polymerase II. This work highlights the strong conservation of both the HSP90/R2TP system and its clients and further shows that Spag, unlike Saccharomyces cerevisiae Tah1, performs essential functions in metazoans. Interaction of Spag with both Hsp70 and Hsp90 suggests a model whereby R2TP would accompany clients from Hsp70 to Hsp90 to facilitate their assembly into macromolecular complexes.

  14. Identification of a transformer homolog in the acorn worm, Saccoglossus kowalevskii, and analysis of its activity in insect cells.

    PubMed

    Suzuki, Masataka G; Tochigi, Mayuko; Sakaguchi, Honami; Aoki, Fugaku; Miyamoto, Norio

    2015-06-01

    The transformer (tra) gene is an intermediate component of the sex determination hierarchy in many insect species. The homolog of tra is also found in two branchiopod crustacean species but is not known outside arthropods. We have isolated a tra homolog in the acorn worm, Saccoglossus kowalevskii, which is a hemichordate belonging to the deuterostome superphylum. The full-length complementary DNA (cDNA) of the S. kowalevskii tra homolog (Sktra) has a 3786-bp open reading frame that encodes a 1261-amino acid sequence including a TRA-CAM domain and an arginine/serine (RS)-rich domain, both of which are characteristic of TRA orthologs. Reverse transcription PCR (RT-PCR) analyses demonstrated that Sktra showed no differences in expression patterns between testes and ovaries, but its expression level was approximately 7.5-fold higher in the testes than in the ovaries. TRA, together with the protein product of the transformer-2 (tra-2) gene, assembles on doublesex (dsx) pre-messenger RNA (mRNA) via the cis-regulatory element, enhancing female-specific splicing of dsx in Drosophila. To understand functional conservation of the SkTRA protein as a dsx-splicing activator, we investigated whether SkTRA is capable of inducing female-specific splicing of the Drosophila dsx. Ectopic expression of Sktra cDNA in insect cultured cells did not induce the female-specific splicing of dsx. On the other hand, forced expression of Sktra-2 (a tra-2 homolog of S. kowalevskii) was able to induce the female-specific dsx splicing. These results demonstrate that the function as a dsx-splicing activator is not conserved in SkTRA even though SkTRA-2 is capable of functionally replacing the Drosophila TRA-2. We have also found a tra homolog in an echinoderm genome. This study provides the first evidence that that tra is conserved not only in arthropods but also in basal species of deuterostoms.

  15. The Evolution of MicroRNA Pathway Protein Components in Cnidaria

    PubMed Central

    Moran, Yehu; Praher, Daniela; Fredman, David; Technau, Ulrich

    2013-01-01

    In the last decade, it became evident that posttranscriptional regulation of gene expression by microRNAs is a central biological process in both plants and animals. Yet, our knowledge about microRNA biogenesis and utilization in animals stems mostly from the study of Bilateria. In this study, we identified genes encoding the protein components of different parts of the microRNA pathway in Cnidaria, the likely sister phylum of Bilateria. These genes originated from three cnidarian lineages (sea anemones, stony corals, and hydras) that are separated by at least 500 My from one another. We studied the expression and phylogeny of the cnidarian homologs of Drosha and Pasha (DGCR8) that compose the microprocessor, the RNAse III enzyme Dicer and its partners, the HEN1 methyltransferase, the Argonaute protein effectors, as well as members of the GW182 protein family. We further reveal that whereas the bilaterian dicer partners Loquacious/TRBP and PACT are absent from Cnidaria, this phylum contains homologs of the double-stranded RNA-binding protein HYL1, the Dicer partner found in plants. We also identified HYL1 homologs in a sponge and a ctenophore. This finding raises questions regarding the independent evolution of the microRNA pathway in plants and animals, and together with the other results shed new light on the evolution of an important regulatory pathway. PMID:24030553

  16. The evolution of microRNA pathway protein components in Cnidaria.

    PubMed

    Moran, Yehu; Praher, Daniela; Fredman, David; Technau, Ulrich

    2013-12-01

    In the last decade, it became evident that posttranscriptional regulation of gene expression by microRNAs is a central biological process in both plants and animals. Yet, our knowledge about microRNA biogenesis and utilization in animals stems mostly from the study of Bilateria. In this study, we identified genes encoding the protein components of different parts of the microRNA pathway in Cnidaria, the likely sister phylum of Bilateria. These genes originated from three cnidarian lineages (sea anemones, stony corals, and hydras) that are separated by at least 500 My from one another. We studied the expression and phylogeny of the cnidarian homologs of Drosha and Pasha (DGCR8) that compose the microprocessor, the RNAse III enzyme Dicer and its partners, the HEN1 methyltransferase, the Argonaute protein effectors, as well as members of the GW182 protein family. We further reveal that whereas the bilaterian dicer partners Loquacious/TRBP and PACT are absent from Cnidaria, this phylum contains homologs of the double-stranded RNA-binding protein HYL1, the Dicer partner found in plants. We also identified HYL1 homologs in a sponge and a ctenophore. This finding raises questions regarding the independent evolution of the microRNA pathway in plants and animals, and together with the other results shed new light on the evolution of an important regulatory pathway.

  17. T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

    PubMed

    Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

    1994-04-12

    The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

  18. Next-Generation Sequence Analysis of the Genome of RFHVMn, the Macaque Homolog of Kaposi's Sarcoma (KS)-Associated Herpesvirus, from a KS-Like Tumor of a Pig-Tailed Macaque

    PubMed Central

    Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung

    2013-01-01

    The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218

  19. Computational analysis of conserved RNA secondary structure in transcriptomes and genomes.

    PubMed

    Eddy, Sean R

    2014-01-01

    Transcriptomics experiments and computational predictions both enable systematic discovery of new functional RNAs. However, many putative noncoding transcripts arise instead from artifacts and biological noise, and current computational prediction methods have high false positive rates. I discuss prospects for improving computational methods for analyzing and identifying functional RNAs, with a focus on detecting signatures of conserved RNA secondary structure. An interesting new front is the application of chemical and enzymatic experiments that probe RNA structure on a transcriptome-wide scale. I review several proposed approaches for incorporating structure probing data into the computational prediction of RNA secondary structure. Using probabilistic inference formalisms, I show how all these approaches can be unified in a well-principled framework, which in turn allows RNA probing data to be easily integrated into a wide range of analyses that depend on RNA secondary structure inference. Such analyses include homology search and genome-wide detection of new structural RNAs.

  20. Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae).

    PubMed

    Liu, Zhixiong; Zhang, Dandan; Liu, Di; Li, Fenglan; Lu, Hai

    2013-02-01

    KEY MESSAGE : Two transcript isoforms of AGAMOUS homologs, from single and double flower Prunus lannesiana, respectively, showed different functions. The Arabidopsis floral homeotic C function gene AGAMOUS (AG) confers stamen and carpel identity. Loss of AG function results in homeotic conversions of stamens into petals and formation of double flowers. In order to present a molecular dissection of a double-flower cultivar in Prunus lannesiana (Rosaceae), we isolated and identified a single-copy gene, AG homolog from two genetically cognate P. lannesiana bearing single and double flowers, respectively. Sequence analysis revealed that the AG homolog, prseag-1, from double flowers showed a 170-bp exon skipping as compared to PrseAG (Prunus serrulata AGAMOUS) from the single flowers. Genomic DNA sequence revealed that abnormal splicing resulted in mutant prseag-1 protein with the C-terminal AG motifs I and II deletions. In addition, protein sequence alignment and phylogenetic analyses revealed that the PrseAG was grouped into the euAG lineage. A semi-quantitative PCR analysis showed that the expression of PrseAG was restricted to reproductive organs of stamens and carpels in single flowers of P. lannesiana 'speciosa', while the prseag-1 mRNA was highly transcribed throughout the petals, stamens, and carpels in double flowers from 'Albo-rosea'. The transgenic Arabidopsis containing 35S::PrseAG displayed extremely early flowering, bigger stamens and carpels and homeotic conversion of petals into staminoid organs, but ectopic expression of prseag-1 could not mimic the phenotypic ectopic expression of PrseAG in Arabidopsis. In general, this study provides evidences to show that double flower 'Albo-rosea' is a putative C functional ag mutant in P. lannesiana.

  1. Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

    2012-10-01

    This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

  2. Design and construction of a VHGT-attached WDM-type triplex transceiver module using polymer PLC hybrid integration technology

    NASA Astrophysics Data System (ADS)

    Jerábek, Vitezslav; Hüttel, Ivan; Prajzler, Václav; Busek, K.; Seliger, P.

    2008-11-01

    We report about design and construction of the bidirectional transceiver TRx module for subscriber part of the passive optical network PON for a fiber to the home FTTH topology. The TRx module consists of a epoxy novolak resin polymer planar lightwave circuit (PLC) hybrid integration technology with volume holographic grating triplex filter VHGT, surface-illuminated photodetectors and spot-size converted Fabry-Pérot laser diode in SMD package. The hybrid PLC has composed from a two parts-polymer optical waveguide including VHGT filter section and a optoelectronic microwave section. The both parts are placed on the composite substrate.

  3. Free energy minimization to predict RNA secondary structures and computational RNA design.

    PubMed

    Churkin, Alexander; Weinbrand, Lina; Barash, Danny

    2015-01-01

    Determining the RNA secondary structure from sequence data by computational predictions is a long-standing problem. Its solution has been approached in two distinctive ways. If a multiple sequence alignment of a collection of homologous sequences is available, the comparative method uses phylogeny to determine conserved base pairs that are more likely to form as a result of billions of years of evolution than by chance. In the case of single sequences, recursive algorithms that compute free energy structures by using empirically derived energy parameters have been developed. This latter approach of RNA folding prediction by energy minimization is widely used to predict RNA secondary structure from sequence. For a significant number of RNA molecules, the secondary structure of the RNA molecule is indicative of its function and its computational prediction by minimizing its free energy is important for its functional analysis. A general method for free energy minimization to predict RNA secondary structures is dynamic programming, although other optimization methods have been developed as well along with empirically derived energy parameters. In this chapter, we introduce and illustrate by examples the approach of free energy minimization to predict RNA secondary structures.

  4. Cryo-EM near-atomic structure of a dsRNA fungal virus shows ancient structural motifs preserved in the dsRNA viral lineage

    PubMed Central

    Luque, Daniel; Gómez-Blanco, Josué; Garriga, Damiá; Brilot, Axel F.; González, José M.; Havens, Wendy M.; Carrascosa, José L.; Trus, Benes L.; Verdaguer, Nuria; Ghabrial, Said A.; Castón, José R.

    2014-01-01

    Viruses evolve so rapidly that sequence-based comparison is not suitable for detecting relatedness among distant viruses. Structure-based comparisons suggest that evolution led to a small number of viral classes or lineages that can be grouped by capsid protein (CP) folds. Here, we report that the CP structure of the fungal dsRNA Penicillium chrysogenum virus (PcV) shows the progenitor fold of the dsRNA virus lineage and suggests a relationship between lineages. Cryo-EM structure at near-atomic resolution showed that the 982-aa PcV CP is formed by a repeated α-helical core, indicative of gene duplication despite lack of sequence similarity between the two halves. Superimposition of secondary structure elements identified a single “hotspot” at which variation is introduced by insertion of peptide segments. Structural comparison of PcV and other distantly related dsRNA viruses detected preferential insertion sites at which the complexity of the conserved α-helical core, made up of ancestral structural motifs that have acted as a skeleton, might have increased, leading to evolution of the highly varied current structures. Analyses of structural motifs only apparent after systematic structural comparisons indicated that the hallmark fold preserved in the dsRNA virus lineage shares a long (spinal) α-helix tangential to the capsid surface with the head-tailed phage and herpesvirus viral lineage. PMID:24821769

  5. Alternatively Spliced Homologous Exons Have Ancient Origins and Are Highly Expressed at the Protein Level

    PubMed Central

    Abascal, Federico; Ezkurdia, Iakes; Rodriguez-Rivas, Juan; Rodriguez, Jose Manuel; del Pozo, Angela; Vázquez, Jesús; Valencia, Alfonso; Tress, Michael L.

    2015-01-01

    Alternative splicing of messenger RNA can generate a wide variety of mature RNA transcripts, and these transcripts may produce protein isoforms with diverse cellular functions. While there is much supporting evidence for the expression of alternative transcripts, the same is not true for the alternatively spliced protein products. Large-scale mass spectroscopy experiments have identified evidence of alternative splicing at the protein level, but with conflicting results. Here we carried out a rigorous analysis of the peptide evidence from eight large-scale proteomics experiments to assess the scale of alternative splicing that is detectable by high-resolution mass spectroscopy. We find fewer splice events than would be expected: we identified peptides for almost 64% of human protein coding genes, but detected just 282 splice events. This data suggests that most genes have a single dominant isoform at the protein level. Many of the alternative isoforms that we could identify were only subtly different from the main splice isoform. Very few of the splice events identified at the protein level disrupted functional domains, in stark contrast to the two thirds of splice events annotated in the human genome that would lead to the loss or damage of functional domains. The most striking result was that more than 20% of the splice isoforms we identified were generated by substituting one homologous exon for another. This is significantly more than would be expected from the frequency of these events in the genome. These homologous exon substitution events were remarkably conserved—all the homologous exons we identified evolved over 460 million years ago—and eight of the fourteen tissue-specific splice isoforms we identified were generated from homologous exons. The combination of proteomics evidence, ancient origin and tissue-specific splicing indicates that isoforms generated from homologous exons may have important cellular roles. PMID:26061177

  6. RNA-Puzzles Round II: assessment of RNA structure prediction programs applied to three large RNA structures

    PubMed Central

    Miao, Zhichao; Adamiak, Ryszard W.; Blanchet, Marc-Frédérick; Boniecki, Michal; Bujnicki, Janusz M.; Chen, Shi-Jie; Cheng, Clarence; Chojnowski, Grzegorz; Chou, Fang-Chieh; Cordero, Pablo; Cruz, José Almeida; Ferré-D'Amaré, Adrian R.; Das, Rhiju; Ding, Feng; Dokholyan, Nikolay V.; Dunin-Horkawicz, Stanislaw; Kladwang, Wipapat; Krokhotin, Andrey; Lach, Grzegorz; Magnus, Marcin; Major, François; Mann, Thomas H.; Masquida, Benoît; Matelska, Dorota; Meyer, Mélanie; Peselis, Alla; Popenda, Mariusz; Purzycka, Katarzyna J.; Serganov, Alexander; Stasiewicz, Juliusz; Szachniuk, Marta; Tandon, Arpit; Tian, Siqi; Wang, Jian; Xiao, Yi; Xu, Xiaojun; Zhang, Jinwei; Zhao, Peinan; Zok, Tomasz; Westhof, Eric

    2015-01-01

    This paper is a report of a second round of RNA-Puzzles, a collective and blind experiment in three-dimensional (3D) RNA structure prediction. Three puzzles, Puzzles 5, 6, and 10, represented sequences of three large RNA structures with limited or no homology with previously solved RNA molecules. A lariat-capping ribozyme, as well as riboswitches complexed to adenosylcobalamin and tRNA, were predicted by seven groups using RNAComposer, ModeRNA/SimRNA, Vfold, Rosetta, DMD, MC-Fold, 3dRNA, and AMBER refinement. Some groups derived models using data from state-of-the-art chemical-mapping methods (SHAPE, DMS, CMCT, and mutate-and-map). The comparisons between the predictions and the three subsequently released crystallographic structures, solved at diffraction resolutions of 2.5–3.2 Å, were carried out automatically using various sets of quality indicators. The comparisons clearly demonstrate the state of present-day de novo prediction abilities as well as the limitations of these state-of-the-art methods. All of the best prediction models have similar topologies to the native structures, which suggests that computational methods for RNA structure prediction can already provide useful structural information for biological problems. However, the prediction accuracy for non-Watson–Crick interactions, key to proper folding of RNAs, is low and some predicted models had high Clash Scores. These two difficulties point to some of the continuing bottlenecks in RNA structure prediction. All submitted models are available for download at http://ahsoka.u-strasbg.fr/rnapuzzles/. PMID:25883046

  7. Molecular characterization and in situ mRNA localization of the neural recognition molecule J1-160/180: a modular structure similar to tenascin

    PubMed Central

    1993-01-01

    The oligodendrocyte-derived extracellular matrix glycoprotein J1- 160/180 is a recognition molecule expressed exclusively in the central nervous system. J1-160/180 has been shown to be adhesive for astrocytes and repellent towards neurons and growth cones. We report here the complete nucleotide sequence of J1-160/180 in the rat. The predicted amino acid sequence showed a structural architecture very similar to tenascin: a cysteine-rich amino terminal region is followed by 4.5 epidermal growth factor-like repeats, 9 fibronectin type III homologous repeats and a domain homologous to fibrinogen. Sequence comparison analysis revealed highest homology of rat J1-160/180 to mouse tenascin and chicken restrictin with a similarity of 66% and 85%, respectively. The J1-160/180-coding mRNA is derived from a single copy gene. Using the polymerase chain reaction we could show that two J1-160/180 isoforms are generated by alternative splicing of the sixth fibronectin type III homologous repeat. Localization of J1-160/180 mRNA by in situ hybridization in the cerebellum, hippocampus and olfactory bulb confirmed the expression of J1-160/180 by oligodendrocytes with a peak of transcription at 7-14 d after birth, indicating a functional role during myelination. In addition, J1-160/180-specific RNA was found in a small subset of neurons in all three structures of the CNS analyzed. These neurons continue to express J1-160/180 in the adult. PMID:7679676

  8. Long-read sequencing of nascent RNA reveals coupling among RNA processing events.

    PubMed

    Herzel, Lydia; Straube, Korinna; Neugebauer, Karla M

    2018-06-14

    Pre-mRNA splicing is accomplished by the spliceosome, a megadalton complex that assembles de novo on each intron. Because spliceosome assembly and catalysis occur cotranscriptionally, we hypothesized that introns are removed in the order of their transcription in genomes dominated by constitutive splicing. Remarkably little is known about splicing order and the regulatory potential of nascent transcript remodeling by splicing, due to the limitations of existing methods that focus on analysis of mature splicing products (mRNAs) rather than substrates and intermediates. Here, we overcome this obstacle through long-read RNA sequencing of nascent, multi-intron transcripts in the fission yeast Schizosaccharomyces pombe Most multi-intron transcripts were fully spliced, consistent with rapid cotranscriptional splicing. However, an unexpectedly high proportion of transcripts were either fully spliced or fully unspliced, suggesting that splicing of any given intron is dependent on the splicing status of other introns in the transcript. Supporting this, mild inhibition of splicing by a temperature-sensitive mutation in prp2 , the homolog of vertebrate U2AF65, increased the frequency of fully unspliced transcripts. Importantly, fully unspliced transcripts displayed transcriptional read-through at the polyA site and were degraded cotranscriptionally by the nuclear exosome. Finally, we show that cellular mRNA levels were reduced in genes with a high number of unspliced nascent transcripts during caffeine treatment, showing regulatory significance of cotranscriptional splicing. Therefore, overall splicing of individual nascent transcripts, 3' end formation, and mRNA half-life depend on the splicing status of neighboring introns, suggesting crosstalk among spliceosomes and the polyA cleavage machinery during transcription elongation. © 2018 Herzel et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species

    PubMed Central

    Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.

    1970-01-01

    The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826

  10. Gentle Masking of Low-Complexity Sequences Improves Homology Search

    PubMed Central

    Frith, Martin C.

    2011-01-01

    Detection of sequences that are homologous, i.e. descended from a common ancestor, is a fundamental task in computational biology. This task is confounded by low-complexity tracts (such as atatatatatat), which arise frequently and independently, causing strong similarities that are not homologies. There has been much research on identifying low-complexity tracts, but little research on how to treat them during homology search. We propose to find homologies by aligning sequences with “gentle” masking of low-complexity tracts. Gentle masking means that the match score involving a masked letter is , where is the unmasked score. Gentle masking slightly but noticeably improves the sensitivity of homology search (compared to “harsh” masking), without harming specificity. We show examples in three useful homology search problems: detection of NUMTs (nuclear copies of mitochondrial DNA), recruitment of metagenomic DNA reads to reference genomes, and pseudogene detection. Gentle masking is currently the best way to treat low-complexity tracts during homology search. PMID:22205972

  11. Extracellular and circulating redox- and metalloregulated eRNA and eRNP: copper ion-structured RNA cytokines (angiotropin ribokines) and bioaptamer targets imparting RNA chaperone and novel biofunctions to S100-EF-hand and disease-associated proteins.

    PubMed

    Wissler, Josef H

    2004-06-01

    Bioassays for cellular differentiation and tissue morphogenesis were used to design methods for isolation of bioactive redox- and metalloregulated nucleic acids and copper ion complexes with proteins from extracellular, circulating, wound, and supernatant fluids of cultured cells. In extracellular biospheres, diversities of nucleic acids were found to be secreted by cells upon activation. They may reflect nucleic acid biolibraries with molecular imprints of cellular history. After removal of protein components, eRNA prototypes exuded by activated cells were sequenced. They are small, endogenous, highly modified and edited, redox- and metalloregulated 5'-end phosphorylated extracellular eRNA (approximately 2-200 bases) with cellular, enzymic, and bioaptamer functions. Fenton-type OH* radical redox reactions may form modified nucleotides in RNA as wobbles eRNA per se, or as copper ion-complex with protein (e.g., S100A12-EF-hand protein, angiotropin-related protein, calgranulin-C, hippocampal neurite differentiation factor) are shown to be bioactive in vivo and in vitro as cytokines (ribokines) and as nonmitogenic angiomorphogens for endothelial cell differentiation in the formation of organoid supracellular capillary structures. As bioaptamers, copper ion-structured eRNA imparts novel biofunctions to proteins that they do not have on their own. The origin of extracellular RNA and intermediate precursors (up to 500 bases) was traced to intracellular parent nucleic acids. Intermediate precursors with and without partial homology were found. This suggests that bioaptamers are not directly retranslatable gene products. Metalloregulated eRNA bioaptamer function was investigated by domains (e.g. 5'...CUG...3' hairpin loop) for folding, bioactivity, and binding of protein with copper, calcium, and alkali metal ion affinity. Vice versa, metalloregulated nucleic acid-binding domains (K3H, R3H) in proteins were identified. Interaction of protein and eRNA docking potentials

  12. NUCLEAR PORE ANCHOR, the Arabidopsis Homolog of Tpr/Mlp1/Mlp2/Megator, Is Involved in mRNA Export and SUMO Homeostasis and Affects Diverse Aspects of Plant Development[W

    PubMed Central

    Xu, Xianfeng Morgan; Rose, Annkatrin; Muthuswamy, Sivaramakrishnan; Jeong, Sun Yong; Venkatakrishnan, Sowmya; Zhao, Qiao; Meier, Iris

    2007-01-01

    Vertebrate Tpr and its yeast homologs Mlp1/Mlp2, long coiled-coil proteins of nuclear pore inner basket filaments, are involved in mRNA export, telomere organization, spindle pole assembly, and unspliced RNA retention. We identified Arabidopsis thaliana NUCLEAR PORE ANCHOR (NUA) encoding a 237-kD protein with similarity to Tpr. NUA is located at the inner surface of the nuclear envelope in interphase and in the vicinity of the spindle in prometaphase. Four T-DNA insertion lines were characterized, which comprise an allelic series of increasing severity for several correlating phenotypes, such as early flowering under short days and long days, increased abundance of SUMO conjugates, altered expression of several flowering regulators, and nuclear accumulation of poly(A)+ RNA. nua mutants phenocopy mutants of EARLY IN SHORT DAYS4 (ESD4), an Arabidopsis SUMO protease concentrated at the nuclear periphery. nua esd4 double mutants resemble nua and esd4 single mutants, suggesting that the two proteins act in the same pathway or complex, supported by yeast two-hybrid interaction. Our data indicate that NUA is a component of nuclear pore-associated steps of sumoylation and mRNA export in plants and that defects in these processes affect the signaling events of flowering time regulation and additional developmental processes. PMID:17513499

  13. Gap junction-dependent homolog avoidance in the developing CNS.

    PubMed

    Baker, Michael W; Yazdani, Neema; Macagno, Eduardo R

    2013-10-16

    Oppositely directed projections of some homologous neurons in the developing CNS of the medicinal leech (Hirudo verbana), such as the AP cells, undergo a form of contact-dependent homolog avoidance. Embryonic APs extend axons within the connective nerve toward adjacent ganglia, in which they meet and form gap junctions (GJs) with the oppositely directed axons of their segmental homologs, stop growing, and are later permanently retracted (Wolszon et al., 1994a,b). However, early deletion of an AP neuron leads to resumed growth and permanent maintenance of the projections of neighboring APs. Here we test the hypothesis that a GJ-based signaling mechanism is responsible for this instance of homolog avoidance. We demonstrate that selective knockdown of GJ gene Hve-inx1 expression in single embryonic APs, by expressing a short-hairpin interfering RNA, leads to continued growth of the projections of the cell toward, into, and beyond adjacent ganglia. Moreover, the projections of the APs in adjacent ganglia also resume growth, mimicking their responses to cell deletion. Continued growth was also observed when two different INX1 mutant transgenes that abolish dye coupling between APs were expressed. These include a mutant transgene that effectively downregulates all GJ plaques that include the INX1 protein and a closed channel INX1 mutant that retains the adhesive cellular binding characteristic of INX1 GJs but not the open channel pore function. Our results add GJ intercellular communication to the list of molecular signaling mechanisms that can act as mediators of growth-inhibiting cell-cell interactions that define the topography of neuronal arbors.

  14. Heat transfer enhancement in triplex-tube latent thermal energy storage system with selected arrangements of fins

    NASA Astrophysics Data System (ADS)

    Zhao, Liang; Xing, Yuming; Liu, Xin; Rui, Zhoufeng

    2018-01-01

    The use of thermal energy storage systems can effectively reduce energy consumption and improve the system performance. One of the promising ways for thermal energy storage system is application of phase change materials (PCMs). In this study, a two-dimensional numerical model is presented to investigate the heat transfer enhancement during the melting/solidification process in a triplex tube heat exchanger (TTHX) by using fluent software. The thermal conduction and natural convection are all taken into account in the simulation of the melting/solidification process. As the volume fraction of fin is kept to be a constant, the influence of proposed fin arrangement on temporal profile of liquid fraction over the melting process is studied and reported. By rotating the unit with different angle, the simulation shows that the melting time varies a little, which means that the installation error can be reduced by the selected fin arrangement. The proposed fin arrangement also can effectively reduce time of the solidification of the PCM by investigating the solidification process. To summarize, this work presents a shape optimization for the improvement of the thermal energy storage system by considering both thermal energy charging and discharging process.

  15. Changing partners: moving from non-homologous to homologous centromere pairing in meiosis

    PubMed Central

    Stewart, Mara N.; Dawson, Dean S.

    2010-01-01

    Reports of centromere pairing in early meiotic cells have appeared sporadically over the past thirty years. Recent experiments demonstrate that early centromere pairing occurs between non-homologous centromeres. As meiosis proceeds, centromeres change partners, becoming arranged in homologous pairs. Investigations of these later centromere pairs indicate that paired homologous centromeres are actively associated rather than positioned passively, side-by-side. Meiotic centromere pairing has been observed in organisms as diverse as mice, wheat and yeast, indicating that non-homologous centromere pairing in early meiosis and active homologous centromere pairing in later meiosis might be themes in meiotic chromosome behavior. Moreover, such pairing could have previously unrecognized roles in mediating chromosome organization or architecture that impact meiotic segregation fidelity. PMID:18804891

  16. The C. elegans TIA-1/TIAR homolog TIAR-1 is required to induce germ cell apoptosis.

    PubMed

    Silva-García, Carlos Giovanni; Estela Navarro, Rosa

    2013-10-01

    In Caenorhabditis elegans, physiological germ cell apoptosis eliminates more than half of the cells in the hermaphrodite gonad to support gamete quality and germline homeostasis by a still unidentified mechanism. External factors can also affect germ cell apoptosis. The BH3-only protein EGL-1 induces germ cell apoptosis when animals are exposed to pathogens or agents that produce DNA damage. DNA damage-induced apoptosis also requires the nematode p53 homolog CEP-1. Previously, we found that heat shock, oxidative, and osmotic stresses induce germ cell apoptosis through an EGL-1 and CEP-1 independent mechanism that requires the MAPKK pathway. However, we observed that starvation increases germ cell apoptosis by an unknown pathway. Searching for proteins that participate in stress-induced apoptosis, we found the RNA-binding protein TIAR-1 (a homolog of the mammalian TIA-1/TIAR family of proteins). Here, we show that TIAR-1 in C. elegans is required to induce apoptosis in the germline under several conditions. We also show that TIAR-1 acts downstream of CED-9 (a BCL2 homolog) to induce apoptosis under stress conditions, and apparently does not seem to regulate ced-4 or ced-3 mRNAs accumulation directly. TIAR-1 is expressed ubiquitously in the cytoplasm of the soma as well as the germline, where it sometimes associates with P granules. We show that animals lacking TIAR-1 expression are temperature sensitive sterile due to oogenesis and spermatogenesis defects. Our work shows that TIAR-1 is required for proper germline function and demonstrates that this protein is important to induce germ cell apoptosis under several conditions. Copyright © 2013 Wiley Periodicals, Inc.

  17. Transcription blockage by stable H-DNA analogs in vitro

    PubMed Central

    Pandey, Shristi; Ogloblina, Anna M.; Belotserkovskii, Boris P.; Dolinnaya, Nina G.; Yakubovskaya, Marianna G.; Mirkin, Sergei M.; Hanawalt, Philip C.

    2015-01-01

    DNA sequences that can form unusual secondary structures are implicated in regulating gene expression and causing genomic instability. H-palindromes are an important class of such DNA sequences that can form an intramolecular triplex structure, H-DNA. Within an H-palindrome, the H-DNA and canonical B-DNA are in a dynamic equilibrium that shifts toward H-DNA with increased negative supercoiling. The interplay between H- and B-DNA and the fact that the process of transcription affects supercoiling makes it difficult to elucidate the effects of H-DNA upon transcription. We constructed a stable structural analog of H-DNA that cannot flip into B-DNA, and studied the effects of this structure on transcription by T7 RNA polymerase in vitro. We found multiple transcription blockage sites adjacent to and within sequences engaged in this triplex structure. Triplex-mediated transcription blockage varied significantly with changes in ambient conditions: it was exacerbated in the presence of Mn2+ or by increased concentrations of K+ and Li+. Analysis of the detailed pattern of the blockage suggests that RNA polymerase is sterically hindered by H-DNA and has difficulties in unwinding triplex DNA. The implications of these findings for the biological roles of triple-stranded DNA structures are discussed. PMID:26101261

  18. Effects of a triplex mixture of Peganum harmala, Rhus coriaria, and Urtica dioica aqueous extracts on metabolic and histological parameters in diabetic rats.

    PubMed

    Abedi Gaballu, Fereydoon; Abedi Gaballu, Yousef; Moazenzade Khyavy, Omid; Mardomi, Alireza; Ghahremanzadeh, Kazem; Shokouhi, Behrooz; Mamandy, Himan

    2015-08-01

    Several therapeutic effects such as antioxidant and blood glucose-lowering activities have been reported for Peganum harmala L (Zygophyllaceae) (PH) seeds, Rhus coriaria L (Anacardiaceae) (RC) fruits, and Urtica dioica L (Urticaceae) (UD) leaves. This study investigates the effects of a triplex mixture (1:1:1) of these medicinal plants on metabolic and histological parameters in diabetic rats. Aqueous extracts of PH, RC and UD were administered as either monotherapy or in combination at a final dose of 200 mg/kg to alloxan-induced diabetic rats by daily gavage. Biochemical parameters including blood glucose, liver function-related enzymes, lipid profile, and creatinine were estimated by spectrophotometric methods. Tissues from the liver and kidney stained with hematoxylin/eosin were histologically examined. The results obtained from the exposure groups were compared to either healthy or diabetic control groups. Compared with the diabetic control rats, all aqueous extracts (ED50 = 11.5 ± 2.57 mg/ml) led to significant decreases in the levels of ALP (1.39-2.23-fold, p < 0.05), low-density lipoprotein cholesterol (LDL-C) (1.79-3.26-fold, p < 0.05), and blood glucose (1.27-4.16-fold, p < 0.05). The serum concentrations of TG was decreased only by treatment with UD and triplex mixture (1.25- and 1.20-fold, respectively, p < 0.05). Among the studied parameters, alanine aminotransferase (ALT), LDL-C, TG, and creatinine recovered to healthy control levels after 4 weeks of treatment with the extract mixture. This study showed that PH, RC, and UD extracts, especially their combination, had significant antidiabetic, hypolipidemic, and liver and renal damage recovering effects.

  19. A Novel Triplex Quantitative PCR Strategy for Quantification of Toxigenic and Nontoxigenic Vibrio cholerae in Aquatic Environments

    PubMed Central

    Bliem, Rupert; Schauer, Sonja; Plicka, Helga; Obwaller, Adelheid; Sommer, Regina; Steinrigl, Adolf; Alam, Munirul; Reischer, Georg H.; Farnleitner, Andreas H.

    2015-01-01

    Vibrio cholerae is a severe human pathogen and a frequent member of aquatic ecosystems. Quantification of V. cholerae in environmental water samples is therefore fundamental for ecological studies and health risk assessment. Beside time-consuming cultivation techniques, quantitative PCR (qPCR) has the potential to provide reliable quantitative data and offers the opportunity to quantify multiple targets simultaneously. A novel triplex qPCR strategy was developed in order to simultaneously quantify toxigenic and nontoxigenic V. cholerae in environmental water samples. To obtain quality-controlled PCR results, an internal amplification control was included. The qPCR assay was specific, highly sensitive, and quantitative across the tested 5-log dynamic range down to a method detection limit of 5 copies per reaction. Repeatability and reproducibility were high for all three tested target genes. For environmental application, global DNA recovery (GR) rates were assessed for drinking water, river water, and water from different lakes. GR rates ranged from 1.6% to 76.4% and were dependent on the environmental background. Uncorrected and GR-corrected V. cholerae abundances were determined in two lakes with extremely high turbidity. Uncorrected abundances ranged from 4.6 × 102 to 2.3 × 104 cell equivalents liter−1, whereas GR-corrected abundances ranged from 4.7 × 103 to 1.6 × 106 cell equivalents liter−1. GR-corrected qPCR results were in good agreement with an independent cell-based direct detection method but were up to 1.6 log higher than cultivation-based abundances. We recommend the newly developed triplex qPCR strategy as a powerful tool to simultaneously quantify toxigenic and nontoxigenic V. cholerae in various aquatic environments for ecological studies as well as for risk assessment programs. PMID:25724966

  20. Rare recessive loss-of-function methionyl-tRNA synthetase mutations presenting as a multi-organ phenotype

    PubMed Central

    2013-01-01

    Background Methionyl-tRNA synthetase (MARS) catalyzes the ligation of methionine to its cognate transfer RNA and therefore plays an essential role in protein biosynthesis. Methods We used exome sequencing, aminoacylation assays, homology modeling, and immuno-isolation of transfected MARS to identify and characterize mutations in the methionyl-tRNA synthetase gene (MARS) in an infant with an unexplained multi-organ phenotype. Results We identified compound heterozygous mutations (F370L and I523T) in highly conserved regions of MARS. The parents were each heterozygous for one of the mutations. Aminoacylation assays documented that the F370L and I523T MARS mutants had 18 ± 6% and 16 ± 6%, respectively, of wild-type activity. Homology modeling of the human MARS sequence with the structure of E. coli MARS showed that the F370L and I523T mutations are in close proximity to each other, with residue I523 located in the methionine binding pocket. We found that the F370L and I523T mutations did not affect the association of MARS with the multisynthetase complex. Conclusion This infant expands the catalogue of inherited human diseases caused by mutations in aminoacyl-tRNA synthetase genes. PMID:24103465

  1. Functional analysis of a weak viral RNA silencing suppressor using two GFP variants as silencing inducers.

    PubMed

    Mann, Krin S; Dietzgen, Ralf G

    2017-01-01

    RNA silencing in plants can be triggered by the introduction of an exogenous gene. Green fluorescent protein (GFP) has been widely used as a visual reporter to study RNA silencing and viral-mediated suppression of RNA silencing in the model plant Nicotiana benthamiana. In transgenic N. benthamiana plants expressing an endoplasmic reticulum targeted GFP variant (16c) known as mGFP5, RNA silencing can be induced by ectopic over-expression of mGFP5. However, other GFP variants can also be used to induce GFP silencing in these plants. We compared the efficiency to induce local and systemic silencing of two commonly used GFP variants: enhanced GFP (eGFP) and mGFP5. Using lettuce necrotic yellows virus (LNYV) P protein to suppress GFP silencing, we demonstrate that eGFP gene, which is 76% identical at the nucleotide level to the endogenously expressed mGFP5 in 16c plants, triggers silencing more slowly and concurrently prolongs detectable silencing suppressor activity of the weak LNYV P suppressor, compared to the homologous mGFP5 gene. The use of eGFP as RNA silencing inducer in wild type or 16c plants appears to be a useful tool in identifying and analysing weak viral RNA silencing suppressor proteins whose activity might otherwise have been masked when challenged by a stronger RNA silencing response. We also show that reducing the dosage of strong dsRNA silencing inducers in conjunction with their homologous GFP targets facilitates the discovery and analysis of "weaker" RNA silencing suppressor activities. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Isolation and characterization of nonhistone chromosomal protein C-14 which stimulates RNA synthesis.

    PubMed

    James, G T; Yeoman, L C; Matsui, S i; Goldberg, A H; Busch, H

    1977-05-31

    The nonhistone chromatin protein, C-14, was extracted from chromatin of Novikoff hepatoma ascites cells and isolated in high purity as shown by its migration as a single dense spot on two-dimensional polyacrylamide gels. Its mobility on sodium dodecyl sulfate gels is consistent with a molecular weight of approximately 70 000. The amino acid composition shows that protein C-14 has an acidic:basic amino acid ratio of 1.8. Its amino terminal amino acid is lysine. Protein C-14 stimulated the incorporation of [3H]UMP into RNA by approximately 30% when added to naked DNA and homologous RNA polymerase I. A 30% stimulation of [3H]UMP incorporation into RNA was also found when protein C-14 was added to an E. coli RNA polymerase system containing either E. coli or Novikoff hepatoma DNA.

  3. Construction of siRNA/miRNA expression vectors based on a one-step PCR process

    PubMed Central

    Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

    2009-01-01

    Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

  4. Dynamic Hsp83 RNA localization during Drosophila oogenesis and embryogenesis.

    PubMed Central

    Ding, D; Parkhurst, S M; Halsell, S R; Lipshitz, H D

    1993-01-01

    Hsp83 is the Drosophila homolog of the mammalian Hsp90 family of regulatory molecular chaperones. We show that maternally synthesized Hsp83 transcripts are localized to the posterior pole of the early Drosophila embryo by a novel mechanism involving a combination of generalized RNA degradation and local protection at the posterior. This protection of Hsp83 RNA occurs in wild-type embryos and embryos produced by females carrying the maternal effect mutations nanos and pumilio, which eliminate components of the posterior polar plasm without disrupting polar granule integrity. In contrast, Hsp83 RNA is not protected at the posterior pole of embryos produced by females carrying maternal mutations that disrupt the posterior polar plasm and the polar granules--cappuccino, oskar, spire, staufen, tudor, valois, and vasa. Mislocalization of oskar RNA to the anterior pole, which has been shown to result in induction of germ cells at the anterior, leads to anterior protection of maternal Hsp83 RNA. These results suggest that Hsp83 RNA is a component of the posterior polar plasm that might be associated with polar granules. In addition, we show that zygotic expression of Hsp83 commences in the anterior third of the embryo at the syncytial blastoderm stage and is regulated by the anterior morphogen, bicoid. We consider the possible developmental significance of this complex control of Hsp83 transcript distribution. Images PMID:7684502

  5. Structural and transcription analysis of two homologous genes for the P700 chlorophyll a-apoproteins in Chlamydomonas reinhardii: evidence for in vivo trans-splicing

    PubMed Central

    Kück, Ulrich; Choquet, Yves; Schneider, Michel; Dron, Michel; Bennoun, Pierre

    1987-01-01

    The two homologous genes for the P700 chlorophyll a-apoproteins (ps1A1 and ps1A2) are encoded by the plastom in the green alga Chlamydomonas reinhardii. The structure and organization of the two genes were determined by comparison with the homologous genes from maize using data from heterologous hybridizations as well as from DNA and RNA sequencing. While the ps1A2 (736 codons) gene shows a continuous gene organization, the ps1A1 (754 codons) gene possesses some unusual features. The discontinuous gene is split into three separate exons which are scattered around the circular chloroplast genome. Exon 1 (86 bp) is separated by ∼50 kb from exon 2 (198 bp), which is located ∼ 90 kb apart from exon 3 (1984 bp). All exons are flanked by intronic sequences of group II. Transcription analysis reveals that the ps1A2 gene hybridizes with a 2.8-kb transcript, while all exon regions of the ps1A1 gene are homologous to a mature mRNA of 2.7 kb. From our data we conclude that the three distantly separated exonic sequences of the ps1A1 gene constitute a functional gene which probably operates by a trans-splicing mechanism. ImagesFig. 3.Fig. 5.Fig. 6. PMID:16453785

  6. Homologous and Homologous like Microwave Solar Radio Bursts

    NASA Astrophysics Data System (ADS)

    Trevisan, R. H.; Sawant, H. S.; Kalman, B.; Gesztelyi, L.

    1990-11-01

    ABSTRACT. Solar radio observations at 1.6 GHz were carried out in the month of July, 1985 by using 13.7 m diameter Itapetinga antenna with time resolution of 3 ms. Homologous Bursts, with total duration of about couple of seconds and repeated by some seconds were observed associated with Homologous H- flares. These H- flares were having periodicities of about 40 min. Observed long periodicities were attributed to oscillation of prominences, and small periods were attributed to removal of plasma from the field interaction zone. Also observed are "Homologous-Like" bursts. These bursts are double peak bursts with same time profile repeating in time. In addition to this, the ratio of the total duration of the bursts to time difference in the peaks of bursts remain constant. Morphological studies of these bursts have been presented. Keq tuoit : SUN-BURSTS - SUN-FLARE

  7. MDA5 assembles into a polar helical filament on dsRNA

    PubMed Central

    Berke, Ian C.; Yu, Xiong; Modis, Yorgo; Egelman, Edward H.

    2012-01-01

    Melanoma differentiation-associated protein 5 (MDA5) detects viral dsRNA in the cytoplasm. On binding of RNA, MDA5 forms polymers, which trigger assembly of the signaling adaptor mitochondrial antiviral-signaling protein (MAVS) into its active fibril form. The molecular mechanism of MDA5 signaling is not well understood, however. Here we show that MDA5 forms helical filaments on dsRNA and report the 3D structure of the filaments using electron microscopy (EM) and image reconstruction. MDA5 assembles into a polar, single-start helix around the RNA. Fitting of an MDA5 homology model into the structure suggests a key role for the MDA5 C-terminal domain in cooperative filament assembly. Our study supports a signal transduction mechanism in which the helical array of MDA5 within filaments nucleates the assembly of MAVS fibrils. We conclude that MDA5 is a polymerization-dependent signaling platform that uses the amyloid-like self-propagating properties of MAVS to amplify signaling. PMID:23090998

  8. Structure of frequency-interacting RNA helicase from Neurospora crassa reveals high flexibility in a domain critical for circadian rhythm and RNA surveillance.

    PubMed

    Morales, Yalemi; Olsen, Keith J; Bulcher, Jacqueline M; Johnson, Sean J

    2018-01-01

    The FRH (frequency-interacting RNA helicase) protein is the Neurospora crassa homolog of yeast Mtr4, an essential RNA helicase that plays a central role in RNA metabolism as an activator of the nuclear RNA exosome. FRH is also a required component of the circadian clock, mediating protein interactions that result in the rhythmic repression of gene expression. Here we show that FRH unwinds RNA substrates in vitro with a kinetic profile similar to Mtr4, indicating that while FRH has acquired additional functionality, its core helicase function remains intact. In contrast with the earlier FRH structures, a new crystal form of FRH results in an ATP binding site that is undisturbed by crystal contacts and adopts a conformation consistent with nucleotide binding and hydrolysis. Strikingly, this new FRH structure adopts an arch domain conformation that is dramatically altered from previous structures. Comparison of the existing FRH structures reveals conserved hinge points that appear to facilitate arch motion. Regions in the arch have been previously shown to mediate a variety of protein-protein interactions critical for RNA surveillance and circadian clock functions. The conformational changes highlighted in the FRH structures provide a platform for investigating the relationship between arch dynamics and Mtr4/FRH function.

  9. Unfolding and Targeting Thermodynamics of a DNA Intramolecular Complex with Joined Triplex-Duplex Domains.

    PubMed

    Johnson, Sarah E; Reiling-Steffensmeier, Calliste; Lee, Hui-Ting; Marky, Luis A

    2018-01-25

    Our laboratory is interested in developing methods that can be used for the control of gene expression. In this work, we are investigating the reaction of an intramolecular complex containing a triplex-duplex junction with partially complementary strands. We used a combination of isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and spectroscopy techniques to determine standard thermodynamic profiles for these targeting reactions. Specifically, we have designed single strands to target one loop (CTTTC) or two loops (CTTTC and GCAA) of this complex. Both reactions yielded exothermic enthalpies of -66.3 and -82.8 kcal/mol by ITC, in excellent agreement with the reaction enthalpies of -72.7 and -88.7 kcal/mol, respectively, obtained from DSC Hess cycles. The favorable heat contributions result from the formation of base-pair stacks involving mainly the unpaired bases of the loops. This shows that each complementary strand is able to invade and disrupt the secondary structure. The simultaneous targeting of two loops yielded a more favorable reaction free energy, by approximately -8 kcal/mol, which corresponds to the formation of roughly four base-pair stacks involving the unpaired bases of the 5'-GCAA loop. The main conclusion is that the targeting of loops with a large number of unpaired bases results in a more favorable reaction free energy.

  10. Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

    1986-11-04

    The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate inmore » the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.« less

  11. Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

    PubMed

    Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

    2017-01-01

    Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

  12. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog- dependent

    PubMed Central

    Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel AC.

    2013-01-01

    Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species. PMID:24113165

  13. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  14. RtcB is the RNA ligase component of an Escherichia coli RNA repair operon.

    PubMed

    Tanaka, Naoko; Shuman, Stewart

    2011-03-11

    RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.

  15. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

    PubMed

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

    2015-05-01

    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3.

    PubMed

    Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T

    2001-01-01

    In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.

  17. A Symplectic Instanton Homology via Traceless Character Varieties

    NASA Astrophysics Data System (ADS)

    Horton, Henry T.

    Since its inception, Floer homology has been an important tool in low-dimensional topology. Floer theoretic invariants of 3-manifolds tend to be either gauge theoretic or symplecto-geometric in nature, and there is a general philosophy that each gauge theoretic Floer homology should have a corresponding symplectic Floer homology and vice-versa. In this thesis, we construct a Lagrangian Floer invariant for any closed, oriented 3-manifold Y (called the symplectic instanton homology of Y and denoted SI(Y)) which is conjecturally equivalent to a Floer homology defined using a certain variant of Yang-Mills gauge theory. The crucial ingredient for defining SI( Y) is the use of traceless character varieties in the symplectic setting, which allow us to avoid the debilitating technical hurdles present when one attempts to define a symplectic version of instanton Floer homologies. Floer theories are also expected to roughly satisfy the axioms of a topological quantum field theory (TQFT), and furthermore Dehn surgeries on knots should induce exact triangles of Floer homologies. Following a strategy used by Ozsvath and Szabo in the context of Heegaard Floer homology, we prove that our theory is functorial with respect to connected 4-dimensional cobordisms, so that cobordisms induce homomorphisms between symplectic instanton homologies. By studying the effect of Dehn surgeries on traceless character varieties, we establish a surgery exact triangle using work of Seidel that relates the geometry of Lefschetz fibrations with exact triangles in Lagrangian Floer theory. We further prove that Dehn surgeries on a link L in a 3-manifold Y induce a spectral sequence of symplectic instanton homologies - the E2-page is isomorphic to a direct sum of symplectic instanton homologies of all possible combinations of 0- and 1-surgeries on the components of L, and the spectral sequence converges to SI(Y). For the branched double cover Sigma(L) of a link L in S3, we show there is a link surgery

  18. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

    PubMed

    Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

    2016-11-01

    Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

  19. Mechanism of mRNA-STAR domain interaction: Molecular dynamics simulations of Mammalian Quaking STAR protein.

    PubMed

    Sharma, Monika; Anirudh, C R

    2017-10-03

    STAR proteins are evolutionary conserved mRNA-binding proteins that post-transcriptionally regulate gene expression at all stages of RNA metabolism. These proteins possess conserved STAR domain that recognizes identical RNA regulatory elements as YUAAY. Recently reported crystal structures show that STAR domain is composed of N-terminal QUA1, K-homology domain (KH) and C-terminal QUA2, and mRNA binding is mediated by KH-QUA2 domain. Here, we present simulation studies done to investigate binding of mRNA to STAR protein, mammalian Quaking protein (QKI). We carried out conventional MD simulations of STAR domain in presence and absence of mRNA, and studied the impact of mRNA on the stability, dynamics and underlying allosteric mechanism of STAR domain. Our unbiased simulations results show that presence of mRNA stabilizes the overall STAR domain by reducing the structural deviations, correlating the 'within-domain' motions, and maintaining the native contacts information. Absence of mRNA not only influenced the essential modes of motion of STAR domain, but also affected the connectivity of networks within STAR domain. We further explored the dissociation of mRNA from STAR domain using umbrella sampling simulations, and the results suggest that mRNA binding to STAR domain occurs in multi-step: first conformational selection of mRNA backbone conformations, followed by induced fit mechanism as nucleobases interact with STAR domain.

  20. Comparative homology agreement search: An effective combination of homology-search methods

    PubMed Central

    Alam, Intikhab; Dress, Andreas; Rehmsmeier, Marc; Fuellen, Georg

    2004-01-01

    Many methods have been developed to search for homologous members of a protein family in databases, and the reliability of results and conclusions may be compromised if only one method is used, neglecting the others. Here we introduce a general scheme for combining such methods. Based on this scheme, we implemented a tool called comparative homology agreement search (chase) that integrates different search strategies to obtain a combined “E value.” Our results show that a consensus method integrating distinct strategies easily outperforms any of its component algorithms. More specifically, an evaluation based on the Structural Classification of Proteins database reveals that, on average, a coverage of 47% can be obtained in searches for distantly related homologues (i.e., members of the same superfamily but not the same family, which is a very difficult task), accepting only 10 false positives, whereas the individual methods obtain a coverage of 28–38%. PMID:15367730

  1. Discovering Deeply Divergent RNA Viruses in Existing Metatranscriptome Data with Machine Learning

    NASA Astrophysics Data System (ADS)

    Rivers, A. R.

    2016-02-01

    Most sampling of RNA viruses and phages has been directed toward a narrow range of hosts and environments. Several marine metagenomic studies have examined the RNA viral fraction in aquatic samples and found a number of picornaviruses and uncharacterized sequences. The lack of homology to known protein families has limited the discovery of new RNA viruses. We developed a computational method for identifying RNA viruses that relies on information in the codon transition probabilities of viral sequences to train a classifier. This approach does not rely on homology, but it has higher information content than other reference-free methods such as tetranucleotide frequency. Training and validation with RefSeq data gave true positive and true negative rates of 99.6% and 99.5% on the highly imbalanced validation sets (0.2% viruses) that, like the metatranscriptomes themselves, contain mostly non-viral sequences. To further test the method, a validation dataset of putative RNA virus genomes were identified in metatransciptomes by the presence of RNA dependent RNA polymerase, an essential gene for RNA viruses. The classifier successfully identified 99.4% of those contigs as viral. This approach is currently being extended to screen all metatranscriptome data sequenced at the DOE Joint Genome Institute, presently 4.5 Gb of assembled data from 504 public projects representing a wide range of marine, aquatic and terrestrial environments.

  2. miRNA regulation in the early development of barley seed

    PubMed Central

    2012-01-01

    Background During the early stages of seed development many genes are under dynamic regulation to ensure the proper differentiation and establishment of the tissue that will constitute the mature grain. To investigate how miRNA regulation contributes to this process in barley, a combination of small RNA and mRNA degradome analyses were used to identify miRNAs and their targets. Results Our analysis identified 84 known miRNAs and 7 new miRNAs together with 96 putative miRNA target genes regulated through a slicing mechanism in grain tissues during the first 15 days post anthesis. We also identified many potential miRNAs including several belonging to known miRNA families. Our data gave us evidence for an increase in miRNA-mediated regulation during the transition between pre-storage and storage phases. Potential miRNA targets were found in various signalling pathways including components of four phytohormone pathways (ABA, GA, auxin, ethylene) and the defence response to powdery mildew infection. Among the putative miRNA targets we identified were two essential genes controlling the GA response, a GA3oxidase1 and a homolog of the receptor GID1, and a homolog of the ACC oxidase which catalyses the last step of ethylene biosynthesis. We found that two MLA genes are potentially miRNA regulated, establishing a direct link between miRNAs and the R gene response. Conclusion Our dataset provides a useful source of information on miRNA regulation during the early development of cereal grains and our analysis suggests that miRNAs contribute to the control of development of the cereal grain, notably through the regulation of phytohormone response pathways. PMID:22838835

  3. Bovine brain ribonuclease is the functional homolog of human ribonuclease 1.

    PubMed

    Eller, Chelcie H; Lomax, Jo E; Raines, Ronald T

    2014-09-19

    Mounting evidence suggests that human pancreatic ribonuclease (RNase 1) plays important roles in vivo, ranging from regulating blood clotting and inflammation to directly counteracting tumorigenic cells. Understanding these putative roles has been pursued with continual comparisons of human RNase 1 to bovine RNase A, an enzyme that appears to function primarily in the ruminant gut. Our results imply a different physiology for human RNase 1. We demonstrate distinct functional differences between human RNase 1 and bovine RNase A. Moreover, we characterize another RNase 1 homolog, bovine brain ribonuclease, and find pronounced similarities between that enzyme and human RNase 1. We report that human RNase 1 and bovine brain ribonuclease share high catalytic activity against double-stranded RNA substrates, a rare quality among ribonucleases. Both human RNase 1 and bovine brain RNase are readily endocytosed by mammalian cells, aided by tight interactions with cell surface glycans. Finally, we show that both human RNase 1 and bovine brain RNase are secreted from endothelial cells in a regulated manner, implying a potential role in vascular homeostasis. Our results suggest that brain ribonuclease, not RNase A, is the true bovine homolog of human RNase 1, and provide fundamental insight into the ancestral roles and functional adaptations of RNase 1 in mammals. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. High-throughput determination of RNA structure by proximity ligation.

    PubMed

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  5. Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts

    PubMed Central

    Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek

    2015-01-01

    Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398

  6. MiR-205-5p and miR-342-3p cooperate in the repression of the E2F1 transcription factor in the context of anticancer chemotherapy resistance

    PubMed Central

    Lai, Xin; Gupta, Shailendra K; Schmitz, Ulf; Marquardt, Stephan; Knoll, Susanne; Spitschak, Alf; Wolkenhauer, Olaf; Pützer, Brigitte M; Vera, Julio

    2018-01-01

    High rates of lethal outcome in tumour metastasis are associated with the acquisition of invasiveness and chemoresistance. Several clinical studies indicate that E2F1 overexpression across high-grade tumours culminates in unfavourable prognosis and chemoresistance in patients. Thus, fine-tuning the expression of E2F1 could be a promising approach for treating patients showing chemoresistance. Methods: We integrated bioinformatics, structural and kinetic modelling, and experiments to study cooperative regulation of E2F1 by microRNA (miRNA) pairs in the context of anticancer chemotherapy resistance. Results: We showed that an enhanced E2F1 repression efficiency can be achieved in chemoresistant tumour cells through two cooperating miRNAs. Sequence and structural information were used to identify potential miRNA pairs that can form tertiary structures with E2F1 mRNA. We then employed molecular dynamics simulations to show that among the identified triplexes, miR-205-5p and miR-342-3p can form the most stable triplex with E2F1 mRNA. A mathematical model simulating the E2F1 regulation by the cooperative miRNAs predicted enhanced E2F1 repression, a feature that was verified by in vitro experiments. Finally, we integrated this cooperative miRNA regulation into a more comprehensive network to account for E2F1-related chemoresistance in tumour cells. The network model simulations and experimental data indicate the ability of enhanced expression of both miR-205-5p and miR-342-3p to decrease tumour chemoresistance by cooperatively repressing E2F1. Conclusions: Our results suggest that pairs of cooperating miRNAs could be used as potential RNA therapeutics to reduce E2F1-related chemoresistance. PMID:29464002

  7. Homological scaffolds of brain functional networks

    PubMed Central

    Petri, G.; Expert, P.; Turkheimer, F.; Carhart-Harris, R.; Nutt, D.; Hellyer, P. J.; Vaccarino, F.

    2014-01-01

    Networks, as efficient representations of complex systems, have appealed to scientists for a long time and now permeate many areas of science, including neuroimaging (Bullmore and Sporns 2009 Nat. Rev. Neurosci. 10, 186–198. (doi:10.1038/nrn2618)). Traditionally, the structure of complex networks has been studied through their statistical properties and metrics concerned with node and link properties, e.g. degree-distribution, node centrality and modularity. Here, we study the characteristics of functional brain networks at the mesoscopic level from a novel perspective that highlights the role of inhomogeneities in the fabric of functional connections. This can be done by focusing on the features of a set of topological objects—homological cycles—associated with the weighted functional network. We leverage the detected topological information to define the homological scaffolds, a new set of objects designed to represent compactly the homological features of the correlation network and simultaneously make their homological properties amenable to networks theoretical methods. As a proof of principle, we apply these tools to compare resting-state functional brain activity in 15 healthy volunteers after intravenous infusion of placebo and psilocybin—the main psychoactive component of magic mushrooms. The results show that the homological structure of the brain's functional patterns undergoes a dramatic change post-psilocybin, characterized by the appearance of many transient structures of low stability and of a small number of persistent ones that are not observed in the case of placebo. PMID:25401177

  8. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  9. Homology of pendrin, sodium-iodide symporter and apical iodide transporter.

    PubMed

    Benvenga, Salvatore; Guarneri, Fabrizio

    2018-06-01

    We observed local homology between human pendrin and sodium/iodide symporter (NIS), that was absent in the NIS-homologous sodium/monocarboxylate transporter or apical iodide transporter (AIT) which, however, does not transport iodide. Thus, we analyzed the full proteins. They shared 63 identical and 66 similar residues (overall homology 14.4%, but 21% when omitting intervening sequences of 15 or more residues). Pendrin was more homologous to NIS (25%) than AIT (20%), particularly in the STAS domain (sulfate transporter and antisigma factor antagonist). Homology was concentrated in 11 segments, with 3/11 involving the STAS domain. In 9/11, homology was greater with NIS (45-58.3%) than with AIT (8.3-42.3%); in 4 of these 9 segments, homology was comparable to or greater than that between NIS and AIT (8.3-52.6%). Pendrin residues which are mutated in Pendred's syndrome are identical to those in the aligned position of NIS and AIT. Hypothyroidism-associated pendrin mutations almost always fall within 4/11 segments. These are the first data that show homology between pendrin and NIS, and topographic relationships between pendrin mutations and the hypothyroid phenotype of PDS.

  10. The Crystal Structure of the RNA-Dependent RNA Polymerase from Human Rhinovirus: A Dual Function Target for Common Cold Antiviral Therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Love, Robert A.; Maegley, Karen A.; Yu, Xiu

    Human rhinoviruses (HRV), the predominant members of the Picornaviridae family of positive-strand RNA viruses, are the major causative agents of the common cold. Given the lack of effective treatments for rhinoviral infections, virally encoded proteins have become attractive therapeutic targets. The HRV genome encodes an RNA-dependent RNA polymerase (RdRp) denoted 3D{sup pol}, which is responsible for replicating the viral genome and for synthesizing a protein primer used in the replication. Here the crystal structures for three viral serotypes (1B, 14, and 16) of HRV 3D{sup pol} have been determined. The three structures are very similar to one another, and tomore » the closely related poliovirus (PV) 3D{sup pol} enzyme. Because the reported PV crystal structure shows significant disorder, HRV 3D{sup pol} provides the first complete view of a picornaviral RdRp. The folding topology of HRV 3D{sup pol} also resembles that of RdRps from hepatitis C virus (HCV) and rabbit hemorrhagic disease virus (RHDV) despite very low sequence homology.« less

  11. The 3D protein of duck hepatitis A virus type 1 binds to a viral genomic 3' UTR and shows RNA-dependent RNA polymerase activity.

    PubMed

    Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun

    2017-12-01

    To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.

  12. [RNA interference library research progress and its application in cancer research].

    PubMed

    Zhao, Ning; Cai, Li

    2013-02-01

    RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

  13. Transcription blockage by stable H-DNA analogs in vitro.

    PubMed

    Pandey, Shristi; Ogloblina, Anna M; Belotserkovskii, Boris P; Dolinnaya, Nina G; Yakubovskaya, Marianna G; Mirkin, Sergei M; Hanawalt, Philip C

    2015-08-18

    DNA sequences that can form unusual secondary structures are implicated in regulating gene expression and causing genomic instability. H-palindromes are an important class of such DNA sequences that can form an intramolecular triplex structure, H-DNA. Within an H-palindrome, the H-DNA and canonical B-DNA are in a dynamic equilibrium that shifts toward H-DNA with increased negative supercoiling. The interplay between H- and B-DNA and the fact that the process of transcription affects supercoiling makes it difficult to elucidate the effects of H-DNA upon transcription. We constructed a stable structural analog of H-DNA that cannot flip into B-DNA, and studied the effects of this structure on transcription by T7 RNA polymerase in vitro. We found multiple transcription blockage sites adjacent to and within sequences engaged in this triplex structure. Triplex-mediated transcription blockage varied significantly with changes in ambient conditions: it was exacerbated in the presence of Mn(2+) or by increased concentrations of K(+) and Li(+). Analysis of the detailed pattern of the blockage suggests that RNA polymerase is sterically hindered by H-DNA and has difficulties in unwinding triplex DNA. The implications of these findings for the biological roles of triple-stranded DNA structures are discussed. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. DcpS is a transcript-specific modulator of RNA in mammalian cells

    PubMed Central

    Zhou, Mi; Bail, Sophie; Plasterer, Heather L.; Rusche, James

    2015-01-01

    The scavenger decapping enzyme DcpS is a multifunctional protein initially identified by its property to hydrolyze the resulting cap structure following 3′ end mRNA decay. In Saccharomyces cerevisiae, the DcpS homolog Dcs1 is an obligate cofactor for the 5′-3′ exoribonuclease Xrn1 while the Caenorhabditis elegans homolog Dcs-1, facilitates Xrn1 mediated microRNA turnover. In both cases, this function is independent of the decapping activity. Whether DcpS and its decapping activity can affect mRNA steady state or stability in mammalian cells remains unknown. We sought to determine DcpS target genes in mammalian cells using a cell-permeable DcpS inhibitor compound, RG3039 initially developed for therapeutic treatment of spinal muscular atrophy. Global mRNA levels were examined following DcpS decapping inhibition with RG3039. The steady-state levels of 222 RNAs were altered upon RG3039 treatment. Of a subset selected for validation, two transcripts that appear to be long noncoding RNAs HS370762 and BC011766, were dependent on DcpS and its scavenger decapping catalytic activity and referred to as DcpS-responsive noncoding transcripts (DRNT) 1 and 2, respectively. Interestingly, only the increase in DRNT1 transcript was accompanied with an increase of its RNA stability and this increase was dependent on both DcpS and Xrn1. Importantly, unlike in yeast where the DcpS homolog is an obligate cofactor for Xrn1, stability of additional Xrn1 dependent RNAs were not altered by a reduction in DcpS levels. Collectively, our data demonstrate that DcpS in conjunction with Xrn1 has the potential to regulate RNA stability in a transcript-selective manner in mammalian cells. PMID:26001796

  15. Identification of a novel homolog of the Drosophila staufen protein in the chromosome 8q13-q21.1 region.

    PubMed

    Buchner, G; Bassi, M T; Andolfi, G; Ballabio, A; Franco, B

    1999-11-15

    We report the identification of a new transcript homologous to the Drosophila staufen protein. This transcript, named STAU2 (HGMW-approved gene symbol and name), maps to the chromosome 8q13-q21 region. The full-length STAU2 cDNA is 4058 bp and contains an open reading frame of 479 amino acids. Analysis of the predicted protein product indicated the presence of three double-stranded RNA-binding domains. Best-fit analysis revealed a 48.5% similarity to the Drosophila protein and a 59.9% similarity to the recently described mammalian homolog hStau, indicating that at least two different transcripts with homologies to the fly protein are present in mammals. Copyright 1999 Academic Press.

  16. DNA sequence alignment by microhomology sampling during homologous recombination

    PubMed Central

    Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

    2015-01-01

    Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

  17. RRP6/EXOSC10 is required for the repair of DNA double-strand breaks by homologous recombination.

    PubMed

    Marin-Vicente, Consuelo; Domingo-Prim, Judit; Eberle, Andrea B; Visa, Neus

    2015-03-15

    The exosome acts on different RNA substrates and plays important roles in RNA metabolism. The fact that short non-coding RNAs are involved in the DNA damage response led us to investigate whether the exosome factor RRP6 of Drosophila melanogaster and its human ortholog EXOSC10 play a role in DNA repair. Here, we show that RRP6 and EXOSC10 are recruited to DNA double-strand breaks (DSBs) in S2 cells and HeLa cells, respectively. Depletion of RRP6/EXOSC10 does not interfere with the phosphorylation of the histone variant H2Av (Drosophila) or H2AX (humans), but impairs the recruitment of the homologous recombination factor RAD51 to the damaged sites, without affecting RAD51 levels. The recruitment of RAD51 to DSBs in S2 cells is also inhibited by overexpression of RRP6-Y361A-V5, a catalytically inactive RRP6 mutant. Furthermore, cells depleted of RRP6 or EXOSC10 are more sensitive to radiation, which is consistent with RRP6/EXOSC10 playing a role in DNA repair. RRP6/EXOSC10 can be co-immunoprecipitated with RAD51, which links RRP6/EXOSC10 to the homologous recombination pathway. Taken together, our results suggest that the ribonucleolytic activity of RRP6/EXOSC10 is required for the recruitment of RAD51 to DSBs. © 2015. Published by The Company of Biologists Ltd.

  18. Immunological purification and partial characterization of variant-specific surface antigen messenger RNA of Trypanosoma brucei brucei.

    PubMed Central

    Lheureux, M; Lheureux, M; Vervoort, T; Van Meirvenne, N; Steinert, M

    1979-01-01

    Polyadenylated RNA isolated from total polyribosomes of two variable antigen types (VATs) of T. brucei brucei were shown to program the synthesis, in mRNA-dependant reticulocyte lysates, of a wide variety of polypeptides. After immunoprecipitation of these cell-free products with an homologous antiserum raised against purified variant-specific surface antigen (VSSA), a major electrophoretic band was apparent on fluorography. It was confirmed that this band corresponds to the variable antigen since only an excess of purified homologous antigen will provoke competition. The apparent molecular weight of the in vitro synthesized antigen is about 63,000 daltons. The VSSA mRNA has been found in membrane-bound polyribosomes and a 15 fold immunological purification of this mRNA has been obtained, using partially purified anti-VSSA IgG in conjunction with inactivated Staphylococcus aureus. Images PMID:116191

  19. Emergence of Noroviruses homologous to strains reported from Djibouti (horn of Africa), Brazil, Italy, Japan and USA among children in Kolkata, India.

    PubMed

    Nataraju, S M; Ganesh, B; Das, S; Chowdhury, S; Nayak, M K; Ghosh, M; Chatterjee, M K; Sarkar, U; Mitra, U; Bhattacharya, M K; Arora, R; Kobayashi, N; Krishnan, T

    2010-09-01

    A total of 625 faecal specimens of diarrheic cases (n-313) and non diarrheic controls (n-312), were screened by RT-PCR to detect Noroviruses in children aged below 5 years in Kolkata, India. Out of the 313 fecal specimens (cases) screened using CDC primer set, 10 (3.19%) showed amplification in reverse transcription-polymerase chain reaction (RT-PCR) for Norovirus. These included 5 of 260 (1.92%) from hospitalized and 5 of 53 (9.43%) from out patients departament (OPD) cases. Nine (90%) of Norovirus positive cases belonged to genogroup GII and one specimen (10%) was positive for genogroup GI. Among the 312 non diarrheic controls 2 (0.63%) were positive for Norovirus GII. Partial RNA dependent RNA polymerase gene (RdRp) sequences corresponding to the six Norovirus GII positive samples showed homology to the sequences of Djibouti (horn of Africa), Brazil, Italy, Japan and US norovirus strains. This study shows the detection of newly emerging Norovirus strains among diarrheic and non diarrheic children in Kolkata.

  20. Object-oriented Persistent Homology

    PubMed Central

    Wang, Bao; Wei, Guo-Wei

    2015-01-01

    Persistent homology provides a new approach for the topological simplification of big data via measuring the life time of intrinsic topological features in a filtration process and has found its success in scientific and engineering applications. However, such a success is essentially limited to qualitative data classification and analysis. Indeed, persistent homology has rarely been employed for quantitative modeling and prediction. Additionally, the present persistent homology is a passive tool, rather than a proactive technique, for classification and analysis. In this work, we outline a general protocol to construct object-oriented persistent homology methods. By means of differential geometry theory of surfaces, we construct an objective functional, namely, a surface free energy defined on the data of interest. The minimization of the objective functional leads to a Laplace-Beltrami operator which generates a multiscale representation of the initial data and offers an objective oriented filtration process. The resulting differential geometry based object-oriented persistent homology is able to preserve desirable geometric features in the evolutionary filtration and enhances the corresponding topological persistence. The cubical complex based homology algorithm is employed in the present work to be compatible with the Cartesian representation of the Laplace-Beltrami flow. The proposed Laplace-Beltrami flow based persistent homology method is extensively validated. The consistence between Laplace-Beltrami flow based filtration and Euclidean distance based filtration is confirmed on the Vietoris-Rips complex for a large amount of numerical tests. The convergence and reliability of the present Laplace-Beltrami flow based cubical complex filtration approach are analyzed over various spatial and temporal mesh sizes. The Laplace-Beltrami flow based persistent homology approach is utilized to study the intrinsic topology of proteins and fullerene molecules. Based on a

  1. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics.

    PubMed

    Feng, Lihui; Rutherford, Steven T; Papenfort, Kai; Bagert, John D; van Kessel, Julia C; Tirrell, David A; Wingreen, Ned S; Bassler, Bonnie L

    2015-01-15

    Quorum sensing is a cell-cell communication process that bacteria use to transition between individual and social lifestyles. In vibrios, homologous small RNAs called the Qrr sRNAs function at the center of quorum-sensing pathways. The Qrr sRNAs regulate multiple mRNA targets including those encoding the quorum-sensing regulatory components luxR, luxO, luxM, and aphA. We show that a representative Qrr, Qrr3, uses four distinct mechanisms to control its particular targets: the Qrr3 sRNA represses luxR through catalytic degradation, represses luxM through coupled degradation, represses luxO through sequestration, and activates aphA by revealing the ribosome binding site while the sRNA itself is degraded. Qrr3 forms different base-pairing interactions with each mRNA target, and the particular pairing strategy determines which regulatory mechanism occurs. Combined mathematical modeling and experiments show that the specific Qrr regulatory mechanism employed governs the potency, dynamics, and competition of target mRNA regulation, which in turn, defines the overall quorum-sensing response. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Downregulation of MicroRNA 29a/b exacerbated diabetic retinopathy by impairing the function of Müller cells via Forkhead box protein O4.

    PubMed

    Zhang, Jiayu; Wu, Liang; Chen, Jiawei; Lin, Sisi; Cai, Daqiu; Chen, Chengwei; Chen, Zhenguo

    2018-05-01

    Diabetic retinopathy is a neurological disease, which can lead to blindness in severe cases. The pathogenesis underlying diabetic retinopathy is unclear. The aim of this study was to explore the role of dysregulated microRNA 29a/b in the onset and progression of diabetic retinopathy. Diabetes mellitus was induced in rats using 60 mg/kg of streptozotocin. Glucose (5.5 and 25 mM) was used to stimulate rat retinal Müller cells. Real-time polymerase chain reaction and Western blot analyses were used to determine gene expression. A luciferase reporter assay was conducted to validate the relationship of microRNA 29a/b with glioma-associated oncogene homolog 1 and Forkhead box protein O4. The expression of microRNA 29a/b and glutamine synthetase decreased in both diabetes mellitus rats and rat retinal Müller cells stimulated with high glucose, whereas the expression of sonic hedgehog, glioma-associated oncogene homolog 1, glial fibrillary acidic protein, and vascular endothelial growth factor, as well as the content of glutamate, increased. Dysregulated microRNA 29a/b was directly regulated by the sonic hedgehog-glioma-associated oncogene homolog 1 signalling pathway, and microRNA 29a and microRNA 29b targeted Forkhead box protein O4 and regulated its expression. Downregulation of microRNA 29a/b, mediated by the sonic hedgehog-glioma-associated oncogene homolog 1 signalling pathway, exacerbated diabetic retinopathy by upregulating Forkhead box protein O4.

  3. Bloom DNA Helicase Facilitates Homologous Recombination between Diverged Homologous Sequences*

    PubMed Central

    Kikuchi, Koji; Abdel-Aziz, H. Ismail; Taniguchi, Yoshihito; Yamazoe, Mitsuyoshi; Takeda, Shunichi; Hirota, Kouji

    2009-01-01

    Bloom syndrome caused by inactivation of the Bloom DNA helicase (Blm) is characterized by increases in the level of sister chromatid exchange, homologous recombination (HR) associated with cross-over. It is therefore believed that Blm works as an anti-recombinase. Meanwhile, in Drosophila, DmBlm is required specifically to promote the synthesis-dependent strand anneal (SDSA), a type of HR not associating with cross-over. However, conservation of Blm function in SDSA through higher eukaryotes has been a matter of debate. Here, we demonstrate the function of Blm in SDSA type HR in chicken DT40 B lymphocyte line, where Ig gene conversion diversifies the immunoglobulin V gene through intragenic HR between diverged homologous segments. This reaction is initiated by the activation-induced cytidine deaminase enzyme-mediated uracil formation at the V gene, which in turn converts into abasic site, presumably leading to a single strand gap. Ig gene conversion frequency was drastically reduced in BLM−/− cells. In addition, BLM−/− cells used limited donor segments harboring higher identity compared with other segments in Ig gene conversion event, suggesting that Blm can promote HR between diverged sequences. To further understand the role of Blm in HR between diverged homologous sequences, we measured the frequency of gene targeting induced by an I-SceI-endonuclease-mediated double-strand break. BLM−/− cells showed a severer defect in the gene targeting frequency as the number of heterologous sequences increased at the double-strand break site. Conversely, the overexpression of Blm, even an ATPase-defective mutant, strongly stimulated gene targeting. In summary, Blm promotes HR between diverged sequences through a novel ATPase-independent mechanism. PMID:19661064

  4. Evolution of E. coli tRNA(Trp)

    NASA Technical Reports Server (NTRS)

    Staves, Mark P.; Lacey, James C., Jr.; Bloch, David P.

    1988-01-01

    It has been shown by Lacey et al. (1985) that, in general, the hydrophobicity ranking of an amino acid correlates with that of its anticodonic nucleotide, with tryptophan being one of the four amino acids for which this rule does not apply. It was proposed that this failure to correlate was due to the fact that the anticodon assignments for the four amino acids were made late, after the mutation of existing tRNAs. In this paper, the evolution of E. coli tRNA(Trp) is examined by comparing its homology with other E. coli tRNAs. The results demonstrate the presence of an evolutionary relationship between E. coli tRNA(Trp) and tRNA(Gly) or tRNA(Arg) molecules, and support the idea of the late assignment of anticodon to Trp.

  5. RNA-Dependent Cysteine Biosynthesis in Bacteria and Archaea

    DOE PAGES

    Mukai, Takahito; Crnković, Ana; Umehara, Takuya; ...

    2017-05-09

    ABSTRACT The diversity of the genetic code systems used by microbes on earth is yet to be elucidated. It is known that certain methanogenic archaea employ an alternative system for cysteine (Cys) biosynthesis and encoding; tRNA Cysis first acylated with phosphoserine (Sep) byO-phosphoseryl-tRNA synthetase (SepRS) and then converted to Cys-tRNA Cysby Sep-tRNA:Cys-tRNA synthase (SepCysS). In this study, we searched all genomic and metagenomic protein sequence data in the Integrated Microbial Genomes (IMG) system and at the NCBI to reveal new clades of SepRS and SepCysS proteins belonging to diverse archaea in the four major groups (DPANN,Euryarchaeota, TACK, and Asgard) andmore » two groups of bacteria (“CandidatusParcubacteria” andChloroflexi). Bacterial SepRS and SepCysS charged bacterial tRNA Cysspecies with cysteinein vitro. Homologs of SepCysE, a scaffold protein facilitating SepRS-SepCysS complex assembly in Euryarchaeota class I methanogens, are found in a few groups of TACK and Asgard archaea, whereas the C-terminally truncated homologs exist fused or genetically coupled with diverse SepCysS species. Investigation of the selenocysteine (Sec)- and pyrrolysine (Pyl)-utilizing traits in SepRS-utilizing archaea and bacteria revealed that the archaea carrying full-length SepCysE employ Sec and that SepRS is often found in Pyl-utilizing archaea andChloroflexibacteria. We further discuss possible contributions of the SepRS-SepCysS system for sulfur assimilation, methanogenesis, and other metabolic processes requiring large amounts of iron-sulfur enzymes or Pyl-containing enzymes.« less

  6. RNA-Dependent Cysteine Biosynthesis in Bacteria and Archaea

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mukai, Takahito; Crnković, Ana; Umehara, Takuya

    ABSTRACT The diversity of the genetic code systems used by microbes on earth is yet to be elucidated. It is known that certain methanogenic archaea employ an alternative system for cysteine (Cys) biosynthesis and encoding; tRNA Cysis first acylated with phosphoserine (Sep) byO-phosphoseryl-tRNA synthetase (SepRS) and then converted to Cys-tRNA Cysby Sep-tRNA:Cys-tRNA synthase (SepCysS). In this study, we searched all genomic and metagenomic protein sequence data in the Integrated Microbial Genomes (IMG) system and at the NCBI to reveal new clades of SepRS and SepCysS proteins belonging to diverse archaea in the four major groups (DPANN,Euryarchaeota, TACK, and Asgard) andmore » two groups of bacteria (“CandidatusParcubacteria” andChloroflexi). Bacterial SepRS and SepCysS charged bacterial tRNA Cysspecies with cysteinein vitro. Homologs of SepCysE, a scaffold protein facilitating SepRS-SepCysS complex assembly in Euryarchaeota class I methanogens, are found in a few groups of TACK and Asgard archaea, whereas the C-terminally truncated homologs exist fused or genetically coupled with diverse SepCysS species. Investigation of the selenocysteine (Sec)- and pyrrolysine (Pyl)-utilizing traits in SepRS-utilizing archaea and bacteria revealed that the archaea carrying full-length SepCysE employ Sec and that SepRS is often found in Pyl-utilizing archaea andChloroflexibacteria. We further discuss possible contributions of the SepRS-SepCysS system for sulfur assimilation, methanogenesis, and other metabolic processes requiring large amounts of iron-sulfur enzymes or Pyl-containing enzymes.« less

  7. Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription.

    PubMed

    Kogoma, T

    1997-06-01

    Chromosome replication in Escherichia coli is normally initiated at oriC, the origin of chromosome replication. E. coli cells possess at least three additional initiation systems for chromosome replication that are normally repressed but can be activated under certain specific conditions. These are termed the stable DNA replication systems. Inducible stable DNA replication (iSDR), which is activated by SOS induction, is proposed to be initiated from a D-loop, an early intermediate in homologous recombination. Thus, iSDR is a form of recombination-dependent DNA replication (RDR). Analysis of iSDR and RDR has led to the proposal that homologous recombination and double-strand break repair involve extensive semiconservative DNA replication. RDR is proposed to play crucial roles in homologous recombination, double-strand break repair, restoration of collapsed replication forks, and adaptive mutation. Constitutive stable DNA replication (cSDR) is activated in mhA mutants deficient in RNase HI or in recG mutants deficient in RecG helicase. cSDR is proposed to be initiated from an R-loop that can be formed by the invasion of duplex DNA by an RNA transcript, which most probably is catalyzed by RecA protein. The third form of SDR is nSDR, which can be transiently activated in wild-type cells when rapidly growing cells enter the stationary phase. This article describes the characteristics of these alternative DNA replication forms and reviews evidence that has led to the formulation of the proposed models for SDR initiation mechanisms. The possible interplay between DNA replication, homologous recombination, DNA repair, and transcription is explored.

  8. Enhancer of zeste homolog 2 blockade by RNA interference is implicated with inhibited proliferation, invasion and promoted apoptosis in endometrial carcinoma.

    PubMed

    Wang, Juan; Ai, Zhihong; Chen, Jing; Teng, Yincheng; Zhu, Jieping

    2018-06-01

    Endometrial carcinoma is the most common gynecological malignancy of the female genital tract worldwide (2012). Enhancer of zeste homolog 2 (EZH2), a critical component of the polycomb repressive complex 2, has been found to be associated with multiple biological processes and is overexpressed in multiple types of cancer. Previous studies have demonstrated that EZH2 is associated with endometrial carcinoma. The present study investigated the expression and biology function of EZH2 in endometrial cancer (EC). It was found that EZH2 levels were markedly increased in endometrial cancer tissues compared with that in adjacent normal tissues. EZH2 was significantly overexpressed in 3 separate endometrial cancer cell lines (Ishikawa, RL95-2 and HEC1-A) when compared with the normal endometrial cell line ESC. Additionally, small interfering RNA was used to investigate the role of EZH2 in endometrial carcinoma cell proliferation, and the results showed that EZH2 knockdown suppressed the proliferation of endometrial carcinoma cells in vitro . Furthermore, EZH2 knockdown induced apoptosis of human EC cells by promoting the expression of pro-apoptosis protein caspase 3, caspase 9, BCL2 associated X and decreasing the expression of anti-apoptosis protein Bcl-2. Finally, the present study demonstrated that EZH2 knockdown suppressed the invasion of EC cells through downregulation of the epithelial-mesenchymal transition. Collectively, these data demonstrate that EZH2 is frequently overexpressed in EC cells and its overexpression is associated with promoting the proliferation and invasion and decreasing the apoptosis of EC cells, suggesting that EZH2 may provide potential therapeutic targets for treatment of endometrial carcinoma.

  9. Induction of virus resistance by exogenous application of double-stranded RNA.

    PubMed

    Mitter, Neena; Worrall, Elizabeth A; Robinson, Karl E; Xu, Zhi Ping; Carroll, Bernard J

    2017-10-01

    Exogenous application of double-stranded RNA (dsRNA) for virus resistance in plants represents a very attractive alternative to virus resistant transgenic crops or pesticides targeting virus vectors. However, the instability of dsRNA sprayed onto plants is a major challenge as spraying naked dsRNA onto plants provides protection against homologous viruses for only 5 days. Innovative approaches, such as the use of nanoparticles as carriers of dsRNA for improved stability and sustained release, are emerging as key disruptive technologies. Knowledge is still limited about the mechanism of entry, transport and processing of exogenously applied dsRNA in plants. Cost of dsRNA and regulatory framework will be key influencers towards practical adoption of this technology. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Successful Validation of RNA Purification and Quantitative Real-Time PCR Analysis of Gene Expression on the International Space Station

    NASA Technical Reports Server (NTRS)

    Tran, L.; Parra, Macarena P.; Jung, J.; Boone, T.; Schonfeld, Julie; Almeida, Eduardo

    2017-01-01

    The NASA Ames WetLab-2 system was developed to offer new on-orbit gene expression analysis capabilities to ISS researchers and can be used to conduct on-orbit RNA isolation and quantitative real time PCR (RT-qPCR) analysis of gene expression from a wide range of biological samples ranging from microbes to mammalian tissues. On orbit validation included three quantitative PCR (qPCR) runs using an E. coli genomic DNA template pre-loaded at three different concentrations. The flight Ct values for the DNA standards showed no statistically significant differences relative to ground controls although there was increased noise in Ct curves, likely due to microgravity-related bubble retention in the optical windows. RNA was successfully purified from both E. coli and mouse liver samples and successfully generated singleplex, duplex and triplex data although with higher standard deviations than ground controls, also likely due to bubbles. Using volunteer science activities, a potential bubble reduction strategy was tested and resulted in smooth amplification curves and tighter Cts between replicates. The WetLab-2 validation experiment demonstrates a novel molecular biology workbench on ISS which allows scientists to purify and stabilize RNA, and to conduct RT-qPCR analyses on-orbit with rapid results. This novel ability is an important step towards utilizing ISS as a National Laboratory facility with the capability to conduct and adjust science experiments in real time without sample return, and opens new possibilities for rapid medical diagnostics and biological environmental monitoring on ISS.

  11. Natural variation of piRNA expression affects immunity to transposable elements.

    PubMed

    Ryazansky, Sergei; Radion, Elizaveta; Mironova, Anastasia; Akulenko, Natalia; Abramov, Yuri; Morgunova, Valeriya; Kordyukova, Maria Y; Olovnikov, Ivan; Kalmykova, Alla

    2017-04-01

    In the Drosophila germline, transposable elements (TEs) are silenced by PIWI-interacting RNA (piRNA) that originate from distinct genomic regions termed piRNA clusters and are processed by PIWI-subfamily Argonaute proteins. Here, we explore the variation in the ability to restrain an alien TE in different Drosophila strains. The I-element is a retrotransposon involved in the phenomenon of I-R hybrid dysgenesis in Drosophila melanogaster. Genomes of R strains do not contain active I-elements, but harbour remnants of ancestral I-related elements. The permissivity to I-element activity of R females, called reactivity, varies considerably in natural R populations, indicating the existence of a strong natural polymorphism in defense systems targeting transposons. To reveal the nature of such polymorphisms, we compared ovarian small RNAs between R strains with low and high reactivity and show that reactivity negatively correlates with the ancestral I-element-specific piRNA content. Analysis of piRNA clusters containing remnants of I-elements shows increased expression of the piRNA precursors and enrichment by the Heterochromatin Protein 1 homolog, Rhino, in weak R strains, which is in accordance with stronger piRNA expression by these regions. To explore the nature of the differences in piRNA production, we focused on two R strains, weak and strong, and showed that the efficiency of maternal inheritance of piRNAs as well as the I-element copy number are very similar in both strains. At the same time, germline and somatic uni-strand piRNA clusters generate more piRNAs in strains with low reactivity, suggesting the relationship between the efficiency of primary piRNA production and variable response to TE invasions. The strength of adaptive genome defense is likely driven by naturally occurring polymorphisms in the rapidly evolving piRNA pathway proteins. We hypothesize that hyper-efficient piRNA production is contributing to elimination of a telomeric retrotransposon He

  12. The FASTK family of proteins: emerging regulators of mitochondrial RNA biology

    PubMed Central

    Jourdain, Alexis A.; Popow, Johannes; de la Fuente, Miguel A.; Martinou, Jean-Claude

    2017-01-01

    Abstract The FASTK family proteins have recently emerged as key post-transcriptional regulators of mitochondrial gene expression. FASTK, the founding member and its homologs FASTKD1–5 are architecturally related RNA-binding proteins, each having a different function in the regulation of mitochondrial RNA biology, from mRNA processing and maturation to ribosome assembly and translation. In this review, we outline the structure, evolution and function of these FASTK proteins and discuss the individual role that each has in mitochondrial RNA biology. In addition, we highlight the aspects of FASTK research that still require more attention. PMID:29036396

  13. Ends of the line for tmRNA-SmpB

    DOE PAGES

    Hudson, Corey M.; Lau, Britney Y.; Williams, Kelly P.

    2014-08-13

    Genes for the RNA tmRNA and protein SmpB, partners in the trans-translation process that rescues stalled ribosomes, have previously been found in all bacteria and some organelles. We validate recent identification of tmRNA homologs in oomycete mitochondria by finding partner genes from oomycete nuclei that target SmpB to the mitochondrion. Exhaustive search now identifies a small number of complete, often highly derived, bacterial genomes that appear to lack a functional copy of one or the other partner gene (but not both). Three groups with reduced genomes have lost the central loop of SmpB, which is thought to improve alanylation andmore » EF-Tu activation: Carsonella, Hodgkinia and the hemplasmas (hemotropic Mycoplasma). Carsonella has also lost the SmpB C-terminal tail, thought to stimulate the decoding center of the ribosome. Carsonella moreover exhibits gene overlap such that tmRNA maturation should produce a non-stop smpB mRNA, and one isolate exhibits complete degradation of the tmRNA gene yet its smpB shows no evidence for relaxed selective constraint. After loss of the SmpB central loop in the hemoplasmas, a subclade apparently lost tmRNA. At least some of the tmRNA/SmpB-deficient strains appear to further lack the ArfA and ArfB backup systems for ribosome rescue. The most frequent neighbors of smpB are the tmRNA gene, a ratA/rnfH unit, and the gene for RNaseR, a known physical and functional partner of tmRNA-SmpB. The tmRNA Website has moved and been updated, adding an SmpB sequence database (http://bioinformatics.sandia.gov/tmrna).« less

  14. Systematic discovery of Xist RNA binding proteins

    PubMed Central

    Chu, Ci; Zhang, Qiangfeng Cliff; da Rocha, Simão Teixeira; Flynn, Ryan A.; Bharadwaj, Maheetha; Calabrese, J. Mauro; Magnuson, Terry; Heard, Edith; Chang, Howard Y.

    2015-01-01

    Summary Noncoding RNAs (ncRNAs) function with associated proteins to effect complex structural and regulatory outcomes. To reveal the composition and dynamics of specific noncoding RNA- protein complexes (RNPs) in vivo, we developed comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS). ChIRP-MS analysis of four ncRNAs captures key protein interactors, including a U1-specific link to the 3′ RNA processing machinery. Xist, an essential lncRNA for X-chromosome inactivation (XCI), interacts with 81 proteins from chromatin modification, nuclear matrix, and RNA remodeling pathways. The Xist RNA-protein particle assembles in two steps coupled with the transition from pluripotency to differentiation. Specific interactors include HnrnpK that participates in Xist-mediated gene silencing and histone modifications, but not Xist localization and Drosophila Split ends homolog Spen that interacts via the A-repeat domain of Xist and is required for gene silencing. Thus, Xist lncRNA engages with proteins in a modular and developmentally controlled manner to coordinate chromatin spreading and silencing. PMID:25843628

  15. Cas9-Guide RNA Directed Genome Editing in Soybean[OPEN

    PubMed Central

    Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P.; Koellhoffer, Jessica P.; Huang, Lingxia; Ward, R. Timothy; Clifton, Elizabeth; Falco, S. Carl; Cigan, A. Mark

    2015-01-01

    Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing. PMID:26294043

  16. Secondary structural entropy in RNA switch (Riboswitch) identification.

    PubMed

    Manzourolajdad, Amirhossein; Arnold, Jonathan

    2015-04-28

    RNA regulatory elements play a significant role in gene regulation. Riboswitches, a widespread group of regulatory RNAs, are vital components of many bacterial genomes. These regulatory elements generally function by forming a ligand-induced alternative fold that controls access to ribosome binding sites or other regulatory sites in RNA. Riboswitch-mediated mechanisms are ubiquitous across bacterial genomes. A typical class of riboswitch has its own unique structural and biological complexity, making de novo riboswitch identification a formidable task. Traditionally, riboswitches have been identified through comparative genomics based on sequence and structural homology. The limitations of structural-homology-based approaches, coupled with the assumption that there is a great diversity of undiscovered riboswitches, suggests the need for alternative methods for riboswitch identification, possibly based on features intrinsic to their structure. As of yet, no such reliable method has been proposed. We used structural entropy of riboswitch sequences as a measure of their secondary structural dynamics. Entropy values of a diverse set of riboswitches were compared to that of their mutants, their dinucleotide shuffles, and their reverse complement sequences under different stochastic context-free grammar folding models. Significance of our results was evaluated by comparison to other approaches, such as the base-pairing entropy and energy landscapes dynamics. Classifiers based on structural entropy optimized via sequence and structural features were devised as riboswitch identifiers and tested on Bacillus subtilis, Escherichia coli, and Synechococcus elongatus as an exploration of structural entropy based approaches. The unusually long untranslated region of the cotH in Bacillus subtilis, as well as upstream regions of certain genes, such as the sucC genes were associated with significant structural entropy values in genome-wide examinations. Various tests show that there

  17. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction

    PubMed Central

    Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.

    2013-01-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231

  18. Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

    PubMed Central

    Toro-Ascuy, Daniela; Rojas-Araya, Bárbara; Valiente-Echeverría, Fernando; Soto-Rifo, Ricardo

    2016-01-01

    The human immunodeficiency virus type-1 (HIV-1) unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs) containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1), Staufen double-stranded RNA binding protein 1/2 (STAU1/2), or components of miRNA-induced silencing complex (miRISC) and processing bodies (PBs). More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A), allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries. PMID:27886048

  19. A core subunit of the RNA-processing/degrading exosome specifically influences cuticular wax biosynthesis in Arabidopsis.

    PubMed

    Hooker, Tanya S; Lam, Patricia; Zheng, Huanquan; Kunst, Ljerka

    2007-03-01

    The cuticle is an extracellular matrix composed of cutin polyester and waxes that covers aerial organs of land plants and protects them from environmental stresses. The Arabidopsis thaliana cer7 mutant exhibits reduced cuticular wax accumulation and contains considerably lower transcript levels of ECERIFERUM3/WAX2/YORE-YORE (CER3/WAX2/YRE), a key wax biosynthetic gene. We show here that CER7 protein is a putative 3'-5' exoribonuclease homologous to yeast Ribonuclease PH45 (RRP45p), a core subunit of the RNA processing and degrading exosome that controls the expression of CER3/WAX2/YRE. We propose that CER7 acts by degrading a specific mRNA species encoding a negative regulator of CER3/WAX2/YRE transcription. A second RRP45p homolog found in Arabidopsis, designated At RRP45a, is partially functionally redundant with CER7, and complete loss of RRP45 function in Arabidopsis is lethal. To our knowledge, CER7 is currently the only example of a core exosomal subunit specifically influencing a cellular process.

  20. Disruption of Higher Order DNA Structures in Friedreich’s Ataxia (GAA)n Repeats by PNA or LNA Targeting

    PubMed Central

    Bergquist, Helen; Rocha, Cristina S. J.; Álvarez-Asencio, Rubén; Nguyen, Chi-Hung; Rutland, Mark. W.; Smith, C. I. Edvard; Good, Liam; Nielsen, Peter E.; Zain, Rula

    2016-01-01

    Expansion of (GAA)n repeats in the first intron of the Frataxin gene is associated with reduced mRNA and protein levels and the development of Friedreich’s ataxia. (GAA)n expansions form non-canonical structures, including intramolecular triplex (H-DNA), and R-loops and are associated with epigenetic modifications. With the aim of interfering with higher order H-DNA (like) DNA structures within pathological (GAA)n expansions, we examined sequence-specific interaction of peptide nucleic acid (PNA) with (GAA)n repeats of different lengths (short: n=9, medium: n=75 or long: n=115) by chemical probing of triple helical and single stranded regions. We found that a triplex structure (H-DNA) forms at GAA repeats of different lengths; however, single stranded regions were not detected within the medium size pathological repeat, suggesting the presence of a more complex structure. Furthermore, (GAA)4-PNA binding of the repeat abolished all detectable triplex DNA structures, whereas (CTT)5-PNA did not. We present evidence that (GAA)4-PNA can invade the DNA at the repeat region by binding the DNA CTT strand, thereby preventing non-canonical-DNA formation, and that triplex invasion complexes by (CTT)5-PNA form at the GAA repeats. Locked nucleic acid (LNA) oligonucleotides also inhibited triplex formation at GAA repeat expansions, and atomic force microscopy analysis showed significant relaxation of plasmid morphology in the presence of GAA-LNA. Thus, by inhibiting disease related higher order DNA structures in the Frataxin gene, such PNA and LNA oligomers may have potential for discovery of drugs aiming at recovering Frataxin expression. PMID:27846236

  1. The crystal structure of the Split End protein SHARP adds a new layer of complexity to proteins containing RNA recognition motifs.

    PubMed

    Arieti, Fabiana; Gabus, Caroline; Tambalo, Margherita; Huet, Tiphaine; Round, Adam; Thore, Stéphane

    2014-06-01

    The Split Ends (SPEN) protein was originally discovered in Drosophila in the late 1990s. Since then, homologous proteins have been identified in eukaryotic species ranging from plants to humans. Every family member contains three predicted RNA recognition motifs (RRMs) in the N-terminal region of the protein. We have determined the crystal structure of the region of the human SPEN homolog that contains these RRMs-the SMRT/HDAC1 Associated Repressor Protein (SHARP), at 2.0 Å resolution. SHARP is a co-regulator of the nuclear receptors. We demonstrate that two of the three RRMs, namely RRM3 and RRM4, interact via a highly conserved interface. Furthermore, we show that the RRM3-RRM4 block is the main platform mediating the stable association with the H12-H13 substructure found in the steroid receptor RNA activator (SRA), a long, non-coding RNA previously shown to play a crucial role in nuclear receptor transcriptional regulation. We determine that SHARP association with SRA relies on both single- and double-stranded RNA sequences. The crystal structure of the SHARP-RRM fragment, together with the associated RNA-binding studies, extend the repertoire of nucleic acid binding properties of RRM domains suggesting a new hypothesis for a better understanding of SPEN protein functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. The crystal structure of the Split End protein SHARP adds a new layer of complexity to proteins containing RNA recognition motifs

    PubMed Central

    Arieti, Fabiana; Gabus, Caroline; Tambalo, Margherita; Huet, Tiphaine; Round, Adam; Thore, Stéphane

    2014-01-01

    The Split Ends (SPEN) protein was originally discovered in Drosophila in the late 1990s. Since then, homologous proteins have been identified in eukaryotic species ranging from plants to humans. Every family member contains three predicted RNA recognition motifs (RRMs) in the N-terminal region of the protein. We have determined the crystal structure of the region of the human SPEN homolog that contains these RRMs—the SMRT/HDAC1 Associated Repressor Protein (SHARP), at 2.0 Å resolution. SHARP is a co-regulator of the nuclear receptors. We demonstrate that two of the three RRMs, namely RRM3 and RRM4, interact via a highly conserved interface. Furthermore, we show that the RRM3–RRM4 block is the main platform mediating the stable association with the H12–H13 substructure found in the steroid receptor RNA activator (SRA), a long, non-coding RNA previously shown to play a crucial role in nuclear receptor transcriptional regulation. We determine that SHARP association with SRA relies on both single- and double-stranded RNA sequences. The crystal structure of the SHARP–RRM fragment, together with the associated RNA-binding studies, extend the repertoire of nucleic acid binding properties of RRM domains suggesting a new hypothesis for a better understanding of SPEN protein functions. PMID:24748666

  3. Effects of cysteine introduction into three homologous cytochromes C.

    PubMed

    Kobayashi, Yoshiko; Sonoyama, Takafumi; Takeda, Taku; Sambongi, Yoshihiro

    2009-05-01

    A cysteine residue was systematically introduced into three homologous cytochromes c from Hydrogenobacter thermophilus, Hydrogenophilus thermoluteolus, and Pseudomonas aeruginosa at a conserved position. The H. thermoluteolus variant showed the most decreased thermal stability as compared with the wild type, which might have been due in part to crosslinked polymer formation. The effects of cysteine introduction differed even at the conserved position in these homologous proteins.

  4. Possible quantum algorithm for the Lipshitz-Sarkar-Steenrod square for Khovanov homology

    NASA Astrophysics Data System (ADS)

    Ospina, Juan

    2013-05-01

    Recently the celebrated Khovanov Homology was introduced as a target for Topological Quantum Computation given that the Khovanov Homology provides a generalization of the Jones polynomal and then it is possible to think about of a generalization of the Aharonov.-Jones-Landau algorithm. Recently, Lipshitz and Sarkar introduced a space-level refinement of Khovanov homology. which is called Khovanov Homotopy. This refinement induces a Steenrod square operation Sq2 on Khovanov homology which they describe explicitly and then some computations of Sq2 were presented. Particularly, examples of links with identical integral Khovanov homology but with distinct Khovanov homotopy types were showed. In the presente work we will introduce possible quantum algorithms for the Lipshitz- Sarkar-Steenrod square for Khovanov Homolog and their possible simulations using computer algebra.

  5. ADAR RNA editing below the backbone.

    PubMed

    Keegan, Liam; Khan, Anzer; Vukic, Dragana; O'Connell, Mary

    2017-09-01

    ADAR RNA editing enzymes ( a denosine d e a minases acting on R NA) that convert adenosine bases to inosines were first identified biochemically 30 years ago. Since then, studies on ADARs in genetic model organisms, and evolutionary comparisons between them, continue to reveal a surprising range of pleiotropic biological effects of ADARs. This review focuses on Drosophila melanogaster , which has a single Adar gene encoding a homolog of vertebrate ADAR2 that site-specifically edits hundreds of transcripts to change individual codons in ion channel subunits and membrane and cytoskeletal proteins. Drosophila ADAR is involved in the control of neuronal excitability and neurodegeneration and, intriguingly, in the control of neuronal plasticity and sleep. Drosophila ADAR also interacts strongly with RNA interference, a key antiviral defense mechanism in invertebrates. Recent crystal structures of human ADAR2 deaminase domain-RNA complexes help to interpret available information on Drosophila ADAR isoforms and on the evolution of ADARs from tRNA deaminase ADAT proteins. ADAR RNA editing is a paradigm for the now rapidly expanding range of RNA modifications in mRNAs and ncRNAs. Even with recent progress, much remains to be understood about these groundbreaking ADAR RNA modification systems. © 2017 Keegan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

    PubMed Central

    Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.

    2013-01-01

    The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545

  7. Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling.

    PubMed

    Oviedo, Néstor J; Pearson, Bret J; Levin, Michael; Sánchez Alvarado, Alejandro

    2008-01-01

    We have identified two genes, Smed-PTEN-1 and Smed-PTEN-2, capable of regulating stem cell function in the planarian Schmidtea mediterranea. Both genes encode proteins homologous to the mammalian tumor suppressor, phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Inactivation of Smed-PTEN-1 and -2 by RNA interference (RNAi) in planarians disrupts regeneration, and leads to abnormal outgrowths in both cut and uncut animals followed soon after by death (lysis). The resulting phenotype is characterized by hyperproliferation of neoblasts (planarian stem cells), tissue disorganization and a significant accumulation of postmitotic cells with impaired differentiation capacity. Further analyses revealed that rapamycin selectively prevented such accumulation without affecting the normal neoblast proliferation associated with physiological turnover and regeneration. In animals in which PTEN function is abrogated, we also detected a significant increase in the number of cells expressing the planarian Akt gene homolog (Smed-Akt). However, functional abrogation of Smed-Akt in Smed-PTEN RNAi-treated animals does not prevent cell overproliferation and lethality, indicating that functional abrogation of Smed-PTEN is sufficient to induce abnormal outgrowths. Altogether, our data reveal roles for PTEN in the regulation of planarian stem cells that are strikingly conserved to mammalian models. In addition, our results implicate this protein in the control of stem cell maintenance during the regeneration of complex structures in planarians.

  8. HTLV-1 Tax plugs and freezes UPF1 helicase leading to nonsense-mediated mRNA decay inhibition.

    PubMed

    Fiorini, Francesca; Robin, Jean-Philippe; Kanaan, Joanne; Borowiak, Malgorzata; Croquette, Vincent; Le Hir, Hervé; Jalinot, Pierre; Mocquet, Vincent

    2018-01-30

    Up-Frameshift Suppressor 1 Homolog (UPF1) is a key factor for nonsense-mediated mRNA decay (NMD), a cellular process that can actively degrade mRNAs. Here, we study NMD inhibition during infection by human T-cell lymphotropic virus type I (HTLV-1) and characterise the influence of the retroviral Tax factor on UPF1 activity. Tax interacts with the central helicase core domain of UPF1 and might plug the RNA channel of UPF1, reducing its affinity for nucleic acids. Furthermore, using a single-molecule approach, we show that the sequential interaction of Tax with a RNA-bound UPF1 freezes UPF1: this latter is less sensitive to the presence of ATP and shows translocation defects, highlighting the importance of this feature for NMD. These mechanistic insights reveal how HTLV-1 hijacks the central component of NMD to ensure expression of its own genome.

  9. Genetic Relatedness Among Human Rotaviruses as Determined by RNA Hybridization

    PubMed Central

    Flores, Jorge; Perez, Irene; White, Laura; Perez, Mireya; Kalica, Anthony R.; Marquina, Ruben; Wyatt, Richard G.; Kapikian, Albert Z.; Chanock, Robert M.

    1982-01-01

    Viral RNAs from human rotaviruses were compared by gel electrophoresis and by hybridization to probes prepared by in vitro transcription of two well-characterized laboratory strains (Wa and DS-1). Also, the viral RNAs were compared by hybridization to probes prepared from three of the test viruses. Thirteen specimens (diarrheal stools) were obtained from infants and children 5 to 21 months old on a single day at the emergency ward of the Caracas Children's Hospital, and an additional specimen was obtained from the same hospital 6 months before. When the electrophoresed viral RNAs were stained with ethidium bromide and examined by UV light, five different migration patterns (electropherotypes) were distinguished on the basis of differences in mobility of the RNA segments. The hybridization technique that was employed permitted only qualitative comparisons of corresponding genes of different human rotaviruses. Ten of the specimens contained enough virus to yield sufficient RNA for hybridization studies. Eight of the viruses studied by hybridization contained 4 to 11 genes that reacted specifically with the Wa probe to yield double-stranded RNA segments with a mobility similar to that of Wa viral RNA or test virus RNA. The other two viruses contained 11 genes that reacted specifically with the DS-1 hybridization probe to yield double-stranded RNA segments with a mobility similar to DS-1 viral RNA or test virus RNA. A more complex picture emerged when hybridization probes were prepared from three of the test viruses and used to compare the different electropherotypes. Corresponding genes that exhibited similar migration did not necessarily exhibit homology when studied by hybridization. Also, some corresponding genes that exhibited homology did not have the same mobility by gel electrophoresis. Images PMID:6288569

  10. Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

    PubMed

    Faragher, S G; Dalgarno, L

    1986-07-20

    The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

  11. Development and Evaluation of a Novel Multicopy-Element-Targeting Triplex PCR for Detection of Mycobacterium avium subsp. paratuberculosis in Feces

    PubMed Central

    Garrido, Joseba M.; Molina, Elena; Geijo, María V.; Elguezabal, Natalia; Vázquez, Patricia; Juste, Ramón A.

    2014-01-01

    The enteropathy called paratuberculosis (PTB), which mainly affects ruminants and has a worldwide distribution, is caused by Mycobacterium avium subsp. paratuberculosis. This disease significantly reduces the cost-effectiveness of ruminant farms, and therefore, reliable and rapid detection methods are needed to control the spread of the bacterium in livestock and in the environment. The aim of this study was to identify a specific and sensitive combination of DNA extraction and amplification to detect M. avium subsp. paratuberculosis in feces. Negative bovine fecal samples were inoculated with increasing concentrations of two different bacterial strains (field and reference) to compare the performance of four extraction and five amplification protocols. The best results were obtained using the JohnePrep and MagMax extraction kits combined with an in-house triplex real-time PCR designed to detect IS900, ISMap02 (an insertion sequence of M. avium subsp. paratuberculosis present in 6 copies per genome), and an internal amplification control DNA simultaneously. These combinations detected 10 M. avium subsp. paratuberculosis cells/g of spiked feces. The triplex PCR detected 1 fg of genomic DNA extracted from the reference strain K10. The performance of the robotized version of the MagMax extraction kit combined with the IS900 and ISMap02 PCR was further evaluated using 615 archival fecal samples from the first sampling of nine Friesian cattle herds included in a PTB control program and followed up for at least 4 years. The analysis of the results obtained in this survey demonstrated that the diagnostic method was highly specific and sensitive for the detection of M. avium subsp. paratuberculosis in fecal samples from cattle and a very valuable tool to be used in PTB control programs. PMID:24727272

  12. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing.

    PubMed

    Makeyev, Eugene V; Zhang, Jiangwen; Carrasco, Monica A; Maniatis, Tom

    2007-08-03

    Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing.

  13. RNA 3D Modules in Genome-Wide Predictions of RNA 2D Structure

    PubMed Central

    Theis, Corinna; Zirbel, Craig L.; zu Siederdissen, Christian Höner; Anthon, Christian; Hofacker, Ivo L.; Nielsen, Henrik; Gorodkin, Jan

    2015-01-01

    Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution. These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D module prediction tools and apply them on a 13-way vertebrate sequence-based alignment. We find that RNA 3D modules predicted by metaRNAmodules and JAR3D are significantly enriched in the screened windows compared to their shuffled counterparts. The initially estimated FDR of 47.0% is lowered to below 25% when certain 3D module predictions are present in the window of the 2D prediction. We discuss the implications and prospects for further development of computational strategies for detection of RNA 2D structure in genomic sequence. PMID:26509713

  14. Zeroth Poisson Homology, Foliated Cohomology and Perfect Poisson Manifolds

    NASA Astrophysics Data System (ADS)

    Martínez-Torres, David; Miranda, Eva

    2018-01-01

    We prove that, for compact regular Poisson manifolds, the zeroth homology group is isomorphic to the top foliated cohomology group, and we give some applications. In particular, we show that, for regular unimodular Poisson manifolds, top Poisson and foliated cohomology groups are isomorphic. Inspired by the symplectic setting, we define what a perfect Poisson manifold is. We use these Poisson homology computations to provide families of perfect Poisson manifolds.

  15. Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

    PubMed

    Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

    2018-06-22

    Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

  16. Structure–function studies of STAR family Quaking proteins bound to their in vivo RNA target sites

    PubMed Central

    Teplova, Marianna; Hafner, Markus; Teplov, Dmitri; Essig, Katharina; Tuschl, Thomas; Patel, Dinshaw J.

    2013-01-01

    Mammalian Quaking (QKI) and its Caenorhabditis elegans homolog, GLD-1 (defective in germ line development), are evolutionarily conserved RNA-binding proteins, which post-transcriptionally regulate target genes essential for developmental processes and myelination. We present X-ray structures of the STAR (signal transduction and activation of RNA) domain, composed of Qua1, K homology (KH), and Qua2 motifs of QKI and GLD-1 bound to high-affinity in vivo RNA targets containing YUAAY RNA recognition elements (RREs). The KH and Qua2 motifs of the STAR domain synergize to specifically interact with bases and sugar-phosphate backbones of the bound RRE. Qua1-mediated homodimerization generates a scaffold that enables concurrent recognition of two RREs, thereby plausibly targeting tandem RREs present in many QKI-targeted transcripts. Structure-guided mutations reduced QKI RNA-binding affinity in vitro and in vivo, and expression of QKI mutants in human embryonic kidney cells (HEK293) significantly decreased the abundance of QKI target mRNAs. Overall, our studies define principles underlying RNA target selection by STAR homodimers and provide insights into the post-transcriptional regulatory function of mammalian QKI proteins. PMID:23630077

  17. ATP-independent diffusion of double-stranded RNA binding proteins

    PubMed Central

    Koh, Hye Ran; Kidwell, Mary Anne; Ragunathan, Kaushik; Doudna, Jennifer A.; Myong, Sua

    2013-01-01

    The proteins harboring double-stranded RNA binding domains (dsRBDs) play diverse functional roles such as RNA localization, splicing, editing, export, and translation, yet mechanistic basis and functional significance of dsRBDs remain unclear. To unravel this enigma, we investigated transactivation response RNA binding protein (TRBP) consisting of three dsRBDs, which functions in HIV replication, protein kinase R(PKR)–mediated immune response, and RNA silencing. Here we report an ATP-independent diffusion activity of TRBP exclusively on dsRNA in a length-dependent manner. The first two dsRBDs of TRBP are essential for diffusion, whereas the third dsRBD is dispensable. Two homologs of TRBP, PKR activator and R3D1-L, displayed the same diffusion, implying a universality of the diffusion activity among this protein family. Furthermore, a Dicer–TRBP complex on dsRNA exhibited dynamic diffusion, which was correlated with Dicer’s catalytic activity. These results implicate the dsRNA-specific diffusion activity of TRBP that contributes to enhancing siRNA and miRNA processing by Dicer. PMID:23251028

  18. Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nitsche, E.M.; Moquin, A.; Adams, P.S.

    1996-05-03

    Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

  19. RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

    PubMed

    Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

    2013-08-01

    Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

  20. The Metastasis Efficiency Modifier Ribosomal RNA Processing 1 Homolog B (RRP1B) Is a Chromatin-associated Factor*

    PubMed Central

    Crawford, Nigel P. S.; Yang, Hailiu; Mattaini, Katherine R.; Hunter, Kent W.

    2009-01-01

    There is accumulating evidence for a role of germ line variation in breast cancer metastasis. We have recently identified a novel metastasis susceptibility gene, Rrp1b (ribosomal RNA processing 1 homolog B). Overexpression of Rrp1b in a mouse mammary tumor cell line induces a gene expression signature that predicts survival in breast cancer. Here we extend the analysis of RRP1B function by demonstrating that the Rrp1b activation gene expression signature accurately predicted the outcome in three of four publicly available breast carcinoma gene expression data sets. In addition, we provide insights into the mechanism of RRP1B. Tandem affinity purification demonstrated that RRP1B physically interacts with many nucleosome binding factors, including histone H1X, poly(ADP-ribose) polymerase 1, TRIM28 (tripartite motif-containing 28), and CSDA (cold shock domain protein A). Co-immunofluorescence and co-immunoprecipitation confirmed these interactions and also interactions with heterochromatin protein-1α and acetyl-histone H4 lysine 5. Finally, we investigated the effects of ectopic expression of an RRP1B allelic variant previously associated with improved survival in breast cancer. Gene expression analyses demonstrate that, compared with ectopic expression of wild type RRP1B in HeLa cells, the variant RRP1B differentially modulates various transcription factors controlled by TRIM28 and CSDA. These data suggest that RRP1B, a tumor progression and metastasis susceptibility candidate gene, is potentially a dynamic modulator of transcription and chromatin structure. PMID:19710015

  1. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  2. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  3. Decorated Heegaard Diagrams and Combinatorial Heegaard Floer Homology

    NASA Astrophysics Data System (ADS)

    Hammarsten, Carl

    Heegaard Floer homology is a collection of invariants for closed oriented three-manifolds, introduced by Ozsvath and Szabo in 2001. The simplest version is defined as the homology of a chain complex coming from a Heegaard diagram of the three manifold. In the original definition, the differentials count the number of points in certain moduli spaces of holomorphic disks, which are hard to compute in general. More recently, Sarkar and Wang (2006) and Ozsvath, Stipsicz and Szabo, (2009) have determined combinatorial methods for computing this homology with Z2 coefficients. Both methods rely on the construction of very specific Heegaard diagrams for the manifold, which are generally very complicated. Given a decorated Heegaard diagram H for a closed oriented 3-manifold Y, that is a Heegaard diagram together with a collection of embedded paths satisfying certain criteria, we describe a combinatorial recipe for a chain complex CF'[special character omitted]( H). If H satisfies some technical constraints we show that this chain complex is homotopically equivalent to the Heegaard Floer chain complex CF[special character omitted](H) and hence has the Heegaard Floer homology HF[special character omitted](Y) as its homology groups. Using branched spines we give an algorithm to construct a decorated Heegaard diagram which satisfies the necessary technical constraints for every closed oriented Y. We present this diagram graphically in the form of a strip diagram.

  4. A hot-spot-active magnetic graphene oxide substrate for microRNA detection based on cascaded chemiluminescence resonance energy transfer

    NASA Astrophysics Data System (ADS)

    Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying

    2015-02-01

    Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal ``off'' state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an ``open'' configuration of the hairpin probe and a CRET signal ``on'' state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme

  5. RNA Recombination In Vivo in the Absence of Viral Replication

    PubMed Central

    Gallei, Andreas; Pankraz, Alexander; Thiel, Heinz-Jürgen; Becher, Paul

    2004-01-01

    To study fundamental aspects of RNA recombination, an in vivo RNA recombination system was established. This system allowed the efficient generation of recombinant cytopathogenic pestiviruses after transfection of synthetic, nonreplicatable, subgenomic transcripts in cells infected with a replicating noncytopathogenic virus. Studies addressing the interplay between RNA recombination and replication revealed that cotransfection of noninfected cells with various pairs of nonreplicatable RNA derivatives also led to the emergence of recombinant viral genomes. Remarkably, homologous and nonhomologous recombination occurred between two overlapping transcripts, each lacking different essential parts of the viral RNA-dependent RNA polymerase (RdRp) gene. Apart from the generally accepted viral replicative copy choice recombination, our results prove the existence of a viral RdRp-independent mechanism of RNA recombination that occurs in vivo. It appears likely that such a mechanism not only contributes to the evolution of RNA viruses but also leads to the generation of recombinant cellular RNAs. PMID:15163720

  6. Editing of the grapevine mitochondrial cytochrome b mRNA and molecular modeling of the protein.

    PubMed

    Islas-Osuna, María A; Silva-Moreno, Begonia; Caceres-Carrizosa, Nidia; García-Robles, Jesús M; Sotelo-Mundo, Rogerio R; Yepiz-Plascencia, Gloria M

    2006-05-01

    Cytochrome b (COB), the central catalytic subunit of ubiquinol cytochrome c reductase, is a component of the transmembrane electron transfer chain that generates proton motive force. Some plant COB mRNAs are processed by RNA editing, which changes the gene coding sequence. This report presents the sequences of the grapevine (Vitis vinifera L.) mitochondrial gene for apocytochrome b (cob), the edited mRNA and the deduced protein. Grapevine COB is 393 amino acids long and is 98% identical to homologs in rapeseed, Arabidopsis thaliana and Oenothera sp. Twenty-one C-U editing sites were identified in the grapevine cob mRNA, resulting in 20 amino acid changes. These changes increase the overall hydrophobicity of the protein and result in a more conserved protein. Molecular modeling of grapevine COB shows that residues changed by RNA editing fit the secondary structure characteristic of an integral membrane protein. This is the first complete mitochondrial gene reported for grapevine. Novel RNA editing sites were identified in grapevine cob, which have not been previously reported for other plants.

  7. Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step.

    PubMed Central

    Eiler, S; Dock-Bregeon, A; Moulinier, L; Thierry, J C; Moras, D

    1999-01-01

    The 2.4 A crystal structure of the Escherichia coli aspartyl-tRNA synthetase (AspRS)-tRNA(Asp)-aspartyl-adenylate complex shows the two substrates poised for the transfer of the aspartic acid moiety from the adenylate to the 3'-hydroxyl of the terminal adenosine of the tRNA. A general molecular mechanism is proposed for the second step of the aspartylation reaction that accounts for the observed conformational changes, notably in the active site pocket. The stabilization of the transition state is mediated essentially by two amino acids: the class II invariant arginine of motif 2 and the eubacterial-specific Gln231, which in eukaryotes and archaea is replaced by a structurally non-homologous serine. Two archetypal RNA-protein modes of interactions are observed: the anticodon stem-loop, including the wobble base Q, binds to the N-terminal beta-barrel domain through direct protein-RNA interactions, while the binding of the acceptor stem involves both direct and water-mediated hydrogen bonds in an original recognition scheme. PMID:10562565

  8. Comprehensive Identification of mRNA-Binding Proteins of Leishmania donovani by Interactome Capture.

    PubMed

    Nandan, Devki; Thomas, Sneha A; Nguyen, Anne; Moon, Kyung-Mee; Foster, Leonard J; Reiner, Neil E

    2017-01-01

    Leishmania are unicellular eukaryotes responsible for leishmaniasis in humans. Like other trypanosomatids, leishmania regulate protein coding gene expression almost exclusively at the post-transcriptional level with the help of RNA binding proteins (RBPs). Due to the presence of polycystronic transcription units, leishmania do not regulate RNA polymerase II-dependent transcription initiation. Recent evidence suggests that the main control points in gene expression are mRNA degradation and translation. Protein-RNA interactions are involved in every aspect of RNA biology, such as mRNA splicing, polyadenylation, localization, degradation, and translation. A detailed picture of these interactions would likely prove to be highly informative in understanding leishmania biology and virulence. We developed a strategy involving covalent UV cross-linking of RBPs to mRNA in vivo, followed by interactome capture using oligo(dT) magnetic beads to define comprehensively the mRNA interactome of growing L. donovani amastigotes. The protein mass spectrometry analysis of captured proteins identified 79 mRNA interacting proteins which withstood very stringent washing conditions. Strikingly, we found that 49 of these mRNA interacting proteins had no orthologs or homologs in the human genome. Consequently, these may represent high quality candidates for selective drug targeting leading to novel therapeutics. These results show that this unbiased, systematic strategy has the promise to be applicable to study the mRNA interactome during various biological settings such as metabolic changes, stress (low pH environment, oxidative stress and nutrient deprivation) or drug treatment.

  9. Targeted delivery of miRNA therapeutics for cardiovascular diseases: opportunities and challenges.

    PubMed

    Kwekkeboom, Rick F J; Lei, Zhiyong; Doevendans, Pieter A; Musters, René J P; Sluijter, Joost P G

    2014-09-01

    Dysregulation of miRNA expression has been associated with many cardiovascular diseases in animal models, as well as in patients. In the present review, we summarize recent findings on the role of miRNAs in cardiovascular diseases and discuss the opportunities, possibilities and challenges of using miRNAs as future therapeutic targets. Furthermore, we focus on the different approaches that can be used to deliver these newly developed miRNA therapeutics to their sites of action. Since siRNAs are structurally homologous with the miRNA therapeutics, important lessons learned from siRNA delivery strategies are discussed that might be applicable to targeted delivery of miRNA therapeutics, thereby reducing costs and potential side effects, and improving efficacy.

  10. Development and validation of duplex, triplex, and pentaplex real-time PCR screening assays for the detection of genetically modified organisms in food and feed.

    PubMed

    Huber, Ingrid; Block, Annette; Sebah, Daniela; Debode, Frédéric; Morisset, Dany; Grohmann, Lutz; Berben, Gilbert; Stebih, Dejan; Milavec, Mojca; Zel, Jana; Busch, Ulrich

    2013-10-30

    Worldwide, qualitative methods based on PCR are most commonly used as screening tools for genetically modified material in food and feed. However, the increasing number and diversity of genetically modified organisms (GMO) require effective methods for simultaneously detecting several genetic elements marking the presence of transgenic events. Herein we describe the development and validation of a pentaplex, as well as complementary triplex and duplex real-time PCR assays, for the detection of the most common screening elements found in commercialized GMOs: P-35S, T-nos, ctp2-cp4-epsps, bar, and pat. The use of these screening assays allows the coverage of many GMO events globally approved for commercialization. Each multiplex real-time PCR assay shows high specificity and sensitivity with an absolute limit of detection below 20 copies for the targeted sequences. We demonstrate by intra- and interlaboratory tests that the assays are robust as well as cost- and time-effective for GMO screening if applied in routine GMO analysis.

  11. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    PubMed

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  12. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    PubMed

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  13. The origin and evolution of tRNA inferred from phylogenetic analysis of structure.

    PubMed

    Sun, Feng-Jie; Caetano-Anollés, Gustavo

    2008-01-01

    The evolutionary history of the two structural and functional domains of tRNA is controversial but harbors the secrets of early translation and the genetic code. To explore the origin and evolution of tRNA, we reconstructed phylogenetic trees directly from molecular structure. Forty-two structural characters describing the geometry of 571 tRNAs and three statistical parameters describing thermodynamic and mechanical features of molecules quantitatively were used to derive phylogenetic trees of molecules and molecular substructures. Trees of molecules failed to group tRNA according to amino acid specificity and did not reveal the tripartite nature of life, probably due to loss of phylogenetic signal or because tRNA diversification predated organismal diversification. Trees of substructures derived from both structural and statistical characters support the origin of tRNA in the acceptor arm and the hypothesis that the top half domain composed of acceptor and pseudouridine (TPsiC) arms is more ancient than the bottom half domain composed of dihydrouridine (DHU) and anticodon arms. This constitutes the cornerstone of the genomic tag hypothesis that postulates tRNAs were ancient telomeres in the RNA world. The trees of substructures suggest a model for the evolution of the major functional and structural components of tRNA. In this model, short RNA hairpins with stems homologous to the acceptor arm of present day tRNAs were extended with regions homologous to TPsiC and anticodon arms. The DHU arm was then incorporated into the resulting three-stemmed structure to form a proto-cloverleaf structure. The variable region was the last structural addition to the molecular repertoire of evolving tRNA substructures.

  14. The semaphorontic view of homology.

    PubMed

    Havstad, Joyce C; Assis, Leandro C S; Rieppel, Olivier

    2015-11-01

    The relation of homology is generally characterized as an identity relation, or alternatively as a correspondence relation, both of which are transitive. We use the example of the ontogenetic development and evolutionary origin of the gnathostome jaw to discuss identity and transitivity of the homology relation under the transformationist and emergentist paradigms respectively. Token identity and consequent transitivity of homology relations are shown to be requirements that are too strong to allow the origin of genuine evolutionary novelties. We consequently introduce the concept of compositional identity that is grounded in relations prevailing between parts (organs and organ systems) of a whole (organism). We recognize an ontogenetic identity of parts within a whole throughout the sequence of successive developmental stages of those parts: this is an intra-organismal character identity maintained throughout developmental trajectory. Correspondingly, we recognize a phylogenetic identity of homologous parts within two or more organisms of different species: this is an inter-species character identity maintained throughout evolutionary trajectory. These different dimensions of character identity--ontogenetic (through development) and phylogenetic (via shared evolutionary history)--break the transitivity of homology relations. Under the transformationist paradigm, the relation of homology reigns over the entire character (-state) transformation series, and thus encompasses the plesiomorphic as well as the apomorphic condition of form. In contrast, genuine evolutionary novelties originate not through transformation of ancestral characters (-states), but instead through deviating developmental trajectories that result in alternate characters. Under the emergentist paradigm, homology is thus synonymous with synapomorphy. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  15. Somatic Mutations and Neoepitope Homology in Melanomas Treated with CTLA-4 Blockade.

    PubMed

    Nathanson, Tavi; Ahuja, Arun; Rubinsteyn, Alexander; Aksoy, Bulent Arman; Hellmann, Matthew D; Miao, Diana; Van Allen, Eliezer; Merghoub, Taha; Wolchok, Jedd D; Snyder, Alexandra; Hammerbacher, Jeff

    2017-01-01

    Immune checkpoint inhibitors are promising treatments for patients with a variety of malignancies. Toward understanding the determinants of response to immune checkpoint inhibitors, it was previously demonstrated that the presence of somatic mutations is associated with benefit from checkpoint inhibition. A hypothesis was posited that neoantigen homology to pathogens may in part explain the link between somatic mutations and response. To further examine this hypothesis, we reanalyzed cancer exome data obtained from our previously published study of 64 melanoma patients treated with CTLA-4 blockade and a new dataset of RNA-Seq data from 24 of these patients. We found that the ability to accurately predict patient benefit did not increase as the analysis narrowed from somatic mutation burden, to inclusion of only those mutations predicted to be MHC class I neoantigens, to only including those neoantigens that were expressed or that had homology to pathogens. The only association between somatic mutation burden and response was found when examining samples obtained prior to treatment. Neoantigen and expressed neoantigen burden were also associated with response, but neither was more predictive than somatic mutation burden. Neither the previously described tetrapeptide signature nor an updated method to evaluate neoepitope homology to pathogens was more predictive than mutation burden. Cancer Immunol Res; 5(1); 84-91. ©2016 AACR. ©2016 American Association for Cancer Research.

  16. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  17. Induction of homologous recombination in Saccharomyces cerevisiae.

    PubMed

    Simon, J R; Moore, P D

    1988-09-01

    We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

  18. RNA Polymerase III promoter screen uncovers a novel noncoding RNA family conserved in Caenorhabditis and other clade V nematodes.

    PubMed

    Gruber, Andreas R

    2014-07-10

    RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Homologous Recombination—Experimental Systems, Analysis and Significance

    PubMed Central

    Kuzminov, Andrei

    2014-01-01

    Homologous recombination is the most complex of all recombination events that shape genomes and produce material for evolution. Homologous recombination events are exchanges between DNA molecules in the lengthy regions of shared identity, catalyzed by a group of dedicated enzymes. There is a variety of experimental systems in E. coli and Salmonella to detect homologous recombination events of several different kinds. Genetic analysis of homologous recombination reveals three separate phases of this process: pre-synapsis (the early phase), synapsis (homologous strand exchange) and post-synapsis (the late phase). In E. coli, there are at least two independent pathway of the early phase and at least two independent pathways of the late phase. All this complexity is incongruent with the originally ascribed role of homologous recombination as accelerator of genome evolution: there is simply not enough duplication and repetition in enterobacterial genomes for homologous recombination to have a detectable evolutionary role, and therefore not enough selection to maintain such a complexity. At the same time, the mechanisms of homologous recombination are uniquely suited for repair of complex DNA lesions called chromosomal lesions. In fact, the two major classes of chromosomal lesions are recognized and processed by the two individual pathways at the early phase of homologous recombination. It follows, therefore, that homologous recombination events are occasional reflections of the continual recombinational repair, made possible in cases of natural or artificial genome redundancy. PMID:26442506

  20. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  1. [Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

    PubMed

    Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

    2017-03-01

    Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

  2. Identification of Lethal Mutations in Yeast Threonyl-tRNA Synthetase Revealing Critical Residues in Its Human Homolog*

    PubMed Central

    Ruan, Zhi-Rong; Fang, Zhi-Peng; Ye, Qing; Lei, Hui-Yan; Eriani, Gilbert; Zhou, Xiao-Long; Wang, En-Duo

    2015-01-01

    Aminoacyl-tRNA synthetases (aaRSs) are a group of ancient enzymes catalyzing aminoacylation and editing reactions for protein biosynthesis. Increasing evidence suggests that these critical enzymes are often associated with mammalian disorders. Therefore, complete determination of the enzymes functions is essential for informed diagnosis and treatment. Here, we show that a yeast knock-out strain for the threonyl-tRNA synthetase (ThrRS) gene is an excellent platform for such an investigation. Saccharomyces cerevisiae ThrRS has a unique modular structure containing four structural domains and a eukaryote-specific N-terminal extension. Using randomly mutated libraries of the ThrRS gene (thrS) and a genetic screen, a set of loss-of-function mutants were identified. The mutations affected the synthetic and editing activities and influenced the dimer interface. The results also highlighted the role of the N-terminal extension for enzymatic activity and protein stability. To gain insights into the pathological mechanisms induced by mutated aaRSs, we systematically introduced the loss-of-function mutations into the human cytoplasmic ThrRS gene. All mutations induced similar detrimental effects, showing that the yeast model could be used to study pathology-associated point mutations in mammalian aaRSs. PMID:25416776

  3. The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain-Specific Alternative Pre-mRNA Splicing

    PubMed Central

    Makeyev, Eugene V.; Zhang, Jiangwen; Carrasco, Monica A.; Maniatis, Tom

    2011-01-01

    SUMMARY Both microRNAs and alternative pre-mRNA splicing have been implicated in the development of the nervous system (NS), but functional interactions between these two pathways are poorly understood. We demonstrate that the neuron-specific microRNA miR-124 directly targets PTBP1 (PTB/hnRNP I) mRNA, which encodes a global repressor of alternative pre-mRNA splicing in nonneuronal cells. Among the targets of PTBP1 is a critical cassette exon in the pre-mRNA of PTBP2 (nPTB/brPTB/PTBLP), an NS-enriched PTBP1 homolog. When this exon is skipped, PTBP2 mRNA is subject to nonsense-mediated decay (NMD). During neuronal differentiation, miR-124 reduces PTBP1 levels, leading to the accumulation of correctly spliced PTBP2 mRNA and a dramatic increase in PTBP2 protein. These events culminate in the transition from non-NS to NS-specific alternative splicing patterns. We also present evidence that miR-124 plays a key role in the differentiation of progenitor cells to mature neurons. Thus, miR-124 promotes NS development, at least in part by regulating an intricate network of NS-specific alternative splicing. PMID:17679093

  4. Staufen1 dimerizes via a conserved motif and a degenerate dsRNA-binding domain to promote mRNA decay

    PubMed Central

    Gleghorn, Michael L.; Gong, Chenguang; Kielkopf, Clara L.; Maquat, Lynne E.

    2014-01-01

    Staufen (STAU)1-mediated mRNA decay (SMD) degrades mammalian-cell mRNAs that bind the double-stranded (ds)RNA-binding protein STAU1 in their 3′-untranslated region. We report a new motif, which typifies STAU homologs from all vertebrate classes, that is responsible for human (h)STAU1 homodimerization. Our crystal structure and mutagenesis analyses reveal that this motif, now named the Staufen-swapping motif (SSM), and dsRNA-binding domain 5 (‘RBD’5) mediate protein dimerization: the two SSM α-helices of one molecule interact primarily through a hydrophobic patch with the two ‘RBD’5 α-helices of a second molecule. ‘RBD’5 adopts the canonical α-β-β-β-α fold of a functional RBD, but it lacks residues and features needed to bind duplex RNA. In cells, SSM-mediated hSTAU1 dimerization increases the efficiency of SMD by augmenting hSTAU1 binding to the ATP-dependent RNA helicase hUPF1. Dimerization regulates keratinocyte-mediated wound-healing and, undoubtedly, many other cellular processes. PMID:23524536

  5. Reduced genetic distance and high replication levels increase the RNA recombination rate of hepatitis delta virus.

    PubMed

    Lin, Chia-Chi; Yang, Zhi-Wei; Iang, Shan-Bei; Chao, Mei

    2015-01-02

    Hepatitis delta virus (HDV) replication is carried out by host RNA polymerases. Since homologous inter-genotypic RNA recombination is known to occur in HDV, possibly via a replication-dependent process, we hypothesized that the degree of sequence homology and the replication level should be related to the recombination frequency in cells co-expressing two HDV sequences. To confirm this, we separately co-transfected cells with three different pairs of HDV genomic RNAs and analyzed the obtained recombinants by RT-PCR followed by restriction fragment length polymorphism and sequencing analyses. The sequence divergence between the clones ranged from 24% to less than 0.1%, and the difference in replication levels was as high as 100-fold. As expected, significant differences were observed in the recombination frequencies, which ranged from 0.5% to 47.5%. Furthermore, varying the relative amounts of parental RNA altered the dominant recombinant species produced, suggesting that template switching occurs frequently during the synthesis of genomic HDV RNA. Taken together, these data suggest that during the host RNA polymerase-driven RNA recombination of HDV, both inter- and intra-genotypic recombination events are important in shaping the genetic diversity of HDV. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

    PubMed

    Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

    1998-04-06

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

  7. The semaphorontic view of homology

    PubMed Central

    Assis, Leandro C.S.; Rieppel, Olivier

    2015-01-01

    ABSTRACT The relation of homology is generally characterized as an identity relation, or alternatively as a correspondence relation, both of which are transitive. We use the example of the ontogenetic development and evolutionary origin of the gnathostome jaw to discuss identity and transitivity of the homology relation under the transformationist and emergentist paradigms respectively. Token identity and consequent transitivity of homology relations are shown to be requirements that are too strong to allow the origin of genuine evolutionary novelties. We consequently introduce the concept of compositional identity that is grounded in relations prevailing between parts (organs and organ systems) of a whole (organism). We recognize an ontogenetic identity of parts within a whole throughout the sequence of successive developmental stages of those parts: this is an intra‐organismal character identity maintained throughout developmental trajectory. Correspondingly, we recognize a phylogenetic identity of homologous parts within two or more organisms of different species: this is an inter‐species character identity maintained throughout evolutionary trajectory. These different dimensions of character identity—ontogenetic (through development) and phylogenetic (via shared evolutionary history)—break the transitivity of homology relations. Under the transformationist paradigm, the relation of homology reigns over the entire character (‐state) transformation series, and thus encompasses the plesiomorphic as well as the apomorphic condition of form. In contrast, genuine evolutionary novelties originate not through transformation of ancestral characters (‐states), but instead through deviating developmental trajectories that result in alternate characters. Under the emergentist paradigm, homology is thus synonymous with synapomorphy. J. Exp. Zool. (Mol. Dev. Evol.) 324B: 578–587, 2015. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and

  8. Tongue Epithelium Cells from shRNA Mediated Transgenic Goat Show High Resistance to Foot and Mouth Disease Virus

    PubMed Central

    Li, Wenting; Wang, Kejun; Kang, Shimeng; Deng, Shoulong; Han, Hongbing; Lian, Ling; Lian, Zhengxing

    2015-01-01

    Foot and mouth disease induced by foot and mouth disease virus (FMDV) is severe threat to cloven-hoofed domestic animals. The gene 3Dpol in FMDV genome encodes the viral RNA polymerase, a vital element for FMDV replication. In this study, a conserved 3D-7414shRNA targeting FMDV-3Dpol gene was designed and injected into pronuclear embryos to produce the transgenic goats. Sixty-one goats were produced, of which, seven goats positively integrated 3D-7414shRNA. Loss of function assay demonstrated that siRNA effectively knockdown 3Dpol gene in skin epithelium cells of transgenic goats. Subsequently, the tongue epithelium cells from transgenic and non-transgenic goats were infected with FMDV O/YS/CHA/05 strain. A significant decrease of virus titres and virus copy number was observed in cells of transgenic goats compared with that of non-transgenic goats, which indicated that 3D-7414siRNA inhibited FMDV replication by interfering FMDV-3Dpol gene. Furthermore, we found that expression of TLR7, RIG-I and TRAF6 was lower in FMDV infected cells from transgenic goats compared to that from non-transgenic goats, which might result from lower virus copy number in transgenic goats’ cells. In conclusion, we successfully produced transgenic goats highly expressing 3D-7414siRNA targeting 3Dpol gene, and the tongue epithelium cells from the transgenic goats showed effective resistance to FMDV. PMID:26671568

  9. A hot-spot-active magnetic graphene oxide substrate for microRNA detection based on cascaded chemiluminescence resonance energy transfer.

    PubMed

    Bi, Sai; Chen, Min; Jia, Xiaoqiang; Dong, Ying

    2015-02-28

    Herein, a cascaded chemiluminescence resonance energy transfer (C-CRET) process was demonstrated from horseradish peroxidase (HRP)-mimicking DNAzyme-catalyzed luminol-H2O2 to fluorescein and further to graphene oxide (GO) when HRP-mimicking DNAzyme/fluorescein was in close proximity to the GO surface. The proposed C-CRET system was successfully implemented to construct three modes of C-CRET hot-spot-active substrates (modes I, II and III) by covalently immobilizing HRP-mimicking DNAzyme/fluorescein-labeled hairpin DNAs (hot-spot-generation probes) on magnetic GO (MGO), resulting in a signal "off" state due to the quenching of the luminol/H2O2/HRP-mimicking DNAzyme/fluorescein CRET system by GO. Upon the introduction of microRNA-122 (miRNA-122), the targets (mode I) or the new triggers that were generated through a strand displacement reaction (SDR) initiated by miRNA-122 (modes II and III) hybridized with the loop domains of hairpin probes on MGO to form double-stranded (modes I and II) or triplex-stem structures (mode III), causing an "open" configuration of the hairpin probe and a CRET signal "on" state, thus achieving sensitive and selective detection of miRNA-122. More importantly, the substrate exhibited excellent controllability, reversibility and reproducibility through SDR and magnetic separation (modes II and III), especially sequence-independence for hairpin probes in mode III, holding great potential for the development of a versatile platform for optical biosensing.

  10. Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    PubMed Central

    Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

    2011-01-01

    Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

  11. The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1.

    PubMed Central

    Toczyski, D P; Steitz, J A

    1993-01-01

    EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

  12. Isolation and characterization of Xenopus laevis homologs of the mouse inv gene and functional analysis of the conserved calmodulin binding sites.

    PubMed

    Yasuhiko, Yukuto; Shiokawa, Koichiro; Mochizuki, Toshio; Asashima, Makoto; Yokoyama, Takahiko

    2006-04-01

    The homozygous inv (inversion of embryonic turning) mouse mutant shows situs inversus and polycystic kidney disease, both of which result from the lack of the inv gene. Previously, we suggested that inv may be important for the left-right axis formation, not only in mice but also in Xenopus, and that calmodulin regulates this inv protein function. Here, we isolated and characterized two Xenopus laevis homologs (Xinv-1 and Xinv-2) of the mouse inv gene, and performed functional analysis of the conserved IQ motifs that interact with calmodulin. Xinv-1 expresses early in development in the same manner as mouse inv does. Unexpectedly, a full-length Xenopus inv mRNA did not randomize cardiac orientation when injected into Xenopus embryos, which is different from mouse inv mRNA. Contrary to mouse inv mRNA, Xenopus inv mRNA with mutated IQ randomized cardiac orientation. The present study indicates that calmodulin binding sites (IQ motifs) are crucial in controlling the biological activity of both mouse and Xenopus inv proteins. Although mouse and Xenopus inv genes have a quite similar structure, the interaction with calmodulin and IQ motifs of Xenopus inv and mouse inv proteins may regulate their function in different ways.

  13. Intermolecular Interactions of Homologs of Germ Plasm Components in Mammalian Germ Cells

    PubMed Central

    Fox, Mark S.; Clark, Amander T.; El Majdoubi, Mohammed; Vigne, Jean-Louis; Urano, Jun; Hostetler, Chris E.; Griswold, Michael D.; Weiner, Richard I.; Pera, Renee A. Reijo

    2007-01-01

    In some species such as flies, worms, frogs, and fish the key to forming and maintaining early germ cell populations is the assembly of germ plasm, microscopically-distinct egg cytoplasm that is rich in RNAs, RNA-binding proteins and ribosomes. Cells which inherit germ plasm are destined for the germ cell lineage. In contrast, in mammals, germ cells are formed and maintained later in development as a result of inductive signaling from one embryonic cell type to another. Research advances, using complementary approaches, including identification of key signaling factors that act during the initial stages of germ cell development, differentiation of germ cells in vitro from mouse and human embryonic stem cells and the demonstration, that homologs of germ plasm components are conserved in mammals, have shed light on key elements in the early development of mammalian germ cells. Here, we use FRET (Fluorescence Resonance Energy Transfer) to demonstrate that living mammalian germ cells possess specific RNA/protein complexes that contain germ plasm homologs, beginning in the earliest stages of development examined. Moreover, we demonstrate that although both human and mouse germ cells and embryonic stem cells express the same proteins, germ cell specific protein/protein interactions distinguish germ cells from precursor embryonic stem cells in vitro; interactions also determine sub-cellular localization of complex components. Finally, we suggest that assembly of similar protein complexes may be central to differentiation of diverse cell lineages and provide useful diagnostic tools for isolation of specific cell types from the assorted types differentiated from embryonic stem cells. PMID:16996493

  14. Web-Beagle: a web server for the alignment of RNA secondary structures.

    PubMed

    Mattei, Eugenio; Pietrosanto, Marco; Ferrè, Fabrizio; Helmer-Citterich, Manuela

    2015-07-01

    Web-Beagle (http://beagle.bio.uniroma2.it) is a web server for the pairwise global or local alignment of RNA secondary structures. The server exploits a new encoding for RNA secondary structure and a substitution matrix of RNA structural elements to perform RNA structural alignments. The web server allows the user to compute up to 10 000 alignments in a single run, taking as input sets of RNA sequences and structures or primary sequences alone. In the latter case, the server computes the secondary structure prediction for the RNAs on-the-fly using RNAfold (free energy minimization). The user can also compare a set of input RNAs to one of five pre-compiled RNA datasets including lncRNAs and 3' UTRs. All types of comparison produce in output the pairwise alignments along with structural similarity and statistical significance measures for each resulting alignment. A graphical color-coded representation of the alignments allows the user to easily identify structural similarities between RNAs. Web-Beagle can be used for finding structurally related regions in two or more RNAs, for the identification of homologous regions or for functional annotation. Benchmark tests show that Web-Beagle has lower computational complexity, running time and better performances than other available methods. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. The onset of homologous chromosome pairing during Drosophila melanogaster embryogenesis.

    PubMed

    Hiraoka, Y; Dernburg, A F; Parmelee, S J; Rykowski, M C; Agard, D A; Sedat, J W

    1993-02-01

    We have determined the position within the nucleus of homologous sites of the histone gene cluster in Drosophila melanogaster using in situ hybridization and high-resolution, three-dimensional wide field fluorescence microscopy. A 4.8-kb biotinylated probe for the histone gene repeat, located approximately midway along the short arm of chromosome 2, was hybridized to whole-mount embryos in late syncytial and early cellular blastoderm stages. Our results show that the two homologous histone loci are distinct and separate through all stages of the cell cycle up to nuclear cycle 13. By dramatic contrast, the two homologous clusters were found to colocalize with high frequency during interphase of cycle 14. Concomitant with homolog pairing at cycle 14, both histone loci were also found to move from their position near the midline of the nucleus toward the apical side. This result suggests that coincident with the initiation of zygotic transcription, there is dramatic chromosome and nuclear reorganization between nuclear cycles 13 and 14.

  16. Noncoding RNA Shows Context-Dependent Function | Center for Cancer Research

    Cancer.gov

    In addition to well-studied protein coding sequences, it is known that the genomes of higher organisms produce numerous noncoding RNAs (ncRNAs). Important roles for some ncRNAs in cell function have been demonstrated, though usually on a case-by-case basis, leading some scientists to argue that the majority of ncRNA production is just “noise” that results from the imperfect transcription machinery. The fact that many ncRNAs overlap with coding genes has hampered studies of their activities. Thus, a general understanding of whether ncRNA production is functional or not is lacking. To address this issue, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues developed a new approach using single-molecule imaging in living cells. The researchers specifically labeled coding and ncRNAs from the GAL locus in yeast, which regulates the galactose response. Glucose is the preferred source of carbon for yeast, but when it is scarce, genes within the GAL locus, including GAL10 and GAL1, are activated to allow the metabolism of galactose.

  17. Principles of long noncoding RNA evolution derived from direct comparison of transcriptomes in 17 species.

    PubMed

    Hezroni, Hadas; Koppstein, David; Schwartz, Matthew G; Avrutin, Alexandra; Bartel, David P; Ulitsky, Igor

    2015-05-19

    The inability to predict long noncoding RNAs from genomic sequence has impeded the use of comparative genomics for studying their biology. Here, we develop methods that use RNA sequencing (RNA-seq) data to annotate the transcriptomes of 16 vertebrates and the echinoid sea urchin, uncovering thousands of previously unannotated genes, most of which produce long intervening noncoding RNAs (lincRNAs). Although in each species, >70% of lincRNAs cannot be traced to homologs in species that diverged >50 million years ago, thousands of human lincRNAs have homologs with similar expression patterns in other species. These homologs share short, 5'-biased patches of sequence conservation nested in exonic architectures that have been extensively rewired, in part by transposable element exonization. Thus, over a thousand human lincRNAs are likely to have conserved functions in mammals, and hundreds beyond mammals, but those functions require only short patches of specific sequences and can tolerate major changes in gene architecture. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  18. The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L.

    PubMed Central

    Zúñiga, M C; Steitz, J A

    1977-01-01

    The nucleotide sequence of tRNA1Gly isolated from the posterior silk gland of Bombyx mori has been determined. This transfer RNA is present in high amounts in the posterior silk gland during the fifth larval instar. It has a GCC anticodon, capable of decoding a major glycine codon in the fibroin messenger RNA, GGU. Structural features of Bombyx tRNA1Gly and its homology to other eukaryotic glycine tRNAs are discussed. Images PMID:414206

  19. DNA Repair: The Search for Homology.

    PubMed

    Haber, James E

    2018-05-01

    The repair of chromosomal double-strand breaks (DSBs) by homologous recombination is essential to maintain genome integrity. The key step in DSB repair is the RecA/Rad51-mediated process to match sequences at the broken end to homologous donor sequences that can be used as a template to repair the lesion. Here, in reviewing research about DSB repair, I consider the many factors that appear to play important roles in the successful search for homology by several homologous recombination mechanisms. See also the video abstract here: https://youtu.be/vm7-X5uIzS8. © 2018 WILEY Periodicals, Inc.

  20. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    PubMed

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  1. Allogeneic T cell responses are regulated by a specific miRNA-mRNA network

    PubMed Central

    Sun, Yaping; Tawara, Isao; Zhao, Meng; Qin, Zhaohui S.; Toubai, Tomomi; Mathewson, Nathan; Tamaki, Hiroya; Nieves, Evelyn; Chinnaiyan, Arul M.; Reddy, Pavan

    2013-01-01

    Donor T cells that respond to host alloantigens following allogeneic bone marrow transplantation (BMT) induce graft-versus-host (GVH) responses, but their molecular landscape is not well understood. MicroRNAs (miRNAs) regulate gene (mRNA) expression and fine-tune the molecular responses of T cells. We stimulated naive T cells with either allogeneic or nonspecific stimuli and used argonaute cross-linked immunoprecipitation (CLIP) with subsequent ChIP microarray analyses to profile miR responses and their direct mRNA targets. We identified a unique expression pattern of miRs and mRNAs following the allostimulation of T cells and a high correlation between the expression of the identified miRs and a reduction of their mRNA targets. miRs and mRNAs that were predicted to be differentially regulated in allogeneic T cells compared with nonspecifically stimulated T cells were validated in vitro. These analyses identified wings apart-like homolog (Wapal) and synaptojanin 1 (Synj1) as potential regulators of allogeneic T cell responses. The expression of these molecular targets in vivo was confirmed in MHC-mismatched experimental BMT. Targeted silencing of either Wapal or Synj1 prevented the development of GVH response, confirming a role for these regulators in allogeneic T cell responses. Thus, this genome-wide analysis of miRNA-mRNA interactions identifies previously unrecognized molecular regulators of T cell responses. PMID:24216511

  2. Bacillus subtilis MazF-bs (EndoA) is a UACAU-specific mRNA interferase.

    PubMed

    Park, Jung-Ho; Yamaguchi, Yoshihiro; Inouye, Masayori

    2011-08-04

    MazF is an mRNA interferase which cleaves mRNAs at a specific sequence. Here, we show that in contrast to MazF-ec from Escherichia coli, which specifically cleaves ACA sequences, MazF-bs from Bacillus subtilis is an mRNA interferase that specifically cleaves a five-base sequence, UACAU. MazF homologues widely prevailing in Gram-positive bacteria were found to be highly homologous to MazF-bs, suggesting that they may also have similar cleavage specificity. This cleavage site is over-represented in the B. subtilis genes associated with biosynthesis of secondary metabolites, suggesting that MazF-bs may be involved in the regulation of the production of secondary metabolites. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Development and validation of a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines.

    PubMed

    Petrov, Anja; Beer, Martin; Blome, Sandra

    2014-01-01

    Dysregulation of cytokine responses plays a major role in the pathogenesis of severe and life-threatening infectious diseases like septicemia or viral hemorrhagic fevers. In pigs, diseases like African and classical swine fever are known to show exaggerated cytokine releases. To study these responses and their impact on disease severity and outcome in detail, reliable, highly specific and sensitive methods are needed. For cytokine research on the molecular level, real-time RT-PCRs have been proven to be suitable. Yet, the currently available and most commonly used SYBR Green I assays or heterogeneous gel-based RT-PCRs for swine show a significant lack of specificity and sensitivity. The latter is however absolutely essential for an accurate quantification of rare cytokine transcripts as well as for detection of small changes in gene expressions. For this reason, a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines was designed and validated within the presented study. Cytokines were chosen to represent different immunological pathways and targets known to be involved in the pathogenesis of the above mentioned porcine diseases, namely interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor (TNF)-α and interferon (IFN)-α. Beta-Actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes for normalization. For absolute quantification a synthetic standard plasmid was constructed comprising all target cytokines and reference genes within a single molecule allowing the generation of positive control RNA. The standard as well as positive RNAs from samples, and additionally more than 400 clinical samples, which were collected from animal trials, were included in the validation process to assess analytical sensitivity and applicability under routine conditions. The resulting assay allows the reliable assessment of gene expression

  4. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  5. Homologation and functionalization of carbon monoxide by a recyclable uranium complex.

    PubMed

    Gardner, Benedict M; Stewart, John C; Davis, Adrienne L; McMaster, Jonathan; Lewis, William; Blake, Alexander J; Liddle, Stephen T

    2012-06-12

    Carbon monoxide (CO) is in principle an excellent resource from which to produce industrial hydrocarbon feedstocks as alternatives to crude oil; however, CO has proven remarkably resistant to selective homologation, and the few complexes that can effect this transformation cannot be recycled because liberation of the homologated product destroys the complexes or they are substitutionally inert. Here, we show that under mild conditions a simple triamidoamine uranium(III) complex can reductively homologate CO and be recycled for reuse. Following treatment with organosilyl halides, bis(organosiloxy)acetylenes, which readily convert to furanones, are produced, and this was confirmed by the use of isotopically (13)C-labeled CO. The precursor to the triamido uranium(III) complex is formed concomitantly. These findings establish that, under appropriate conditions, uranium(III) can mediate a complete synthetic cycle for the homologation of CO to higher derivatives. This work may prove useful in spurring wider efforts in CO homologation, and the simplicity of this system suggests that catalytic CO functionalization may soon be within reach.

  6. Homologation and functionalization of carbon monoxide by a recyclable uranium complex

    PubMed Central

    Gardner, Benedict M.; Stewart, John C.; Davis, Adrienne L.; McMaster, Jonathan; Lewis, William; Blake, Alexander J.; Liddle, Stephen T.

    2012-01-01

    Carbon monoxide (CO) is in principle an excellent resource from which to produce industrial hydrocarbon feedstocks as alternatives to crude oil; however, CO has proven remarkably resistant to selective homologation, and the few complexes that can effect this transformation cannot be recycled because liberation of the homologated product destroys the complexes or they are substitutionally inert. Here, we show that under mild conditions a simple triamidoamine uranium(III) complex can reductively homologate CO and be recycled for reuse. Following treatment with organosilyl halides, bis(organosiloxy)acetylenes, which readily convert to furanones, are produced, and this was confirmed by the use of isotopically 13C-labeled CO. The precursor to the triamido uranium(III) complex is formed concomitantly. These findings establish that, under appropriate conditions, uranium(III) can mediate a complete synthetic cycle for the homologation of CO to higher derivatives. This work may prove useful in spurring wider efforts in CO homologation, and the simplicity of this system suggests that catalytic CO functionalization may soon be within reach. PMID:22652572

  7. Single-molecule FRET-Rosetta reveals RNA structural rearrangements during human telomerase catalysis

    PubMed Central

    Parks, Joseph W.; Kappel, Kalli; Das, Rhiju; Stone, Michael D.

    2017-01-01

    Maintenance of telomeres by telomerase permits continuous proliferation of rapidly dividing cells, including the majority of human cancers. Despite its direct biomedical significance, the architecture of the human telomerase complex remains unknown. Generating homogeneous telomerase samples has presented a significant barrier to developing improved structural models. Here we pair single-molecule Förster resonance energy transfer (smFRET) measurements with Rosetta modeling to map the conformations of the essential telomerase RNA core domain within the active ribonucleoprotein. FRET-guided modeling places the essential pseudoknot fold distal to the active site on a protein surface comprising the C-terminal element, a domain that shares structural homology with canonical polymerase thumb domains. An independently solved medium-resolution structure of Tetrahymena telomerase provides a blind test of our modeling methodology and sheds light on the structural homology of this domain across diverse organisms. Our smFRET-Rosetta models reveal nanometer-scale rearrangements within the RNA core domain during catalysis. Taken together, our FRET data and pseudoatomic molecular models permit us to propose a possible mechanism for how RNA core domain rearrangement is coupled to template hybrid elongation. PMID:28096444

  8. Polycipiviridae: a proposed new family of polycistronic picorna-like RNA viruses

    USDA-ARS?s Scientific Manuscript database

    Solenopsis invicta virus 2 is a single-stranded positive-sense picorna-like RNA virus with an unusual genome structure. The monopartite genome of approximately 11 kb contains four short open reading frames in its 5' one third, three of which encode proteins with homology to picornavirus-like jelly-r...

  9. From root to fruit: RNA-Seq analysis shows that arbuscular mycorrhizal symbiosis may affect tomato fruit metabolism.

    PubMed

    Zouari, Inès; Salvioli, Alessandra; Chialva, Matteo; Novero, Mara; Miozzi, Laura; Tenore, Gian Carlo; Bagnaresi, Paolo; Bonfante, Paola

    2014-03-21

    Tomato (Solanum lycopersicum) establishes a beneficial symbiosis with arbuscular mycorrhizal (AM) fungi. The formation of the mycorrhizal association in the roots leads to plant-wide modulation of gene expression. To understand the systemic effect of the fungal symbiosis on the tomato fruit, we used RNA-Seq to perform global transcriptome profiling on Moneymaker tomato fruits at the turning ripening stage. Fruits were collected at 55 days after flowering, from plants colonized with Funneliformis mosseae and from control plants, which were fertilized to avoid responses related to nutrient deficiency. Transcriptome analysis identified 712 genes that are differentially expressed in fruits from mycorrhizal and control plants. Gene Ontology (GO) enrichment analysis of these genes showed 81 overrepresented functional GO classes. Up-regulated GO classes include photosynthesis, stress response, transport, amino acid synthesis and carbohydrate metabolism functions, suggesting a general impact of fungal symbiosis on primary metabolisms and, particularly, on mineral nutrition. Down-regulated GO classes include cell wall, metabolism and ethylene response pathways. Quantitative RT-PCR validated the RNA-Seq results for 12 genes out of 14 when tested at three fruit ripening stages, mature green, breaker and turning. Quantification of fruit nutraceutical and mineral contents produced values consistent with the expression changes observed by RNA-Seq analysis. This RNA-Seq profiling produced a novel data set that explores the intersection of mycorrhization and fruit development. We found that the fruits of mycorrhizal plants show two transcriptomic "signatures": genes characteristic of a climacteric fleshy fruit, and genes characteristic of mycorrhizal status, like phosphate and sulphate transporters. Moreover, mycorrhizal plants under low nutrient conditions produce fruits with a nutrient content similar to those from non-mycorrhizal plants under high nutrient conditions

  10. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    PubMed

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  11. LINE-1 ORF1 protein localizes in stress granules with other RNA-binding proteins, including components of RNA interference RNA-induced silencing complex.

    PubMed

    Goodier, John L; Zhang, Lili; Vetter, Melissa R; Kazazian, Haig H

    2007-09-01

    LINE-1 retrotransposons constitute one-fifth of human DNA and have helped shape our genome. A full-length L1 encodes a 40-kDa RNA-binding protein (ORF1p) and a 150-kDa protein (ORF2p) with endonuclease and reverse transcriptase activities. ORF1p is distinctive in forming large cytoplasmic foci, which we identified as cytoplasmic stress granules. A phylogenetically conserved central region of the protein is critical for wild-type localization and retrotransposition. Yeast two-hybrid screens revealed several RNA-binding proteins that coimmunoprecipitate with ORF1p and colocalize with ORF1p in foci. Two of these proteins, YB-1 and hnRNPA1, were previously reported in stress granules. We identified additional proteins associated with stress granules, including DNA-binding protein A, 9G8, and plasminogen activator inhibitor RNA-binding protein 1 (PAI-RBP1). PAI-RBP1 is a homolog of VIG, a part of the Drosophila melanogaster RNA-induced silencing complex (RISC). Other RISC components, including Ago2 and FMRP, also colocalize with PAI-RBP1 and ORF1p. We suggest that targeting ORF1p, and possibly the L1 RNP, to stress granules is a mechanism for controlling retrotransposition and its associated genetic and cellular damage.

  12. Interspecific variation in mitochondrial serine transfer RNA (UCN) in Euptychiina butterflies (Lepidoptera: Satyrinae): structure and alignment.

    PubMed

    Marín, Mario Alejandro; López, Andrés; Uribe, Sandra Inés

    2012-06-01

    The nucleotide variation and structural patterns of mitochondrial RNA molecule have been proposed as useful tools in molecular systematics; however, their usefulness is always subject to a proper assessment of homology in the sequence alignment. The present study describes the secondary structure of mitochondrial tRNA for the amino acid serine (UCN) on 13 Euptychiina species and the evaluation of its potential use for evolutionary studies in this group of butterflies. The secondary structure of tRNAs showed variation among the included species except between Hermeuptychia sp1 and sp2. Variation was concentrated in the ribotimidina-pseudouridine-cystosine (TψC), dihydrouridine (DHU) and variable loops and in the DHU and TψC arms. These results suggest this region as a potential marker useful for taxonomic differentiation of species in this group and also confirm the importance of including information from the secondary structure of tRNA to optimize the alignments.

  13. Characterization of Mycobacterium smegmatis PolD2 and PolD1 as RNA/DNA polymerases homologous to the POL domain of bacterial DNA ligase D

    PubMed Central

    Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S.

    2013-01-01

    Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3’-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotide and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologs of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both, in an M. smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5’-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ. PMID:23198659

  14. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3′ untranslated region AU-rich regulatory element

    PubMed Central

    Yoo, Soonmoon; Kim, Hak Hee; Kim, Paul; Donnelly, Christopher J.; Kalinski, Ashley L.; Vuppalanchi, Deepika; Park, Michael; Lee, Seung Joon; Merianda, Tanuja T.; Perrone-Bizzozero, Nora I.; Twiss, Jeffery L.

    2013-01-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3′UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich element (ARE) in GAP-43’s 3′UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 coimmunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3′UTR competing with endogenous GAP-43 mRNA. Conversely, overexpressing GAP-43 coding sequence with it’s 3′UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43’s 3′UTR. PMID:23586486

  15. Homologous Chromosome Pairing in Drosophila melanogaster Proceeds through Multiple Independent Initiations

    PubMed Central

    Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.

    1998-01-01

    The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544

  16. miRNA Enriched in Human Neuroblast Nuclei Bind the MAZ Transcription Factor and Their Precursors Contain the MAZ Consensus Motif.

    PubMed

    Goldie, Belinda J; Fitzsimmons, Chantel; Weidenhofer, Judith; Atkins, Joshua R; Wang, Dan O; Cairns, Murray J

    2017-01-01

    While the cytoplasmic function of microRNA (miRNA) as post-transcriptional regulators of mRNA has been the subject of significant research effort, their activity in the nucleus is less well characterized. Here we use a human neuronal cell model to show that some mature miRNA are preferentially enriched in the nucleus. These molecules were predominantly primate-specific and contained a sequence motif with homology to the consensus MAZ transcription factor binding element. Precursor miRNA containing this motif were shown to have affinity for MAZ protein in nuclear extract. We then used Ago1/2 RIP-Seq to explore nuclear miRNA-associated mRNA targets. Interestingly, the genes for Ago2-associated transcripts were also significantly enriched with MAZ binding sites and neural function, whereas Ago1-transcripts were associated with general metabolic processes and localized with SC35 spliceosomes. These findings suggest the MAZ transcription factor is associated with miRNA in the nucleus and may influence the regulation of neuronal development through Ago2-associated miRNA induced silencing complexes. The MAZ transcription factor may therefore be important for organizing higher order integration of transcriptional and post-transcriptional processes in primate neurons.

  17. Alcohol homologation

    DOEpatents

    Wegman, Richard W.; Moloy, Kenneth G.

    1988-01-01

    A process for the homologation of an alkanol by reaction with synthesis gas in contact with a system containing rhodium atom, ruthenium atom, iodine atom and a bis(diorganophosphino) alkane to selectivity produce the next higher homologue.

  18. Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.

    PubMed Central

    Jeruzalmi, D; Steitz, T A

    1998-01-01

    The T7 RNA polymerase-T7 lysozyme complex regulates phage gene expression during infection of Escherichia coli. The 2.8 A crystal structure of the complex reveals that lysozyme binds at a site remote from the polymerase active site, suggesting an indirect mechanism of inhibition. Comparison of the T7 RNA polymerase structure with that of the homologous pol I family of DNA polymerases reveals identities in the catalytic site but also differences specific to RNA polymerase function. The structure of T7 RNA polymerase presented here differs significantly from a previously published structure. Sequence similarities between phage RNA polymerases and those from mitochondria and chloroplasts, when interpreted in the context of our revised model of T7 RNA polymerase, suggest a conserved fold. PMID:9670025

  19. Evolutionary plasticity of the NHL domain underlies distinct solutions to RNA recognition.

    PubMed

    Kumari, Pooja; Aeschimann, Florian; Gaidatzis, Dimos; Keusch, Jeremy J; Ghosh, Pritha; Neagu, Anca; Pachulska-Wieczorek, Katarzyna; Bujnicki, Janusz M; Gut, Heinz; Großhans, Helge; Ciosk, Rafal

    2018-04-19

    RNA-binding proteins regulate all aspects of RNA metabolism. Their association with RNA is mediated by RNA-binding domains, of which many remain uncharacterized. A recently reported example is the NHL domain, found in prominent regulators of cellular plasticity like the C. elegans LIN-41. Here we employ an integrative approach to dissect the RNA specificity of LIN-41. Using computational analysis, structural biology, and in vivo studies in worms and human cells, we find that a positively charged pocket, specific to the NHL domain of LIN-41 and its homologs (collectively LIN41), recognizes a stem-loop RNA element, whose shape determines the binding specificity. Surprisingly, the mechanism of RNA recognition by LIN41 is drastically different from that of its more distant relative, the fly Brat. Our phylogenetic analysis suggests that this reflects a rapid evolution of the domain, presenting an interesting example of a conserved protein fold that acquired completely different solutions to RNA recognition.

  20. Short-term effects of stored homologous red blood cell transfusion on cardiorespiratory function and inflammation: an experimental study in a hypovolemia model

    PubMed Central

    Biagini, S.; Dale, C.S.; Real, J.M.; Moreira, E.S.; Carvalho, C.R.R.; Schettino, G.P.P.; Wendel, S.; Azevedo, L.C.P.

    2017-01-01

    The pathophysiological mechanisms associated with the effects of red blood cell (RBC) transfusion on cardiopulmonary function and inflammation are unclear. We developed an experimental model of homologous 14-days stored RBC transfusion in hypovolemic swine to evaluate the short-term effects of transfusion on cardiopulmonary system and inflammation. Sixteen healthy male anesthetized swine (68±3.3 kg) were submitted to controlled hemorrhage (25% of blood volume). Two units of non-filtered RBC from each animal were stored under blood bank conditions for 14 days. After 30 min of hypovolemia, the control group (n=8) received an infusion of lactated Ringer's solution (three times the removed volume). The transfusion group (n=8) received two units of homologous 14-days stored RBC and lactated Ringer's solution in a volume that was three times the difference between blood removed and blood transfusion infused. Both groups were followed up for 6 h after resuscitation with collection of hemodynamic and respiratory data. Cytokines and RNA expression were measured in plasma and lung tissue. Stored RBC transfusion significantly increased mixed oxygen venous saturation and arterial oxygen content. Transfusion was not associated with alterations on pulmonary function. Pulmonary concentrations of cytokines were not different between groups. Gene expression for lung cytokines demonstrated a 2-fold increase in mRNA level for inducible nitric oxide synthase and a 0.5-fold decrease in mRNA content for IL-21 in the transfused group. Thus, stored homologous RBC transfusion in a hypovolemia model improved cardiovascular parameters but did not induce significant effects on microcirculation, pulmonary inflammation and respiratory function up to 6 h after transfusion. PMID:29185590

  1. Fabrication of a TFF-Attached WDM-Type Triplex Transceiver Module Using Silica PLC Hybrid Integration Technology

    NASA Astrophysics Data System (ADS)

    Han, Young-Tak; Park, Yoon-Jung; Park, Sang-Ho; Shin, Jang-Uk; Lee, Chul-Wook; Ko, Hyunsung; Baek, Yongsoon; Park, Chul-Hee; Kwon, Yoon-Koo; Hwang, Wol-Yon; Oh, Kwang-Ryong; Sung, Heekyung

    2006-12-01

    An optical triplex transceiver (TRx) module, which consists of thin-film filter (TFF)-attached wavelength-division multiplexer (WDM) and photodiode (PD) carriers, has been fabricated using a silica planar lightwave circuit (PLC) hybrid integration technology. Two types of TFFs were attached to a diced sidewall of a silica-terraced PLC platform to realize the TFF-attached WDM. The PD carriers with a 45° mirror, on which receiving surface-illuminated PDs were bonded, were assembled with the PLC platform to form receiver (Rx) parts. As the main performances of the packaged TRx module, a very clear transmitter (Tx) eye pattern and minimum Rx sensitivity of -25.7 dBm were obtained under a 1.25-Gb/s Tx Rx operation for digital applications. For an analog Rx application, a module responsivity of about 0.8 A/W was achieved, and a second-order intermodulation distortion value of less than -70 dBc at an optical modulation index of 40% was obtained under a two-tone test of 400 and 450 MHz.

  2. RNA topoisomerase is prevalent in all domains of life and associates with polyribosomes in animals

    PubMed Central

    Ahmad, Muzammil; Xue, Yutong; Lee, Seung Kyu; Martindale, Jennifer L.; Shen, Weiping; Li, Wen; Zou, Sige; Ciaramella, Maria; Debat, Hélène; Nadal, Marc; Leng, Fenfei; Zhang, Hongliang; Wang, Quan; Siaw, Grace Ee-Lu; Niu, Hengyao; Pommier, Yves; Gorospe, Myriam; Hsieh, Tao-Shih; Tse-Dinh, Yuk-Ching; Xu, Dongyi; Wang, Weidong

    2016-01-01

    DNA Topoisomerases are essential to resolve topological problems during DNA metabolism in all species. However, the prevalence and function of RNA topoisomerases remain uncertain. Here, we show that RNA topoisomerase activity is prevalent in Type IA topoisomerases from bacteria, archaea, and eukarya. Moreover, this activity always requires the conserved Type IA core domains and the same catalytic residue used in DNA topoisomerase reaction; however, it does not absolutely require the non-conserved carboxyl-terminal domain (CTD), which is necessary for relaxation reactions of supercoiled DNA. The RNA topoisomerase activity of human Top3β differs from that of Escherichia coli topoisomerase I in that the former but not the latter requires the CTD, indicating that topoisomerases have developed distinct mechanisms during evolution to catalyze RNA topoisomerase reactions. Notably, Top3β proteins from several animals associate with polyribosomes, which are units of mRNA translation, whereas the Top3 homologs from E. coli and yeast lack the association. The Top3β-polyribosome association requires TDRD3, which directly interacts with Top3β and is present in animals but not bacteria or yeast. We propose that RNA topoisomerases arose in the early RNA world, and that they are retained through all domains of DNA-based life, where they mediate mRNA translation as part of polyribosomes in animals. PMID:27257063

  3. Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

    PubMed

    Li, X; De Boer, S H

    1995-10-01

    Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

  4. Alcohol homologation

    DOEpatents

    Wegman, R.W.; Moloy, K.G.

    1988-02-23

    A process is described for the homologation of an alkanol by reaction with synthesis gas in contact with a system containing rhodium atom, ruthenium atom, iodine atom and a bis(diorganophosphino) alkane to selectivity produce the next higher homologue.

  5. RNA Interference in Infectious Tropical Diseases

    PubMed Central

    Hong, Young S.

    2008-01-01

    Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

  6. Noncoding RNA Shows Context-Dependent Function | Center for Cancer Research

    Cancer.gov

    In addition to well-studied protein coding sequences, it is known that the genomes of higher organisms produce numerous noncoding RNAs (ncRNAs). Important roles for some ncRNAs in cell function have been demonstrated, though usually on a case-by-case basis, leading some scientists to argue that the majority of ncRNA production is just “noise” that results from the imperfect

  7. Modelling methane emissions from natural wetlands by development and application of the TRIPLEX-GHG model

    USGS Publications Warehouse

    Zhu, Qing; Liu, Jinxun; Peng, C.; Chen, H.; Fang, X.; Jiang, H.; Yang, G.; Zhu, D.; Wang, W.; Zhou, X.

    2014-01-01

    A new process-based model TRIPLEX-GHG was developed based on the Integrated Biosphere Simulator (IBIS), coupled with a new methane (CH4) biogeochemistry module (incorporating CH4 production, oxidation, and transportation processes) and a water table module to investigate CH4 emission processes and dynamics that occur in natural wetlands. Sensitivity analysis indicates that the most sensitive parameters to evaluate CH4 emission processes from wetlands are r (defined as the CH4 to CO2 release ratio) and Q10 in the CH4 production process. These two parameters were subsequently calibrated to data obtained from 19 sites collected from approximately 35 studies across different wetlands globally. Being heterogeneously spatially distributed, r ranged from 0.1 to 0.7 with a mean value of 0.23, and the Q10 for CH4 production ranged from 1.6 to 4.5 with a mean value of 2.48. The model performed well when simulating magnitude and capturing temporal patterns in CH4 emissions from natural wetlands. Results suggest that the model is able to be applied to different wetlands under varying conditions and is also applicable for global-scale simulations.

  8. Numerical investigation of PCM in vertical triplex tube thermal energy storage system for CSP applications

    NASA Astrophysics Data System (ADS)

    Almsater, Saleh; Saman, Wasim; Bruno, Frank

    2017-06-01

    Numerical study for phase change material (PCM) in high temperature vertical triplex tube thermal energy storage system (TTTESS) were performed, using ANSYS FLUENT 15. For validation purposes, numerical modelling of a low temperature PCM was initially conducted and the predicted results were compared with the numerical and experimental data from the literature. The average temperature for freezing and melting agree well with the results from the literature. The validated model for the low temperature PCM was extended to high temperature TTTESS; the supercritical CO2 as the heat transfer fluid (HTF) flows in the inside and outside tubes during the charging and discharging processes, whereas the Lithium and Potassium carbonate (Li2CO3-K2CO3) (35%-65%) as the PCM is enclosed between them. To enhance the heat transfer inside the PCM, eight fins have been incorporated between the internal and external tubes. This study also provides results demonstrating the effect of adding more fins relative to the case of no fins on the freezing and melting fraction of the PCM. Compared to 2 tank system, the TTTESS with eight fins can provide significant performance with less size.

  9. RNA-Puzzles Round III: 3D RNA structure prediction of five riboswitches and one ribozyme

    PubMed Central

    Biesiada, Marcin; Boniecki, Michał J.; Chou, Fang-Chieh; Ferré-D'Amaré, Adrian R.; Das, Rhiju; Dunin-Horkawicz, Stanisław; Geniesse, Caleb; Kappel, Kalli; Kladwang, Wipapat; Krokhotin, Andrey; Łach, Grzegorz E.; Major, François; Mann, Thomas H.; Pachulska-Wieczorek, Katarzyna; Patel, Dinshaw J.; Piccirilli, Joseph A.; Popenda, Mariusz; Purzycka, Katarzyna J.; Ren, Aiming; Rice, Greggory M.; Santalucia, John; Tandon, Arpit; Trausch, Jeremiah J.; Wang, Jian; Weeks, Kevin M.; Williams, Benfeard; Xiao, Yi; Zhang, Dong; Zok, Tomasz

    2017-01-01

    RNA-Puzzles is a collective experiment in blind 3D RNA structure prediction. We report here a third round of RNA-Puzzles. Five puzzles, 4, 8, 12, 13, 14, all structures of riboswitch aptamers and puzzle 7, a ribozyme structure, are included in this round of the experiment. The riboswitch structures include biological binding sites for small molecules (S-adenosyl methionine, cyclic diadenosine monophosphate, 5-amino 4-imidazole carboxamide riboside 5′-triphosphate, glutamine) and proteins (YbxF), and one set describes large conformational changes between ligand-free and ligand-bound states. The Varkud satellite ribozyme is the most recently solved structure of a known large ribozyme. All puzzles have established biological functions and require structural understanding to appreciate their molecular mechanisms. Through the use of fast-track experimental data, including multidimensional chemical mapping, and accurate prediction of RNA secondary structure, a large portion of the contacts in 3D have been predicted correctly leading to similar topologies for the top ranking predictions. Template-based and homology-derived predictions could predict structures to particularly high accuracies. However, achieving biological insights from de novo prediction of RNA 3D structures still depends on the size and complexity of the RNA. Blind computational predictions of RNA structures already appear to provide useful structural information in many cases. Similar to the previous RNA-Puzzles Round II experiment, the prediction of non-Watson–Crick interactions and the observed high atomic clash scores reveal a notable need for an algorithm of improvement. All prediction models and assessment results are available at http://ahsoka.u-strasbg.fr/rnapuzzles/. PMID:28138060

  10. Hedgehog signaling pathway is active in GBM with GLI1 mRNA expression showing a single continuous distribution rather than discrete high/low clusters.

    PubMed

    Chandra, Vikas; Das, Tapojyoti; Gulati, Puneet; Biswas, Nidhan K; Rote, Sarang; Chatterjee, Uttara; Ghosh, Samarendra N; Deb, Sumit; Saha, Suniti K; Chowdhury, Anup K; Ghosh, Subhashish; Rudin, Charles M; Mukherjee, Ankur; Basu, Analabha; Dhara, Surajit

    2015-01-01

    Hedgehog (Hh) signaling pathway is a valid therapeutic target in a wide range of malignancies. We focus here on glioblastoma multiforme (GBM), a lethal malignancy of the central nervous system (CNS). By analyzing RNA-sequencing based transcriptomics data on 149 clinical cases of TCGA-GBM database we show here a strong correlation (r = 0.7) between GLI1 and PTCH1 mRNA expression--as a hallmark of the canonical Hh-pathway activity in this malignancy. GLI1 mRNA expression varied in 3 orders of magnitude among the GBM patients of the same cohort showing a single continuous distribution-unlike the discrete high/low-GLI1 mRNA expressing clusters of medulloblastoma (MB). When compared with MB as a reference, the median GLI1 mRNA expression in GBM appeared 14.8 fold lower than that of the "high-Hh" cluster of MB but 5.6 fold higher than that of the "low-Hh" cluster of MB. Next, we demonstrated statistically significant up- and down-regulation of GLI1 mRNA expressions in GBM patient-derived low-passage neurospheres in vitro by sonic hedgehog ligand-enriched conditioned media (shh-CM) and by Hh-inhibitor drug vismodegib respectively. We also showed clinically achievable dose (50 μM) of vismodegib alone to be sufficient to induce apoptosis and cell cycle arrest in these low-passage GBM neurospheres in vitro. Vismodegib showed an effect on the neurospheres, both by down-regulating GLI1 mRNA expression and by inducing apoptosis/cell cycle arrest, irrespective of their relative endogenous levels of GLI1 mRNA expression. We conclude from our study that this single continuous distribution pattern of GLI1 mRNA expression technically puts almost all GBM patients in a single group rather than discrete high- or low-clusters in terms of Hh-pathway activity. That is suggestive of therapies with Hh-pathway inhibitor drugs in this malignancy without a need for further stratification of patients on the basis of relative levels of Hh-pathway activity among them.

  11. Hepcidin suppression in β-thalassemia is associated with the down-regulation of atonal homolog 8.

    PubMed

    Upanan, Supranee; McKie, Andrew T; Latunde-Dada, Gladys O; Roytrakul, Sittiruk; Uthaipibull, Chairat; Pothacharoen, Peraphan; Kongtawelert, Prachya; Fucharoen, Suthat; Srichairatanakool, Somdet

    2017-08-01

    Atonal homolog 8 (ATOH8) is defined as a positive regulator of hepcidin transcription, which links erythropoietic activity with iron-sensing molecules. In the present study, we investigated the association between hepcidin and ATOH8 expression in β-thalassemia. We found that inhibition of hepcidin expression in β-thalassemia is correlated with reduced ATOH8 expression. Hepatic hepcidin 1 (Hamp1) and Atoh8 mRNA expression were down-regulated in β-thalassemic mice. Hepcidin (HAMP) and ATOH8 mRNA expression were consistently suppressed in Huh7 cells cultured in medium supplemented with β-thalassemia patient serum. The Huh7 cells, which were transfected with ATOH8-FLAG expression plasmid and cultured in the supplemented medium, exhibited increased levels of ATOH8 mRNA, ATOH8-FLAG protein, pSMAD1,5,8, and HAMP mRNA. Interestingly, over-expression of ATOH8 reversed the effects of hepcidin suppression induced by the β-thalassemia patient sera. In conclusion, hepcidin suppression in β-thalassemia is associated with the down-regulation of ATOH8 in response to anemia. We, therefore, suggest that ATOH8 is an important transcriptional regulator of hepcidin in β-thalassemia.

  12. DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination

    PubMed Central

    Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A.; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S.; Lan, Li

    2015-01-01

    Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome. PMID:26100862

  13. DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination.

    PubMed

    Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S; Lan, Li

    2015-07-07

    Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome.

  14. Improve the prediction of RNA-binding residues using structural neighbours.

    PubMed

    Li, Quan; Cao, Zanxia; Liu, Haiyan

    2010-03-01

    The interactions between RNA-binding proteins (RBPs) with RNA play key roles in managing some of the cell's basic functions. The identification and prediction of RNA binding sites is important for understanding the RNA-binding mechanism. Computational approaches are being developed to predict RNA-binding residues based on the sequence- or structure-derived features. To achieve higher prediction accuracy, improvements on current prediction methods are necessary. We identified that the structural neighbors of RNA-binding and non-RNA-binding residues have different amino acid compositions. Combining this structure-derived feature with evolutionary (PSSM) and other structural information (secondary structure and solvent accessibility) significantly improves the predictions over existing methods. Using a multiple linear regression approach and 6-fold cross validation, our best model can achieve an overall correct rate of 87.8% and MCC of 0.47, with a specificity of 93.4%, correctly predict 52.4% of the RNA-binding residues for a dataset containing 107 non-homologous RNA-binding proteins. Compared with existing methods, including the amino acid compositions of structure neighbors lead to clearly improvement. A web server was developed for predicting RNA binding residues in a protein sequence (or structure),which is available at http://mcgill.3322.org/RNA/.

  15. Accurate multiple sequence-structure alignment of RNA sequences using combinatorial optimization.

    PubMed

    Bauer, Markus; Klau, Gunnar W; Reinert, Knut

    2007-07-27

    The discovery of functional non-coding RNA sequences has led to an increasing interest in algorithms related to RNA analysis. Traditional sequence alignment algorithms, however, fail at computing reliable alignments of low-homology RNA sequences. The spatial conformation of RNA sequences largely determines their function, and therefore RNA alignment algorithms have to take structural information into account. We present a graph-based representation for sequence-structure alignments, which we model as an integer linear program (ILP). We sketch how we compute an optimal or near-optimal solution to the ILP using methods from combinatorial optimization, and present results on a recently published benchmark set for RNA alignments. The implementation of our algorithm yields better alignments in terms of two published scores than the other programs that we tested: This is especially the case with an increasing number of input sequences. Our program LARA is freely available for academic purposes from http://www.planet-lisa.net.

  16. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

  17. Archaea Signal Recognition Particle Shows the Way

    PubMed Central

    Zwieb, Christian; Bhuiyan, Shakhawat

    2010-01-01

    Archaea SRP is composed of an SRP RNA molecule and two bound proteins named SRP19 and SRP54. Regulated by the binding and hydrolysis of guanosine triphosphates, the RNA-bound SRP54 protein transiently associates not only with the hydrophobic signal sequence as it emerges from the ribosomal exit tunnel, but also interacts with the membrane-associated SRP receptor (FtsY). Comparative analyses of the archaea genomes and their SRP component sequences, combined with structural and biochemical data, support a prominent role of the SRP RNA in the assembly and function of the archaea SRP. The 5e motif, which in eukaryotes binds a 72 kilodalton protein, is preserved in most archaea SRP RNAs despite the lack of an archaea SRP72 homolog. The primary function of the 5e region may be to serve as a hinge, strategically positioned between the small and large SRP domain, allowing the elongated SRP to bind simultaneously to distant ribosomal sites. SRP19, required in eukaryotes for initiating SRP assembly, appears to play a subordinate role in the archaea SRP or may be defunct. The N-terminal A region and a novel C-terminal R region of the archaea SRP receptor (FtsY) are strikingly diverse or absent even among the members of a taxonomic subgroup. PMID:20672053

  18. [Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N

    1996-12-01

    The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

  19. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  20. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed

    Parrish, S; Fire, A

    2001-10-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

  1. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed Central

    Parrish, S; Fire, A

    2001-01-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

  2. Structural similarities and functional differences clarify evolutionary relationships between tRNA healing enzymes and the myelin enzyme CNPase.

    PubMed

    Muruganandam, Gopinath; Raasakka, Arne; Myllykoski, Matti; Kursula, Inari; Kursula, Petri

    2017-05-16

    Eukaryotic tRNA splicing is an essential process in the transformation of a primary tRNA transcript into a mature functional tRNA molecule. 5'-phosphate ligation involves two steps: a healing reaction catalyzed by polynucleotide kinase (PNK) in association with cyclic phosphodiesterase (CPDase), and a sealing reaction catalyzed by an RNA ligase. The enzymes that catalyze tRNA healing in yeast and higher eukaryotes are homologous to the members of the 2H phosphoesterase superfamily, in particular to the vertebrate myelin enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase). We employed different biophysical and biochemical methods to elucidate the overall structural and functional features of the tRNA healing enzymes yeast Trl1 PNK/CPDase and lancelet PNK/CPDase and compared them with vertebrate CNPase. The yeast and the lancelet enzymes have cyclic phosphodiesterase and polynucleotide kinase activity, while vertebrate CNPase lacks PNK activity. In addition, we also show that the healing enzymes are structurally similar to the vertebrate CNPase by applying synchrotron radiation circular dichroism spectroscopy and small-angle X-ray scattering. We provide a structural analysis of the tRNA healing enzyme PNK and CPDase domains together. Our results support evolution of vertebrate CNPase from tRNA healing enzymes with a loss of function at its N-terminal PNK-like domain.

  3. Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

    PubMed Central

    Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

    2017-01-01

    ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

  4. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.

  5. MutS HOMOLOG1-Derived Epigenetic Breeding Potential in Tomato1[OPEN

    PubMed Central

    Kundariya, Hardik; Xu, Ying-Zhi; Sandhu, Ajay; Yu, Jiantao; Zhang, Mingfang

    2015-01-01

    Evidence is compelling in support of a naturally occurring epigenetic influence on phenotype expression in land plants, although discerning the epigenetic contribution is difficult. Agriculturally important attributes like heterosis, inbreeding depression, phenotypic plasticity, and environmental stress response are thought to have significant epigenetic components, but unequivocal demonstration of this is often infeasible. Here, we investigate gene silencing of a single nuclear gene, MutS HOMOLOG1 (MSH1), in the tomato (Solanum lycopersicum) ‘Rutgers’ to effect developmental reprogramming of the plant. The condition is heritable in subsequent generations independent of the MSH1-RNA interference transgene. Crossing these transgene-null, developmentally altered plants to the isogenic cv Rutgers wild type results in progeny lines that show enhanced, heritable growth vigor under both greenhouse and field conditions. This boosted vigor appears to be graft transmissible and is partially reversed by treatment with the methylation inhibitor 5-azacytidine, implying the influence of mobile, epigenetic factors and DNA methylation changes. These data provide compelling evidence for the feasibility of epigenetic breeding in a crop plant. PMID:25736208

  6. Nucleotide Oligomers

    DTIC Science & Technology

    2001-01-01

    translated is ensured. For example, autosomal dominant retinitis pigmentosa (ADRP) is a genetic disorder that results in the degeneration of night and...GLOSSARY A adenosine ADRP Autosomal Dominant Retinitis Pigmentosa C cytidine DNA deoxyribonucleic acid G guanosine mRNA messenger RNA OH hydroxyl PCR...peripheral vision. The genetic defect lies in one, or both copies of a gene required for normal retinal structure and vision, rhodopsin. Triplex

  7. The planarian TRPA1 homolog mediates extraocular behavioral responses to near-ultraviolet light.

    PubMed

    Birkholz, Taylor R; Beane, Wendy S

    2017-07-15

    Although light is most commonly thought of as a visual cue, many animals possess mechanisms to detect light outside of the eye for various functions, including predator avoidance, circadian rhythms, phototaxis and migration. Here we confirm that planarians (like Caenorhabditis elegans , leeches and Drosophila larvae) are capable of detecting and responding to light using extraocular photoreception. We found that, when either eyeless or decapitated worms were exposed to near-ultraviolet (near-UV) light, intense wild-type photophobic behaviors were still observed. Our data also revealed that behavioral responses to green wavelengths were mediated by ocular mechanisms, whereas near-UV responses were driven by extraocular mechanisms. As part of a candidate screen to uncover the genetic basis of extraocular photoreception in the planarian species Schmidtea mediterranea , we identified a potential role for a homolog of the transient receptor potential channel A1 ( TRPA1 ) in mediating behavioral responses to extraocular light cues. RNA interference (RNAi) to Smed-TrpA resulted in worms that lacked extraocular photophobic responses to near-UV light, a mechanism previously only identified in Drosophila These data show that the planarian TRPA1 homolog is required for planarian extraocular-light avoidance and may represent a potential ancestral function of this gene. TRPA1 is an evolutionarily conserved detector of temperature and chemical irritants, including reactive oxygen species that are byproducts of UV-light exposure. Our results suggest that planarians possess extraocular photoreception and display an unconventional TRPA1-mediated photophobic response to near-UV light. © 2017. Published by The Company of Biologists Ltd.

  8. The expansion of the metazoan microRNA repertoire

    PubMed Central

    Hertel, Jana; Lindemeyer, Manuela; Missal, Kristin; Fried, Claudia; Tanzer, Andrea; Flamm, Christoph; Hofacker, Ivo L; Stadler, Peter F

    2006-01-01

    Background MicroRNAs have been identified as crucial regulators in both animals and plants. Here we report on a comprehensive comparative study of all known miRNA families in animals. We expand the MicroRNA Registry 6.0 by more than 1000 new homologs of miRNA precursors whose expression has been verified in at least one species. Using this uniform data basis we analyze their evolutionary history in terms of individual gene phylogenies and in terms of preservation of genomic nearness across species. This allows us to reliably identify microRNA clusters that are derived from a common transcript. Results We identify three episodes of microRNA innovation that correspond to major developmental innovations: A class of about 20 miRNAs is common to protostomes and deuterostomes and might be related to the advent of bilaterians. A second large wave of innovations maps to the branch leading to the vertebrates. The third significant outburst of miRNA innovation coincides with placental (eutherian) mammals. In addition, we observe the expected expansion of the microRNA inventory due to genome duplications in early vertebrates and in an ancestral teleost. The non-local duplications in the vertebrate ancestor are predated by local (tandem) duplications leading to the formation of about a dozen ancient microRNA clusters. Conclusion Our results suggest that microRNA innovation is an ongoing process. Major expansions of the metazoan miRNA repertoire coincide with the advent of bilaterians, vertebrates, and (placental) mammals. PMID:16480513

  9. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    NASA Astrophysics Data System (ADS)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  10. Complete nucleotide sequences and genome characterization of a novel double-stranded RNA virus infecting Rosa multiflora.

    PubMed

    Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib

    2008-01-01

    The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.

  11. SIRT1 inhibits EV71 genome replication and RNA translation by interfering with the viral polymerase and 5′UTR RNA

    PubMed Central

    Han, Yang; Wang, Lvyin; Cui, Jin; Song, Yu; Luo, Zhen; Chen, Junbo; Xiong, Ying; Zhang, Qi; Liu, Fang; Ho, Wenzhe; Liu, Yingle; Wu, Jianguo

    2016-01-01

    ABSTRACT Enterovirus 71 (EV71) possesses a single-stranded positive RNA genome that contains a single open reading frame (ORF) flanked by a 5′ untranslated region (5′UTR) and a polyadenylated 3′UTR. Here, we demonstrated that EV71 activates the production of silent mating type information regulation 2 homolog 1 (SIRT1), a histone deacetylase (HDAC). EV71 further stimulates SIRT1 sumoylation and deacetylase activity, and enhances SIRT1 translocation from the nucleus to the cytoplasm. More interestingly, activated SIRT1 subsequently binds with the EV71 3Dpol protein (a viral RNA-dependent RNA polymerase, RdRp) to repress the acetylation and RdRp activity of 3Dpol, resulting in the attenuation of viral genome replication. Moreover, SIRT1 interacts with the cloverleaf structure of the EV71 RNA 5′UTR to inhibit viral RNA transcription, and binds to the internal ribosome entry site (IRES) of the EV71 5′UTR to attenuate viral RNA translation. Thus, EV71 stimulates SIRT1 production and activity, which in turn represses EV71 genome replication by inhibiting viral polymerase, and attenuates EV71 RNA transcription and translation by interfering with viral RNA. These results uncover a new function of SIRT1 and reveal a new mechanism underlying the regulation of EV71 replication. PMID:27875274

  12. The Puf family of RNA-binding proteins in plants: phylogeny, structural modeling, activity and subcellular localization

    PubMed Central

    2010-01-01

    Background Puf proteins have important roles in controlling gene expression at the post-transcriptional level by promoting RNA decay and repressing translation. The Pumilio homology domain (PUM-HD) is a conserved region within Puf proteins that binds to RNA with sequence specificity. Although Puf proteins have been well characterized in animal and fungal systems, little is known about the structural and functional characteristics of Puf-like proteins in plants. Results The Arabidopsis and rice genomes code for 26 and 19 Puf-like proteins, respectively, each possessing eight or fewer Puf repeats in their PUM-HD. Key amino acids in the PUM-HD of several of these proteins are conserved with those of animal and fungal homologs, whereas other plant Puf proteins demonstrate extensive variability in these amino acids. Three-dimensional modeling revealed that the predicted structure of this domain in plant Puf proteins provides a suitable surface for binding RNA. Electrophoretic gel mobility shift experiments showed that the Arabidopsis AtPum2 PUM-HD binds with high affinity to BoxB of the Drosophila Nanos Response Element I (NRE1) RNA, whereas a point mutation in the core of the NRE1 resulted in a significant reduction in binding affinity. Transient expression of several of the Arabidopsis Puf proteins as fluorescent protein fusions revealed a dynamic, punctate cytoplasmic pattern of localization for most of these proteins. The presence of predicted nuclear export signals and accumulation of AtPuf proteins in the nucleus after treatment of cells with leptomycin B demonstrated that shuttling of these proteins between the cytosol and nucleus is common among these proteins. In addition to the cytoplasmically enriched AtPum proteins, two AtPum proteins showed nuclear targeting with enrichment in the nucleolus. Conclusions The Puf family of RNA-binding proteins in plants consists of a greater number of members than any other model species studied to date. This, along with the

  13. RNA Related to That of a Murine Leukemia Virus in Burkitt's Tumors and Nasopharyngeal Carcinomas

    PubMed Central

    Kufe, D.; Hehlmann, R.; Spiegelman, S.

    1973-01-01

    RNA homologous to that of the Rauscher leukemia virus has been detected in Burkitt's lymphomas and nasopharyngeal carcinomas. Earlier excellent experimental evidence has linked these two human tumors with the Epstein-Barr virus, a DNA-containing agent. PMID:4346039

  14. A novel function for the DEAD-box RNA helicase DDX-23 in primary microRNA processing in Caenorhabditis elegans.

    PubMed

    Chu, Yu-De; Chen, Hsin-Kai; Huang, Tao; Chan, Shih-Peng

    2016-01-15

    Primary microRNAs (pri-miRNAs) are cleaved by the nuclear RNase III Drosha to produce hairpin-shaped precursor miRNAs (pre-miRNAs). In humans, this process is known to be facilitated by the DEAD-box helicases p68 (DDX5) and p72 (DDX17). In this study, we performed a candidate-based RNAi screen in C. elegans to identify DEAD/H-box proteins involved in miRNA biogenesis. In a let-7(mg279) sensitized genetic background, knockdown of a homolog of yeast splicing factor Prp28p, DDX-23, or a homolog of human helicases p68 and p72, DDX-17, enhanced let-7 loss-of-function phenotypes, suggesting that these helicases play a role in let-7 processing and/or function. In both ddx-23(RNAi) and ddx-17(RNAi), levels of mature let-7 were decreased while pri-let-7 was found to accumulate, indicating that the helicases likely act at the level of pri-let-7 processing. DDX-23 and DDX-17 were also required for the biogenesis of other known heterochronic miRNAs, including lin-4 and the let-7 family members miR-48, miR-84 and miR-241. Their function was not confined to the heterochronic pathway, however, since they were both necessary for down-regulation of cog-1 by the spatial patterning miRNA, lsy-6. Here, we present a novel function for C. elegans DDX-23 in pri-miRNA processing, and also suggest a conserved role for DDX-17 in this process. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Probing the structure of Nun transcription arrest factor bound to RNA polymerase

    PubMed Central

    Mustaev, Arkady; Vitiello, Christal L.; Gottesman, Max E.

    2016-01-01

    The coliphage HK022 protein Nun transcription elongation arrest factor inhibits RNA polymerase translocation. In vivo, Nun acts specifically to block transcription of the coliphage λ chromosome. Using in vitro assays, we demonstrate that Nun cross-links RNA in an RNA:DNA hybrid within a ternary elongation complex (TEC). Both the 5′ and the 3′ ends of the RNA cross-link Nun, implying that Nun contacts RNA polymerase both at the upstream edge of the RNA:DNA hybrid and in the vicinity of the catalytic center. This finding suggests that Nun may inhibit translocation by more than one mechanism. Transcription elongation factor GreA efficiently blocked Nun cross-linking to the 3′ end of the transcript, whereas the highly homologous GreB factor did not. Surprisingly, both factors strongly suppressed Nun cross-linking to the 5′ end of the RNA, suggesting that GreA and GreB can enter the RNA exit channel as well as the secondary channel, where they are known to bind. These findings extend the known action mechanism for these ubiquitous cellular factors. PMID:27436904

  16. RNA interference can be used to disrupt gene function in tardigrades.

    PubMed

    Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

    2013-05-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

  17. Molecular mechanisms of homologous chromosome pairing and segregation in plants.

    PubMed

    Zhang, Jing; Zhang, Bing; Su, Handong; Birchler, James A; Han, Fangpu

    2014-03-20

    In most eukaryotic species, three basic steps of pairing, recombination and synapsis occur during prophase of meiosis I. Homologous chromosomal pairing and recombination are essential for accurate segregation of chromosomes. In contrast to the well-studied processes such as recombination and synapsis, many aspects of chromosome pairing are still obscure. Recent progress in several species indicates that the telomere bouquet formation can facilitate homologous chromosome pairing by bringing chromosome ends into close proximity, but the sole presence of telomere clustering is not sufficient for recognizing homologous pairs. On the other hand, accurate segregation of the genetic material from parent to offspring during meiosis is dependent on the segregation of homologs in the reductional meiotic division (MI) with sister kinetochores exhibiting mono-orientation from the same pole, and the segregation of sister chromatids during the equational meiotic division (MII) with kinetochores showing bi-orientation from the two poles. The underlying mechanism of orientation and segregation is still unclear. Here we focus on recent studies in plants and other species that provide insight into how chromosomes find their partners and mechanisms mediating chromosomal segregation. Copyright © 2013. Published by Elsevier Ltd.

  18. Methylation guide RNA evolution in archaea: structure, function and genomic organization of 110 C/D box sRNA families across six Pyrobaculum species.

    PubMed

    Lui, Lauren M; Uzilov, Andrew V; Bernick, David L; Corredor, Andrea; Lowe, Todd M; Dennis, Patrick P

    2018-05-16

    Archaeal homologs of eukaryotic C/D box small nucleolar RNAs (C/D box sRNAs) guide precise 2'-O-methyl modification of ribosomal and transfer RNAs. Although C/D box sRNA genes constitute one of the largest RNA gene families in archaeal thermophiles, most genomes have incomplete sRNA gene annotation because reliable, fully automated detection methods are not available. We expanded and curated a comprehensive gene set across six species of the crenarchaeal genus Pyrobaculum, particularly rich in C/D box sRNA genes. Using high-throughput small RNA sequencing, specialized computational searches and comparative genomics, we analyzed 526 Pyrobaculum C/D box sRNAs, organizing them into 110 families based on synteny and conservation of guide sequences which determine methylation targets. We examined gene duplications and rearrangements, including one family that has expanded in a pattern similar to retrotransposed repetitive elements in eukaryotes. New training data and inclusion of kink-turn secondary structural features enabled creation of an improved search model. Our analyses provide the most comprehensive, dynamic view of C/D box sRNA evolutionary history within a genus, in terms of modification function, feature plasticity, and gene mobility.

  19. Accelerated probabilistic inference of RNA structure evolution

    PubMed Central

    Holmes, Ian

    2005-01-01

    Background Pairwise stochastic context-free grammars (Pair SCFGs) are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs) is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License. PMID:15790387

  20. Identification of a novel selD homolog from Eukaryotes, Bacteria, and Archaea: Is there an autoregulatory mechanism in selenocysteine metabolism?

    PubMed Central

    Guimarães, M. Jorge; Peterson, David; Vicari, Alain; Cocks, Benjamin G.; Copeland, Neal G.; Gilbert, Debra J.; Jenkins, Nancy A.; Ferrick, David A.; Kastelein, Robert A.; Bazan, J. Fernando; Zlotnik, Albert

    1996-01-01

    Escherichia coli selenophosphate synthetase (SPS, the selD gene product) catalyzes the production of monoselenophosphate, the selenium donor compound required for synthesis of selenocysteine (Sec) and seleno-tRNAs. We report the molecular cloning of human and mouse homologs of the selD gene, designated Sps2, which contains an in-frame TGA codon at a site corresponding to the enzyme’s putative active site. These sequences allow the identification of selD gene homologs in the genomes of the bacterium Haemophilus influenzae and the archaeon Methanococcus jannaschii, which had been previously misinterpreted due to their in-frame TGA codon. Sps2 mRNA levels are elevated in organs previously implicated in the synthesis of selenoproteins and in active sites of blood cell development. In addition, we show that Sps2 mRNA is up-regulated upon activation of T lymphocytes and have mapped the Sps2 gene to mouse chromosome 7. Using the mouse gene isolated from the hematopoietic cell line FDCPmixA4, we devised a construct for protein expression that results in the insertion of a FLAG tag sequence at the N terminus of the SPS2 protein. This strategy allowed us to document the readthrough of the in-frame TGA codon and the incorporation of 75Se into SPS2. These results suggest the existence of an autoregulatory mechanism involving the incorporation of Sec into SPS2 that might be relevant to blood cell biology. This mechanism is likely to have been present in ancient life forms and conserved in a variety of living organisms from all domains of life. PMID:8986768

  1. The 86-kilodalton antigen from Schistosoma mansoni is a heat-shock protein homologous to yeast HSP-90.

    PubMed

    Johnson, K S; Wells, K; Bock, J V; Nene, V; Taylor, D W; Cordingley, J S

    1989-08-01

    We report the sequence of a cDNA clone encoding an 86-kDa polypeptide antigen (p86) from Schistosoma mansoni. Fusion proteins made in Escherichia coli are recognized by human infection sera. The reading frame of this antigen is highly homologous to those of the large heat-shock proteins of Saccharomyces cerevisiae (HSP90) and Drosophila melanogaster (HSP83). mRNA encoding p86 increases in response to heat shock of adult worms, as does HSP70. Comparisons of the sequences of HSP70 and HSP83 homologues show that these two families of heat-shock proteins are not significantly related except for the last four amino acid residues, which are Glu-Glu-Val-Asp in every case. This sequence is not found at the carboxy terminus of any other protein in the current databases.

  2. Long non-coding RNA phosphatase and tensin homolog pseudogene 1 suppresses osteosarcoma cell growth via the phosphoinositide 3-kinase/protein kinase B signaling pathway.

    PubMed

    Yan, Bin; Wubuli, Aikepaer; Liu, Yidong; Wang, Xin

    2018-06-01

    Osteosarcoma is a common type of human carcinoma, which exhibits a high metastasis and recurrence rate. Previous studies have indicated that long non-coding RNA phosphatase and tensin homolog pseudogene 1 (lnPTENP1) has tumor suppressive action by modulating PTEN expression in different types of tumor cells. However, the potential mechanism by which lnPTENP1 has an effect in osteosarcoma cells remains elusive. In the present study, the role of lnPTENP1 in osteosarcoma cells was investigated and the possible mechanisms by which it functions were explored. It was revealed that lnPTENP1 transfection significantly inhibited osteosarcoma cell growth, proliferation, migration and invasion. LnPTENP1 transfection also significantly promoted apoptosis in Mg63 cells treated with tunicamycin. Further analysis revealed that lnPTENP1 transfection regulated osteosarcoma cell growth via the PI3K/AKT signaling pathway. In vivo assays revealed that lnPTENP1 transfection significantly inhibited osteosarcoma tumor growth and significantly increased the protein expression and phosphorylation levels of PI3K and AKT. In conclusion, the results of the present study indicated that lnPTENP1 may inhibit osteosarcoma cell growth via the PI3K/AKT signaling pathway, which may be a potential novel target for human osteosarcoma therapy.

  3. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    PubMed Central

    Du, Yushen; Wu, Nicholas C.; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting

    2016-01-01

    ABSTRACT Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. PMID:27803181

  4. Structural Rearrangement in an RsmA/CsrA Ortholog of Pseudomonas aeruginosa Creates a Dimeric RNA-Binding Protein, RsmN

    PubMed Central

    Morris, Elizabeth R.; Hall, Gareth; Li, Chan; Heeb, Stephan; Kulkarni, Rahul V.; Lovelock, Laura; Silistre, Hazel; Messina, Marco; Cámara, Miguel; Emsley, Jonas; Williams, Paul; Searle, Mark S.

    2013-01-01

    Summary In bacteria, the highly conserved RsmA/CsrA family of RNA-binding proteins functions as global posttranscriptional regulators acting on mRNA translation and stability. Through phenotypic complementation of an rsmA mutant in Pseudomonas aeruginosa, we discovered a family member, termed RsmN. Elucidation of the RsmN crystal structure and that of the complex with a hairpin from the sRNA, RsmZ, reveals a uniquely inserted α helix, which redirects the polypeptide chain to form a distinctly different protein fold to the domain-swapped dimeric structure of RsmA homologs. The overall β sheet structure required for RNA recognition is, however, preserved with compensatory sequence and structure differences, allowing the RsmN dimer to target binding motifs in both structured hairpin loops and flexible disordered RNAs. Phylogenetic analysis indicates that, although RsmN appears unique to P. aeruginosa, homologous proteins with the inserted α helix are more widespread and arose as a consequence of a gene duplication event. PMID:23954502

  5. Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.

    PubMed

    Meloche, S; Beatty, B G; Pellerin, J

    1996-10-03

    We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.

  6. Alternative Polyadenylation in Glioblastoma Multiforme and Changes in Predicted RNA Binding Protein Profiles

    PubMed Central

    Shao, Jiaofang; Zhang, Jing; Zhang, Zengming; Jiang, Huawei; Lou, Xiaoyan; Foltz, Gregory; Lan, Qing; Huang, Qiang

    2013-01-01

    Abstract Alternative polyadenylation (APA) is widely present in the human genome and plays a key role in carcinogenesis. We conducted a comprehensive analysis of the APA products in glioblastoma multiforme (GBM, one of the most lethal brain tumors) and normal brain tissues and further developed a computational pipeline, RNAelements (http://sysbio.zju.edu.cn/RNAelements/), using covariance model from known RNA binding protein (RBP) targets acquired by RNA Immunoprecipitation (RIP) analysis. We identified 4530 APA isoforms for 2733 genes in GBM, and found that 182 APA isoforms from 148 genes showed significant differential expression between normal and GBM brain tissues. We then focused on three genes with long and short APA isoforms that show inconsistent expression changes between normal and GBM brain tissues. These were myocyte enhancer factor 2D, heat shock factor binding protein 1, and polyhomeotic homolog 1 (Drosophila). Using the RNAelements program, we found that RBP binding sites were enriched in the alternative regions between the first and the last polyadenylation sites, which would result in the short APA forms escaping regulation from those RNA binding proteins. To the best of our knowledge, this report is the first comprehensive APA isoform dataset for GBM and normal brain tissues. Additionally, we demonstrated a putative novel APA-mediated mechanism for controlling RNA stability and translation for APA isoforms. These observations collectively lay a foundation for novel diagnostics and molecular mechanisms that can inform future therapeutic interventions for GBM. PMID:23421905

  7. Phylogenetic distribution and evolutionary pattern of an α-proteobacterial small RNA gene that controls polyhydroxybutyrate accumulation in Sinorhizobium meliloti.

    PubMed

    Lagares, Antonio; Roux, Indra; Valverde, Claudio

    2016-06-01

    It has become clear that sRNAs play relevant regulatory functions in bacteria. However, a comprehensive understanding of their biological roles considering evolutionary aspects has not been achieved for most of them. Thus, we have characterized the evolutionary and phylogenetic aspects of the Sinorhizobium meliloti mmgR gene encoding the small RNA MmgR, which has been recently reported to be involved in the regulation of polyhydroxybutyrate accumulation in this bacterium. We constructed a covariance model from a multiple sequence and structure alignment of mmgR close homologs that allowed us to extend the search and to detect further remote homologs of the sRNA gene. From our results, mmgR seemed to evolve from a common ancestor of the α-proteobacteria that diverged from the order of Rickettsiales. We have found mmgR homologs in most current species of α-proteobacteria, with a few exceptions in which genomic reduction events or gene rearrangements seem to explain its absence. Furthermore, a strong microsyntenic relationship was found between a large set of mmgR homologs and homologs of a gene encoding a putative N-formyl glutamate amidohydrolase (NFGAH) that allowed us to trace back the evolutionary path of this group of mmgR orthologs. Among them, structure and sequence traits have been completely conserved throughout evolution, namely a Rho-independent terminator and a 10-mer (5'-UUUCCUCCCU-3') that is predicted to remain in a single-stranded region of the sRNA. We thus propose the definition of the new family of α-proteobacterial sRNAs αr8, as well as the subfamily αr8s1 which encompass S. meliloti mmgR orthologs physically linked with the downstream open reading frame encoding a putative NFGAH. So far, mmgR is the trans-encoded small RNA with the widest phylogenetic distribution of well recognized orthologs among α-proteobacteria. Expression of the expected MmgR transcript in rhizobiales other than S. meliloti (Sinorhizobium fredii, Rhizobium

  8. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    PubMed Central

    2012-01-01

    Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13

  9. Prefiltering Model for Homology Detection Algorithms on GPU.

    PubMed

    Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier

    2016-01-01

    Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

  10. Short hairpin RNA interference therapy for ischemic heart disease.

    PubMed

    Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C

    2008-09-30

    During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by

  11. Characterization of a serine proteinase homologous (SPH) in Chinese mitten crab Eriocheir sinensis.

    PubMed

    Qin, Chuanjie; Chen, Liqiao; Qin, Jian G; Zhao, Daxian; Zhang, Hao; Wu, Ping; Li, Erchao

    2010-01-01

    The serine protease homologous (SPH) is an important cofactor of prophenoloxidase-activating enzyme (PPAE). The gene of SPH of Chinese mitten crab Eriocheir sinensis (EsSPH) in hemocytes was cloned and characterized using reverse transcript polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The SPH cDNA consisted of 1386 bp with an open reading frame (ORF) encoded a protein of 378 amino acids, 154 bp 5'-untranslated region, and 95 bp 3'-untranslated region. Sequence comparisons against the GenBank database showed that EsSPH deduced amino acids had an overall identity to the gene of serine protease family from 41% to 70% of 15 invertebrate species. The protein had the structural characteristics of SPH, including the conserved six cysteine residues in the N-terminal clip domain and the functional activity (His157, Asp209, Gly311) in the C-terminal serine proteinase-like domain. To analyze the role of EsSPH in an acute infection, the temporal expression of the EsSPH gene after the Aeromonas hydrophila challenge was measured by real-time RT-PCR. The EsSPH transcripts in hemocytes significantly increased at 6 h, 12 h and 48 h over time after the A. hydrophila injection. This expression pattern shows that EsSPH has the potential to defend against invading microorganisms. The mRNA transcripts of EsSPH were detected in all tissues with the highest in the hepatopancreas. Interestingly, the mRNA transcripts of EsSPH and proPO were found in ova and expressed in oosperms, suggesting that the maternal transfer of EsSPH and proPO may exit in crab, but this warrants confirmation in further research.

  12. Domain structure, GTP-hydrolyzing activity and 7S RNA binding of Acidianus ambivalens ffh-homologous protein suggest an SRP-like complex in archaea.

    PubMed

    Moll, R; Schmidtke, S; Schäfer, G

    1999-01-01

    In this study we provide, for the first time, experimental evidence that a protein homologous to bacterial Ffh is part of an SRP-like ribonucleoprotein complex in hyperthermophilic archaea. The gene encoding the Ffh homologue in the hyperthermophilic archaeote Acidianus ambivalens has been cloned and sequenced. Recombinant Ffh protein was expressed in E. coli and subjected to biochemical and functional studies. A. ambivalens Ffh encodes a 50.4-kDa protein that is structured by three distinct regions: the N-terminal hydrophilic N-region (N), the GTP/GDP-binding domain (G) and a C-terminal located C-domain (C). The A. ambivalens Ffh sequence shares 44-46% sequence similarity with Ffh of methanogenic archaea, 34-36% similarity with eukaryal SRP54 and 30-34% similarity with bacterial Ffh. A polyclonal antiserum raised against the first two domains of A. ambivalens Ffh reacts specifically with a single protein (apparent molecular mass: 46 kDa, termed p46) present in cytosolic and in plasmamembrane cell fractions of A. ambivalens. Recombinant Ffh has a melting point of tm = 89 degreesC. Its intrinsic GTPase activity obviously depends on neutral pH and low ionic strength with a preference for chloride and acetate salts. Highest rates of GTP hydrolysis have been achieved at 81 degreesC in presence of 0.1-1 mm Mg2+. GTP hydrolysis is significantly inhibited by high glycerol concentrations, and the GTP hydrolysis rate also markedly decreases by addition of detergents. The Km for GTP is 13.7 microm at 70 degreesC and GTP hydrolysis is strongly inhibited by GDP (Ki = 8 microm). A. ambivalens Ffh, which includes an RNA-binding motif in the C-terminal domain, is shown to bind specifically to 7S RNA of the related crenarchaeote Sulfolobus solfataricus. Comparative sequence analysis reveals the presence of typical signal sequences in plasma membrane as well as extracellular proteins of hyperthermophilic crenarchaea which strongly supposes recognition events by an Ffh containing

  13. Prokaryotic Argonautes - variations on the RNA interference theme.

    PubMed

    van der Oost, John; Swarts, Daan C; Jore, Matthijs M

    2014-04-15

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

  14. Prokaryotic Argonautes - variations on the RNA interference theme

    PubMed Central

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  15. A Smart Responsive Dual Aptamers-Targeted Bubble-Generating Nanosystem for Cancer Triplex Therapy and Ultrasound Imaging.

    PubMed

    Zhao, Feifei; Zhou, Jie; Su, Xiangjie; Wang, Yuhui; Yan, Xiaosa; Jia, Shaona; Du, Bin

    2017-05-01

    The absence of targeted, single treatment methods produces low therapeutic value for treating cancers. To increase the accumulation of drugs in tumors and improve the treatment effectiveness, near-infrared 808 nm photothermal responsive dual aptamers-targeted docetaxel (DTX)-containing nanoparticles is proposed. In this system, DTX and NH 4 HCO 3 are loaded in thermosensitive liposomes. The surface of liposomes is coated with gold nanoshells and connected with sulfydryl (SH) modified AS1411 and S2.2 aptamers. The nanosystem has good biocompatibility and uniform size (diameter about 200 nm). The drug is rapidly released, reaching a maximum amount (84%) at 4 h under 808 nm laser irradiation. The experiments conducted in vitro and in vivo demonstrate the nanosystem can synergistically inhibit tumor growth by combination of chemotherapy, photothermal therapy, and biological therapy. Dual ligand functionalization significantly increases cellular uptake on breast cancer cell line (MCF-7) cells and achieves ultrasound imaging (USI) at tumor site. The results indicate that this drug delivery system is a promising theranostic agent involving light-thermal response at tumor sites, dual ligand targeted triplex therapy, and USI. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins

    PubMed Central

    Englert, Markus; Beier, Hildburg

    2005-01-01

    Pre-tRNA splicing is an essential process in all eukaryotes. It requires the concerted action of an endonuclease to remove the intron and a ligase for joining the resulting tRNA halves as studied best in the yeast Saccharomyces cerevisiae. Here, we report the first characterization of an RNA ligase protein and its gene from a higher eukaryotic organism that is an essential component of the pre-tRNA splicing process. Purification of tRNA ligase from wheat germ by successive column chromatographic steps has identified a protein of 125 kDa by its potentiality to covalently bind AMP, and by its ability to catalyse the ligation of tRNA halves and the circularization of linear introns. Peptide sequences obtained from the purified protein led to the elucidation of the corresponding proteins and their genes in Arabidopsis and Oryza databases. The plant tRNA ligases exhibit no overall sequence homologies to any known RNA ligases, however, they harbour a number of conserved motifs that indicate the presence of three intrinsic enzyme activities: an adenylyltransferase/ligase domain in the N-terminal region, a polynucleotide kinase in the centre and a cyclic phosphodiesterase domain at the C-terminal end. In vitro expression of the recombinant Arabidopsis tRNA ligase and functional analyses revealed all expected individual activities. Plant RNA ligases are active on a variety of substrates in vitro and are capable of inter- and intramolecular RNA joining. Hence, we conclude that their role in vivo might comprise yet unknown essential functions besides their involvement in pre-tRNA splicing. PMID:15653639

  17. Survey of rice proteins interacting with OsFCA and OsFY proteins which are homologous to the Arabidopsis flowering time proteins, FCA and FY.

    PubMed

    Jang, Yun Hee; Park, Hyo-Young; Kim, Soon-Kap; Lee, Jeong Hwan; Suh, Mi Chung; Chung, Young Soo; Paek, Kyung-Hee; Kim, Jeong-Kook

    2009-08-01

    The FCA protein is involved in controlling flowering time and plays more general roles in RNA-mediated chromatin silencing in Arabidopsis. It contains two RNA-binding domains and a WW domain. The FCA protein interacts with FY, a polyadenylation factor, via its WW domain. We previously characterized a rice gene, OsFCA, which was homologous to FCA. Here, we found that the OsFCA protein could interact through its WW domain with the following proteins: OsFY, a protein containing a CID domain present in RNA-processing factors such as Pcf11 and Nrd1; a protein similar to splicing factor SF1; a protein similar to FUSE splicing factor; and OsMADS8. The FY protein is associated with the 3' end processing machinery in Arabidopsis. Thus, we examined interactions between OsFY and the rice homologs (OsCstF-50, -64 and -77) of the AtCstF-50, -64 and -77 proteins. We found that OsFY could bind OsCstF50, whereas the OsCstF77 protein could bridge the interaction between OsCstF50 and OsCstF64. Taken together, our data suggest that OsFCA could interact with several proteins other than OsFY through its WW domain and may play several roles in rice.

  18. RNA Interference: Biology, Mechanism, and Applications

    PubMed Central

    Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

    2003-01-01

    Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

  19. Ancient origin and recent innovations of RNA polymerase IV and V

    DOE PAGES

    Huang, Yi; Kendall, Timmy; Forsythe, Evan S.; ...

    2015-03-12

    Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less

  20. Ancient origin and recent innovations of RNA polymerase IV and V

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Yi; Kendall, Timmy; Forsythe, Evan S.

    Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less

  1. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family.

    PubMed

    Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F

    1998-08-01

    In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

  2. EOL-1, the Homolog of the Mammalian Dom3Z, Regulates Olfactory Learning in C. elegans

    PubMed Central

    Shen, Yu; Zhang, Jiangwen; Calarco, John A.

    2014-01-01

    Learning is an essential function of the nervous system. However, our understanding of molecular underpinnings of learning remains incomplete. Here, we characterize a conserved protein EOL-1 that regulates olfactory learning in Caenorhabditis elegans. A recessive allele of eol-1 (enhanced olfactory learning) learns better to adjust its olfactory preference for bacteria foods and eol-1 acts in the URX sensory neurons to regulate learning. The mammalian homolog of EOL-1, Dom3Z, which regulates quality control of pre-mRNAs, can substitute the function of EOL-1 in learning regulation, demonstrating functional conservation between these homologs. Mutating the residues of Dom3Z that are critical for its enzymatic activity, and the equivalent residues in EOL-1, abolishes the function of these proteins in learning. Together, our results provide insights into the function of EOL-1/Dom3Z and suggest that its activity in pre-mRNA quality control is involved in neural plasticity. PMID:25274815

  3. The Vasa Homolog RDE-12 engages target mRNA and multiple argonaute proteins to promote RNAi in C. elegans.

    PubMed

    Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C

    2014-04-14

    Argonaute (AGO) proteins are key nuclease effectors of RNAi. Although purified AGOs can mediate a single round of target RNA cleavage in vitro, accessory factors are required for small interfering RNA (siRNA) loading and to achieve multiple-target turnover. To identify AGO cofactors, we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi, including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 colocalizes with WAGO-1 in germline P granules and in cytoplasmic and perinuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1), where it promotes small RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. MutY-Homolog (MYH) inhibition reduces pancreatic cancer cell growth and increases chemosensitivity

    PubMed Central

    Sharbeen, George; Youkhana, Janet; Mawson, Amanda; McCarroll, Joshua; Nunez, Andrea; Biankin, Andrew; Johns, Amber; Goldstein, David; Phillips, Phoebe

    2017-01-01

    Patients with pancreatic ductal adenocarcinoma (PC) have a poor prognosis due to metastases and chemoresistance. PC is characterized by extensive fibrosis, which creates a hypoxic microenvironment, and leads to increased chemoresistance and intracellular oxidative stress. Thus, proteins that protect against oxidative stress are potential therapeutic targets for PC. A key protein that maintains genomic integrity against oxidative damage is MutY-Homolog (MYH). No prior studies have investigated the function of MYH in PC cells. Using siRNA, we showed that knockdown of MYH in PC cells 1) reduced PC cell proliferation and increased apoptosis; 2) further decreased PC cell growth in the presence of oxidative stress and chemotherapy agents (gemcitabine, paclitaxel and vincristine); 3) reduced PC cell metastatic potential; and 4) decreased PC tumor growth in a subcutaneous mouse model in vivo. The results from this study suggest MYH may be a novel therapeutic target for PC that could potentially improve patient outcome by reducing PC cell survival, increasing the efficacy of existing drugs and reducing metastatic spread. PMID:27999205

  5. MutY-Homolog (MYH) inhibition reduces pancreatic cancer cell growth and increases chemosensitivity.

    PubMed

    Sharbeen, George; Youkhana, Janet; Mawson, Amanda; McCarroll, Joshua; Nunez, Andrea; Biankin, Andrew; Johns, Amber; Goldstein, David; Phillips, Phoebe

    2017-02-07

    Patients with pancreatic ductal adenocarcinoma (PC) have a poor prognosis due to metastases and chemoresistance. PC is characterized by extensive fibrosis, which creates a hypoxic microenvironment, and leads to increased chemoresistance and intracellular oxidative stress. Thus, proteins that protect against oxidative stress are potential therapeutic targets for PC. A key protein that maintains genomic integrity against oxidative damage is MutY-Homolog (MYH). No prior studies have investigated the function of MYH in PC cells. Using siRNA, we showed that knockdown of MYH in PC cells 1) reduced PC cell proliferation and increased apoptosis; 2) further decreased PC cell growth in the presence of oxidative stress and chemotherapy agents (gemcitabine, paclitaxel and vincristine); 3) reduced PC cell metastatic potential; and 4) decreased PC tumor growth in a subcutaneous mouse model in vivo. The results from this study suggest MYH may be a novel therapeutic target for PC that could potentially improve patient outcome by reducing PC cell survival, increasing the efficacy of existing drugs and reducing metastatic spread.

  6. Adenovirus-mediated RNA interference against foot-and-mouth disease virus infection both in vitro and in vivo.

    PubMed

    Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin

    2006-04-01

    Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.

  7. The OGCleaner: filtering false-positive homology clusters.

    PubMed

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

    2017-01-01

    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Rational design of aminoacyl-tRNA synthetase specific for p-acetyl-L-phenylalanine.

    PubMed

    Sun, Renhua; Zheng, Heng; Fang, Zhengzhi; Yao, Wenbing

    2010-01-01

    The Methanococcus jannaschii tRNA(Tyr)/tyrosyl-tRNA synthetase pair has been engineered to incorporate unnatural amino acids into proteins in Escherichia coli site-specifically. In order to add other unnatural amino acids into proteins by this approach, the amino acid binding site of M. jannaschii tyrosyl-tRNA synthetase need to be mutated. The crystal structures of M. jannaschii tyrosyl-tRNA synthetase and its mutations were determined, which provided an opportunity to design aminoacyl-tRNA synthetases specific for other unnatural amino acids. In our study, we attempted to design aminoacyl-tRNA synthetases being able to deliver p-acetyl-L-phenylalanine into proteins. p-Acetyl-L-phenylalanine was superimposed on tyrosyl in M. jannaschii tyrosyl-tRNA synthetase-tyrosine complex. Tyr32 needed to be changed to non-polar amino acid with shorter side chain, Val, Leu, Ile, Gly or Ala, in order to reduce steric clash and provide hydrophobic environment to acetyl on p-acetyl-L-phenylalanine. Asp158 and Ile159 would be changed to specific amino acids for the same reason. So we designed 60 aminoacyl-tRNA synthetases. Binding of these aminoacyl-tRNA synthetases with p-acetyl-L-phenylalanine indicated that only 15 of them turned out to be able to bind p-acetyl-L-phenylalanine with reasonable poses. Binding affinity computation proved that the mutation of Tyr32Leu and Asp158Gly benefited p-acetyl-L-phenylalanine binding. And two of the designed aminoacyl-tRNA synthetases had considerable binding affinities. They seemed to be very promising to be able to incorporate p-acetyl-L-phenylalanine into proteins in E. coli. The results show that the combination of homology modeling and molecular docking is a feasible method to filter inappropriate mutations in molecular design and point out beneficial mutations. Copyright 2009 Elsevier Inc. All rights reserved.

  9. An RNA-Binding Multimer Specifies Nematode Sperm Fate.

    PubMed

    Aoki, Scott T; Porter, Douglas F; Prasad, Aman; Wickens, Marvin; Bingman, Craig A; Kimble, Judith

    2018-06-26

    FOG-3 is a master regulator of sperm fate in Caenorhabditis elegans and homologous to Tob/BTG proteins, which in mammals are monomeric adaptors that recruit enzymes to RNA binding proteins. Here, we determine the FOG-3 crystal structure and in vitro demonstrate that FOG-3 forms dimers that can multimerize. The FOG-3 multimeric structure has a basic surface potential, suggestive of binding nucleic acid. Consistent with that prediction, FOG-3 binds directly to nearly 1,000 RNAs in nematode spermatogenic germ cells. Most binding is to the 3' UTR, and most targets (94%) are oogenic mRNAs, even though assayed in spermatogenic cells. When tethered to a reporter mRNA, FOG-3 represses its expression. Together these findings elucidate the molecular mechanism of sperm fate specification and reveal the evolution of a protein from monomeric to multimeric form with acquisition of a distinct mode of mRNA repression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  10. A bioinformatic survey of RNA-binding proteins in Plasmodium.

    PubMed

    Reddy, B P Niranjan; Shrestha, Sony; Hart, Kevin J; Liang, Xiaoying; Kemirembe, Karen; Cui, Liwang; Lindner, Scott E

    2015-11-02

    The malaria parasites in the genus Plasmodium have a very complicated life cycle involving an invertebrate vector and a vertebrate host. RNA-binding proteins (RBPs) are critical factors involved in every aspect of the development of these parasites. However, very few RBPs have been functionally characterized to date in the human parasite Plasmodium falciparum. Using different bioinformatic methods and tools we searched P. falciparum genome to list and annotate RBPs. A representative 3D models for each of the RBD domain identified in P. falciparum was created using I-TESSAR and SWISS-MODEL. Microarray and RNAseq data analysis pertaining PfRBPs was performed using MeV software. Finally, Cytoscape was used to create protein-protein interaction network for CITH-Dozi and Caf1-CCR4-Not complexes. We report the identification of 189 putative RBP genes belonging to 13 different families in Plasmodium, which comprise 3.5% of all annotated genes. Almost 90% (169/189) of these genes belong to six prominent RBP classes, namely RNA recognition motifs, DEAD/H-box RNA helicases, K homology, Zinc finger, Puf and Alba gene families. Interestingly, almost all of the identified RNA-binding helicases and KH genes have cognate homologs in model species, suggesting their evolutionary conservation. Exploration of the existing P. falciparum blood-stage transcriptomes revealed that most RBPs have peak mRNA expression levels early during the intraerythrocytic development cycle, which taper off in later stages. Nearly 27% of RBPs have elevated expression in gametocytes, while 47 and 24% have elevated mRNA expression in ookinete and asexual stages. Comparative interactome analyses using human and Plasmodium protein-protein interaction datasets suggest extensive conservation of the PfCITH/PfDOZI and PfCaf1-CCR4-NOT complexes. The Plasmodium parasites possess a large number of putative RBPs belonging to most of RBP families identified so far, suggesting the presence of extensive post

  11. Investigating homology between proteins using energetic profiles.

    PubMed

    Wrabl, James O; Hilser, Vincent J

    2010-03-26

    Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding) and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved local stability, may

  12. The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8α+ dendritic cells

    PubMed Central

    Crozat, Karine; Guiton, Rachel; Contreras, Vanessa; Feuillet, Vincent; Dutertre, Charles-Antoine; Ventre, Erwan; Vu Manh, Thien-Phong; Baranek, Thomas; Storset, Anne K.; Marvel, Jacqueline; Boudinot, Pierre; Hosmalin, Anne; Schwartz-Cornil, Isabelle

    2010-01-01

    Human BDCA3+ dendritic cells (DCs) were suggested to be homologous to mouse CD8α+ DCs. We demonstrate that human BDCA3+ DCs are more efficient than their BDCA1+ counterparts or plasmacytoid DCs (pDCs) in cross-presenting antigen and activating CD8+ T cells, which is similar to mouse CD8α+ DCs as compared with CD11b+ DCs or pDCs, although with more moderate differences between human DC subsets. Yet, no specific marker was known to be shared between homologous DC subsets across species. We found that XC chemokine receptor 1 (XCR1) is specifically expressed and active in mouse CD8α+, human BDCA3+, and sheep CD26+ DCs and is conserved across species. The mRNA encoding the XCR1 ligand chemokine (C motif) ligand 1 (XCL1) is selectively expressed in natural killer (NK) and CD8+ T lymphocytes at steady-state and is enhanced upon activation. Moreover, the Xcl1 mRNA is selectively expressed at high levels in central memory compared with naive CD8+ T lymphocytes. Finally, XCR1−/− mice have decreased early CD8+ T cell responses to Listeria monocytogenes infection, which is associated with higher bacterial loads early in infection. Therefore, XCR1 constitutes the first conserved specific marker for cell subsets homologous to mouse CD8α+ DCs in higher vertebrates and promotes their ability to activate early CD8+ T cell defenses against an intracellular pathogenic bacteria. PMID:20479118

  13. Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

    PubMed

    Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

    2018-05-04

    Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for

  14. Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

    PubMed Central

    Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M

    1982-01-01

    A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

  15. Down-Regulation of TM29, a Tomato SEPALLATA Homolog, Causes Parthenocarpic Fruit Development and Floral Reversion1

    PubMed Central

    Ampomah-Dwamena, Charles; Morris, Bret A.; Sutherland, Paul; Veit, Bruce; Yao, Jia-Long

    2002-01-01

    We have characterized the tomato (Lycopersicon esculentum Mill.) MADS box gene TM29 that shared a high amino acid sequence homology to the Arabidopsis SEP1, 2, and 3 (SEPALLATA1, 2, and 3) genes. TM29 showed similar expression profiles to SEP1, with accumulation of mRNA in the primordia of all four whorls of floral organs. In addition, TM29 mRNA was detected in inflorescence and vegetative meristems. To understand TM29 function, we produced transgenic tomato plants in which TM29 expression was down-regulated by either cosuppression or antisense techniques. These transgenic plants produced aberrant flowers with morphogenetic alterations in the organs of the inner three whorls. Petals and stamens were green rather than yellow, suggesting a partial conversion to a sepalloid identity. Stamens and ovaries were infertile, with the later developing into parthenocarpic fruit. Ectopic shoots with partially developed leaves and secondary flowers emerged from the fruit. These shoots resembled the primary transgenic flowers and continued to produce parthenocarpic fruit and additional ectopic shoots. Based on the temporal and spatial expression pattern and transgenic phenotypes, we propose that TM29 functions in floral organ development, fruit development, and maintenance of floral meristem identity in tomato. PMID:12376628

  16. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    NASA Technical Reports Server (NTRS)

    Winker, S.; Woese, C. R.

    1991-01-01

    The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

  17. Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

    PubMed Central

    Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

    1997-01-01

    A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

  18. A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures.

    PubMed

    Xu, Wentao; Tian, Jingjing; Shao, Xiangli; Zhu, Longjiao; Huang, Kunlun; Luo, Yunbo

    2017-03-15

    For previously reported aptasensor, the sensitivity and selectivity of aptamers to targets were often suppressed due to the reporter label of single-stranded molecular beacon or hindrance of the duplex DNA strand displacement. To solve the affinity declining of aptamers showed in traditional way and realize on-site rapid detection of Lipopolysaccharides (LPS), we developed an ingenious structure-switching aptasensor based on the bulb-like triplex turn-on switch (BTTS) as the effective molecular recognition and signal transduction element and streptavidin-horseradish peroxidase modified hybridization chain reaction (HCR-HRP) nanocomposites as the signal amplifier and signal report element. In the presence of LPS, the bulb-like LPS-aptamer (BLA) and LPS formed the LPS/aptamer complex, while the BTTS disassembled and liberated the dissociative bridge probes (BP) to achieve molecular recognition and signal transduction. Immobilized BP, captured by immobilized capture probes (CP), triggered hybridization chain reactions (HCR) to amplify the switching signal, and the HCR products were then modified with streptavidin-horseradish peroxidase (SA-HRP) to form HCR-HRP nanostructures to output colorimetric signals. In less than four hours, the proposed biosensor showed a detection limit of 50pg/mL of LPS quantitatively with the portable spectrophotometer and the observation limit of 20ng/mL semi-quantitatively with the naked eye, opening up new opportunities for LPS detection in future clinical diagnosis, food security and environment monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Identification of a Soybean MOTHER OF FT AND TFL1 Homolog Involved in Regulation of Seed Germination

    PubMed Central

    Wang, Xu; Wu, Faqiang; Hu, Ruibo; Fu, Yongfu

    2014-01-01

    Seed germination is an important event in the life cycle of seed plants, and is controlled by complex and coordinated genetic networks. Many genes involved in the regulation of this process have been identified in different plant species so far. Recent studies in both Arabidopsis and wheat have uncovered a new role of MOTHER OF FT AND TFL1 (MFT) in seed germination. Here, we reported a homolog of MFT in soybean (GmMFT) which strongly expressed in seeds. Detailed expression analysis showed that the mRNA level of GmMFT increased with seed development but declined during seed germination. The transcription of GmMFT also responded to exogenous application of ABA and GA3. Ectopic expression of GmMFT CDS in Arabidopsis moderately inhibited seed germination. All these evidences suggest that GmMFT may be a negative regulator of seed germination. PMID:24932489

  20. Cloning and expression of a sorghum gene with homology to maize vp1. Its potential involvement in pre-harvest sprouting resistance.

    PubMed

    Carrari, F; Perez-Flore, L; Lijavetzky, D; Enciso, S; Sanchez, R; Benech-Arnold, R; Iusem, N

    2001-04-01

    Pre-harvest sprouting (PHS) in sorghum is related to the lack of a normal dormancy level during seed development and maturation. Based on previous evidence that seed dormancy in maize is controlled by the vp1 gene, we used a PCR-based approach to isolate two Sorghum bicolor genomic and cDNA clones from two genotypes exhibiting different PHS behaviour and sensitivity to abscisic acid (ABA). The two 699 amino acid predicted protein sequences differ in two residues at positions 341 (Gly or Cys within the repression domain) and 448 (Pro or Ser) and show over 80, 70 and 60% homology to maize, rice and oat VP1 proteins respectively. Expression analysis of the sorghum vp1 gene in the two lines shows a slightly higher level of vp1 mRNA in the embryos susceptible to PHS than in those resistant to PHS during embryogenesis. However, timing of expression was different between these genotypes during this developmental process. Whereas for the former the main peak of expression was observed at 20 days after pollination (DAP), the peak in the latter was found at later developmental stages when seed maturation was almost complete. Under favourable germination conditions and in the presence of fluridone (an inhibitor of ABA biosynthesis), sorghum vp1 mRNA showed to be consistently correlated with sensitivity to ABA but not with ABA content and dormancy.

  1. Lessons from bacterial homolog of tubulin, FtsZ for microtubule dynamics.

    PubMed

    Battaje, Rachana Rao; Panda, Dulal

    2017-09-01

    FtsZ, a homolog of tubulin, is found in almost all bacteria and archaea where it has a primary role in cytokinesis. Evidence for structural homology between FtsZ and tubulin came from their crystal structures and identification of the GTP box. Tubulin and FtsZ constitute a distinct family of GTPases and show striking similarities in many of their polymerization properties. The differences between them, more so, the complexities of microtubule dynamic behavior in comparison to that of FtsZ, indicate that the evolution to tubulin is attributable to the incorporation of the complex functionalities in higher organisms. FtsZ and microtubules function as polymers in cell division but their roles differ in the division process. The structural and partial functional homology has made the study of their dynamic properties more interesting. In this review, we focus on the application of the information derived from studies on FtsZ dynamics to study microtubule dynamics and vice versa. The structural and functional aspects that led to the establishment of the homology between the two proteins are explained to emphasize the network of FtsZ and microtubule studies and how they are connected. © 2017 Society for Endocrinology.

  2. Gene expression network regulated by DNA methylation and microRNA during microcystin-leucine arginine induced malignant transformation in human hepatocyte L02 cells.

    PubMed

    Chen, Hong-Qiang; Zhao, Ji; Li, Yan; He, Li-Xiong; Huang, Yu-Jing; Shu, Wei-Qun; Cao, Jia; Liu, Wen-Bin; Liu, Jin-Yi

    2018-06-01

    Microcystin (MC) is a cyclic heptapeptide compound which could lead to the development of hepatocellular carcinoma. However, the underlying epigenetic regulation mechanism is largely unknown. In this study, microcystin-LR (L: lysine, R: arginine, MC-LR) was used to induce the malignant transformation of human hepatocyte L02 cell line. The profile of gene expression, microRNA (miRNA) and DNA methylation were detected through high-throughput sequencing. Compared with control group, the expression of 826 genes and 187 miRNAs changed significantly in MC-LR treated group. DNA methylation sequencing analysis showed that 2592 CpG sites differentially methylated in promoter or the coding DNA sequence (CDS) of genes, while DNA methyltransferase 3 alpha (DNMT3a) and DNA methyltransferase 3 beta (DNMT3b) were dramatically up-regulated. Functional analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed that significantly changed mRNAs and microRNAs were mainly involved in the formation of cancer, proliferation, invasion, migration and metabolism. MiRNA-mRNA network and mRNA-mRNA network analysis showed that hsa-miR-320a, hsa-miR-331-3p, hsa-miR-26a-5p, hsa-miR-196a-5p, hsa-miR-221-3p, coiled-coil domain containing 180 (CCDC180), melanoma antigen gene family member D1 (MAGED1), membrane spanning 4-domains A7 (MS4A7), hephaestin like 1 (HEPHL1), BH3 (Bcl-2 homology 3)-like motif containing, cell death inducer (BLID), matrix metallopeptidase 13 (MMP13), guanylate binding protein 5 (GBP5), adipogenesis regulatory factor (ADIRF), formin homology 2 domain containing 1 (FHDC1), protein kinase CAMP-dependent type II regulatory subunit beta (PRKAR2B), nodium leak channel, non-selective (NALCN), myosin light chain kinase 3 (MYLK3), epidermal growth factor receptor (EGFR) and zinc finger protein 704 (ZNF704) were key miRNAs and genes in the malignant transformation induced by MC-LR in L02 cells. Moreover, we found that expression of MYLK3, EGFR and ZNF704 were

  3. BmTGIF, a Bombyx mori Homolog of Drosophila DmTGIF, Regulates Progression of Spermatogenesis

    PubMed Central

    Sheng, Jie; Xue, Renyu; Gong, Chengliang

    2012-01-01

    TG-interacting factor (TGIF) in Drosophila consists of two tandemly-repeated genes, achintya (Dmachi) and vismay (Dmvis), which act as transcriptional activators in Drosophila spermatogenesis. In contrast, TGIF in humans is a transcriptional repressor that binds directly to DNA or interacts with corepressors to repress the transcription of target genes. In this study, we investigated the characteristics and functions of BmTGIF, a Bombyx mori homolog of DmTGIF. Like DmTGIF, BmTGIF is predominantly expressed in the testes and ovaries. Four alternatively spliced isoforms could be isolated from testes, and two isoforms from ovaries. Quantitative polymerase chain reaction indicated BmTGIF was abundantly expressed in the testis of 3rd instar larvae, when the testis is almost full of primary spermatocytes. The results of luciferase assays indicated that BmTGIF contains two adjacent acidic domains that activate the transcription of reporter genes. Immunofluorescence assay in BmN cells showed that the BmTGIF protein was located mainly in the nucleus, and paraffin sections of testis showed BmTGIF was grossly expressed in primary spermatocytes and mature sperms. Consistent with the role of DmVis in Drosophila development, BmTGIF significantly affected spermatid differentiation, as indicated by hematoxylin-eosin staining of paraffin sections of testis from BmTGIF-small interfering RNA (siRNA)-injected male silkworms. Co-immunoprecipitation experiments suggested that BmTGIF interacted with BmAly, and that they may recruit other factors to form a complex to regulate the genes required for meiotic divisions and spermatid differentiation. The results of this analysis of BmTGIF will improve our understanding of the mechanism of spermatid differentiation in B. mori, with potential applications for pest control. PMID:23152760

  4. Drosophila RISC component VIG and its homolog Vig2 impact heterochromatin formation.

    PubMed

    Gracheva, Elena; Dus, Monica; Elgin, Sarah C R

    2009-07-08

    Heterochromatin formation plays an important role in gene regulation and the maintenance of genome integrity. Here we present results from a study of the D. melanogaster gene vig, encoding an RNAi complex component and its homolog vig2 (CG11844) that support their involvement in heterochromatin formation and/or maintenance. Protein null mutations vig(EP812) and vig2(PL470) act as modifiers of Position Effect Variegation (PEV). VIG and Vig2 are present in polytene chromosomes and partially overlap with HP1. Quantitative immunoblots show depletion of HP1 and HP2 (large isoform) in isolated nuclei from the vig(EP812) mutant. The vig2(PL470) mutant strain demonstrates a decreased level of H3K9me2. Pull-down experiments using antibodies specific to HP1 recovered both VIG and Vig2. The association between HP1 and both VIG and Vig2 proteins depends on an RNA component. The above data and the developmental profiles of the two genes suggest that Vig2 may be involved in heterochromatin targeting and establishment early in development, while VIG may have a role in stabilizing HP1/HP2 chromatin binding during later stages.

  5. Acclimation of Oxygenic Photosynthesis to Iron Starvation Is Controlled by the sRNA IsaR1.

    PubMed

    Georg, Jens; Kostova, Gergana; Vuorijoki, Linda; Schön, Verena; Kadowaki, Taro; Huokko, Tuomas; Baumgartner, Desirée; Müller, Maximilian; Klähn, Stephan; Allahverdiyeva, Yagut; Hihara, Yukako; Futschik, Matthias E; Aro, Eva-Mari; Hess, Wolfgang R

    2017-05-22

    Oxygenic photosynthesis crucially depends on proteins that possess Fe 2+ or Fe/S complexes as co-factors or prosthetic groups. Here, we show that the small regulatory RNA (sRNA) IsaR1 (Iron-Stress-Activated RNA 1) plays a pivotal role in acclimation to low-iron conditions. The IsaR1 regulon consists of more than 15 direct targets, including Fe 2+ -containing proteins involved in photosynthetic electron transfer, detoxification of anion radicals, citrate cycle, and tetrapyrrole biogenesis. IsaR1 is essential for maintaining physiological levels of Fe/S cluster biogenesis proteins during iron deprivation. Consequently, IsaR1 affects the acclimation of the photosynthetic apparatus to iron starvation at three levels: (1) directly, via posttranscriptional repression of gene expression; (2) indirectly, via suppression of pigment; and (3) Fe/S cluster biosynthesis. Homologs of IsaR1 are widely conserved throughout the cyanobacterial phylum. We conclude that IsaR1 is a critically important riboregulator. These findings provide a new perspective for understanding the regulation of iron homeostasis in photosynthetic organisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. New enzymes from environmental cassette arrays: Functional attributes of a phosphotransferase and an RNA-methyltransferase

    PubMed Central

    Nield, Blair S.; Willows, Robert D.; Torda, Andrew E.; Gillings, Michael R.; Holmes, Andrew J.; Nevalainen, K.M. Helena; Stokes, H.W.; Mabbutt, Bridget C.

    2004-01-01

    By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7″) from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%–28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg2+-binding residues. Unlike related APH(4) or APH(7″) enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins. PMID:15152095

  7. New enzymes from environmental cassette arrays: functional attributes of a phosphotransferase and an RNA-methyltransferase.

    PubMed

    Nield, Blair S; Willows, Robert D; Torda, Andrew E; Gillings, Michael R; Holmes, Andrew J; Nevalainen, K M Helena; Stokes, H W; Mabbutt, Bridget C

    2004-06-01

    By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7") from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%-28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg(2+)-binding residues. Unlike related APH(4) or APH(7") enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins.

  8. Tocopherol and tocotrienol homologs in parenteral lipid emulsions

    PubMed Central

    Xu, Zhidong; Harvey, Kevin A; Pavlina, Thomas M; Zaloga, Gary P; Siddiqui, Rafat A

    2015-01-01

    Parenteral lipid emulsions, which are made of oils from plant and fish sources, contain different types of tocopherols and tocotrienols (vitamin E homologs). The amount and types of vitamin E homologs in various lipid emulsions vary considerably and are not completely known. The objective of this analysis was to develop a quantitative method to determine levels of all vitamin E homologs in various lipid emulsions. An HPLC system was used to measure vitamin E homologs using a Pinnacle DB Silica normal phase column and an isocratic, n-hexane:1,4 dioxane (98:2) mobile phase. An optimized protocol was used to report vitamin E homolog concentrations in soybean oil-based (Intralipid®, Ivelip®, Lipofundin® N, Liposyn® III, and Liposyn® II), medium- and long-chain fatty acid-based (Lipofundin®, MCT and Structolipid®), olive oil-based (ClinOleic®), and fish oil-based (Omegaven®) and mixture of these oils-based (SMOFlipid®, Lipidem®) commercial parenteral lipid emulsions. Total content of all vitamin E homologs varied greatly between different emulsions, ranging from 57.9 to 383.9 µg/mL. Tocopherols (α, β, γ, δ) were the predominant vitamin E homologs for all emulsions, with tocotrienol content < 0.3%. In all of the soybean emulsions, except for Lipofundin® N, the predominant vitamin E homolog was γ-tocopherol, which ranged from 57–156 µg/mL. ClinOleic® predominantly contained α-tocopherol (32 µg/mL), whereas α-tocopherol content in Omegaven® was higher than most of the other lipid emulsions (230 µg/mL). Practical applications The information on the types and quantity of vitamin E homologs in various lipid emulsions will be extremely useful to physicians and healthcare personnel in selecting appropriate lipid emulsions that are exclusively used in patients with inadequate gastrointestinal function, including hospitalized and critically ill patients. Some emulsions may require vitamin E supplementation in order to meet minimal human requirements

  9. Detecting distant homologies on protozoans metabolic pathways using scientific workflows.

    PubMed

    da Cruz, Sérgio Manuel Serra; Batista, Vanessa; Silva, Edno; Tosta, Frederico; Vilela, Clarissa; Cuadrat, Rafael; Tschoeke, Diogo; Dávila, Alberto M R; Campos, Maria Luiza Machado; Mattoso, Marta

    2010-01-01

    Bioinformatics experiments are typically composed of programs in pipelines manipulating an enormous quantity of data. An interesting approach for managing those experiments is through workflow management systems (WfMS). In this work we discuss WfMS features to support genome homology workflows and present some relevant issues for typical genomic experiments. Our evaluation used Kepler WfMS to manage a real genomic pipeline, named OrthoSearch, originally defined as a Perl script. We show a case study detecting distant homologies on trypanomatids metabolic pathways. Our results reinforce the benefits of WfMS over script languages and point out challenges to WfMS in distributed environments.

  10. RNA interference can be used to disrupt gene function in tardigrades

    PubMed Central

    Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

    2012-01-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

  11. miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

    PubMed Central

    Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

    2015-01-01

    RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

  12. Long noncoding RNA derived from CD244 signaling epigenetically controls CD8+ T-cell immune responses in tuberculosis infection

    PubMed Central

    Wang, Yang; Zhong, Huiling; Xie, Xiaodan; Chen, Crystal Y.; Huang, Dan; Shen, Ling; Zhang, Hui; Chen, Zheng W.; Zeng, Gucheng

    2015-01-01

    Molecular mechanisms for T-cell immune responses modulated by T cell-inhibitory molecules during tuberculosis (TB) infection remain unclear. Here, we show that active human TB infection up-regulates CD244 and CD244 signaling-associated molecules in CD8+ T cells and that blockade of CD244 signaling enhances production of IFN-γ and TNF-α. CD244 expression/signaling in TB correlates with high levels of a long noncoding RNA (lncRNA)-BC050410 [named as lncRNA-AS-GSTT1(1-72) or lncRNA-CD244] in the CD244+CD8+ T-cell subpopulation. CD244 signaling drives lncRNA-CD244 expression via sustaining a permissive chromatin state in the lncRNA-CD244 locus. By recruiting polycomb protein enhancer of zeste homolog 2 (EZH2) to infg/tnfa promoters, lncRNA-CD244 mediates H3K27 trimethylation at infg/tnfa loci toward repressive chromatin states and inhibits IFN-γ/TNF-α expression in CD8+ T cells. Such inhibition can be reversed by knock down of lncRNA-CD244. Interestingly, adoptive transfer of lncRNA-CD244–depressed CD8+ T cells to Mycobacterium tuberculosis (MTB)-infected mice reduced MTB infection and TB pathology compared with lncRNA-CD244–expressed controls. Thus, this work uncovers previously unidentified mechanisms in which T cell-inhibitory signaling and lncRNAs regulate T-cell responses and host defense against TB infection. PMID:26150504

  13. A HuD-ZBP1 ribonucleoprotein complex localizes GAP-43 mRNA into axons through its 3' untranslated region AU-rich regulatory element.

    PubMed

    Yoo, Soonmoon; Kim, Hak H; Kim, Paul; Donnelly, Christopher J; Kalinski, Ashley L; Vuppalanchi, Deepika; Park, Michael; Lee, Seung J; Merianda, Tanuja T; Perrone-Bizzozero, Nora I; Twiss, Jeffery L

    2013-09-01

    Localized translation of axonal mRNAs contributes to developmental and regenerative axon growth. Although untranslated regions (UTRs) of many different axonal mRNAs appear to drive their localization, there has been no consensus RNA structure responsible for this localization. We recently showed that limited expression of ZBP1 protein restricts axonal localization of both β-actin and GAP-43 mRNAs. β-actin 3'UTR has a defined element for interaction with ZBP1, but GAP-43 mRNA shows no homology to this RNA sequence. Here, we show that an AU-rich regulatory element (ARE) in GAP-43's 3'UTR is necessary and sufficient for its axonal localization. Axonal GAP-43 mRNA levels increase after in vivo injury, and GAP-43 mRNA shows an increased half-life in regenerating axons. GAP-43 mRNA interacts with both HuD and ZBP1, and HuD and ZBP1 co-immunoprecipitate in an RNA-dependent fashion. Reporter mRNA with the GAP-43 ARE competes with endogenous β-actin mRNA for axonal localization and decreases axon length and branching similar to the β-actin 3'UTR competing with endogenous GAP-43 mRNA. Conversely, over-expressing GAP-43 coding sequence with its 3'UTR ARE increases axonal elongation and this effect is lost when just the ARE is deleted from GAP-43's 3'UTR. We have recently found that over-expression of GAP-43 using an axonally targeted construct with the 3'UTRs of GAP-43 promoted elongating growth of axons, while restricting the mRNA to the cell body with the 3'UTR of γ-actin had minimal effect on axon length. In this study, we show that the ARE in GAP-43's 3'UTR is responsible for localization of GAP-43 mRNA into axons and is sufficient for GAP-43 protein's role in elongating axonal growth. © 2013 International Society for Neurochemistry.

  14. Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated, homology-independent knock-in system.

    PubMed

    Katoh, Yohei; Michisaka, Saki; Nozaki, Shohei; Funabashi, Teruki; Hirano, Tomoaki; Takei, Ryota; Nakayama, Kazuhisa

    2017-04-01

    The CRISPR/Cas9 system has revolutionized genome editing in virtually all organisms. Although the CRISPR/Cas9 system enables the targeted cleavage of genomic DNA, its use for gene knock-in remains challenging because levels of homologous recombination activity vary among various cells. In contrast, the efficiency of homology-independent DNA repair is relatively high in most cell types. Therefore the use of a homology-independent repair mechanism is a possible alternative for efficient genome editing. Here we constructed a donor knock-in vector optimized for the CRISPR/Cas9 system and developed a practical system that enables efficient disruption of target genes by exploiting homology-independent repair. Using this practical knock-in system, we successfully disrupted genes encoding proteins involved in ciliary protein trafficking, including IFT88 and IFT20, in hTERT-RPE1 cells, which have low homologous recombination activity. The most critical concern using the CRISPR/Cas9 system is off-target cleavage. To reduce the off-target cleavage frequency and increase the versatility of our knock-in system, we constructed a universal donor vector and an expression vector containing Cas9 with enhanced specificity and tandem sgRNA expression cassettes. We demonstrated that the second version of our system has improved usability. © 2017 Katoh et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  15. Molecular Characterization of Global Regulatory RNA Species That Control Pathogenicity Factors in Erwinia amylovora and Erwinia herbicola pv. gypsophilae†‡

    PubMed Central

    Ma, Weilei; Cui, Yaya; Liu, Yang; Dumenyo, C. Korsi; Mukherjee, Asita; Chatterjee, Arun K.

    2001-01-01

    rsmBEcc specifies a nontranslatable RNA regulator that controls exoprotein production and pathogenicity in soft rot-causing Erwinia carotovora subsp. carotovora. This effect of rsmBEcc RNA is mediated mostly by neutralizing the function of RsmAEcc, an RNA-binding protein of E. carotovora subsp. carotovora, which acts as a global negative regulator. To determine the occurrence of functional homologs of rsmBEcc in non-soft-rot-causing Erwinia species, we cloned the rsmB genes of E. amylovora (rsmBEa) and E. herbicola pv. gypsophilae (rsmBEhg). We show that rsmBEa in E. amylovora positively regulates extracellular polysaccharide (EPS) production, motility, and pathogenicity. In E. herbicola pv. gypsophilae, rsmBEhg elevates the levels of transcripts of a cytokinin (etz) gene and stimulates the production of EPS and yellow pigment as well as motility. RsmAEa and RsmAEhg have more than 93% identity to RsmAEcc and, like the latter, function as negative regulators by affecting the transcript stability of the target gene. The rsmB genes reverse the negative effects of RsmAEa, RsmAEhg, and RsmAEcc, but the extent of reversal is highest with homologous combinations of rsm genes. These observations and findings that rsmBEa and rsmBEhg RNA bind RsmAEcc indicate that the rsmB effect is channeled via RsmA. Additional support for this conclusion comes from the observation that the rsmB genes are much more effective as positive regulators in a RsmA+ strain of E. carotovora subsp. carotovora than in its RsmA− derivative. E. herbicola pv. gypsophilae produces a 290-base rsmB transcript that is not subject to processing. By contrast, E. amylovora produces 430- and 300-base rsmB transcripts, the latter presumably derived by processing of the primary transcript as previously noted with the transcripts of rsmBEcc. Southern blot hybridizations revealed the presence of rsmB homologs in E. carotovora, E. chrysanthemi, E. amylovora, E. herbicola, E. stewartii and E. rhapontici, as well as

  16. Synthetic biology approach for plant protection using dsRNA.

    PubMed

    Niehl, Annette; Soininen, Marjukka; Poranen, Minna M; Heinlein, Manfred

    2018-02-26

    Pathogens induce severe damages on cultivated plants and represent a serious threat to global food security. Emerging strategies for crop protection involve the external treatment of plants with double-stranded (ds)RNA to trigger RNA interference. However, applying this technology in greenhouses and fields depends on dsRNA quality, stability and efficient large-scale production. Using components of the bacteriophage phi6, we engineered a stable and accurate in vivo dsRNA production system in Pseudomonas syringae bacteria. Unlike other in vitro or in vivo dsRNA production systems that rely on DNA transcription and postsynthetic alignment of single-stranded RNA molecules, the phi6 system is based on the replication of dsRNA by an RNA-dependent RNA polymerase, thus allowing production of high-quality, long dsRNA molecules. The phi6 replication complex was reprogrammed to multiply dsRNA sequences homologous to tobacco mosaic virus (TMV) by replacing the coding regions within two of the three phi6 genome segments with TMV sequences and introduction of these constructs into P. syringae together with the third phi6 segment, which encodes the components of the phi6 replication complex. The stable production of TMV dsRNA was achieved by combining all the three phi6 genome segments and by maintaining the natural dsRNA sizes and sequence elements required for efficient replication and packaging of the segments. The produced TMV-derived dsRNAs inhibited TMV propagation when applied to infected Nicotiana benthamiana plants. The established dsRNA production system enables the broad application of dsRNA molecules as an efficient, highly flexible, nontransgenic and environmentally friendly approach for protecting crops against viruses and other pathogens. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. RNA motif search with data-driven element ordering.

    PubMed

    Rampášek, Ladislav; Jimenez, Randi M; Lupták, Andrej; Vinař, Tomáš; Brejová, Broňa

    2016-05-18

    In this paper, we study the problem of RNA motif search in long genomic sequences. This approach uses a combination of sequence and structure constraints to uncover new distant homologs of known functional RNAs. The problem is NP-hard and is traditionally solved by backtracking algorithms. We have designed a new algorithm for RNA motif search and implemented a new motif search tool RNArobo. The tool enhances the RNAbob descriptor language, allowing insertions in helices, which enables better characterization of ribozymes and aptamers. A typical RNA motif consists of multiple elements and the running time of the algorithm is highly dependent on their ordering. By approaching the element ordering problem in a principled way, we demonstrate more than 100-fold speedup of the search for complex motifs compared to previously published tools. We have developed a new method for RNA motif search that allows for a significant speedup of the search of complex motifs that include pseudoknots. Such speed improvements are crucial at a time when the rate of DNA sequencing outpaces growth in computing. RNArobo is available at http://compbio.fmph.uniba.sk/rnarobo .

  18. Molecular characterization of an adiponectin receptor homolog in the white leg shrimp, Litopenaeus vannamei

    PubMed Central

    Kim, Ah Ran; Alam, Md Jobaidul; Yoon, Tae-ho; Lee, Soo Rin; Park, Hyun; Kim, Doo-Nam; An, Doo-Hae; Lee, Jae-Bong; Lee, Chung Il

    2016-01-01

    Adiponectin (AdipoQ) and its receptors (AdipoRs) are strongly related to growth and development of skeletal muscle, as well as glucose and lipid metabolism in vertebrates. Herein we report the identification of the first full-length cDNA encoding an AdipoR homolog (Liv-AdipoR) from the decapod crustacean Litopenaeus vannamei using a combination of next generation sequencing (NGS) technology and bioinformatics analysis. The full-length Liv-AdipoR (1,245 bp) encoded a protein that exhibited the canonical seven transmembrane domains (7TMs) and the inversed topology that characterize members of the progestin and adipoQ receptor (PAQR) family. Based on the obtained sequence information, only a single orthologous AdipoR gene appears to exist in arthropods, whereas two paralogs, AdipoR1 and AdipoR2, have evolved in vertebrates. Transcriptional analysis suggested that the single Liv-AdipoR gene appears to serve the functions of two mammalian AdipoRs. At 72 h after injection of 50 pmol Liv-AdipoR dsRNA (340 bp) into L. vannamei thoracic muscle and deep abdominal muscle, transcription levels of Liv-AdipoR decreased by 93% and 97%, respectively. This confirmed optimal conditions for RNAi of Liv-AdipoR. Knockdown of Liv-AdipoR resulted in significant changes in the plasma levels of ammonia, 3-methylhistine, and ornithine, but not plasma glucose, suggesting that that Liv-AdipoR is important for maintaining muscle fibers. The chronic effect of Liv-AdipoR dsRNA injection was increased mortality. Transcriptomic analysis showed that 804 contigs were upregulated and 212 contigs were downregulated by the knockdown of Liv-AdipoR in deep abdominal muscle. The significantly upregulated genes were categorized as four main functional groups: RNA-editing and transcriptional regulators, molecular chaperones, metabolic regulators, and channel proteins. PMID:27478708

  19. Strong Inverse Correlation Between MicroRNA-125b and Human Papillomavirus DNA in Productive Infection

    PubMed Central

    Nuovo, Gerard J.; Wu, Xin; Volinia, Stefano; Yan, Fengting; di Leva, Gianpiero; Chin, Nena; Nicol, Alcina F.; Jiang, Jinmai; Otterson, Gregory; Schmittgen, Thomas D.; Croce, Carlo

    2014-01-01

    Infection by the human papillomavirus (HPV) is a cause of cervical intraepithelial neoplasia (CIN) and cancer. microRNA (miRNA) in situ analysis of the transformation zone epithelia, the site of initial cervical HPV infection, showed that miRNAs let-7c, — 99a, 26a, and 125b were the most abundantly expressed. In situ testing of CIN 1 showed a dramatic reduction in miR-125b expression in the koilocytes, the cytologic marker of productive HPV infection. A marked reduction in miR-125b was likewise observed in the HPV-infected cells of the condyloma acuminatum, verruca vulgaris, and epidermodysplasia verruciformis. Reverse transcriptase in situ polymerase chain reaction (PCR) showed that the pre-miRNA 125b was present in the koilocyte, suggesting direct inactivation of the mature miRNA. HEK cells transfected with only the antimiR-125b showed perinuclear halos equivalent to HPV-infected koilocytes. NIH 3T3 cells transfected with the HPV 16 full-length genome and mimetic miR-125b showed a marked reduction in viral DNA and protein synthesis by quantitative PCR and in situ-based analyses, respectively (P=0.002). Alternatively, cotransfection with anti-miR-125b and HPV 16 markedly increased HPV DNA (P=0.002). Sequence analyses showed strong homology between L2 of different HPV genotypes and miR-125b. Transfection with HPV 16 L2 resulted in a marked reduction in miR-125b levels in the NIH 3T3 cells. HPV L2-induced inactivation of miR-125b is associated with the classic cytologic changes of the koilocyte, and the exogenous application of mimetic miR-125b markedly inhibits HPV DNA synthesis. PMID:20736742

  20. Strong inverse correlation between microRNA-125b and human papillomavirus DNA in productive infection.

    PubMed

    Nuovo, Gerard J; Wu, Xin; Volinia, Stefano; Yan, Fengting; di Leva, Gianpiero; Chin, Nena; Nicol, Alcina F; Jiang, Jinmai; Otterson, Gregory; Schmittgen, Thomas D; Croce, Carlo

    2010-09-01

    Infection by the human papillomavirus (HPV) is a cause of cervical intraepithelial neoplasia (CIN) and cancer. microRNA (miRNA) in situ analysis of the transformation zone epithelia, the site of initial cervical HPV infection, showed that miRNAs let-7c, -99a, 26a, and 125b were the most abundantly expressed. In situ testing of CIN 1 showed a dramatic reduction in miR-125b expression in the koilocytes, the cytologic marker of productive HPV infection. A marked reduction in miR-125b was likewise observed in the HPV-infected cells of the condyloma acuminatum, verruca vulgaris, and epidermodysplasia verruciformis. Reverse transcriptase in situ polymerase chain reaction (PCR) showed that the pre-miRNA 125b was present in the koilocyte, suggesting direct inactivation of the mature miRNA. HEK cells transfected with only the antimiR-125b showed perinuclear halos equivalent to HPV-infected koilocytes. NIH 3T3 cells transfected with the HPV 16 full-length genome and mimetic miR-125b showed a marked reduction in viral DNA and protein synthesis by quantitative PCR and in situ-based analyses, respectively (P=0.002). Alternatively, cotransfection with anti-miR-125b and HPV 16 markedly increased HPV DNA (P=0.002). Sequence analyses showed strong homology between L2 of different HPV genotypes and miR-125b. Transfection with HPV 16 L2 resulted in a marked reduction in miR-125b levels in the NIH 3T3 cells. HPV L2-induced inactivation of miR-125b is associated with the classic cytologic changes of the koilocyte, and the exogenous application of mimetic miR-125b markedly inhibits HPV DNA synthesis.