Sample records for rna-homology shows triplex


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. EXTERIOR DETAIL OF TRIPLEX COTTAGE FRONT SHOWING ENTRANCE TO FIRST FLOOR APARTMENT. VIEW TO SOUTHEAST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  4. Identification of plant microRNA homologs.


    Dezulian, Tobias; Remmert, Michael; Palatnik, Javier F; Weigel, Detlef; Huson, Daniel H


    MicroRNAs (miRNAs) are a recently discovered class of non-coding RNAs that regulate gene and protein expression in plants and animals. MiRNAs have so far been identified mostly by specific cloning of small RNA molecules, complemented by computational methods. We present a computational identification approach that is able to identify candidate miRNA homologs in any set of sequences, given a query miRNA. The approach is based on a sequence similarity search step followed by a set of structural filters.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  6. Triplexer Monitor Design for Failure Detection in FTTH System

    NASA Astrophysics Data System (ADS)

    Fu, Minglei; Le, Zichun; Hu, Jinhua; Fei, Xia


    Triplexer was one of the key components in FTTH systems, which employed an analog overlay channel for video broadcasting in addition to bidirectional digital transmission. To enhance the survivability of triplexer as well as the robustness of FTTH system, a multi-ports device named triplexer monitor was designed and realized, by which failures at triplexer ports can be detected and localized. Triplexer monitor was composed of integrated circuits and its four input ports were connected with the beam splitter whose power division ratio was 95∶5. By means of detecting the sampled optical signal from the beam splitters, triplexer monitor tracked the status of the four ports in triplexer (e.g. 1310 nm, 1490 nm, 1550 nm and com ports). In this paper, the operation scenario of the triplexer monitor with external optical devices was addressed. And the integrated circuit structure of the triplexer monitor was also given. Furthermore, a failure localization algorithm was proposed, which based on the state transition diagram. In order to measure the failure detection and localization time under the circumstance of different failed ports, an experimental test-bed was built. Experiment results showed that the detection time for the failure at 1310 nm port by the triplexer monitor was less than 8.20 ms. For the failure at 1490 nm or 1550 nm port it was less than 8.20 ms and for the failure at com port it was less than 7.20 ms.

  7. Quantitative analysis of the ion-dependent folding stability of DNA triplexes

    NASA Astrophysics Data System (ADS)

    Chen, Gengsheng; Chen, Shi-Jie


    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  8. Quantitative analysis of the ion-dependent folding stability of DNA triplexes.


    Chen, Gengsheng; Chen, Shi-Jie


    A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.

  9. 25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

    NASA Technical Reports Server (NTRS)

    Baharaeen, S.; Vishniac, H. S.


    Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

  10. Aminopyridinyl-Pseudodeoxycytidine Derivatives Selectively Stabilize Antiparallel Triplex DNA with Multiple CG Inversion Sites.


    Okamura, Hidenori; Taniguchi, Yosuke; Sasaki, Shigeki


    The sequence-specific formation of triplex DNA offers a potential basis for genome-targeting technologies. In an antiparallel triplex DNA, the sequence-specificity is established by the formation of specific base triplets (G-GC, A-AT, and T-AT) between a triplex-forming oligonucleotide (TFO) and a duplex DNA. However, there are no natural nucleosides that can selectively recognize the inverted CG and TA base pairs. Therefore, the recognition of the CG and TA inversion sites to form a stable triplex DNA has been a long-standing goal for the triplex-forming technology. We now describe the design and synthesis of pseudo-deoxycytidine (ΨdC) derivatives for selective recognition of the CG base pair to expand the triplex-forming sequence. The aminopyridine-bearing ΨdC derivatives showed high selectivity and affinity toward the CG base pair in all neighboring base contexts. Remarkably, 3-methyl-2-aminopyridinyl-ΨdC ((Me) AP-ΨdC) formed a stable triplex with the promoter sequence of the hTERT gene containing four CG inversion sites, and effectively inhibited its transcription in human cancer cells. Thus, (Me) AP-ΨdC is expected to serve as a new starting point of triplex-forming oligonucleotides for a wide variety of genome-targeting applications.

  11. Design and function of triplex hairpin ribozymes.


    Aquino-Jarquin, Guillermo; Rojas-Hernández, Ramiro; Alvarez-Salas, Luis Marat


    Triplex ribozymes allow for the individual activity of multiple trans-acting ribozymes producing higher target cleavage relative to tandem-expressed RZs. A triplex expression system based on a single hairpin ribozyme for the multiple expression (multiplex) vectors can be engineered to target RNAs with single or multiple antisense-accessible sites. System construction relies on triplex expression modules consisting of hairpin ribozyme cassettes flanked by ribozymes lacking catalytic domains. Multiplex vectors can be generated with single or multiple specificity by tandem cloning of triplex expression modules. Triplex ribozymes are initially tested in vitro using cis- and trans-cleavage assays against radioactive-labeled targets. In addition, triplex ribozymes are tested for cis and trans cleavage in vivo by transfection in cultured cells followed by ribonuclease protection assays (RPAs) and RT-PCR. The use of triplex configurations with multiplex ribozymes will provide the basis for the development of future RZ-based therapies and technologies.

  12. A study of the non-covalent interaction between flavonoids and DNA triplexes by electrospray ionization mass spectrometry

    NASA Astrophysics Data System (ADS)

    Wan, Cuihong; Cui, Meng; Song, Fengrui; Liu, Zhiqiang; Liu, Shuying


    The binding interactions of 22 flavonoids (9 aglycones and 13 glycosides) with DNA triplexes were investigated using electrospray ionization mass spectrometry (ESI-MS). The results revealed that the hydroxyl positions of aglycones, the locations and numbers of saccharide, as well as the aglycone skeletons play roles in the triplex-binding properties of flavonoids. The presence of 3-OH, or 3'-OH, or replacement of 4'-OH with methoxy group in aglycones decreased the fraction of bound DNA sharply. Flavonoid glycosides exhibit higher binding affinities towards the DNA triplexes than their aglycone counterparts. Glycosylations of flavones at the 8-C position and isoflavones at the 7-O position show higher binding affinities than those on the other positions of ring A of aglycones. Glycosylation with a disaccharide on C3 position of flavonol results in higher binding affinity than that with monosaccharide. Flexibility of the ring B is favorable for its interaction with DNA triplex. According to sustained off-resonance irradiation collision-induced dissociation (SORI-CID) experiments, glycosylation and non-planarity of flavonoid aglycones lead to different dissociation pathways of the flavonoid/triplex complexes. The differences between dissociation patterns suggest different DNA-binding modes or DNA-binding affinities. Although the exact binding geometry of the flavonoid-triplex complexes cannot be specified, the results may be helpful for understanding the triplex-binding properties of flavonoids and give a clue to design of triplex-binding ligands.

  13. Ultra compact triplexing filters based on SOI nanowire AWGs

    NASA Astrophysics Data System (ADS)

    Jiashun, Zhang; Junming, An; Lei, Zhao; Shijiao, Song; Liangliang, Wang; Jianguang, Li; Hongjie, Wang; Yuanda, Wu; Xiongwei, Hu


    An ultra compact triplexing filter was designed based on a silicon on insulator (SOI) nanowire arrayed waveguide grating (AWG) for fiber-to-the-home FTTH. The simulation results revealed that the design performed well in the sense of having a good triplexing function. The designed SOI nanowire AWGs were fabricated using ultraviolet lithography and induced coupler plasma etching. The experimental results showed that the crosstalk was less than -15 dB, and the 3 dB-bandwidth was 11.04 nm. The peak wavelength output from ports a, c, and b were 1455, 1510 and 1300 nm, respectively, which deviated from our original expectations. The deviation of the wavelength is mainly caused by 45 nm width deviation of the arrayed waveguides during the course of the fabrication process and partly caused by material dispersion.

  14. Novel design of bi-directional triplexer based on PLC

    NASA Astrophysics Data System (ADS)

    Xu, Chenglin; Shen, Linping; Zhou, Dong; Huang, Wei-Ping; Hong, Jin


    As the development of the technology, fiber-to-the-home (FTTH) becomes a feasible solution to meet the increasing demand on bandwidth. Due to the massive number of end users, cheap and reliable components become the bottleneck to deploy the new technology. Triplexer is one of the key components in the FTTH and is used by every end user. Currently, the available triplexers are either based on bulk optics or fiber optics with large size and high price due to manual labor involved. Planar lightwave circuit (PLC) is a possible technology for massive production and cost reduction. However, it is very challenging to design such bi-directional triplexer on PLC. The first challenge is that three channels, at λ=1310nm, 1490nm, and 1555nm, are separated unevenly over a very large wavelength range; Secondly, the bandwidths of the three channels, Δλ=100nm, 20nm, and 10nm, are very different. In the paper, we proposed a novel design by combining both coarse WDM and dense WDM. In the design, a multi-mode interference (MMI) device is used for coarse WDM to separate the 1310nm from the other two channels. The dense WDM for the remaining two channels is performed by an array waveguide gratings (AWG). The MMI and AWG are built on the same wafer with monolithic integration. Initial simulation results show it is a very promising device.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. EXTERIOR FRONT OF TRIPLEX COTTAGE. CONCRETE STEPS IN FOREGROUND LEAD TO SECOND FLOOR WEST SIDE APARTMENT. VIEW TO SOUTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  16. DNA-triplex stabilizing properties of 8-aminoguanine

    PubMed Central

    Soliva, Robert; Güimil García, Ramón; Blas, J. Ramón; Eritja, Ramon; Asensio, Juan Luis; González, Carlos; Luque, F. Javier; Orozco, Modesto


    A DNA-triplex stabilizing purine (8-aminoguanine) is designed based on molecular modeling and synthesized. The substitution of guanine by 8-aminoguanine largely stabilizes the triplex both at neutral and acidic pH, as suggested by molecular dynamics and thermodynamic integration calculations, and demonstrated by melting experiments. NMR experiments confirm the triplex-stabilizing properties of 8-aminoguanine and demonstrate that few changes are found in the structure of the triplex due to the presence of this modified base. PMID:11071942

  17. Studying RNA homology and conservation with Infernal: from single sequences to RNA families

    PubMed Central

    Barquist, Lars; Burge, Sarah W.; Gardner, Paul P.


    Emerging high-throughput technologies have led to a deluge of putative non-coding RNA (ncRNA) sequences identified in a wide variety of organisms. Systematic characterization of these transcripts will be a tremendous challenge. Homology detection is critical to making maximal use of functional information gathered about ncRNAs: identifying homologous sequence allows us to transfer information gathered in one organism to another quickly and with a high degree of confidence. ncRNA presents a challenge for homology detection, as the primary sequence is often poorly conserved and de novo secondary structure prediction and search remains difficult. This protocol introduces methods developed by the Rfam database for identifying “families” of homologous ncRNAs starting from single “seed” sequences using manually curated sequence alignments to build powerful statistical models of sequence and structure conservation known as covariance models (CMs), implemented in the Infernal software package. We provide a step-by-step iterative protocol for identifying ncRNA homologs, then constructing an alignment and corresponding CM. We also work through an example for the bacterial small RNA MicA, discovering a previously unreported family of divergent MicA homologs in genus Xenorhabdus in the process. PMID:27322404

  18. Studying RNA Homology and Conservation with Infernal: From Single Sequences to RNA Families.


    Barquist, Lars; Burge, Sarah W; Gardner, Paul P


    Emerging high-throughput technologies have led to a deluge of putative non-coding RNA (ncRNA) sequences identified in a wide variety of organisms. Systematic characterization of these transcripts will be a tremendous challenge. Homology detection is critical to making maximal use of functional information gathered about ncRNAs: identifying homologous sequence allows us to transfer information gathered in one organism to another quickly and with a high degree of confidence. ncRNA presents a challenge for homology detection, as the primary sequence is often poorly conserved and de novo secondary structure prediction and search remain difficult. This unit introduces methods developed by the Rfam database for identifying "families" of homologous ncRNAs starting from single "seed" sequences, using manually curated sequence alignments to build powerful statistical models of sequence and structure conservation known as covariance models (CMs), implemented in the Infernal software package. We provide a step-by-step iterative protocol for identifying ncRNA homologs and then constructing an alignment and corresponding CM. We also work through an example for the bacterial small RNA MicA, discovering a previously unreported family of divergent MicA homologs in genus Xenorhabdus in the process. © 2016 by John Wiley & Sons, Inc.

  19. Vacuum UV CD spectra of homopolymer duplexes and triplexes containing A.T or A.U base pairs.

    PubMed Central

    Johnson, K H; Gray, D M; Sutherland, J C


    Vacuum UV circular dichroism (CD) spectra were measured down to 174 nm for five homopolymers, five duplexes, and four triplexes containing adenine, uracil, and thymine. Near 190 nm, the CD bands of poly[d(A)] and poly[r(A)] were larger than the CD bands of the polypyrimidines, poly[d(T)], poly[d(U)], and poly[r(U)]. Little change was observed in the 190 nm region upon formation of the duplexes (poly[d(A).d(T)], poly[d(A).d(U)], poly[r(A).d(T)], poly[r(A).d(U)], and poly[r(A).r(U)]) or upon formation of two of the triplexes (poly[d(T).d(A).d(T)] and poly[d(U).d(A).d(U)]). This showed that the purine strand had the same or a similar structure in these duplexes and triplexes as when free in solution. Both A.U and A.T base pairing induced positive bands at 177 and 202 nm. For three triplexes containing poly[d(A)], the formation of a triplex from a duplex and a free pyrimidine strand induced a negative band centered between 210 and 215 nm. The induction of a band between 210 and 215 nm indicated that these triplexes had aspects of the A conformation. PMID:2041768

  20. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej


    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  1. Triplex reverse transcription-PCR for detecting viable toxigenic Vibrio cholerae in water samples in Thailand.


    Kanoktippornchai, Boonnapa; Chomvarin, Chariya; Engchanil, Chulapan; Wongboot, Warawan


    Abstract. Detection of toxigenic Vibrio cholerae O1/O139 in aquatic environment is difficult to achieve using the culture method. For direct detection of viable toxigenic V. cholerae in aquatic environment, we developed a triplex reverse transcription (RT)-PCR, targeting genes for the outer membrane protein (ompW), cholera toxin A (ctxA) and toxin-coregulated pilli (tcpA) and compared the assay with the culture method. After enrichment of the bacteria-containing filters in alkaline peptone water for 6 hours, the sensitivity of triplex RT-PCR for detecting V. cholerae was 7 cfu/ml. Of the 80 environmental water samples collected from various regions in Northeast Thailand, triplex RT-PCR detected 15 toxigenic and 20 non-toxigenic V. cholerae, whereas the culture method detected only 3 toxigenic V. cholerae--containing water samples. These results show that this triplex RT-PCR method could be used as an alternative tool for rapid and sensitive identification of viable toxigenic V cholerae in environmental water samples.

  2. Selective Preference of Parallel DNA Triplexes Is Due to the Disruption of Hoogsteen Hydrogen Bonds Caused by the Severe Nonisostericity between the G*GC and T*AT Triplets

    PubMed Central

    Goldsmith, Gunaseelan; Rathinavelan, Thenmalarchelvi; Yathindra, Narayanarao


    Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping), double (overlapping) and multiple pairs of nonisosteric base triplets (NIBTs). It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i) an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii) clarity for the prevalence of antiparallel triplexes and (iii) comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO’s against potential triplex target sites. PMID:27010368

  3. Selective Preference of Parallel DNA Triplexes Is Due to the Disruption of Hoogsteen Hydrogen Bonds Caused by the Severe Nonisostericity between the G*GC and T*AT Triplets.


    Goldsmith, Gunaseelan; Rathinavelan, Thenmalarchelvi; Yathindra, Narayanarao


    Implications of DNA, RNA and RNA.DNA hybrid triplexes in diverse biological functions, diseases and therapeutic applications call for a thorough understanding of their structure-function relationships. Despite exhaustive studies mechanistic rationale for the discriminatory preference of parallel DNA triplexes with G*GC & T*AT triplets still remains elusive. Here, we show that the highest nonisostericity between the G*GC & T*AT triplets imposes extensive stereochemical rearrangements contributing to context dependent triplex destabilisation through selective disruption of Hoogsteen scheme of hydrogen bonds. MD simulations of nineteen DNA triplexes with an assortment of sequence milieu reveal for the first time fresh insights into the nature and extent of destabilization from a single (non-overlapping), double (overlapping) and multiple pairs of nonisosteric base triplets (NIBTs). It is found that a solitary pair of NIBTs, feasible either at a G*GC/T*AT or T*AT/G*GC triplex junction, does not impinge significantly on triplex stability. But two overlapping pairs of NIBTs resulting from either a T*AT or a G*GC interruption disrupt Hoogsteen pair to a noncanonical mismatch destabilizing the triplex by ~10 to 14 kcal/mol, implying that their frequent incidence in multiples, especially, in short sequences could even hinder triplex formation. The results provide (i) an unambiguous and generalised mechanistic rationale for the discriminatory trait of parallel triplexes, including those studied experimentally (ii) clarity for the prevalence of antiparallel triplexes and (iii) comprehensive perspectives on the sequence dependent influence of nonisosteric base triplets useful in the rational design of TFO's against potential triplex target sites.

  4. Triplex formation inhibits HER-2/neu transcription in vitro.

    PubMed Central

    Ebbinghaus, S W; Gee, J E; Rodu, B; Mayfield, C A; Sanders, G; Miller, D M


    Triplex-forming oligonucleotides (TFOs) have been shown to bind to target DNA sequences in several human gene promoters such as the c-myc oncogene, the epidermal growth factor receptor, and the dihydrofolate reductase genes. TFOs have been shown to inhibit transcription in vitro and gene expression in cell culture of the c-myc and other genes. The HER-2/neu oncogene, which is overexpressed in breast cancer and other human malignancies, contains a purine-rich sequence in its promoter, which is favorable for purine:purine:pyrimidine (R:R:Y) triplex formation. Although its function in the HER-2/neu promoter is unknown, this purine-rich site is homologous to a protein-binding sequence in the promoter of the epidermal growth factor receptor that is necessary for efficient transcription of this gene. We have shown that this sequence is a site for nuclear protein binding by incubation with a crude nuclear extract. We describe the formation of an interstrand triplex using a purine-rich oligonucleotide antiparallel to this purine-rich target sequence of the HER-2/neu promoter. Triplex formation by the oligonucleotide prevents protein binding to the target site in the HER-2/neu promoter in vitro. We have shown that this oligonucleotide is a potent and specific inhibitor of HER-2/neu transcription in an in vitro assay. The triplex target site contains a single pyrimidine base that does not conform to the R:R:Y triplex motif. In an attempt to abrogate the potentially destabilizing effects of this pyrimidine base on triplex formation, we have substituted an abasic linker for the pyrimidine residue in the triplex forming oligonucleotide. Triplex formation with the modified oligonucleotide appears to occur with approximately equivalent binding affinity. Triplex formation in the HER-2/neu oncogene promoter prevents transcription in vitro and may represent a future modality for specific inhibition of this gene in vivo. Images PMID:7901237

  5. Development and validation of a triplex real-time PCR assay for the simultaneous detection of three mustard species and three celery varieties in food.


    Palle-Reisch, Monika; Hochegger, Rupert; Cichna-Markl, Margit


    The paper presents a triplex real-time PCR assay allowing the simultaneous detection of three mustard species (white, black and brown mustard) and three celery varieties (celery roots, celery stalks and leaf celery) in foodstuffs. The triplex assay does not show cross-reactivity with other Brassicaceae. Low cross-reactivities were observed with fenugreek, cumin, ginger, caraway, turmeric, lovage and rye, the ΔCt values were, however, ⩾ 12 compared to positive controls. The triplex assay allows the detection of traces of DNA of the allergenic components in spite of an excess of the other DNA templates. Analysis of extracts from model sausages containing defined concentrations of mustard and celery showed that the triplex assay is applicable to both raw and processed foods. It was found to allow the detection of 1 ppm black/brown mustard and 50 ppm white mustard and celery in raw and brewed sausages with a probability ⩾ 95%.

  6. Triplex-forming oligonucleotide target sequences in the human genome

    PubMed Central

    Goñi, J. Ramon; de la Cruz, Xavier; Orozco, Modesto


    The existence of sequences in the human genome which can be a target for triplex formation, and accordingly are candidates for anti-gene therapies, has been studied by using bioinformatics tools. It was found that the population of triplex-forming oligonucleotide target sequences (TTS) is much more abundant than that expected from simple random models. The population of TTS is large in all the genome, without major differences between chromosomes. A wide analysis along annotated regions of the genome allows us to demonstrate that the largest relative concentration of TTS is found in regulatory regions, especially in promoter zones, which suggests a tremendous potentiality for triplex strategy in the control of gene expression. The dependence of the stability and selectivity of the triplexes on the length of the TTS is also analysed using knowledge-based rules. PMID:14726484

  7. Unique condensation patterns of triplex DNA: physical aspects and physiological implications

    PubMed Central

    Goobes, Rivka; Cohen, Orit; Minsky, Abraham


    Triple-stranded DNA structures can be formed in living cells, either by native DNA sequences or following the application of antigene strategies, in which triplex-forming oligonucleotides are targeted to the nucleus. Recent studies imply that triplex motifs may play a role in DNA transcription, recombination and condensation processes in vivo. Here we show that very short triple-stranded DNA motifs, but not double-stranded segments of a comparable length, self-assemble into highly condensed and ordered structures. The condensation process, studied by circular dichroism and polarized-light microscopy, occurs under conditions that mimic cellular environments in terms of ionic strength, ionic composition and crowding. We argue that the unique tendency of triplex DNA structures to self-assemble, a priori unexpected in light of the very short length and the large charge density of these motifs, reflects the presence of strong attractive interactions that result from enhanced ion correlations. The results provide, as such, a direct experimental link between charge density, attractive interactions between like-charge polymers and DNA packaging. Moreover, the observations strongly support the notion that triple-stranded DNA motifs may be involved in the regulation of chromosome organization in living cells. PMID:12000835

  8. Experimental RNomics in Aquifex aeolicus: identification of small non-coding RNAs and the putative 6S RNA homolog

    PubMed Central

    Willkomm, Dagmar K.; Minnerup, Jens; Hüttenhofer, Alexander; Hartmann, Roland K.


    By an experimental RNomics approach, we have generated a cDNA library from small RNAs expressed from the genome of the hyperthermophilic bacterium Aquifex aeolicus. The library included RNAs that were antisense to mRNAs and tRNAs as well as RNAs encoded in intergenic regions. Substantial steady-state levels in A.aeolicus cells were confirmed for several of the cloned RNAs by northern blot analysis. The most abundant intergenic RNA of the library was identified as the 6S RNA homolog of A.aeolicus. Although shorter in size (150 nt) than its γ-proteobacterial homologs (∼185 nt), it is predicted to have the most stable structure among known 6S RNAs. As in the γ-proteobacteria, the A.aeolicus 6S RNA gene (ssrS) is located immediately upstream of the ygfA gene encoding a widely conserved 5-formyltetrahydrofolate cyclo-ligase. We identifed novel 6S RNA candidates within the γ-proteobacteria but were unable to identify reasonable 6S RNA candidates in other bacterial branches, utilizing mfold analyses of the region immediately upstream of ygfA combined with 6S RNA blastn searches. By RACE experiments, we mapped the major transcription initiation site of A.aeolicus 6S RNA primary transcripts, located within the pheT gene preceding ygfA, as well as three processing sites. PMID:15814812

  9. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression.


    Paugh, Steven W; Coss, David R; Bao, Ju; Laudermilk, Lucas T; Grace, Christy R; Ferreira, Antonio M; Waddell, M Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F; Panetta, John C; Wilkinson, Mark R; Pui, Ching-Hon; Naeve, Clayton W; Uberbacher, Edward C; Bonten, Erik J; Evans, William E


    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10(-16)) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription.

  10. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    SciTech Connect

    Paugh, Steven W.; Coss, David R.; Bao, Ju; Laudermilk, Lucas T.; Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael Rex; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching -Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.


    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10-16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.

  11. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression


    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...


    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10-16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  12. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.


    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. FIRST FLOOR APARTMENT KITCHEN PANTRY INTERIOR SHOWING WOOD SHELVING AND CASEMENT WINDOW. VIEW TO WEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. FIRST FLOOR APARTMENT KITCHEN INTERIOR SHOWING OPPOSITE VIEW FROM CA-180-A-16. VIEW TO NORTHWEST. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  16. Divalent cations and molecular crowding buffers stabilize G-triplex at physiologically relevant temperatures

    PubMed Central

    Jiang, Hong-Xin; Cui, Yunxi; Zhao, Ting; Fu, Hai-Wei; Koirala, Deepak; Punnoose, Jibin Abraham; Kong, De-Ming; Mao, Hanbin


    G-triplexes are non-canonical DNA structures formed by G-rich sequences with three G-tracts. Putative G-triplex-forming sequences are expected to be more prevalent than putative G-quadruplex-forming sequences. However, the research on G-triplexes is rare. In this work, the effects of molecular crowding and several physiologically important metal ions on the formation and stability of G-triplexes were examined using a combination of circular dichroism, thermodynamics, optical tweezers and calorimetry techniques. We determined that molecular crowding conditions and cations, such as Na+, K+, Mg2+ and Ca2+, promote the formation of G-triplexes and stabilize these structures. Of these four metal cations, Ca2+ has the strongest stabilizing effect, followed by K+, Mg2+, and Na+ in a decreasing order. The binding of K+ to G-triplexes is accompanied by exothermic heats, and the binding of Ca2+ with G-triplexes is characterized by endothermic heats. G-triplexes formed from two G-triad layers are not stable at physiological temperatures; however, G-triplexes formed from three G-triads exhibit melting temperatures higher than 37°C, especially under the molecular crowding conditions and in the presence of K+ or Ca2+. These observations imply that stable G-triplexes may be formed under physiological conditions. PMID:25787838

  17. Binding of oligonucleotides to a viral hairpin forming RNA triplexes with parallel G*G•C triplets

    PubMed Central

    Carmona, Pedro; Molina, Marina


    Infrared and UV spectroscopies have been used to study the assembly of a hairpin nucleotide sequence (nucleotides 3–30) of the 5′ non-coding region of the hepatitis C virus RNA (5′-GGCGGGGAUUAUCCCCGCUGUGAGGCGG-3′) with a RNA 20mer ligand (5′-CCGCCUCACAAAGGUGGGGU-3′) in the presence of magnesium ion and spermidine. The resulting complex involves two helical structural domains: the first one is an intermolecular duplex stem at the bottom of the target hairpin and the second one is a parallel triplex generated by the intramolecular hairpin duplex and the ligand. Infrared spectroscopy shows that N-type sugars are exclusively present in the complex. This is the first case of formation of a RNA parallel triplex with purine motif and shows that this type of targeting RNA strands to viral RNA duplexes can be used as an alternative to antisense oligonucleotides or ribozymes. PMID:11884630

  18. Homogeneous Electrochemical Biosensor for Melamine Based on DNA Triplex Structure and Exonuclease III-Assisted Recycling Amplification.


    Fu, Caili; Liu, Chang; Li, Ying; Guo, Yajing; Luo, Fang; Wang, Peilong; Guo, Longhua; Qiu, Bin; Lin, Zhenyu


    Abasic site (AP site) in the triplex structure can recognize specific target with high selectivity. In this study, this character was first applied to develop a simple, sensitive, and selective homogeneous electrochemical biosensor for melamine determination. The assay combines the advantage of the high selectivity of the DNA triplex structure containing an AP site to melamine and high efficiency of exonuclease (Exo) III-assisted recycling amplification. DNA-1 (T1), DNA-2 (T2), poly[dA] probe containing an AP site (8A) and methylene blue-labeled DNA probe (dMB probe) were carefully designed. Melamine can specifically locate in the AP site through hydrogen bonding interaction between thymine and melamine to make T1, T2, and 8A close to each other, therefore, forming a stable T-melamine-T DNA triplex structure. Under the optimal conditions, the differential pulse voltammetric (DPV) response had a linear relationship with the logarithm of melamine concentration in the range of 1 nM∼0.5 μM. The developed biosensor has been successfully applied to detect the migration of melamine from melamine bowl. Result showed that the migration in 4% acetic acid solvent was the largest, which is similar to that detected by high performance liquid chromatography. This homogeneous electrochemical sensor may have a potential prospect in detecting melamine in dairy products and migration of melamine from multicategory food packaging or application materials.

  19. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    PubMed Central

    Malik, Hassan Jamil; Raza, Amir; Amin, Imran; Scheffler, Jodi A.; Scheffler, Brian E.; Brown, Judith K.; Mansoor, Shahid


    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses to crop and ornamental plants worldwide. Using RNA interference (RNAi) to down regulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus disease spread. Using a Tobacco rattle virus-derived plasmid for in planta transient expression of double stranded RNA (dsRNA) homologous to the acetylcholinesterase (AChE) and ecdysone receptor (EcR) genes of B. tabaci, resulted in significant adult whitefly mortality. Nicotiana tabacum L. plants expressing dsRNA homologous to B. tabaci AChE and EcR were constructed by fusing sequences derived from both genes. Mortality of adult whiteflies exposed to dsRNA by feeding on N. tabacum plants, compared to non-dsRNA expressing plants, recorded at 24-hr intervals post-ingestion for three days, was >90% and 10%, respectively. Analysis of gene expression by real time quantitative PCR indicated that whitefly mortality was attributable to the down-regulation of both target genes by RNAi. Results indicated that knock down of whitefly genes involved in neuronal transmission and transcriptional activation of developmental genes, has potential as a bio-pesticide to reduce whitefly population size and thereby decrease virus spread. PMID:27929123

  20. A distinct triplex DNA unwinding activity of ChlR1 helicase.


    Guo, Manhong; Hundseth, Kristian; Ding, Hao; Vidhyasagar, Venkatasubramanian; Inoue, Akira; Nguyen, Chi-Hung; Zain, Rula; Lee, Jeremy S; Wu, Yuliang


    Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw breakage syndrome characterized by cellular defects in genome maintenance. The DNA triplex helix structures that form by Hoogsteen or reverse Hoogsteen hydrogen bonding are examples of alternate DNA structures that can be a source of genomic instability. In this study, we have examined the ability of human ChlR1 helicase to destabilize DNA triplexes. Biochemical studies demonstrated that ChlR1 efficiently melted both intermolecular and intramolecular DNA triplex substrates in an ATP-dependent manner. Compared with other substrates such as replication fork and G-quadruplex DNA, triplex DNA was a preferred substrate for ChlR1. Also, compared with FANCJ, a helicase of the same family, the triplex resolving activity of ChlR1 is unique. On the other hand, the mutant protein from a Warsaw breakage syndrome patient failed to unwind these triplexes. A previously characterized triplex DNA-specific antibody (Jel 466) bound triplex DNA structures and inhibited ChlR1 unwinding activity. Moreover, cellular assays demonstrated that there were increased triplex DNA content and double-stranded breaks in ChlR1-depleted cells, but not in FANCJ(-/-) cells, when cells were treated with a triplex stabilizing compound benzoquinoquinoxaline, suggesting that ChlR1 melting of triple-helix structures is distinctive and physiologically important to defend genome integrity. On the basis of our results, we conclude that the abundance of ChlR1 known to exist in vivo is likely to be a strong deterrent to the stability of triplexes that can potentially form in the human genome.

  1. Polypurine reverse-Hoogsteen (PPRH) oligonucleotides can form triplexes with their target sequences even under conditions where they fold into G-quadruplexes

    PubMed Central

    Solé, Anna; Delagoutte, Emmanuelle; Ciudad, Carlos J.; Noé, Véronique; Alberti, Patrizia


    Polypurine reverse-Hoogsteen (PPRH) oligonucleotides are non-modified DNA molecules composed of two mirror-symmetrical polypurine stretches linked by a five-thymidine loop. They can fold into reverse-Hoogsteen hairpins and bind to their polypyrimidine target sequence by Watson-Crick bonds forming a three-stranded structure. They have been successfully used to knockdown gene expression and to repair single-point mutations in cells. In this work, we provide an in vitro characterization (UV and fluorescence spectroscopy, gel electrophoresis and nuclease assays) of the structure and stability of two repair-PPRH oligonucleotides and of the complexes they form with their single-stranded targets. We show that one PPRH oligonucleotide forms a hairpin, while the other folds, in potassium, into a guanine-quadruplex (G4). However, the hairpin-prone oligonucleotide does not form a triplex with its single-stranded target, while the G4-prone oligonucleotide converts from a G4 into a reverse-Hoogsteen hairpin forming a triplex with its target sequence. Our work proves, in particular, that folding of a PPRH oligonucleotide into a G4 does not necessarily impair sequence-specific DNA recognition by triplex formation. It also illustrates an original example of DNA structural conversion of a G4 into a reverse-Hoogsteen hairpin driven by triplex formation; this kind of conversion might occur at particular loci of genomic DNA. PMID:28067256

  2. Spectroscopic and calorimetric investigation on the DNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) at acidic pH.

    PubMed Central

    Xodo, L E; Manzini, G; Quadrifoglio, F


    The equimolar mixture of d(CTCTTCTTTCTTTTCTTTCTTCTC) (dY24) and d(GAGAAGAAAGA) (dR11) [designated (dY24).(dR11)], forms at pH = 5 a DNA triplex, which mimicks the H-DNA structure. The DNA triplex was identified by the following criteria: (i) dY24 and dR11 co-migrate in a poly-acrylamide gel, with a mobility and a retardation coefficient comparable to those observed for an 11-triad DNA triplex, previously characterized in our laboratories (1); (ii) the intercalator ethidium bromide shows a poor affinity for (dR11).(dY24) at pH = 5, and a high affinity at pH = 8; (iii) the (dR11).(dY24) mixture is not a substrate for DNase I at pH = 5; (iv) the CD spectrum of (dR11).(dY24), at pH = 5, is consistent with those previously reported for triple-stranded DNA. The (dR11).(dY24) mixture exhibits a thermally induced co-operative transition, which appears to be monophasic, reversible and concentration dependent. This transition is attributed to the disruption of the DNA triplex into single strands. The enthalpy change of the triplex-coil transition was measured by DSC (delta Hcal = 129 +/- 6 kcal/mol) and, assuming a two-state model, by analysis of UV-denaturation curves (average of two methods delta HUV = 137 +/- 13 kcal/mol). Subtracting from delta Hcal of triplex formation the contributions due to the Watson-Crick helix and to the protonation of the C-residues, we found that each pyrimidine binding into the major groove of the duplex, through a Hoogsteen base pair, is accompanied by an average delta H = -5.8 +/- 0.6 kcal/mol. The effect on the stability of the (dR11).(dY24) triplex due to the substitution of a T:A:T triad with a T:T:T one was also investigated. Images PMID:2362808

  3. Triplex structures induce DNA double strand breaks via replication fork collapse in NER deficient cells

    PubMed Central

    Kaushik Tiwari, Meetu; Adaku, Nneoma; Peart, Natoya; Rogers, Faye A.


    Structural alterations in DNA can serve as natural impediments to replication fork stability and progression, resulting in DNA damage and genomic instability. Naturally occurring polypurine mirror repeat sequences in the human genome can create endogenous triplex structures evoking a robust DNA damage response. Failures to recognize or adequately process these genomic lesions can result in loss of genomic integrity. Nucleotide excision repair (NER) proteins have been found to play a prominent role in the recognition and repair of triplex structures. We demonstrate using triplex-forming oligonucleotides that chromosomal triplexes perturb DNA replication fork progression, eventually resulting in fork collapse and the induction of double strand breaks (DSBs). We find that cells deficient in the NER damage recognition proteins, XPA and XPC, accumulate more DSBs in response to chromosomal triplex formation than NER-proficient cells. Furthermore, we demonstrate that XPC-deficient cells are particularly prone to replication-associated DSBs in the presence of triplexes. In the absence of XPA or XPC, deleterious consequences of triplex-induced genomic instability may be averted by activating apoptosis via dual phosphorylation of the H2AX protein. Our results reveal that damage recognition by XPC and XPA is critical to maintaining replication fork integrity and preventing replication fork collapse in the presence of triplex structures. PMID:27298253

  4. Bi-directional triplexer with butterfly MMI coupler using SU-8 polymer waveguides

    NASA Astrophysics Data System (ADS)

    Mareš, David; Jeřábek, Vítězslav; Prajzler, Václav


    We report about a design of a bi-directional planar optical multiplex/demultiplex filter (triplexer) for the optical part of planar hybrid WDM bi-directional transceiver in fiber-to-the-home (FTTH) PON applications. The triplex lightwave circuit is based on the Epoxy Novolak Resin SU-8 waveguides on the silica-on-silicon substrate with Polymethylmethacrylate cladding layer. The triplexer is comprised of a linear butterfly concept of multimode interference (MMI) coupler separating downstream optical signals of 1490 nm and 1550 nm. For the upstream channel of 1310 nm, an additional directional coupler (DC) is used to add optical signal of 1310 nm propagating in opposite direction. The optical triplexer was designed and optimized using beam propagation method. The insertion losses, crosstalk attenuation, and extinction ratio for all three inputs/outputs were investigated. The intended triplexer was designed using the parameters of the separated DC and MMI filter to approximate the idealized direct connection of both devices.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. FIRST FLOOR APARTMENT SOUTH BEDROOM INTERIOR SHOWING PAIRED 6-LIGHT OVER 6-LIGHT DOUBLE-HUNG, WOOD-FRAMED WINDOWS. VIEW TO SOUTH. - Lee Vining Creek Hydroelectric System, Triplex Cottage, Lee Vining Creek, Lee Vining, Mono County, CA

  6. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.


    Mukherjee, Anirban; Vasquez, Karen M


    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences.

  7. TriPleX: a versatile dielectric photonic platform

    NASA Astrophysics Data System (ADS)

    Wörhoff, Kerstin; Heideman, René G.; Leinse, Arne; Hoekman, Marcel


    Photonic applications based on planar waveguide technology impose stringent requirements on properties such as optical propagation losses, light coupling to optical fibers, integration density, as well as on reliability and reproducibility. The latter is correlated to a high level of control of the refractive index and waveguide geometry. In this paper, we review a versatile dielectric waveguide platform, called TriPleX, which is based on alternating silicon nitride and silicon dioxide films. Fabrication with CMOS-compatible equipment based on low-pressure chemical vapor deposition enables the realization of stable material compositions being a prerequisite to the control of waveguide properties and modal shape. The transparency window of both materials allows for the realization of low-loss waveguides over a wide wavelength range (400 nm-2.35 μm). Propagation losses as low as 5×10-4 dB/cm are reported. Three basic geometries (box shell, double stripe, and filled box) can be distinguished. A specific tapering technology is developed for on-chip, low-loss (<0.1 dB) spotsize convertors, allowing for combining efficient fiber to chip coupling with high-contrast waveguides required for increased functional complexity as well as for hybrid integration with other photonic platforms such as InP and SOI. The functionality of the TriPleX platform is captured by verified basic building blocks. The corresponding library and associated design kit is available for multi-project wafer (MPW) runs. Several applications of this platform technology in communications, biomedicine, sensing, as well as a few special fields of photonics are treated in more detail.

  8. Synthesis of C-5, C-2' and C-4'-neomycin-conjugated triplex forming oligonucleotides and their affinity to DNA-duplexes.


    Tähtinen, Ville; Granqvist, Lotta; Virta, Pasi


    Neomycin-conjugated homopyrimidine oligo 2'-deoxyribonucleotides have been synthesized on a solid phase and their potential as triplex forming oligonucleotides (TFOs) with DNA-duplexes has been studied. For the synthesis of the conjugates, C-5, C-2' and C-4'-tethered alkyne-modified nucleoside derivatives were used as an integral part of the standard automated oligonucleotide chain elongation. An azide-derived neomycin was then conjugated to the incorporated terminal alkynes by Cu(I)-catalyzed 1,3-dipolar cycloaddition (the click chemistry). Concentrated ammonia released the desired conjugates in acceptable purity and yields. The site of conjugation was expectedly important for the Hoogsteen-face recognition: C-5-conjugation showed a notable positive effect, whereas the influence of the C-2' and C-4'-modification remained marginal. In addition to conventional characterization methods (UV- and CD-spectroscopy), (19)F NMR spectroscopy was applied for the monitoring of triplex/duplex/single strand-conversions.

  9. Studies on the formation and stability of triplex DNA using fluorescence correlation spectroscopy.


    Hu, Hongyan; Huang, Xiangyi; Ren, Jicun


    Triplex DNA has become one of the most useful recognition motifs in the design of new molecular biology tools, therapeutic agents and sophisticated DNA-based nanomaterials because of its direct recognition of natural double-stranded DNA. In this paper, we developed a sensitive and microscale method to study the formation and stability characterization of triplex DNA using fluorescence correlation spectroscopy (FCS). The principle of this method is mainly based on the excellent capacity of FCS for sensitively distinguishing between free single-strand DNA (ssDNA) fluorescent probes and fluorescent probe-double-strand DNA (dsDNA) hybridized complexes. First, we systematically investigated the experimental conditions of triplex DNA formation. Then, we evaluated the equilibrium association constants (K(a)) under different ssDNA probe lengths, composition and pH. Finally, we used FCS to measure the hybridization fraction of a 20-mer perfectly matched ssDNA probe and three single-base mismatched ssDNA probes with 146-mer dsDNA. Our data illustrated that FCS is a useful tool for the direct determination of the thermodynamic parameters of triplex DNA formation and discrimination of a single-base mismatch of triplex DNA without denaturation. Compared with current methods, our method is characterized by high sensitivity, good universality and small sample and reagent requirements. More importantly, our method has the potential to become a platform for triplex DNA research in vitro.

  10. A Triplex Ribozyme Expression System Based on a Single Hairpin Ribozyme

    PubMed Central

    Aquino-Jarquin, Guillermo; Benítez-Hess, María Luisa; DiPaolo, Joseph A.


    Triplex ribozyme (RZ) configurations allow for the individual activity of trans-acting RZs in multiple expression cassettes (multiplex), thereby increasing target cleavage relative to conventionally expressed RZs. Although hairpin RZs have been advantageously compared to hammerhead RZs, their longer size and structural features complicated triplex design. We present a triplex expression system based on a single hairpin RZ with trans-cleavage capability and simple engineering. The system was tested in vitro using cis- and trans-cleavage kinetic assays against a known target RNA from HPV-16 E6/E7 mRNA. Single and multiplex triplex RZ constructs were more efficient in cleaving the target than tandem-cloned hairpin RZs, suggesting that the release of individual RZs enhanced trans-cleavage kinetics. Multiplex systems constructed with two different hairpin RZs resulted in better trans-cleavage compared to standard double-RZ constructs. In addition, the triplex RZ performed cis- and trans-cleavage in cervical cancer cells. The use of triplex configurations with multiplex RZs permit differential targeting of the same or different RNA, thus improving potential use against unstable targets. This prototype will provide the basis for the development of future RZ-based therapies and technologies. PMID:18707243

  11. A triplex ribozyme expression system based on a single hairpin ribozyme.


    Aquino-Jarquin, Guillermo; Benítez-Hess, María Luisa; DiPaolo, Joseph A; Alvarez-Salas, Luis M


    Triplex ribozyme (RZ) configurations allow for the individual activity of trans-acting RZs in multiple expression cassettes (multiplex), thereby increasing target cleavage relative to conventionally expressed RZs. Although hairpin RZs have been advantageously compared to hammerhead RZs, their longer size and structural features complicated triplex design. We present a triplex expression system based on a single hairpin RZ with transcleavage capability and simple engineering. The system was tested in vitro using cis- and trans-cleavage kinetic assays against a known target RNA from HPV-16 E6/E7 mRNA. Single and multiplex triplex RZ constructs were more efficient in cleaving the target than tandem-cloned hairpin RZs, suggesting that the release of individual RZs enhanced trans-cleavage kinetics. Multiplex systems constructed with two different hairpin RZs resulted in better trans-cleavage compared to standard double-RZ constructs. In addition, the triplex RZ performed cis- and trans-cleavage in cervical cancer cells. The use of triplex configurations with multiplex RZs permit differential targeting of the same or different RNA, thus improving potential use against unstable targets. This prototype will provide the basis for the development of future RZ-based therapies and technologies.

  12. Development of triplex SYBR green real-time PCR for detecting Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp. without extraction of DNA.


    Kerdsin, Anusak; Uchida, Ryuichi; Verathamjamrus, Chris; Puangpatra, Parichart; Kawakami, Kazuyoshi; Puntanakul, Pollert; Lochindarat, Sorasak; Bunnag, Thanyanut; Sawanpanyalert, Pathom; Dejsirilert, Surang; Oishi, Kazunori


    Although Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp. are prevalent causes of community-acquired pneumonia, rapid and sensitive diagnosis is difficult. Real-time PCR provides rapid and sensitive diagnosis, however, DNA extraction is still required, which is time-consuming, costly and includes a risk of contamination. Therefore, we aimed to develop triplex real-time PCR without DNA extraction. AmpDirect(R) Plus which inhibits PCR inhibitors was used as the PCR buffer. Melting temperatures of the PCR products for the three bacteria were analyzed by SYBR green triplex real-time PCR and were found to be significantly different. Detection limits of bacteria cells diluted in nasopharyngeal aspirates (NPAs) were comparable with the detection limits of previously reported real-time PCR. Our PCR without DNA extraction and probe real-time PCR with DNA extraction showed identical results for the detection of the three bacteria from 38 respiratory specimens (sputum, endotracheal aspirates, and NPAs) collected from patients with pneumonia. No cross-reaction with other bacteria was observed. Our triplex real-time PCR successfully detected and differentiated the three bacteria. Although further field tests are required, our assay is a promising method for the rapid and cost-effective detection of the three bacteria.

  13. Human HMGB1 directly facilitates interactions between nucleotide excision repair proteins on triplex-directed psoralen interstrand crosslinks.


    Lange, Sabine S; Reddy, Madhava C; Vasquez, Karen M


    Psoralen is a chemotherapeutic agent that acts by producing DNA interstrand crosslinks (ICLs), which are especially cytotoxic and mutagenic because their complex chemical nature makes them difficult to repair. Proteins from multiple repair pathways, including nucleotide excision repair (NER), are involved in their removal in mammalian cells, but the exact nature of their repair is poorly understood. We have shown previously that HMGB1, a protein involved in chromatin structure, transcriptional regulation, and inflammation, can bind cooperatively to triplex-directed psoralen ICLs with RPA, and that mammalian cells lacking HMGB1 are hypersensitive to psoralen ICLs. However, whether this effect is mediated by a role for HMGB1 in DNA damage recognition is still unknown. Given HMGB1's ability to bind to damaged DNA and its interaction with the RPA protein, we hypothesized that HMGB1 works together with the NER damage recognition proteins to aid in the removal of ICLs. We show here that HMGB1 is capable of binding to triplex-directed psoralen ICLs with the dedicated NER damage recognition complex XPC-RAD23B, as well as XPA-RPA, and that they form a higher-order complex on these lesions. In addition, we demonstrate that HMGB1 interacts with XPC-RAD23B and XPA in the absence of DNA. These findings directly demonstrate interactions between HMGB1 and the NER damage recognition proteins, and suggest that HMGB1 may affect ICL repair by enhancing the interactions between NER damage recognition factors.

  14. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    PubMed Central

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.


    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  15. Photonic crystal-based WDM filter for integrated optical triplexer transceiver

    NASA Astrophysics Data System (ADS)

    Park, Dae-Seo; Kim, Jae-Hyun; O, Beom-Hoan; Park, Se-Geun; Lee, El-Hang; Lee, Seung-Gol


    We propose the new concept of an optical triplexer for an application of Gigabit Ethernet Passive Optical Network (GEPON) to Fiber-To-The-Home (FTTH) network. Based on a photonic crystal structure with local point defects, the optical triplexer is optimally designed. The proposed device is analyzed by the plane wave expansion method and its performance characteristics are evaluated by the finite-difference time-domain method. The optical triplexer proposed here is designed to have a compact size of about 4 × 3 μm2 and the extinction ratios of -32.33 dB for 1310 nm, -19.84 dB for 1490 nm and -29.93 dB for 1550 nm, respectively.

  16. Interaction of silver ion with CG.C+ base triplets in DNA triplex.


    Ihara, Toshihiro; Ishii, Tatsuaki; Jyo, Akinori


    When designing ligands for specific sequences in DNA duplexes, triple helix formation is a useful recognition motif, because base triplet formation is based on the simple rule of complementary Hoogsteen hydrogen bonding, CG.C(+) and TA.T. However the triplexes containing CG.C(+) triplets form only in a weak acidic solution, because cytosines in third strand need to be protonated to satisfy its complementarity to CG base-pairs. A simple and easy method to stabilize the DNA triplex using Ag(+) was reported. A silver ion displaces the N3 proton of cytosine in Hoogsteen base-pairing to form a base triplet, CG.CAg(+). By the addition of an equimolar amount of Ag(+), the third strand 15 mer sequence containing five cytosines was stabilized by ca. 30 degrees C in melting temperature at pH 7. The triplex structure was stable even under weak basic conditions.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  5. A magnesium-induced triplex pre-organizes the SAM-II riboswitch

    PubMed Central

    Roy, Susmita; Lammert, Heiko; Dayie, T. Kwaku; Sanbonmatsu, Karissa Y.


    Our 13C- and 1H-chemical exchange saturation transfer (CEST) experiments previously revealed a dynamic exchange between partially closed and open conformations of the SAM-II riboswitch in the absence of ligand. Here, all-atom structure-based molecular simulations, with the electrostatic effects of Manning counter-ion condensation and explicit magnesium ions are employed to calculate the folding free energy landscape of the SAM-II riboswitch. We use this analysis to predict that magnesium ions remodel the landscape, shifting the equilibrium away from the extended, partially unfolded state towards a compact, pre-organized conformation that resembles the ligand-bound state. Our CEST and SAXS experiments, at different magnesium ion concentrations, quantitatively confirm our simulation results, demonstrating that magnesium ions induce collapse and pre-organization. Agreement between theory and experiment bolsters microscopic interpretation of our simulations, which shows that triplex formation between helix P2b and loop L1 is highly sensitive to magnesium and plays a key role in pre-organization. Pre-organization of the SAM-II riboswitch allows rapid detection of ligand with high selectivity, which is important for biological function. PMID:28248966

  6. Asymmetric triplex metallohelices with high and selective activity against cancer cells.


    Faulkner, Alan D; Kaner, Rebecca A; Abdallah, Qasem M A; Clarkson, Guy; Fox, David J; Gurnani, Pratik; Howson, Suzanne E; Phillips, Roger M; Roper, David I; Simpson, Daniel H; Scott, Peter


    Small cationic amphiphilic α-helical peptides are emerging as agents for the treatment of cancer and infection, but they are costly and display unfavourable pharmacokinetics. Helical coordination complexes may offer a three-dimensional scaffold for the synthesis of mimetic architectures. However, the high symmetry and modest functionality of current systems offer little scope to tailor the structure to interact with specific biomolecular targets, or to create libraries for phenotypic screens. Here, we report the highly stereoselective asymmetric self-assembly of very stable, functionalized metallohelices. Their anti-parallel head-to-head-to-tail 'triplex' strand arrangement creates an amphipathic functional topology akin to that of the active sub-units of, for example, host-defence peptides and p53. The metallohelices display high, structure-dependent toxicity to the human colon carcinoma cell-line HCT116 p53(++), causing dramatic changes in the cell cycle without DNA damage. They have lower toxicity to human breast adenocarcinoma cells (MDA-MB-468) and, most remarkably, they show no significant toxicity to the bacteria methicillin-resistant Staphylococcus aureus and Escherichia coli.

  7. Long-Term Observation of Triplex Surgery for Cataract after Phakic 6H Implantation for Super High Myopia

    PubMed Central

    Liu, Xin; Wang, Xiaoying; Lu, Yi; Zheng, Tianyu; Zhou, Xingtao


    Purpose. To analyze the safety, effectiveness, and stability of triplex surgery for phakic 6H anterior chamber phakic intraocular lens explantation and phacoemulsification with in-the-bag IOL implantation for super high myopia in long-term observations. Methods. This retrospective case series evaluated 16 eyes of 10 patients who underwent triplex surgery. Best corrected visual acuity (BCVA), endothelial cell density (ECD), and associated adverse events were evaluated. Results. The mean follow-up time after the triplex surgery was 46 ± 14 months. The mean logMAR BCVA was significantly improved after triplex surgery (P = 0.047). One eye developed endophthalmitis five days postoperatively and underwent pars plana vitrectomy (PPV). Five eyes with preoperative severe endothelial cell loss developed corneal decompensation and underwent keratoplasty at a mean time of 9.4 ± 2.6 months after the triplex surgery. One eye had graft failure and underwent a second keratoplasty. The eye developed rhegmatogenous retinal detachment and underwent PPV with silicone oil 18 months later. ECD before the triplex surgery was not significantly different compared with that at last follow-up (P = 0.495) apart from these five eyes. Three eyes (18.8%) developed posterior capsule opacification. Conclusions. Triplex surgery was safe and effective for phakic 6H related complicated cataracts. Early extraction before severe ECD loss is recommended. PMID:27190642

  8. Spectroscopic studies on the binding interaction of novel 13-phenylalkyl analogs of the natural alkaloid berberine to nucleic acid triplexes.


    Bhowmik, Debipreeta; Buzzetti, Franco; Fiorillo, Gaetano; Lombardi, Paolo; Suresh Kumar, Gopinatha


    In this study we have characterized the capability of six 13-phenylalkyl analogs of berberine to stabilize nucleic acid triplex structures, poly(rA)⋅2poly(rU) and poly(dA)⋅2poly(dT). Berberine analogs bind to the RNA and DNA triplexes non-cooperatively. As the chain length of the substitution increased beyond CH2, the affinity enhanced up to critical length of (CH2)4, there after which the binding affinity decreased for both the triplexes. A remarkably stronger intercalative binding of the analogs compared to berberine to the triplexes was confirmed from ferrocyanide fluorescence quenching, fluorescence polarization and viscosity results. Circular dichroism results had indicated strong conformational changes in the triplexes on binding of the analogs. The analogs enhanced the stability of the Hoogsteen base paired third strand of both the triplexes while no significant change in the high-temperature duplex-to-single strand transitions was observed. Energetics of the interaction revealed that as the alkyl chain length increased, the binding was more entropy driven. This study demonstrates that phenylalkyl substitution at the 13-position of berberine increased the triplex binding affinity of berberine but a threshold length of the side chain is critical for the strong intercalative binding to occur.

  9. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.


    Hari, Yoshiyuki


    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  10. Characteristics of triplex-directed photoadduct formation by psoralen-linked oligodeoxynucleotides.

    PubMed Central

    Bates, P J; Macaulay, V M; McLean, M J; Jenkins, T C; Reszka, A P; Laughton, C A; Neidle, S


    A triplex-forming oligopyrimidine has been attached at its 5'-end to a photoreactive psoralen derivative and used to target a sequence which forms part of the coding region of the human aromatase gene. The 20 base pair sequence is not a perfect triplex target since it contains three pyrimidine interruptions within the purine-rich strand. Despite this, we have detected triplex-directed photoadduct formation at pH 7.0 between the psoralen-linked oligonucleotide and a 30mer duplex representing the aromatase target. Photoadduct formation was found to be sensitive to pH, temperature, cation concentration and the base composition of the third strand. By varying the base sequence of the target duplex around the psoralen intercalation site, we have characterised the site and mode of psoralen intercalation. The attached psoralen has been found to intercalate at the triplex-duplex junction with a strong preference for one orientation. We have shown that the psoralen will bind at the junction even when there is a preferred TpA step at an adjacent site. We have also compared the binding affinity and photoreactivity of oligodeoxyribonucleotides linked to two different psoralen derivatives and found differences in the rate of crosslinking and the extent of crosslink formation. Finally, we have examined oligodeoxyribonucleotides which are attached to psoralen by polymethylene linkers of different lengths. Images PMID:7501447

  11. DNA Binding and Condensation Properties of the Herpes Simplex Virus Type 1 Triplex Protein VP19C

    PubMed Central

    Bera, Alakesh; Perkins, Edward M.; Zhu, Jian; Zhu, Heng; Desai, Prashant


    Herpesvirus capsids are regular icosahedrons with a diameter of a 125 nm and are made up of 162 capsomeres arranged on a T = 16 lattice. The capsomeres (VP5) interact with the triplex structure, which is a unique structural feature of herpesvirus capsid shells. The triplex is a heterotrimeric complex; one molecule of VP19C and two of VP23 form a three-pronged structure that acts to stabilize the capsid shell through interactions with adjacent capsomeres. VP19C interacts with VP23 and with the major capsid protein VP5 and is required for the nuclear localization of VP23. Mutation of VP19C results in the abrogation of capsid shell synthesis. Analysis of the sequence of VP19C showed the N-terminus of VP19C is very basic and glycine rich. It was hypothesized that this domain could potentially bind to DNA. In this study an electrophoretic mobility shift assay (EMSA) and a DNA condensation assay were performed to demonstrate that VP19C can bind DNA. Purified VP19C was able to bind to both a DNA fragment of HSV-1 origin as well as a bacterial plasmid sequence indicating that this activity is non-specific. Ultra-structural imaging of the nucleo-protein complexes revealed that VP19C condensed the DNA and forms toroidal DNA structures. Both the DNA binding and condensing properties of VP19C were mapped to the N-terminal 72 amino acids of the protein. Mutational studies revealed that the positively charged arginine residues in this N-terminal domain are required for this binding. This DNA binding activity, which resides in a non-conserved region of the protein could be required for stabilization of HSV-1 DNA association in the capsid shell. PMID:25121591

  12. Synthesis of oligonucleotides containing N,N-disubstituted 3-deazacytosine nucleobases by post-elongation modification and their triplex-forming ability with double-stranded DNA.


    Akabane-Nakata, Masaaki; Obika, Satoshi; Hari, Yoshiyuki


    A phosphoramidite of a 2'-O,4'-C-methylene-bridged nucleoside, bearing 4-(2,4,6-triisopropylbenzenesulfonyloxy)pyridin-2-one as a nucleobase precursor, was synthesized and introduced into an oligonucleotide. Treatment with various secondary amines after elongating the oligonucleotide on an automated DNA synthesizer enabled facile and mild conversion of the precursor into the corresponding N,N-disubstituted 3-deazacytosine nucleobases. The evaluation of the triplex-forming ability of the synthesized oligonucleotides with double-stranded DNA showed that the nucleobase possessing the (3S)-3-guanidinopyrrolidine moiety can recognize a CG base pair with high sequence-selectivity and binding-affinity.

  13. DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

    SciTech Connect

    Ono, A.; Kan, Lousing ); Chingnien Chen )


    The DNA oligomer analogues 3{prime}d (CTTTCTT) 5{prime}-P4-5{prime}d(TTCTTCTT)3{prime} (4), 5{prime}d-(TTTCTTTC) 3{prime}-P2-3{prime}d(CTTTCTTT)5{prime} (5), and 5{prime}d(TTTCTTTC)3{prime}-P2-3{prime}d(CTTTCTTT)5{prime}-P4-5{prime}d-(TTCTTCTT)3{prime} (6) (P2 = {Rho}*{Rho} and P4 = {Rho}*{Rho}*{Rho}{Rho}, where {Rho} = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5{prime}d(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'{center dot} 5{prime}d(TTCTTCTTAAAGAAAGGGCTTTCTTT)3{prime} (1), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5{prime}d(TTCTTCTT)3{prime}(2) and 5{prime}d(TTTCTTTC)3{prime} (3) and the linked oligomer analogues 4-6 with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was 1-5 >> 1-4 >1-(2, 3). The mixture of 1 and 6 showed two transitions corresponding to the dissociation of the third strand. These results are useful when considering the using of oligonucleotide analogues that can bind as third strands to DNA duplexes of higher complexity.

  14. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    PubMed Central

    Carbone, Giuseppina M.; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V.


    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of the oligonucleotide in cells. The 11mer daunomycin-conjugated GT (dauno-GT11) TFO targeted a sequence upstream of the P2 promoter, a site known to be critical for transcription of the c-myc gene. Band-shift assays showed that the dauno-GT11 formed triplex DNA with enhanced stability compared to the unmodified TFO. Band shift and footprinting experiments demonstrated that binding of dauno-GT11 was highly sequence-specific with exclusive binding to the 11 bp target site in the c-myc promoter. The daunomycin-conjugated TFO inhibited transcription in vitro and reduced c-myc promoter activity in prostate and breast cancer cells. The daunomycin-conjugated TFO was taken up by cells with a distinctive intracellular distribution compared to free daunomycin. However, cationic lipid-mediated delivery was required for enhanced cellular uptake, nuclear localization and biological activity of the TFO in cells. Dauno-GT11 reduced transcription of the endogenous c-myc gene in cells, but did not affect expression of non-target genes, such as ets-1 and ets-2, which contained very similar target sequences in their promoters. Daunomycin-conjugated control oligonucleotides unable to form triplex DNA with the target sequence did not have any effect in these assays, indicating that daunomycin was not directly responsible for the activity of daunomycin-conjugated TFO. Thus, attachment of daunomycin resulted in increased triplex stability and biological activity of the 11mer GT-rich TFO without

  15. Exploring the reasons for the large density of triplex-forming oligonucleotide target sequences in the human regulatory regions

    PubMed Central

    Goñi, Josep Ramon; Vaquerizas, Juan Manuel; Dopazo, Joaquin; Orozco, Modesto


    Background DNA duplex sequences that can be targets for triplex formation are highly over-represented in the human genome, especially in regulatory regions. Results Here we studied using bioinformatics tools several properties of triplex target sequences in an attempt to determine those that make these sequences so special in the genome. Conclusion Our results strongly suggest that the unique physical properties of these sequences make them particularly suitable as "separators" between protein-recognition sites in the promoter region. PMID:16566817

  16. New design of a triplexer using ring resonator integrated with directional coupler based on photonic crystals

    NASA Astrophysics Data System (ADS)

    Wu, Yaw-Dong; Shih, Tien-Tsorng; Lee, Jian-Jang


    In this paper, we proposed the design of directional coupler integrated with ring resonator based on two-dimensional photonic crystals (2D PCs) to develop a triplexer filter. It can be widely used as the fiber access network element for multiplexer-demultiplexer wavelength selective in fiber-to-the-home (FTTH) communication systems. The directional coupler is chosen to separate the wavelengths of 1490nm and 1310nm. The ring resonator separates the wavelength of 1550nm. The transmission efficiency is larger than 90%. Besides, the total size of propose triplexer is only 19μm×12μm. We present simulation results using the finite-difference time-domain (FDTD) method for the proposed structure.

  17. Automated Triplex (HBV, HCV and HIV) NAT Assay Systems for Blood Screening in India

    PubMed Central


    This review is confined to triplex nucleic acid testing (NAT) assays to be used on fully automated platform. Around the world, these assays are being used at various transfusion medicine centres or blood banks to screen blood units for HBV, HCV and HIV. These assay systems can screen up to 1000 blood units for HBV, HCV and HIV simultaneously in a day. This area has been dominated by mainly two manufacturers: M/s Gen-Probe-Novartis and M/s Roche Molecular Systems. The triplex NAT assay systems of both manufacturers are licensed by United States Food and Drug Administration. There is not much awareness about the technology and procedures used in these assays. The main objective of this review is to create awareness about the technology and procedure of these assays. PMID:27042485

  18. Heteropolymeric triplex-based genomic assay to detect pathogens or single-nucleotide polymorphisms in human genomic samples.


    Daksis, Jasmine I; Erikson, Glen H


    Human genomic samples are complex and are considered difficult to assay directly without denaturation or PCR amplification. We report the use of a base-specific heteropolymeric triplex, formed by native duplex genomic target and an oligonucleotide third strand probe, to assay for low copy pathogen genomes present in a sample also containing human genomic duplex DNA, or to assay human genomic duplex DNA for Single Nucleotide Polymorphisms (SNP), without PCR amplification. Wild-type and mutant probes are used to identify triplexes containing FVL G1691A, MTHFR C677T and CFTR mutations. The specific triplex structure forms rapidly at room temperature in solution and may be detected without a separation step. YOYO-1, a fluorescent bis-intercalator, promotes and signals the formation of the specific triplex. Genomic duplexes may be assayed homogeneously with single base pair resolution. The specific triple-stranded structures of the assay may approximate homologous recombination intermediates, which various models suggest may form in either the major or minor groove of the duplex. The bases of the stable duplex target are rendered specifically reactive to the bases of the probe because of the activity of intercalated YOYO-1, which is known to decondense duplex locally 1.3 fold. This may approximate the local decondensation effected by recombination proteins such as RecA in vivo. Our assay, while involving triplex formation, is sui generis, as it is not homopurine sequence-dependent, as are "canonical triplexes". Rather, the base pair-specific heteropolymeric triplex of the assay is conformation-dependent. The highly sensitive diagnostic assay we present allows for the direct detection of base sequence in genomic duplex samples, including those containing human genomic duplex DNA, thereby bypassing the inherent problems and cost associated with conventional PCR based diagnostic assays.

  19. UV spectroscopic identification and thermodynamic analysis of protonated third strand deoxycytidine residues at neutrality in the triplex d(C(+)-T)6:[d(A-G)6.d(C-T)6]; evidence for a proton switch.

    PubMed Central

    Lavelle, L; Fresco, J R


    Near-UV difference spectral analysis of the triplex formed from d(C-T)6 and d(A-G)6.d(C-T)6 in neutral and acidic solution shows that the third strand dC residues are protonated at pH 7.0, far above their intrinsic pKa. Additional support for ion-dipole interactions between the third strand dC residues and the G.C target base pairs comes from reduced positive dependence of triplet stability on ionic strength below 0.9 M Na+, inverse dependence above 0.9 M Na+ and strong positive dependence on hydrogen ion concentration. Molecular modeling (AMBER) of C:G.C and C+:G.C base triplets with the third strand base bound in the Hoogsteen geometry shows that only the C+:G.C triplet is energetically feasible. van't Hoff analysis of the melting of the triplex and target duplex shows that between pH 5.0 and 8.5 in 0.15 M NaCl/0.005 M MgCl2 the enthalpy of melting (delta H degree obs) varies from 5.7 to 6.6 kcal.mol-1 for the duplex in a duplex mixture and from 7.3 to 9.7 kcal.mol-1 for third strand dissociation in the triplex mixture. We have extended the condensation-screening theory of Manning to pH-dependent third strand binding. In this development we explicitly include the H+ contribution to the electrostatic free energy and obtain [formula: see text]. The number of protons released in the dissociation of the third strand from the target duplex at pH 7.0, delta n2, is thereby calculated to be 5.5, in good agreement with approximately six third strand dc residues per mole of triplex. This work shows that when third strand binding requires protonated residues that would otherwise be neutral, triplex formation and dissociation are mediated by proton uptake and release, i.e., a proton switch. As a by-product of this study, we have found that at low pH the Watson-Crick duplex d(A-G)6.d(C-T)6 undergoes a transition to a parallel Hoogsteen duplex d(A-G)6.d(C(+)-T)6. PMID:7651830

  20. Interaction of octahedral ruthenium(II) polypyridyl complex [Ru(bpy)2(PIP)](2+) with poly(U)·poly(A)*poly(U) triplex: Increasing third-strand stabilization of the triplex without affecting the stability of the duplex.


    Zhu, Zhiyuan; Peng, Mengna; Zhang, Jingwen; Tan, Lifeng


    Triple-helical RNA are of interest because of possible biological roles as well as the potential therapeutic uses of these structures, while the stability of triplexes is usually weaker than that of the Watson-Crick base pairing duplex strand due to the electrostatic repulsion between three polyanionic strands. Therefore, how to increase the stability of the specific sequences of triplexes are of importance. In this paper the binding of a Ru(II) complex, [Ru(bpy)2(PIP)](2+) (bpy=2.2'-bipyridine, PIP=2-phenyl-1H-imidazo[4,5-f]- [1,10]-phenanthroline), with poly(U)·poly(A)*poly(U) triplex has been investigated by spectrophotometry, spectrofluorometry, viscosimetry and circular dichroism. The results suggest that [Ru(bpy)2(PIP)](2+) as a metallointercalator can stabilize poly(U)·poly(A)*poly(U) triplex (where · denotes the Watson-Crick base pairing and * denotes the Hoogsteen base pairing),while it stabilizes third-strand with no obvious effect on the duplex of poly(U)·poly(A), reflecting the binding of this complex with the triplex is favored by the Hoogsteen paired poly(U) third strand to a great extent.

  1. Ultrasensitive colorimetric detection of circulating tumor DNA using hybridization chain reaction and the pivot of triplex DNA

    NASA Astrophysics Data System (ADS)

    Li, Ruimin; Zou, Li; Luo, Yanwei; Zhang, Manjun; Ling, Liansheng


    This work presents an amplified colorimetric biosensor for circulating tumor DNA (ctDNA), which associates the hybridization chain reaction (HCR) amplification with G-Quadruplex DNAzymes activity through triplex DNA formation. In the presence of ctDNA, HCR occurs. The resulting HCR products are specially recognized by one sequence to include one GGG repeat and the other containing three GGG repeats, through the synergetic effect of triplex DNA and asymmetrically split G-Quadruplex forming. Such design takes advantage of the amplification property of HCR and the high peroxidase-like catalytic activity of asymmetrically split G-Quadruplex DNAzymes by means of triplex DNA formation, which produces color signals in the presence of ctDNA. Nevertheless, in the absence of ctDNA, no HCR happens. Thus, no triplex DNA and G-Quadruplex structure is formed, producing a negligible background. The colorimetric sensing platform is successfully applied in complex biological environments such as human blood plasma for ctDNA detection, with a detection limit corresponding to 0.1 pM. This study unambiguously uses triplex DNA forming as the pivot to integrate nucleic acid amplification and DNAzymes for producing a highly sensitive signal with low background.

  2. Ultrasensitive colorimetric detection of circulating tumor DNA using hybridization chain reaction and the pivot of triplex DNA

    PubMed Central

    Li, Ruimin; Zou, Li; Luo, Yanwei; Zhang, Manjun; Ling, Liansheng


    This work presents an amplified colorimetric biosensor for circulating tumor DNA (ctDNA), which associates the hybridization chain reaction (HCR) amplification with G-Quadruplex DNAzymes activity through triplex DNA formation. In the presence of ctDNA, HCR occurs. The resulting HCR products are specially recognized by one sequence to include one GGG repeat and the other containing three GGG repeats, through the synergetic effect of triplex DNA and asymmetrically split G-Quadruplex forming. Such design takes advantage of the amplification property of HCR and the high peroxidase-like catalytic activity of asymmetrically split G-Quadruplex DNAzymes by means of triplex DNA formation, which produces color signals in the presence of ctDNA. Nevertheless, in the absence of ctDNA, no HCR happens. Thus, no triplex DNA and G-Quadruplex structure is formed, producing a negligible background. The colorimetric sensing platform is successfully applied in complex biological environments such as human blood plasma for ctDNA detection, with a detection limit corresponding to 0.1 pM. This study unambiguously uses triplex DNA forming as the pivot to integrate nucleic acid amplification and DNAzymes for producing a highly sensitive signal with low background. PMID:28276503

  3. 2',4'-BNA bearing a chiral guanidinopyrrolidine-containing nucleobase with potent ability to recognize the CG base pair in a parallel-motif DNA triplex.


    Hari, Yoshiyuki; Akabane, Masaaki; Obika, Satoshi


    In order to expand the target sequence used in triplex DNA formation, seven novel nucleotide analogues were synthesized and incorporated into triplex-forming oligonucleotides by post-elongation modification approaches. Among them, , equipped with a suitable restricted conformation of sugar and nucleobase moieties, was found to have the highest sequence-selectivity and affinity towards CG base pairs within double-stranded DNA.

  4. An isocytidine derivative with a 2-amino-6-methylpyridine unit for selective recognition of the CG interrupting site in an antiparallel triplex DNA.


    Okamura, Hidenori; Taniguchi, Yosuke; Sasaki, Shigeki


    Sequence-specific recognition of duplex DNA mediated by triple helix formation offers a potential basis for oligonucleotide therapy and biotechnology. However, triplex formation is limited mostly to homopurine strands, due to poor stabilization at CG or TA base pairs in the target duplex DNA sequences. Several non-natural nucleosides have been designed for the recognition of CG or TA base pairs within an antiparallel triplex DNA. Nevertheless, problems including low selectivity and high dependence on the neighboring bases remain unsolved. We thus synthesized N(2)-arylmethyl isodC derivatives and incorporated them into triplex-forming oligonucleotides (TFOs) for the selective recognition of the CG base pair within antiparallel triplex DNA. It was shown that an isodC derivative bearing a 2-amino-6-methylpyridine moiety (AP-isodC) recognizes the CG base pair with high selectivity in antiparallel triplex DNA irrespective of the flanking base pairs.

  5. Kinetic study of the binding of triplex-forming oligonucleotides containing partial cationic modifications to double-stranded DNA.


    Hari, Yoshiyuki; Ijitsu, Shin; Akabane-Nakata, Masaaki; Yoshida, Takuya; Obika, Satoshi


    Several triplex-forming oligonucleotides (TFOs) partially modified with 2'-O-(2-aminoethyl)- or 2'-O-(2-guanidinoethyl)-nucleotides were synthesized and their association rate constants (kon) with double-stranded DNA were estimated by UV spectrophotometry. Introduction of cationic modifications in the 5'-region of the TFOs significantly increased the kon values compared to that of natural TFO, while no enhancement in the rate of triplex DNA formation was observed when the modifications were in the middle and at the 3'-region. The kon value of a TFO with three adjacent cationic modifications at the 5'-region was found to be 3.4 times larger than that of a natural one. These results provide useful information for overcoming the inherent sluggishness of triplex DNA formation.

  6. Mechanism of site-specific psoralen photoadducts formation in triplex DNA directed by psoralen-conjugated oligonucleotides.


    Ping, Yueh-Hsin; Rana, Tariq M


    Triplex-formation oligonucleotides attached with a photoreactive psoralen molecule (psoTFO) can be used to induce site-specific DNA damage and to control gene expression. Inhibition of transcription by psoralen-cross-linked triplexes results in both arrest and termination of RNA Pol II transcriptional complexes during elongation. To understand the relationship between triplex psoralen cross-linking products and the fate of RNA Pol II elongation complexes, it is important to delineate the mechanism for creating site-specific psoralen photoadducts in a target duplex DNA. To investigate the mechanism of photoadduct-formation by psoralen photo-cross-linking, triplex structures were generated by targeting a DNA duplex with psoTFOs of different lengths. The psoralen photoadducts were then analyzed after UV irradiation, which initiates the psoralen cross-linking reaction. Our results demonstrated that UV irradiation of triplexes formed between a psoTFO and a DNA duplex generated two distinct groups of psoralen photoadducts: monoadducts and psoralen interstrand cross-link products. The formation of these psoralen photoadducts was also photoreversible through exposure to short wavelength UV irradiation. The length of a psoTFO was shown to establish the position at which psoralen was added to the target DNA duplex and determined which photoadducts products formed predominantly. Kinetic experiments that monitored the formation of the psoralen photoadducts also suggested that the length of the psoTFO influenced which photoadducts were preferentially formed at faster rates. Taken together, these studies provide new insight into the mechanism associated with the formation of psoralen photoadducts that are directed by psoTFO during triplex formation.

  7. Therapeutic genome mutagenesis using synthetic donor DNA and triplex-forming molecules.


    Reza, Faisal; Glazer, Peter M


    Genome mutagenesis can be achieved in a variety of ways, though a select few are suitable for therapeutic settings. Among them, the harnessing of intracellular homologous recombination affords the safety and efficacy profile suitable for such settings. Recombinagenic donor DNA and mutagenic triplex-forming molecules co-opt this natural recombination phenomenon to enable the specific, heritable editing and targeting of the genome. Editing the genome is achieved by designing the sequence-specific recombinagenic donor DNA to have base mismatches, insertions, and deletions that will be incorporated into the genome when it is used as a template for recombination. Targeting the genome is similarly achieved by designing the sequence-specific mutagenic triplex-forming molecules to further recruit the recombination machinery thereby upregulating its activity with the recombinagenic donor DNA. This combination of extracellularly introduced, designed synthetic molecules and intercellularly ubiquitous, evolved natural machinery enables the mutagenesis of chromosomes and engineering of whole genomes with great fidelity while limiting nonspecific interactions. Herein, we demonstrate the harnessing of recombinagenic donor DNA and mutagenic triplex-forming molecular technology for potential therapeutic applications. These demonstrations involve, among others, utilizing this technology to correct genes so that they become physiologically functional, to induce dormant yet functional genes in place of non-functional counterparts, to place induced genes under regulatory elements, and to disrupt genes to abrogate a cellular vulnerability. Ancillary demonstrations of the design and synthesis of this recombinagenic and mutagenic molecular technology as well as their delivery and assayed interaction with duplex DNA reveal a potent technological platform for engineering specific changes into the living genome.

  8. Distribution of alginate gene sequences in the Pseudomonas rRNA homology group I-Azomonas-Azotobacter lineage of superfamily B procaryotes.

    PubMed Central

    Fialho, A M; Zielinski, N A; Fett, W F; Chakrabarty, A M; Berry, A


    Chromosomal DNA from group I Pseudomonas species, Azotobacter vinelandii, Azomonas macrocytogens, Xanthomonas campestris, Serpens flexibilis, and three enteric bacteria was screened for sequences homologous to four Pseudomonas aeruginosa alginate (alg) genes (algA, pmm, algD, and algR1). All the group I Pseudomonas species tested (including alginate producers and nonproducers) contained sequences homologous to all the P. aeruginosa alg genes used as probes, with the exception of P. stutzeri, which lacked algD. Azotobacter vinelandii also contained sequences homologous to all the alg gene probes tested, while Azomonas macrocytogenes DNA showed homology to all but algD. X. campestris contained sequences homologous to pmm and algR1 but not to algA or algD. The helical bacterium S. flexibilis showed homology to the algR1 gene, suggesting that an environmentally responsive regulatory gene similar to algR1 exists in S. flexibilis. Escherichia coli showed homology to the algD and algR1 genes, while Salmonella typhimurium and Klebsiella pneumoniae failed to show homology with any of the P. aeruginosa alg genes. Since all the organisms tested are superfamily B procaryotes, these results suggest that within superfamily B, the alginate genes are distributed throughout the Pseudomonas group I-Azotobacter-Azomonas lineage, while only some alg genes have been retained in the Pseudomonas group V (Xanthomonas) and enteric lineages. Images PMID:1689562

  9. High-resolution atomic force microscopy of duplex and triplex DNA molecules

    NASA Astrophysics Data System (ADS)

    Klinov, Dmitry; Dwir, Benjamin; Kapon, Eli; Borovok, Natalia; Molotsky, Tatiana; Kotlyar, Alexander


    Double-stranded poly(dG)-poly(dC) and triple-stranded poly(dG)-poly(dG)-poly(dC) DNA were deposited on the modified surface of highly oriented pyrolitic graphite (HOPG) and visualized using atomic force microscopy with high-resolution (radius of ~1 nm) tips. The high resolution attained by this technique enabled us to detect single-stranded regions in double-stranded poly(dG)-poly(dC) and double-stranded and single-stranded regions in poly(dG)-poly(dG)-poly(dC) triplexes, as well as to resolve the helical pitch of the triplex molecules. We could also follow the reaction of G-strand extension in poly(dG)-poly(dC) by the Klenow exo- fragment of DNA polymerase I. This approach to molecular visualization could serve as a useful tool for the investigation of irregular structures in canonical DNA and other biopolymers, as well as studies of the molecular mechanisms of DNA replication and transcription.

  10. Study of the development of uteroplacental and fetal feline circulation by triplex Doppler.


    Pereira, Barbara Sucupira; Pinto, José Nicodemos; Freire, Luma Morena Passos; Campello, Cláudio Cabral; Domingues, Sheyla Farhayldes Souza; da Silva, Lucia Daniel Machado


    The objective was to evaluate blood flow in fetal and maternal vessels by Triplex Doppler and its association with development of blood vessels during gestation in the domestic cat. Ten queens were examined weekly from 14 to 63 d after mating. Peak systolic velocity (PSV), end diastolic velocity (EDV), resistance index (RI) and pulsatility index (PI) of uteroplacental, aorta and umbilical fetal arteries and caudal vena cava of the fetus were evaluated. Throughout pregnancy, there was an increase in PSV and EDV in the aorta and umbilical arteries. In the caudal vena cava, there was an increase in PSV, whereas the EDV was constant, with a significant increase on Day 63. Peak systolic velocity and EDV of the uteroplacental artery reduced significantly on Day 63. Resistance index of the umbilical artery progressively decreased. In the aorta, this reduction was detected only on Day 42, with no defined pattern in the caudal vena cava and uteroplacental artery. Pulsatility index of the aorta varied. Although pulsatility increased in the caudal vena cava on Day 35 and remained elevated, pulsatility was significantly reduced in the umbilical artery by Day 63. The pulsatility index of the uteroplacental artery was constant (increased only on Day 63). Triplex Doppler evaluation could be a useful adjunct for prenatal care of pregnant queens, including assessment of vascular gestational development and prediction of gestational age.

  11. Modulation of psoralen DNA crosslinking kinetics associated with a triplex-forming oligonucleotide.


    Oh, Dennis H; Suzara, Vincent; Krishnan, Rajagopal


    A triplex-forming oligonucleotide (TFO), HPRT3, conjugated to a psoralen derivative, was designed to target a psoralen reaction site within the HPRT gene. HPRT3 bound with high affinity to a synthetic duplex target sequence. At a uniform UVA radiation dose, the ratio of psoralen monoadducts (MA) to interstrand crosslinks decreased and inverted with increasing TFO concentration. As the TFO concentration increased from 10 nm to 10 microm, the efficiency of psoralen MA formation remained relatively constant but the efficiency of interstrand crosslink formation increased several-fold. Neither shortening the TFO to reduce its dissociation constant nor altering the DNA sequences flanking the TFO binding site altered the concentration dependence of MA and crosslink yields. The psoralen photokinetics associated with 10 nm HPRT3 converted to those associated with 10 microm HPRT3 with the addition of other unrelated TFOs at 10 microm that do not specifically interact with the HPRT3 target sequence. Glycerol at concentrations of 0.5% (vol/vol) or higher also mimicked high TFO concentrations in enhancing crosslink formation. These results demonstrate that while psoralen may be targeted to react at a particular sequence by TFOs, photoreactivity associated with triplex formation is also modulated by sequence-independent factors that may affect the local macromolecular environment.

  12. A web-based search engine for triplex-forming oligonucleotide target sequences.


    Gaddis, Sara S; Wu, Qi; Thames, Howard D; DiGiovanni, John; Walborg, Earl F; MacLeod, Michael C; Vasquez, Karen M


    Triplex technology offers a useful approach for site-specific modification of gene structure and function both in vitro and in vivo. Triplex-forming oligonucleotides (TFOs) bind to their target sites in duplex DNA, thereby forming triple-helical DNA structures via Hoogsteen hydrogen bonding. TFO binding has been demonstrated to site-specifically inhibit gene expression, enhance homologous recombination, induce mutation, inhibit protein binding, and direct DNA damage, thus providing a tool for gene-specific manipulation of DNA. We have developed a flexible web-based search engine to find and annotate TFO target sequences within the human and mouse genomes. Descriptive information about each site, including sequence context and gene region (intron, exon, or promoter), is provided. The engine assists the user in finding highly specific TFO target sequences by eliminating or flagging known repeat sequences and flagging overlapping genes. A convenient way to check for the uniqueness of a potential TFO binding site is provided via NCBI BLAST. The search engine may be accessed at

  13. In vivo generation of highly abundant sequence-specific oligonucleotides for antisense and triplex gene regulation.

    PubMed Central

    Noonberg, S B; Scott, G K; Garovoy, M R; Benz, C C; Hunt, C A


    Antisense and triplex oligonucleotides continue to demonstrate potential as mediators of gene-specific repression of protein synthesis. However, inefficient and heterogeneous cellular uptake, intracellular sequestration, and rapid intracellular and extracellular degradation represent obstacles to their eventual clinical utility. Efficient cellular delivery of targeted ribozymes can present similar problems. In this report we describe a system for circumventing these obstacles and producing large quantities of short, sequence-specific RNA oligonucleotides for use in these gene regulation strategies. The oligonucleotides are generated from a vector containing promoter, capping, and termination sequences from the human small nuclear U6 gene, surrounding a synthetic sequence incorporating the oligonucleotide of interest. In vivo, these oligonucleotides are produced constitutively and without cell type specificity in levels up to 5 x 10(6) copies per cell, reach steady-state levels of expression within 9 hours post-transfection, and are still readily detectable 7 days post-transfection. In addition, these oligonucleotides are retained in the nucleus, obtain a 5' gamma-monomethyl phosphate cap, and have an intracellular half-life of approximately one hour. This expression vector provides a novel and efficient method of intracellular delivery of antisense or triplex RNA oligonucleotides (and/or ribozymes) for gene regulation, as well as a cost-effective means of comparing the biological activity arising from a variety of different potential oligonucleotide sequences. Images PMID:8052538

  14. Triplex DNA: A new platform for polymerase chain reaction – based biosensor

    PubMed Central

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng


    Non - specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence - specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10−12 M to 1.0 × 10−7 M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy. PMID:26268575

  15. Triplex PCR assay for the rapid identification of 3 major Vibrio species, Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio fluvialis.


    Vinothkumar, Kittappa; Bhardwaj, Ashima Kushwaha; Ramamurthy, Thandavarayan; Niyogi, Swapan Kumar


    A triplex PCR assay was developed for the identification of 3 major Vibrio spp., Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio fluvialis by targeting their haemolysin, haem-utilizing, and central regulatory genes, respectively. This simple, rapid, sensitive, and specific assay using cell lysates from 227 samples established its usefulness in research and epidemiology.

  16. Fabrication and measurement of hoop strength of SiC triplex tube for nuclear fuel cladding applications

    NASA Astrophysics Data System (ADS)

    Kim, Daejong; Lee, Hyun-Geun; Park, Ji Yeon; Kim, Weon-Ju


    The SiC ceramics are under investigation for the fuel cladding in the light water nuclear reactors because of its excellent high temperature strength and corrosion resistance against hot steam under the severe accident conditions. In this study, the SiC triplex tubes consisting of a SiC inner layer, a SiC/PyC/SiC intermediate layer, and a SiC outer layer were fabricated by the chemical vapor processes. The hoop strength and fracture behaviors of the SiC triplex tube were investigated. The SiC triplex tubes fabricated at the high ratio of H2/MTS had a quite high average strength with a relatively small standard deviation. The hoop strength of the composite tubes tends to increase with the volume fraction of the reinforced fibers. The highest fiber volume fraction was obtained using Tyranno SA3-0.8k with the dense winding patterns such as bamboo-like mosaic pattern, which resulted in the high hoop strength compared to other fibers of Tyranno SA3-1.6k and Hi-Nicalon Type S. Hoop strength also increased slightly as the winding angle increased from 45° to 65°. Fracture behaviors of the SiC triplex tube were investigated via the observation of microstructure of the failed samples.

  17. Enhanced hepatic uptake and bioactivity of type alpha1(I) collagen gene promoter-specific triplex-forming oligonucleotides after conjugation with cholesterol.


    Cheng, Kun; Ye, Zhaoyang; Guntaka, Ramareddy V; Mahato, Ram I


    A triplex-forming oligonucleotide (TFO) specific for type alpha1(I) collagen promoter is a promising candidate for treating liver fibrosis. Earlier, we determined the pharmacokinetics and biodistribution of TFO after systemic administration into normal and fibrotic rats. In this study, we conjugated cholesterol to the 3' end of the TFO via a disulfide bond and determined its cellular and nuclear uptake and bioactivity using HSC-T6 cell lines in vitro, followed by biodistribution at whole-body, organ (liver), and subcellular levels. Conjugation with cholesterol had little effect on the triplex-forming ability of the TFO with target duplex DNA, and the cellular uptake of (33)P-TFO-cholesterol (Chol) increased by 2- to approximately 4-fold. Real-time reverse transcriptase-polymerase chain reaction analysis after transfection of HSC-T6 cells with TFO-Chol or TFO indicated that TFO-Chol had higher inhibition on type alpha1(I) collagen primary transcript than naked TFO at low concentration (200 nM) but showed similar inhibition at higher concentration (500 and 1000 nM). There was increase in the inhibition on primary transcript with transfection time. The hepatic uptake of (33)P-TFO-Chol after systemic administration was 72.22% of the dose compared with 45.8% of (33)P-TFO. There was significant increase in the uptake of (33)P-TFO-Chol by hepatic stellate cells and hepatocytes. More importantly, the nuclear uptake of TFO-Chol was higher than TFO in cell culture system and in vivo studies. In conclusion, TFO-Chol is a potential antifibrotic agent.

  18. Tracking false-negative results in molecular diagnosis: proposal of a triplex-PCR based method for leishmaniasis diagnosis

    PubMed Central


    Background Molecular biological methods have become increasingly relevant to the diagnosis and control of infectious diseases, such as leishmaniasis. Since various factors may affect the sensitivity of PCR assays, including DNA yield and purity, an optimal extraction method is pivotal. Losses of a parasite’s DNA during extraction may significantly impair its detection by PCR and lead to false-negative results. This study proposes a triplex PCR assay targeting the parasite’s DNA, an external control (pUC18) and an internal control (G3PD) for accurate diagnosis of leishmaniasis. Results Two primer pairs were designed to detect the plasmid pUC18 and a triplex PCR assay targeting the Leishmania braziliensis kinetoplast DNA, the external control and the internal control was standardized. The triplex PCR assay was assessed for its ability to detect the three target DNA fragments simultaneously. PCR products from pUC18 DNA resulted in bands of 368 (P1) and 316 (P2) base pairs (bp). The triplex PCR optimized with the chosen external control system (P1) allowed the simultaneous detection of the internal control (G3PD – 567 bp) as well as of small quantities (10 pg) of the target parasite’s DNA, detected by amplification of a 138 bp product. Conclusions The new tool standardized herein enables a more reliable interpretation of PCR results, mainly by contributing to quality assurance of leishmaniasis diagnosis. Furthermore, after simple standardization steps, this protocol could be applied to the diagnosis of other infectious diseases in reference laboratories. This triplex PCR enables the assessment of small losses during the DNA extraction process, problems concerning DNA degradation (sample quality) and the detection of L. braziliensis kDNA. PMID:24808911

  19. Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

    NASA Technical Reports Server (NTRS)

    Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.


    Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

  20. The Herpes Simplex Virus Triplex Protein, VP23, Exists as a Molten Globule

    PubMed Central

    Kirkitadze, Marina D.; Barlow, Paul N.; Price, Nicholas C.; Kelly, Sharon M.; Boutell, Christopher J.; Rixon, Frazer J.; McClelland, David A.


    Two proteins, VP19C (50,260 Da) and VP23 (34,268 Da), make up the triplexes which connect adjacent hexons and pentons in the herpes simplex virus type 1 capsid. VP23 was expressed in Escherichia coli and purified to homogeneity by Ni-agarose affinity chromatography. In vitro capsid assembly experiments demonstrated that the purified protein was functionally active. Its physical status was examined by differential scanning calorimetry, ultracentrifugation, size exclusion chromatography, circular dichroism, fluorescence spectroscopy, and 8-anilino-1-naphthalene sulfonate binding studies. These studies established that the bacterially expressed VP23 exhibits properties consistent with its being in a partially folded, molten globule state. We propose that the molten globule represents a functionally relevant intermediate which is necessary to allow VP23 to undergo interaction with VP19C in the process of capsid assembly. PMID:9811746

  1. Biophysical Characterization of the Strong Stabilization of the RNA Triplex poly(U)•poly(A)*poly(U) by 9-O-(ω-amino) Alkyl Ether Berberine Analogs

    PubMed Central

    Hossain, Maidul; Haq, Lucy; Suresh Kumar, Gopinatha


    Background Binding of two 9-O-(ω-amino) alkyl ether berberine analogs BC1 and BC2 to the RNA triplex poly(U)•poly(A)*poly(U) was studied by various biophysical techniques. Methodology/Principal Findings Berberine analogs bind to the RNA triplex non-cooperatively. The affinity of binding was remarkably high by about 5 and 15 times, respectively, for BC1 and BC2 compared to berberine. The site size for the binding was around 4.3 for all. Based on ferrocyanide quenching, fluorescence polarization, quantum yield values and viscosity results a strong intercalative binding of BC1 and BC2 to the RNA triplex has been demonstrated. BC1 and BC2 stabilized the Hoogsteen base paired third strand by about 18.1 and 20.5°C compared to a 17.5°C stabilization by berberine. The binding was entropy driven compared to the enthalpy driven binding of berbeine, most likely due to additional contacts within the grooves of the triplex and disruption of the water structure by the alkyl side chain. Conclusions/Significance Remarkably higher binding affinity and stabilization effect of the RNA triplex by the amino alkyl berberine analogs was achieved compared to berberine. The length of the alkyl side chain influence in the triplex stabilization phenomena. PMID:22666416

  2. A combined method for triplex pump fault diagnosis based on wavelet transform, fuzzy logic and neuro-networks

    NASA Astrophysics Data System (ADS)

    Kong, Fansen; Chen, Ruheng


    A new combined method based on wavelet transformation, fuzzy logic and neuro-networks is proposed for fault diagnosis of a triplex. The failure characteristics of the fluid- and dynamic-end can be divided into wavelet transform in different scales at the same time (in: Jun Zhu et al. (Eds.), Proceedings of an International Conference on Condition Monitoring. National Defense Industry Press, Beijing, 1997, pp. 271-275). Therefore, the characteristic variables can be constructed making use of the coefficients of Edgeworth asymptotic spectrum expansion formula and fuzzified to train the neuro-network to identify the faults of fluid- and dynamic-end of triplex pump in fuzzy domain. Tests indicate that the information of wavelet transformation in scale 2 is related to the meshing state of the gear and the information in scales 4 and 5 is related to the running state of fluid-end. Good agreement between analytical and experimental results has been obtained.

  3. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.


    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A


    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  4. Granulomatous Skin Lesions in Moray Eels Caused by a Novel Mycobacterium Species Related to Mycobacterium triplex

    PubMed Central

    Herbst, Lawrence H.; Costa, Sylvia F.; Weiss, Louis M.; Johnson, Linda K.; Bartell, John; Davis, Raymond; Walsh, Michael; Levi, Michael


    An outbreak of granulomatous dermatitis was investigated in a captive population of moray eels. The affected eels had florid skin nodules concentrated around the head and trunk. Histopathological examination revealed extensive granulomatous inflammation within the dermis and subcutaneous fascial plane between the fat and axial musculature. Acid-fast rods were detected within the smallest lesions, which were presumably the ones that had developed earliest. Eventually, after several months of incubation at room temperature, a very slowly growing acid-fast organism was isolated. Sequencing of the 16S rRNA gene identified it as a Mycobacterium species closely related (0.59% divergence) to M. triplex, an SAV mycobacterium. Intradermal inoculation of healthy green moray eels with this organism reliably reproduced the lesion. Experimentally induced granulomatous dermatitis appeared within 2 weeks of inoculation and slowly but progressively expanded during the 2 months of the experiment. Live organisms were recovered from these lesions at all time points, fulfilling Koch's postulates for this bacterium. In a retrospective study of tissues collected between 1993 and 1999 from five spontaneous disease cases, acid-fast rods were consistently found within lesions, and a nested PCR for the rRNA gene also demonstrated the presence of mycobacteria within affected tissues. PMID:11402008

  5. Modelling methane emissions from natural wetlands by development and application of the TRIPLEX-GHG model

    USGS Publications Warehouse

    Zhu, Qing; Liu, Jinxun; Peng, C.; Chen, H.; Fang, X.; Jiang, H.; Yang, G.; Zhu, D.; Wang, W.; Zhou, X.


    A new process-based model TRIPLEX-GHG was developed based on the Integrated Biosphere Simulator (IBIS), coupled with a new methane (CH4) biogeochemistry module (incorporating CH4 production, oxidation, and transportation processes) and a water table module to investigate CH4 emission processes and dynamics that occur in natural wetlands. Sensitivity analysis indicates that the most sensitive parameters to evaluate CH4 emission processes from wetlands are r (defined as the CH4 to CO2 release ratio) and Q10 in the CH4 production process. These two parameters were subsequently calibrated to data obtained from 19 sites collected from approximately 35 studies across different wetlands globally. Being heterogeneously spatially distributed, r ranged from 0.1 to 0.7 with a mean value of 0.23, and the Q10 for CH4 production ranged from 1.6 to 4.5 with a mean value of 2.48. The model performed well when simulating magnitude and capturing temporal patterns in CH4 emissions from natural wetlands. Results suggest that the model is able to be applied to different wetlands under varying conditions and is also applicable for global-scale simulations.

  6. Triplex PCR using new primers for the detection of Toxoplasma gondii.


    Rahumatullah, Anizah; Khoo, Boon Yin; Noordin, Rahmah


    Molecular methods are used increasingly for the detection of Toxoplasma gondii infection. This study developed a rapid, sensitive, and specific conventional triplex PCR for the detection of the B1 gene and ITS1 region of T. gondii using newly designed primers and an internal control based on the Vibrio cholerae HemM gene. The annealing temperature and concentrations of the primers, MgCl(2), and dNTPs were optimized. Two sets of primers (set 1 and 2) were tested, which contained different segments of the T. gondii B1 gene, 529 repeat region and ITS1 region. A series of sensitivity tests were performed using parasite DNA, whole parasites, and spiked human body fluids. Specificity tests were performed using DNA from common protozoa and bacteria. The newly developed assay based on set 2 primers was found to be specific and sensitive. The test was capable of detecting as little as 10 pg T. gondii DNA, 10(4) tachyzoites in spiked body fluids, and T. gondii DNA in the organ tissues of experimentally infected mice. The assay developed in this study will be useful for the laboratory detection of T. gondii infection.

  7. Comparative evaluation of a triplex nucleic acid test for detection of HBV DNA, HCV RNA, and HIV-1 RNA, with the Procleix Tigris System.


    Xiao, Xinglong; Zhai, Jianxin; Zeng, Jinfeng; Tian, Cong; Wu, Hui; Yu, Yigang


    Nucleic acid testing (NAT) is valuable for screening blood donors for occult hepatitis B virus (HBV) infection and infection during the window period in countries where HBV is endemic, such as China. An "in-house" NAT (Triplex NAT) was developed for screening for HBV DNA, hepatitis C virus (HCV) RNA, and the human immunodeficiency virus type 1 (HIV-1) RNA. Using the Triplex NAT, a head-to-head comparative clinical evaluation was carried out against the most common commercial NAT used for blood screening in China: the Procleix Tigris System. A total of 33,025 specimens which were negative for Hepatitis B surface antigen, HCV antibody and HIV-1 antibody/antigen from potential blood donors were tested for HBV DNA, HCV RNA, and HIV-1 RNA by both the in-house Triplex assay and the commercially available Procleix Tigris System. Eleven specimens were detected as HBV positive by both NATs. Twelve specimens were detected as HBV positive by the Procleix Ultrio assay and the discriminatory assays, and not the Triplex. Twenty-eight specimens were detected as HBV positive by the Triplex and not the Procleix Ultrio. This study, combined with other data obtained in China, suggest that at least 50% HBV surface antigen negative but DNA-positive blood donations would be undetected using the current commercial NATs because of their insufficient sensitivity and/or Mini-Pool formatting strategies.

  8. A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures.


    Xu, Wentao; Tian, Jingjing; Shao, Xiangli; Zhu, Longjiao; Huang, Kunlun; Luo, Yunbo


    For previously reported aptasensor, the sensitivity and selectivity of aptamers to targets were often suppressed due to the reporter label of single-stranded molecular beacon or hindrance of the duplex DNA strand displacement. To solve the affinity declining of aptamers showed in traditional way and realize on-site rapid detection of Lipopolysaccharides (LPS), we developed an ingenious structure-switching aptasensor based on the bulb-like triplex turn-on switch (BTTS) as the effective molecular recognition and signal transduction element and streptavidin-horseradish peroxidase modified hybridization chain reaction (HCR-HRP) nanocomposites as the signal amplifier and signal report element. In the presence of LPS, the bulb-like LPS-aptamer (BLA) and LPS formed the LPS/aptamer complex, while the BTTS disassembled and liberated the dissociative bridge probes (BP) to achieve molecular recognition and signal transduction. Immobilized BP, captured by immobilized capture probes (CP), triggered hybridization chain reactions (HCR) to amplify the switching signal, and the HCR products were then modified with streptavidin-horseradish peroxidase (SA-HRP) to form HCR-HRP nanostructures to output colorimetric signals. In less than four hours, the proposed biosensor showed a detection limit of 50pg/mL of LPS quantitatively with the portable spectrophotometer and the observation limit of 20ng/mL semi-quantitatively with the naked eye, opening up new opportunities for LPS detection in future clinical diagnosis, food security and environment monitoring.

  9. Ultra-fast analog-to-digital converter based on a nonlinear triplexer and an optical coder with a photonic crystal structure.


    Mehdizadeh, Farhad; Soroosh, Mohammad; Alipour-Banaei, Hamed; Farshidi, Ebrahim


    In this paper, we propose what we believe is a novel all-optical analog-to-digital converter (ADC) based on photonic crystals. The proposed structure is composed of a nonlinear triplexer and an optical coder. The nonlinear triplexer is for creating discrete levels in the continuous optical input signal, and the optical coder is for generating a 2-bit standard binary code out of the discrete levels coming from the nonlinear triplexer. Controlling the resonant mode of the resonant rings through optical intensity is the main objective and working mechanism of the proposed structure. The maximum delay time obtained for the proposed structure was about 5 ps and the total footprint is about 1520  μm2.

  10. Development and validation of duplex, triplex, and pentaplex real-time PCR screening assays for the detection of genetically modified organisms in food and feed.


    Huber, Ingrid; Block, Annette; Sebah, Daniela; Debode, Frédéric; Morisset, Dany; Grohmann, Lutz; Berben, Gilbert; Stebih, Dejan; Milavec, Mojca; Zel, Jana; Busch, Ulrich


    Worldwide, qualitative methods based on PCR are most commonly used as screening tools for genetically modified material in food and feed. However, the increasing number and diversity of genetically modified organisms (GMO) require effective methods for simultaneously detecting several genetic elements marking the presence of transgenic events. Herein we describe the development and validation of a pentaplex, as well as complementary triplex and duplex real-time PCR assays, for the detection of the most common screening elements found in commercialized GMOs: P-35S, T-nos, ctp2-cp4-epsps, bar, and pat. The use of these screening assays allows the coverage of many GMO events globally approved for commercialization. Each multiplex real-time PCR assay shows high specificity and sensitivity with an absolute limit of detection below 20 copies for the targeted sequences. We demonstrate by intra- and interlaboratory tests that the assays are robust as well as cost- and time-effective for GMO screening if applied in routine GMO analysis.

  11. Triplex-forming ability of oligonucleotides containing 1-aryl-1,2,3-triazole nucleobases linked via a two atom-length spacer.


    Hari, Yoshiyuki; Nakahara, Motoi; Obika, Satoshi


    Phosphoramidites containing 2-propynyloxy or 1-butyn-4-yl as nucleobase precursors were synthesized and introduced into oligonucleotides using an automated DNA synthesizer. Copper-catalyzed alkyne-azide 1,3-dipolar cycloaddition of the oligonucleotides with various azides gave the corresponding triazolylated oligonucleotides, triplex-forming ability of these synthetic oligonucleotides with double-stranded DNA targets was evaluated by UV melting experiments. It was found that nucleobases containing 2-(1-m-carbonylaminophenyl-1,2,3-triazol-4-yl)ethyl units likely interacted with A of a TA base pair in a parallel triplex DNA.

  12. Design and construction of a VHGT-attached WDM-type triplex transceiver module using polymer PLC hybrid integration technology

    NASA Astrophysics Data System (ADS)

    Jerábek, Vitezslav; Hüttel, Ivan; Prajzler, Václav; Busek, K.; Seliger, P.


    We report about design and construction of the bidirectional transceiver TRx module for subscriber part of the passive optical network PON for a fiber to the home FTTH topology. The TRx module consists of a epoxy novolak resin polymer planar lightwave circuit (PLC) hybrid integration technology with volume holographic grating triplex filter VHGT, surface-illuminated photodetectors and spot-size converted Fabry-Pérot laser diode in SMD package. The hybrid PLC has composed from a two parts-polymer optical waveguide including VHGT filter section and a optoelectronic microwave section. The both parts are placed on the composite substrate.

  13. Specific triplex binding capacity of mixed base sequence duplex nucleic acids used for single-nucleotide polymorphism detection.


    Daksis, Jasmine I; Erikson, Glen H


    Specific base recognition and binding between native double-stranded DNA (dsDNA) and complementary single-stranded DNA (ssDNA) of mixed base sequence is presented. Third-strand binding, facilitated and stabilized by a DNA intercalator, YOYO-1, occurs within 5 min at room temperature. This triplex binding capability has been used to develop a homogeneous assay that accurately detects 1-, 2-, or 3-bp mutations or deletions in the dsDNA target. Every type of 1-bp mismatch can be identified. The assay can reliably distinguish homozygous from heterozygous polymerase chain reaction (PCR)-amplified genomic dsDNA, thus providing a highly sensitive clinical diagnostic assay.

  14. "The Show"

    ERIC Educational Resources Information Center

    Gehring, John


    For the past 16 years, the blue-collar city of Huntington, West Virginia, has rolled out the red carpet to welcome young wrestlers and their families as old friends. They have come to town chasing the same dream for a spot in what many of them call "The Show". For three days, under the lights of an arena packed with 5,000 fans, the…

  15. Glass-NiP-CoFeP triplex-shell particles with hollow cores and tunable magnetic properties.


    An, Zhenguo; Zhang, Jingjie


    Low density (0.55-0.92g/mL, depending on the shell thickness and composition) glass-metal-metal triplex-shell hollow particles (TSHP) were prepared by a three-step route. First, micrometer-sized silicate glass particles with hollow cores, uniform shells, and high sphericity were prepared through spray drying and subsequent melting. NiP shell was uniformly assembled to the previously obtained glass hollow particles by silver seed induced chemical reduction of Ni(2+) by sodium hypophosphite, and glass-NiP double-shell hollow particles (DSHP) with compact and uniform shells were formed. The as-formed NiP particles further acted as the seeds for the directed formation and assembly of the CoFeP shell on the NiP shell to form the final glass-NiP-CoFeP triplex-shell hollow particles (TSHP). The influences of the component of the reaction system on the composition, structure, and magnetic properties of the hollow particles were studied. The multishell hollow particles thus obtained may have some promising applications in the fields of low-density magnetic materials, conduction, microwave absorbers, catalysis, etc. This work provides an additional strategy to fabricate multishell structured hollow particles with tailored shell composition and magnetic properties, which can be extended to the controlled preparation of multishell composite particles with the shells consisting of metal, oxides, or other compounds.

  16. Colour-encoded paramagnetic microbead-based direct inhibition triplex flow cytometric immunoassay for ochratoxin A, fumonisins and zearalenone in cereals and cereal-based feed.


    Peters, Jeroen; Thomas, Darren; Boers, Ed; de Rijk, Theo; Berthiller, Franz; Haasnoot, Willem; Nielen, Michel W F


    A combined (triplex) immunoassay for the simultaneous detection of three mycotoxins in grains was developed with superparamagnetic colour-encoded microbeads, in combination with two bead-dedicated flow cytometers. Monoclonal antibodies were coupled to the beads, and the amounts of bound mycotoxins were inversely related to the amounts of bound fluorescent labelled mycotoxins (inhibition immunoassay format). The selected monoclonal antibodies were tested for their target mycotoxins and for cross-reactivity with relevant metabolites and masked mycotoxins. In the triplex format, low levels of cross-interactions between the assays occurred at irrelevant high levels only. All three assays were influenced by the sample matrix of cereal extracts to some extent, and matrix-matched calibrations are recommended for quantitative screening purposes. In a preliminary in-house validation, the triplex assay was found to be reproducible, sensitive and sufficiently accurate for the quantitative screening at ML level. The triplex assay was critically compared to liquid chromatography-tandem mass spectrometry using reference materials and fortified blank material. Results for the quantification of ochratoxin A and zearalenone were in good agreement. However, the fumonisin assay was, due to overestimation, only suitable for qualitative judgements. Both flow cytometer platforms (Luminex 100 and FLEXMAP 3D) performed similar with respect to sensitivity with the advantages of a higher sample throughput and response range of the FLEXMAP 3D and lower cost of the Luminex 100.

  17. Detection and clinical significance of CD44v6 and integrin-β1 in pancreatic cancer patients using a triplex real-time RT-PCR assay.


    Zhou, Gang; Chiu, David; Qin, Dajiang; Niu, Lizhi; Cai, Jinlei; He, Lihua; Huang, Wenhao; Xu, Kecheng


    The cell adhesion molecules CD44v6 and integrin-β1 are associated with the progression and metastasis of cancer. A novel triplex real-time reverse transcription polymerase chain reaction (qRT-PCR) assay was developed to quantify CD44v6 and integrin-β1 gene expression in peripheral blood mononuclear cells from 30 pancreatic cancer (PC) patients and 12 healthy individuals. The standard curve of the triplex qRT-PCR was constructed by optimizing the reaction condition and the amplification efficiency was 102.5, 101.1, and 100.6 % for CD44v6, integrin-β1 and endogenous gene (β-actin) amplification. Nonspecific bands were not observed from the triplex qRT-PCR amplification and the detection limit of this assay was 100 copies. Expression levels of CD44v6 and integrin-β1 gene were significantly lower in healthy individuals than PC patients (P<0.05). CD44v6 and integrin-β1 gene expression were not associated with the sex, age, and tumor position in PC (P>0.05). CD44v6 gene expression was significantly associated with clinical stage, liver metastasis, and tumor size (P<0.05). Integrin-β1 gene expression was significantly associated with clinical stage and liver metastasis (P<0.05). This triplex qRT-PCR assay may provide a useful tool for diagnosis, prognosis, and therapeutic evaluation in PC.

  18. Thermodynamic contributions for the incorporation of GTA triplets within canonical TAT/TAT and C+GC/C+GC base-triplet stacks of DNA triplexes.


    Soto, Ana Maria; Marky, Luis A


    Nucleic acid triple helices may be used in the control of gene expression. One limitation of using triplex-forming oligonucleotides as therapeutic agents is that their target sequences are limited to homopurine tracts. To increase the repertoire of sequences that can be targeted, it has been postulated that a guanine can target a thymidine forming a stable GTA mismatch triplet. In this work, we have used a combination of optical and calorimetric techniques to determine thermodynamic unfolding profiles of two triplexes containing a single GTA triplet, d(A(3)TA(3)C(5)T(3)AT(3)C(5)T(3)GT(3)) (ATA) and d(AGTGAC(5)TCACTC(5)TCGCT) (GTG), and their control triplexes, d(A(7)C(5)T(7)C(5)T(7)) (TAT7) and d(AGAGAC(5)TCTCTC(5)TCTCT) (AG5T). In general, the presence of a GTA mismatch in DNA triplexes is destabilizing; however, this destabilization is greater when placed in a C(+)GC/C(+)GC base-triplet stack than between a TAT/TAT stack. These destabilizations are accompanied by a reduced unfolding enthalpy of approximately 10 kcal/mol, suggesting a decrease in the base stacking contributions surrounding the mismatch. Relative to their corresponding control triplexes, the folding of ATA is accompanied by a lower counterion uptake and a similar proton uptake, while GTG folding is accompanied by an increase in the counterion and proton uptakes. These effects are consistent with the observed decrease in stacking interactions. The overall results indicate that the main difficulty of targeting pyrimidine interruptions is that the decrease in stacking contributions, due to the incorporation of a GTA mismatch, affects the stability of the neighboring base triplets. This suggests that nucleotide analogues that increase the strength of these base-triplet stacks will result in a more effective targeting of pyrimidine interruptions.

  19. FC-TRIPLEX Chagas/Leish IgG1: A Multiplexed Flow Cytometry Method for Differential Serological Diagnosis of Chagas Disease and Leishmaniasis

    PubMed Central

    Teixeira-Carvalho, Andréa; Campos, Fernanda Magalhães Freire; Geiger, Stefan Michael; Rocha, Roberta Dias Rodrigues; de Araújo, Fernanda Fortes; Vitelli-Avelar, Danielle Marquete; Andrade, Mariléia Chaves; Araújo, Márcio Sobreira Silva; Lemos, Elenice Moreira; de Freitas Carneiro Proietti, Anna Bárbara; Sabino, Ester Cerdeira; Caldas, Rafaella Gaiotti; Freitas, Carolina Renata Camargos; Campi-Azevedo, Ana Carolina; Elói-Santos, Silvana Maria; Martins-Filho, Olindo Assis


    Differential serological diagnosis of Chagas disease and leishmaniasis is difficult owing to cross-reactivity resulting from the fact that the parasites that cause these pathologies share antigenic epitopes. Even with optimized serological assays that use parasite-specific recombinant antigens, inconclusive test results continue to be a problem. Therefore, new serological tests with high sensitivity and specificity are needed. In the present work, we developed and evaluated the performance of a new flow cytometric serological method, referred to as FC-TRIPLEX Chagas/Leish IgG1, for the all-in-one classification of inconclusive tests. The method uses antigens for the detection of visceral leishmaniasis, localized cutaneous leishmaniasis, and Chagas disease and is based on an inverted detuned algorithm for analysis of anti-Trypanosomatidae IgG1 reactivity. First, parasites were label with fluorescein isothiocyanate or Alexa Fluor 647 at various concentrations. Then serum samples were serially diluted, the dilutions were incubated with suspensions of mixed labeled parasites, and flow cytometric measurements were performed to determine percentages of positive fluorescent parasites. Using the new method, we obtained correct results for 76 of 80 analyzed serum samples (95% overall performance), underscoring the outstanding performance of the method. Moreover, we found that the fluorescently labeled parasite suspensions were stable during storage at room temperature, 4°C, and –20°C for 1 year. In addition, two different lots of parasite suspensions showed equivalent antigen recognition; that is, the two lots showed equivalent categorical segregation of anti-Trypanosomatidae IgG1 reactivity at selected serum dilutions. In conclusion, we have developed a sensitive and selective method for differential diagnosis of Chagas disease, visceral leishmaniasis, and localized cutaneous leishmaniasis. PMID:25875961

  20. FC-TRIPLEX Chagas/Leish IgG1: a multiplexed flow cytometry method for differential serological diagnosis of chagas disease and leishmaniasis.


    Teixeira-Carvalho, Andréa; Campos, Fernanda Magalhães Freire; Geiger, Stefan Michael; Rocha, Roberta Dias Rodrigues; de Araújo, Fernanda Fortes; Vitelli-Avelar, Danielle Marquete; Andrade, Mariléia Chaves; Araújo, Márcio Sobreira Silva; Lemos, Elenice Moreira; de Freitas Carneiro Proietti, Anna Bárbara; Sabino, Ester Cerdeira; Caldas, Rafaella Gaiotti; Freitas, Carolina Renata Camargos; Campi-Azevedo, Ana Carolina; Elói-Santos, Silvana Maria; Martins-Filho, Olindo Assis


    Differential serological diagnosis of Chagas disease and leishmaniasis is difficult owing to cross-reactivity resulting from the fact that the parasites that cause these pathologies share antigenic epitopes. Even with optimized serological assays that use parasite-specific recombinant antigens, inconclusive test results continue to be a problem. Therefore, new serological tests with high sensitivity and specificity are needed. In the present work, we developed and evaluated the performance of a new flow cytometric serological method, referred to as FC-TRIPLEX Chagas/Leish IgG1, for the all-in-one classification of inconclusive tests. The method uses antigens for the detection of visceral leishmaniasis, localized cutaneous leishmaniasis, and Chagas disease and is based on an inverted detuned algorithm for analysis of anti-Trypanosomatidae IgG1 reactivity. First, parasites were label with fluorescein isothiocyanate or Alexa Fluor 647 at various concentrations. Then serum samples were serially diluted, the dilutions were incubated with suspensions of mixed labeled parasites, and flow cytometric measurements were performed to determine percentages of positive fluorescent parasites. Using the new method, we obtained correct results for 76 of 80 analyzed serum samples (95% overall performance), underscoring the outstanding performance of the method. Moreover, we found that the fluorescently labeled parasite suspensions were stable during storage at room temperature, 4 °C, and -20 °C for 1 year. In addition, two different lots of parasite suspensions showed equivalent antigen recognition; that is, the two lots showed equivalent categorical segregation of anti-Trypanosomatidae IgG1 reactivity at selected serum dilutions. In conclusion, we have developed a sensitive and selective method for differential diagnosis of Chagas disease, visceral leishmaniasis, and localized cutaneous leishmaniasis.

  1. LNA units present in the (2'-OMe)-RNA strand stabilize parallel duplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA and parallel triplexes (2'-OMe)-RNA/[All-R(P)-PS]-DNA/RNA. An improved tool for the inhibition of reverse transcription.


    Maciaszek, Anna; Krakowiak, Agnieszka; Janicka, Magdalena; Tomaszewska-Antczak, Agnieszka; Sobczak, Milena; Mikołajczyk, Barbara; Guga, Piotr


    Homopurine phosphorothioate analogs of DNA, possessing all phosphorus atoms of RP configuration ([All-RP-PS]-DNA), when interact with appropriate complementary RNA or (2'-OMe)-RNA templates, form parallel triplexes or parallel duplexes of very high thermodynamic stability. The present results show that T-LNA or 5-Me-C-LNA units introduced into the parallel Hoogsteen-paired (2'-OMe)-RNA strands (up to four units in the oligomers of 9 or 12 nt in length) stabilize these parallel complexes. At neutral pH, dodecameric parallel duplexes have Tm values of 62-68 °C, which are by 4-10 °C higher than Tm for the reference duplex (with no LNA units present), while for the corresponding triplexes, Tm values exceeded 85 °C. For nonameric parallel duplexes, melting temperatures of 38-62 °C were found and (2'-OMe)-RNA oligomers containing 5-Me-C-LNA units stabilized the complexes more efficiently than the T-LNA containing congeners. In both series the stability of the parallel complexes increased with an increasing number of LNA units present. The same trend was observed in experiments of reverse transcription RNA→DNA (using AMV RT reverse transcriptase) where the formation of parallel triplexes (consisting of an RNA template, [All-RP-PS]-DNA nonamer and Hoogsteen-paired (2'-OMe)-RNA strands containing the LNA units) led to the efficient inhibition of the process. Under the best conditions checked (four 5-Me-C-LNA units, three-fold excess over the RNA template) the inhibition was 94% effective, compared to 71% inhibition observed in the reference system with the Hoogsteen-paired (2'-OMe)-RNA strand carrying no LNA units. This kind of complexation may "arrest" harmful RNA oligomers (e.g., viral RNA or mRNA of unwanted proteins) and, beneficially, exclude them from enzymatic processes, otherwise leading to viral or genetic diseases.

  2. The TRIple PLunger for EXotic beams TRIPLEX for excited-state lifetime measurement studies on rare isotopes

    NASA Astrophysics Data System (ADS)

    Iwasaki, H.; Dewald, A.; Braunroth, T.; Fransen, C.; Smalley, D.; Lemasson, A.; Morse, C.; Whitmore, K.; Loelius, C.


    A new device, the TRIple PLunger for EXotic beams (TRIPLEX), has been developed for lifetime measurement studies with rare isotope beams. This plunger device holds up to three metal foils in the beam path and facilitates the recoil distance Doppler-shift technique to measure lifetimes of nuclear excited states in the range of 1 ps to 1 ns. The unique design allows independent movement of the target and the second degrader with respect to a fixed first degrader in between, enabling advanced experimental approaches, such as the differential recoil distance method and the double recoil distance method. The design and control of the device are presented in this paper, together with simulated performances of the new applications. As an example of actual experiments, results from the lifetime measurement of the neutron-rich 17C isotope performed at the National Superconducting Cyclotron Laboratory are shown.

  3. Human XPA and RPA DNA repair proteins participate in specific recognition of triplex-induced helical distortions

    NASA Astrophysics Data System (ADS)

    Vasquez, Karen M.; Christensen, Jesper; Li, Lei; Finch, Rick A.; Glazer, Peter M.


    Nucleotide excision repair (NER) plays a central role in maintaining genomic integrity by detecting and repairing a wide variety of DNA lesions. Xeroderma pigmentosum complementation group A protein (XPA) is an essential component of the repair machinery, and it is thought to be involved in the initial step as a DNA damage recognition and/or confirmation factor. Human replication protein A (RPA) and XPA have been reported to interact to form a DNA damage recognition complex with greater specificity for damaged DNA than XPA alone. The mechanism by which these two proteins recognize such a wide array of structures resulting from different types of DNA damage is not known. One possibility is that they recognize a common feature of the lesions, such as distortions of the helical backbone. We have tested this idea by determining whether human XPA and RPA proteins can recognize the helical distortions induced by a DNA triple helix, a noncanonical DNA structure that has been shown to induce DNA repair, mutagenesis, and recombination. We measured binding of XPA and RPA, together or separately, to substrates containing triplexes with three, two, or no strands covalently linked by psoralen conjugation and photoaddition. We found that RPA alone recognizes all covalent triplex structures, but also forms multivalent nonspecific DNA aggregates at higher concentrations. XPA by itself does not recognize the substrates, but it binds them in the presence of RPA. Addition of XPA decreases the nonspecific DNA aggregate formation. These results support the hypothesis that the NER machinery is targeted to helical distortions and demonstrate that RPA can recognize damaged DNA even without XPA.

  4. A novel triplex quantitative PCR strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments.


    Bliem, Rupert; Schauer, Sonja; Plicka, Helga; Obwaller, Adelheid; Sommer, Regina; Steinrigl, Adolf; Alam, Munirul; Reischer, Georg H; Farnleitner, Andreas H; Kirschner, Alexander


    Vibrio cholerae is a severe human pathogen and a frequent member of aquatic ecosystems. Quantification of V. cholerae in environmental water samples is therefore fundamental for ecological studies and health risk assessment. Beside time-consuming cultivation techniques, quantitative PCR (qPCR) has the potential to provide reliable quantitative data and offers the opportunity to quantify multiple targets simultaneously. A novel triplex qPCR strategy was developed in order to simultaneously quantify toxigenic and nontoxigenic V. cholerae in environmental water samples. To obtain quality-controlled PCR results, an internal amplification control was included. The qPCR assay was specific, highly sensitive, and quantitative across the tested 5-log dynamic range down to a method detection limit of 5 copies per reaction. Repeatability and reproducibility were high for all three tested target genes. For environmental application, global DNA recovery (GR) rates were assessed for drinking water, river water, and water from different lakes. GR rates ranged from 1.6% to 76.4% and were dependent on the environmental background. Uncorrected and GR-corrected V. cholerae abundances were determined in two lakes with extremely high turbidity. Uncorrected abundances ranged from 4.6×10(2) to 2.3×10(4) cell equivalents liter(-1), whereas GR-corrected abundances ranged from 4.7×10(3) to 1.6×10(6) cell equivalents liter(-1). GR-corrected qPCR results were in good agreement with an independent cell-based direct detection method but were up to 1.6 log higher than cultivation-based abundances. We recommend the newly developed triplex qPCR strategy as a powerful tool to simultaneously quantify toxigenic and nontoxigenic V. cholerae in various aquatic environments for ecological studies as well as for risk assessment programs.

  5. Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.


    Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi


    A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP.

  6. Determination of navigation FDI thresholds using a Markov model. [Failure Detection and Identification in triplex inertial platform systems for Shuttle entry

    NASA Technical Reports Server (NTRS)

    Walker, B. K.; Gai, E.


    A method for determining time-varying Failure Detection and Identification (FDI) thresholds for single sample decision functions is described in the context of a triplex system of inertial platforms. A cost function consisting of the probability of vehicle loss due to FDI decision errors is minimized. A discrete Markov model is constructed from which this cost can be determined as a function of the decision thresholds employed to detect and identify the first and second failures. Optimal thresholds are determined through the use of parameter optimization techniques. The application of this approach to threshold determination is illustrated for the Space Shuttle's inertial measurement instruments.

  7. Selective recognition of cis-trans-isomers of platinum drugs and the detection of triplex DNA based on fluorescence reversible model of quantum dots.


    Xu, Xiaoling; Gao, Fang; Xiao, Xincai; Hu, Yan; Zhu, Chaozhen; Zhao, Dan


    The identification of spatial structures of drugs and the researches on their interaction mechanism with DNA are always attractive to the researchers. However, their realization is lack of simple and fast method. This paper reports the establishment of multiple-functional detection platform based on the "turn off-on" model of ZnCdSe quantum dots. In this system, ZnCdSe quantum dots work as the fluorescent probe, platinum anti-cancer drugs as the quencher and triplex DNA as the trapping agent. The seemingly similar cisplatin and transplatin exhibited different fluorescent recovery behaviors due to their difference in structure, and thus realized the selective detection of cisplatin and transplatin with the reaction time set at 10min as well as the quantitation of cisplatin over the range of 2.5×10(-8)-100×10(-8)M. Based on this, the interactions between platinum anti-cancer drugs and ctDNA as well as polymorphic DNA were further studied, and realized the recognition of triplex DNA. The multiple-functional detection platform integrates the functions of the filtration of high-efficient platinum anti-cancer drugs, the researches on interaction mechanism of drugs, and the recognition of polymorphic DNA, meaningful to the future treatment of viral and cancers based on antisense gene strategy.

  8. Double-stranded DNA-templated cleavage of oligonucleotides containing a P3'->N5' linkage triggered by triplex formation: the effects of chemical modifications and remarkable enhancement in reactivity.


    Ito, Kosuke Ramon; Kodama, Tetsuya; Tomizu, Masaharu; Negoro, Yoshinori; Orita, Ayako; Osaki, Tomohisa; Hosoki, Noritsugu; Tanaka, Takaya; Imanishi, Takeshi; Obika, Satoshi


    We recently reported double-stranded DNA-templated cleavage of oligonucleotides as a sequence-specific DNA-detecting method. In this method, triplex-forming oligonucleotides (TFOs) modified with 5'-amino-2',4'-BNA were used as a DNA-detecting probe. This modification introduced a P3'→N5' linkage (P-N linkage) in the backbone of the TFO, which was quickly cleaved under acidic conditions when it formed a triplex. The prompt fission of the P-N linkage was assumed to be driven by a conformational strain placed on the linkage upon triplex formation. Therefore, chemical modifications around the P-N linkage should change the reactivity by altering the microenvironment. We synthesized 5'-aminomethyl type nucleic acids, and incorporated them into TFOs instead of 5'-amino-2',4'-BNA to investigate the effect of 5'-elongation. In addition, 2',4'-BNA/LNA or 2',5'-linked DNA were introduced at the 3'- and/or 5'-neighboring residues of 5'-amino-2',4'-BNA to reveal neighboring residual effects. We evaluated the triplex stability and reaction properties of these TFOs, and found out that chemical modifications around the P-N linkage greatly affected their reaction properties. Notably, 2',5'-linked DNA at the 3' position flanking 5'-amino-2',4'-BNA brought significantly higher reactivity, and we succeeded in indicating that a TFO with this modification is promising as a DNA analysis tool.

  9. Triplex transfer learning: exploiting both shared and distinct concepts for text classification.


    Zhuang, Fuzhen; Luo, Ping; Du, Changying; He, Qing; Shi, Zhongzhi; Xiong, Hui


    Transfer learning focuses on the learning scenarios when the test data from target domains and the training data from source domains are drawn from similar but different data distributions with respect to the raw features. Along this line, some recent studies revealed that the high-level concepts, such as word clusters, could help model the differences of data distributions, and thus are more appropriate for classification. In other words, these methods assume that all the data domains have the same set of shared concepts, which are used as the bridge for knowledge transfer. However, in addition to these shared concepts, each domain may have its own distinct concepts. In light of this, we systemically analyze the high-level concepts, and propose a general transfer learning framework based on nonnegative matrix trifactorization, which allows to explore both shared and distinct concepts among all the domains simultaneously. Since this model provides more flexibility in fitting the data, it can lead to better classification accuracy. Moreover, we propose to regularize the manifold structure in the target domains to improve the prediction performances. To solve the proposed optimization problem, we also develop an iterative algorithm and theoretically analyze its convergence properties. Finally, extensive experiments show that the proposed model can outperform the baseline methods with a significant margin. In particular, we show that our method works much better for the more challenging tasks when there are distinct concepts in the data.

  10. Mechanization of and experience with a triplex fly-by-wire backup control system

    NASA Technical Reports Server (NTRS)

    Lock, W. P.; Petersen, W. R.; Whitman, G. B.


    A redundant three-axis analog control system was designed and developed to back up a digital fly-by-wire control system for an F-8C airplane. Forty-two flights, involving 58 hours of flight time, were flown by six pilots. The mechanization and operational experience with the backup control system, the problems involved in synchronizing it with the primary system, and the reliability of the system are discussed. The backup control system was dissimilar to the primary system, and it provided satisfactory handling through the flight envelope evaluated. Limited flight tests of a variety of control tasks showed that control was also satisfactory when the backup control system was controlled by a minimum-displacement (force) side stick. The operational reliability of the F-8 digital fly-by-wire control system was satisfactory, with no unintentional downmodes to the backup control system in flight. The ground and flight reliability of the system's components is discussed.

  11. Mechanization of and experience with a triplex fly-by-wire backup control system

    NASA Technical Reports Server (NTRS)

    Lock, W. P.; Petersen, W. R.; Whitman, G. B.


    A redundant three axis analog control system was designed and developed to back up a digital fly by wire control system for an F-8C airplane. The mechanization and operational experience with the backup control system, the problems involved in synchronizing it with the primary system, and the reliability of the system are discussed. The backup control system was dissimilar to the primary system, and it provided satisfactory handling through the flight envelope evaluated. Limited flight tests of a variety of control tasks showed that control was also satisfactory when the backup control system was controlled by a minimum displacement (force) side stick. The operational reliability of the F-8 digital fly by wire control system was satisfactory, with no unintentional downmodes to the backup control system in flight. The ground and flight reliability of the system's components is discussed.

  12. Evidence for a group II intron-like catalytic triplex in the spliceosome

    PubMed Central

    Piccirilli, Joseph A.; Staley, Jonathan P.


    To catalyze pre-mRNA splicing, U6 snRNA positions two metals that interact directly with the scissile phosphates. The U6 metal ligands correspond stereospecifically to metal ligands within the catalytic domain V of a group II self-splicing intron. In domain V, the ligands are organized by base-triple interactions, which also juxtapose the 3′ splice site with the catalytic metals. However, in the spliceosome, the mechanism for organizing catalytic metals and recruiting the substrate has remained unclear. Here we show by genetics, crosslinking, and biochemistry in yeast that analogous triples form in U6 and promote catalytic metal binding and both chemical steps of splicing. Because the triples include an element that defines the 5′ splice site, the triples also provide a mechanism for juxtaposing the pre-mRNA substrate with the catalytic metals. Our data indicate that U6 adopts a group II intron-like tertiary conformation to catalyze splicing. PMID:24747940

  13. Development of SERS substrate using phage-based magnetic template for triplex assay in sepsis diagnosis.


    Nguyen, Anh H; Shin, Yesol; Sim, Sang Jun


    Development of a new substrate for surface-enhanced Raman scattering (SERS) is one area of interest for the improvement of SERS performance. Herein, we introduce a new method for developing new mesoporous SERS substrates using M13 phages that display cysteine-rich peptides on the pVIII major units, which is an alternative for thiol donor using chemical modifications. Together with the SERS substrate development, and the use of the SERS technique for sepsis diagnostics is a new approach in clinical settings. The substrates were characterized and magnetized with magnetic immuno colloids made of gold-coated magnetic nanoparticles and specific antibodies. Conventionally, the SERS-tags are prepared by using gold nanoparticles and are modified with Raman dyes to immobilize specific antibodies to capture the biomarkers in the serum samples. However, in this method the SERS-tags are bound to the mesoporous substrate via antibody/antigen interactions to form clusters or layer-by-layer assemblies of SERS-tags for Raman signal enhancement. The SERS spectra showed distinct peaks for tags corresponding to three typical sepsis-specific biomarkers for diagnostics with the limit of detection values of 27 pM, 103 pM, and 78 pM for C-reactive protein (CRP), procalcitonin (PCT), and soluble triggering receptor expressed on myeloid cells-1 (sTREM-1), respectively. With such an approach, SERS can be used for clinical purposes and can be improved by phage display modification rather than chemical alternatives.

  14. Asymmetric triplex metallohelices with high and selective activity against cancer cells

    NASA Astrophysics Data System (ADS)

    Faulkner, Alan D.; Kaner, Rebecca A.; Abdallah, Qasem M. A.; Clarkson, Guy; Fox, David J.; Gurnani, Pratik; Howson, Suzanne E.; Phillips, Roger M.; Roper, David I.; Simpson, Daniel H.; Scott, Peter


    Small cationic amphiphilic α-helical peptides are emerging as agents for the treatment of cancer and infection, but they are costly and display unfavourable pharmacokinetics. Helical coordination complexes may offer a three-dimensional scaffold for the synthesis of mimetic architectures. However, the high symmetry and modest functionality of current systems offer little scope to tailor the structure to interact with specific biomolecular targets, or to create libraries for phenotypic screens. Here, we report the highly stereoselective asymmetric self-assembly of very stable, functionalized metallohelices. Their anti-parallel head-to-head-to-tail ‘triplex’ strand arrangement creates an amphipathic functional topology akin to that of the active sub-units of, for example, host-defence peptides and p53. The metallohelices display high, structure-dependent toxicity to the human colon carcinoma cell-line HCT116 p53++, causing dramatic changes in the cell cycle without DNA damage. They have lower toxicity to human breast adenocarcinoma cells (MDA-MB-468) and, most remarkably, they show no significant toxicity to the bacteria methicillin-resistant Staphylococcus aureus and Escherichia coli.

  15. Development and Validation of a Harmonized TaqMan-Based Triplex Real-Time RT-PCR Protocol for the Quantitative Detection of Normalized Gene Expression Profiles of Seven Porcine Cytokines

    PubMed Central

    Petrov, Anja; Beer, Martin; Blome, Sandra


    Dysregulation of cytokine responses plays a major role in the pathogenesis of severe and life-threatening infectious diseases like septicemia or viral hemorrhagic fevers. In pigs, diseases like African and classical swine fever are known to show exaggerated cytokine releases. To study these responses and their impact on disease severity and outcome in detail, reliable, highly specific and sensitive methods are needed. For cytokine research on the molecular level, real-time RT-PCRs have been proven to be suitable. Yet, the currently available and most commonly used SYBR Green I assays or heterogeneous gel-based RT-PCRs for swine show a significant lack of specificity and sensitivity. The latter is however absolutely essential for an accurate quantification of rare cytokine transcripts as well as for detection of small changes in gene expressions. For this reason, a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines was designed and validated within the presented study. Cytokines were chosen to represent different immunological pathways and targets known to be involved in the pathogenesis of the above mentioned porcine diseases, namely interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor (TNF)-α and interferon (IFN)-α. Beta-Actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes for normalization. For absolute quantification a synthetic standard plasmid was constructed comprising all target cytokines and reference genes within a single molecule allowing the generation of positive control RNA. The standard as well as positive RNAs from samples, and additionally more than 400 clinical samples, which were collected from animal trials, were included in the validation process to assess analytical sensitivity and applicability under routine conditions. The resulting assay allows the reliable assessment of gene expression

  16. Development and validation of a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines.


    Petrov, Anja; Beer, Martin; Blome, Sandra


    Dysregulation of cytokine responses plays a major role in the pathogenesis of severe and life-threatening infectious diseases like septicemia or viral hemorrhagic fevers. In pigs, diseases like African and classical swine fever are known to show exaggerated cytokine releases. To study these responses and their impact on disease severity and outcome in detail, reliable, highly specific and sensitive methods are needed. For cytokine research on the molecular level, real-time RT-PCRs have been proven to be suitable. Yet, the currently available and most commonly used SYBR Green I assays or heterogeneous gel-based RT-PCRs for swine show a significant lack of specificity and sensitivity. The latter is however absolutely essential for an accurate quantification of rare cytokine transcripts as well as for detection of small changes in gene expressions. For this reason, a harmonized TaqMan-based triplex real-time RT-PCR protocol for the quantitative detection of normalized gene expression profiles of seven porcine cytokines was designed and validated within the presented study. Cytokines were chosen to represent different immunological pathways and targets known to be involved in the pathogenesis of the above mentioned porcine diseases, namely interleukin (IL)-1β, IL-2, IL-4, IL-6, IL-8, tumor necrosis factor (TNF)-α and interferon (IFN)-α. Beta-Actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as reference genes for normalization. For absolute quantification a synthetic standard plasmid was constructed comprising all target cytokines and reference genes within a single molecule allowing the generation of positive control RNA. The standard as well as positive RNAs from samples, and additionally more than 400 clinical samples, which were collected from animal trials, were included in the validation process to assess analytical sensitivity and applicability under routine conditions. The resulting assay allows the reliable assessment of gene expression

  17. Parallel-stranded DNA under topological stress: rearrangement of (dA)15.(dT)15 to a d(A.A.T)n triplex.

    PubMed Central

    Klysik, J; Rippe, K; Jovin, T M


    DNA oligonucleotides with appropriate sequences can form a stable duplex in which the two strands are paired in a parallel orientation instead of as the conventional antiparallel double helix of B-DNA. In parallel-stranded DNA (ps-DNA) base pairing is noncanonical with the glycosidic bonds in a trans orientation. The two grooves are equivalent. We have synthesized DNA duplexes consisting of a central parallel-stranded (dA)15.(dT)15 tract flanked by normal antiparallel regions, and ligated them into the pUC18 plasmid. The effect of negative supercoiling on the covalently closed circular molecules was studied by two-dimensional agarose gel electrophoresis and by chemical modification with OsO4-pyridine (Os,py) and diethylpyrocarbonate (DEPC). The following results were obtained: (i) The ps insert, and by inference ps-DNA in general, adopts a right handed helical form. (ii) Upon increasing the negative superhelix density (-sigma) to greater than 0.03 the 15 bp ps insert undergoes a major transition leading to a relaxation corresponding to a reduction in twist of approximately 2.5 helical turns. The transition free surgery is approximately kcal/mol. (iii) The chemical modification pattern of the resulting structure suggests that the purine strand folds back and associates with the pyrimidine strand, forming a novel intramolecular triplex structure consisting of d(A.A.T) base triplets. A model for the triplex conformation is proposed and its thermodynamic properties are analyzed by statistical mechanics. Images PMID:1766874

  18. Development and Evaluation of a Novel Multicopy-Element-Targeting Triplex PCR for Detection of Mycobacterium avium subsp. paratuberculosis in Feces

    PubMed Central

    Garrido, Joseba M.; Molina, Elena; Geijo, María V.; Elguezabal, Natalia; Vázquez, Patricia; Juste, Ramón A.


    The enteropathy called paratuberculosis (PTB), which mainly affects ruminants and has a worldwide distribution, is caused by Mycobacterium avium subsp. paratuberculosis. This disease significantly reduces the cost-effectiveness of ruminant farms, and therefore, reliable and rapid detection methods are needed to control the spread of the bacterium in livestock and in the environment. The aim of this study was to identify a specific and sensitive combination of DNA extraction and amplification to detect M. avium subsp. paratuberculosis in feces. Negative bovine fecal samples were inoculated with increasing concentrations of two different bacterial strains (field and reference) to compare the performance of four extraction and five amplification protocols. The best results were obtained using the JohnePrep and MagMax extraction kits combined with an in-house triplex real-time PCR designed to detect IS900, ISMap02 (an insertion sequence of M. avium subsp. paratuberculosis present in 6 copies per genome), and an internal amplification control DNA simultaneously. These combinations detected 10 M. avium subsp. paratuberculosis cells/g of spiked feces. The triplex PCR detected 1 fg of genomic DNA extracted from the reference strain K10. The performance of the robotized version of the MagMax extraction kit combined with the IS900 and ISMap02 PCR was further evaluated using 615 archival fecal samples from the first sampling of nine Friesian cattle herds included in a PTB control program and followed up for at least 4 years. The analysis of the results obtained in this survey demonstrated that the diagnostic method was highly specific and sensitive for the detection of M. avium subsp. paratuberculosis in fecal samples from cattle and a very valuable tool to be used in PTB control programs. PMID:24727272

  19. Development and evaluation of a novel multicopy-element-targeting triplex PCR for detection of Mycobacterium avium subsp. paratuberculosis in feces.


    Sevilla, Iker A; Garrido, Joseba M; Molina, Elena; Geijo, María V; Elguezabal, Natalia; Vázquez, Patricia; Juste, Ramón A


    The enteropathy called paratuberculosis (PTB), which mainly affects ruminants and has a worldwide distribution, is caused by Mycobacterium avium subsp. paratuberculosis. This disease significantly reduces the cost-effectiveness of ruminant farms, and therefore, reliable and rapid detection methods are needed to control the spread of the bacterium in livestock and in the environment. The aim of this study was to identify a specific and sensitive combination of DNA extraction and amplification to detect M. avium subsp. paratuberculosis in feces. Negative bovine fecal samples were inoculated with increasing concentrations of two different bacterial strains (field and reference) to compare the performance of four extraction and five amplification protocols. The best results were obtained using the JohnePrep and MagMax extraction kits combined with an in-house triplex real-time PCR designed to detect IS900, ISMap02 (an insertion sequence of M. avium subsp. paratuberculosis present in 6 copies per genome), and an internal amplification control DNA simultaneously. These combinations detected 10 M. avium subsp. paratuberculosis cells/g of spiked feces. The triplex PCR detected 1 fg of genomic DNA extracted from the reference strain K10. The performance of the robotized version of the MagMax extraction kit combined with the IS900 and ISMap02 PCR was further evaluated using 615 archival fecal samples from the first sampling of nine Friesian cattle herds included in a PTB control program and followed up for at least 4 years. The analysis of the results obtained in this survey demonstrated that the diagnostic method was highly specific and sensitive for the detection of M. avium subsp. paratuberculosis in fecal samples from cattle and a very valuable tool to be used in PTB control programs.

  20. Broadly targeted triplex real-time PCR detection of influenza A, B and C viruses based on the nucleoprotein gene and a novel "MegaBeacon" probe strategy.


    Muradrasoli, Shaman; Mohamed, Nahla; Belák, Sándor; Czifra, György; Herrmann, Björn; Berencsi, George; Blomberg, Jonas


    A PCR assay that covers animal and human influenza A, B and C viruses, i.e., most of Orthomyxoviridae, is needed. Influenza types are distinguished based on differences in the nucleoprotein (NP) present in the virus. Conserved NP regions were therefore used to design a TaqMan-based triplex reverse transcription real-time PCR method. Variability of influenza A within the probe target region mandated the development of a novel molecular beacon, the "Mega" molecular beacon (MegaBeacon; MegB), for the detection of influenza A with this method. MegaBeacon is a mismatch-tolerant molecular beacon that is also a TaqMan probe. The triplex method (3QPCR-MegB) was evaluated with influenza A isolates covering 18 HxNx combinations, two influenza B isolates, and five Japanese influenza C isolates, as well as influenza A, B and C synthetic DNA targets. One to ten viral RNA and cDNA genome equivalents were detected per PCR reaction for influenza A, B and C. Seventy-one human nasopharyngeal aspirates from respiratory infections yielded 30 influenza A, 11 influenza B and 0 influenza C with 3QPCR-MegB, where immunofluorescence (IF) found 28 influenza A and 10 influenza B. 3QPCR-MegB was more mismatch-tolerant than a variant PCR with an influenza A TaqMan probe (3QPCR) and is a sensitive and rational method to detect influenza viruses of animal and human origin. MegaBeacon probes hold promise for variable target nucleic acids.

  1. Double triplex real-time PCR assay for simultaneous detection of Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hominis, and Staphylococcus haemolyticus and determination of their methicillin resistance directly from positive blood culture bottles.


    Kilic, Abdullah; Basustaoglu, A Celal


    We developed and validated here a double triplex real-time PCR assay to simultaneously detect and identify Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus haemolyticus and their methicillin resistance in a single reaction directly from Gram-positive cocci-in-clusters (GPCs)-positive blood culture bottles. From August 15, 2009 through February 15, 2010, 238 GPC-positive samples were collected and identified by conventional methods as 11 methicillin-resistant S. aureus (MRSA), 28 methicillin-susceptible S. aureus (MSSA), 176 MR coagulase-negative staphylococci (MRCoNS), 21 MSCoNS and two Enterococcus faecalis. The double triplex real-time PCR assay was targeted and detected tuf, nuc and mecA genes in the first tube and atlE, gap and mvaA genes in the second tube which could be run simultaneously. The detection limit of the assay was found at 10(3) CFU/ml for the atleE gene, 10(4) CFU/ml for the mva gene and 10(5) CFU/ml for gap, nuc, mecA and tuf genes based on seeding experiments. All Staphylococcus species except two S. epidermidis were correctly identified by the assay. The double triplex real-time PCR assay quickly and accurately detects S. aureus, S. epidermidis, S. hominis and S. haemolyticus and their methicillin resistance in a single reaction directly from positive blood culture bottles within 83 min.

  2. Television Quiz Show Simulation

    ERIC Educational Resources Information Center

    Hill, Jonnie Lynn


    This article explores the simulation of four television quiz shows for students in China studying English as a foreign language (EFL). It discusses the adaptation and implementation of television quiz shows and how the students reacted to them.

  3. Triplex-forming oligonucleotides targeting c-MYC potentiate the anti-tumor activity of gemcitabine in a mouse model of human cancer

    PubMed Central

    Boulware, Stephen B.; Christensen, Laura A.; Thames, Howard; Coghlan, Lezlee; Vasquez, Karen M.; Finch, Rick A.


    Antimetabolite chemotherapy remains an essential cancer treatment modality, but often produces only marginal benefit due to the lack of tumor specificity, the development of drug resistance, and the refractoriness of slowly-proliferating cells in solid tumors. Here, we report a novel strategy to circumvent the proliferation-dependence of traditional antimetabolite-based therapies. Triplex-forming oligonucleotides (TFOs) were used to target site-specific DNA damage to the human c-MYC oncogene, thereby inducing replication-independent, unscheduled DNA repair synthesis (UDS) preferentially in the TFO-targeted region. The TFO-directed UDS facilitated incorporation of the antimetabolite, gemcitabine (GEM), into the damaged oncogene, thereby potentiating the anti-tumor activity of GEM. Mice bearing COLO 320DM human colon cancer xenografts (containing amplified c-MYC) were treated with a TFO targeted to c-MYC in combination with GEM. Tumor growth inhibition produced by the combination was significantly greater than with either TFO or GEM alone. Specific TFO binding to the genomic c-MYC gene was demonstrated, and TFO-induced DNA damage was confirmed by NBS1 accumulation, supporting a mechanism of enhanced efficacy of GEM via TFO-targeted DNA damage-induced UDS. Thus, coupling antimetabolite chemotherapeutics with a strategy that facilitates selective targeting of cells containing amplification of cancer-relevant genes can improve their activity against solid tumors, while possibly minimizing host toxicity. PMID:23681918

  4. Development of novel triplex single-step real-time PCR assay for detection of Hepatitis Virus B and C simultaneously.


    Prakash, Shantanu; Jain, Amita; Jain, Bhawana


    Multiplex RT-PCR assays are widely used tools for detection of hepatitis viruses, but none of them provide quality check of sample. In the present study we developed a single-step triplex real-time polymerase chain reaction (PCR) assay for detection of Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) with sample quality check, by using β-actin as housekeeping gene. The primers and probes were self-designed and assay was standardized. Assay was also destined to quantitate copy numbers of HBV and HCV. This novel assay was sensitive, specific, and reproducible for detection of HBV and HCV in serum/plasma. The assay also detected all genotypes of HBV and HCV. The detection limit was 60 IU/mL for HBV and 20 IU/mL for HCV. This assay is the first assay developed on single-step platform for nucleic acid detection of HBV and HCV with an extra edge over all other assays by providing inbuilt check for quality of sample.

  5. Effect of lower bainite/martensite/retained austenite triplex microstructure on the mechanical properties of a low-carbon steel with quenching and partitioning process

    NASA Astrophysics Data System (ADS)

    Li, Wan-song; Gao, Hong-ye; Li, Zhong-yi; Nakashima, Hideharu; Hata, Satoshi; Tian, Wen-huai


    We present a study concerning Fe-0.176C-1.31Si-1.58Mn-0.26Al-0.3Cr (wt%) steel subjected to a quenching and partitioning (Q&P) process. The results of scanning electron microscopy, transmission electron microscopy, X-ray diffraction, and tensile tests demonstrate that the microstructures primarily consist of lath martensite, retained austenite, lower bainite (LB), and a small amount of tempered martensite; moreover, few twin austenite grains were observed. In the microstructure, three types of retained austenite with different sizes and morphologies were observed: blocky retained austenite (~300 nm in width), film-like retained austenite (80-120 nm in width), and ultra- fine film-like retained austenite (30-40 nm in width). Because of the effect of the retained austenite/martensite/LB triplex microstructure, the specimens prepared using different quenching temperatures exhibit high ultimate tensile strength and yield strength. Furthermore, the strength effect of LB can partially counteract the decreasing strength effect of martensite. The formation of LB substantially reduces the amount of retained austenite. Analyses of the retained austenite and the amount of blocky retained austenite indicated that the carbon content is critical to the total elongation of Q&P steel.

  6. Showing What They Know

    ERIC Educational Resources Information Center

    Cech, Scott J.


    Having students show their skills in three dimensions, known as performance-based assessment, dates back at least to Socrates. Individual schools such as Barrington High School--located just outside of Providence--have been requiring students to actively demonstrate their knowledge for years. The Rhode Island's high school graduating class became…

  7. The Ozone Show.

    ERIC Educational Resources Information Center

    Mathieu, Aaron


    Uses a talk show activity for a final assessment tool for students to debate about the ozone hole. Students are assessed on five areas: (1) cooperative learning; (2) the written component; (3) content; (4) self-evaluation; and (5) peer evaluation. (SAH)

  8. What Do Maps Show?

    ERIC Educational Resources Information Center

    Geological Survey (Dept. of Interior), Reston, VA.

    This curriculum packet, appropriate for grades 4-8, features a teaching poster which shows different types of maps (different views of Salt Lake City, Utah), as well as three reproducible maps and reproducible activity sheets which complement the maps. The poster provides teacher background, including step-by-step lesson plans for four geography…

  9. Show Me the Way

    ERIC Educational Resources Information Center

    Dicks, Matthew J.


    Because today's students have grown up steeped in video games and the Internet, most of them expect feedback, and usually gratification, very soon after they expend effort on a task. Teachers can get quick feedback to students by showing them videotapes of their learning performances. The author, a 3rd grade teacher describes how the seemingly…

  10. Chemistry Game Shows

    NASA Astrophysics Data System (ADS)

    Campbell, Susan; Muzyka, Jennifer


    We present a technological improvement to the use of game shows to help students review for tests. Our approach uses HTML files interpreted with a browser on a computer attached to an LCD projector. The HTML files can be easily modified for use of the game in a variety of courses.

  11. Honored Teacher Shows Commitment.

    ERIC Educational Resources Information Center

    Ratte, Kathy


    Part of the acceptance speech of the 1985 National Council for the Social Studies Teacher of the Year, this article describes the censorship experience of this honored social studies teacher. The incident involved the showing of a videotape version of the feature film entitled "The Seduction of Joe Tynan." (JDH)

  12. Talk Show Science.

    ERIC Educational Resources Information Center

    Moore, Mitzi Ruth


    Proposes having students perform skits in which they play the roles of the science concepts they are trying to understand. Provides the dialog for a skit in which hot and cold gas molecules are interviewed on a talk show to study how these properties affect wind, rain, and other weather phenomena. (MDH)

  13. Stage a Water Show

    ERIC Educational Resources Information Center

    Frasier, Debra


    In the author's book titled "The Incredible Water Show," the characters from "Miss Alaineus: A Vocabulary Disaster" used an ocean of information to stage an inventive performance about the water cycle. In this article, the author relates how she turned the story into hands-on science teaching for real-life fifth-grade students. The author also…

  14. Not a "reality" show.


    Wrong, Terence; Baumgart, Erica


    The authors of the preceding articles raise legitimate questions about patient and staff rights and the unintended consequences of allowing ABC News to film inside teaching hospitals. We explain why we regard their fears as baseless and not supported by what we heard from individuals portrayed in the filming, our decade-long experience making medical documentaries, and the full un-aired context of the scenes shown in the broadcast. The authors don't and can't know what conversations we had, what documents we reviewed, and what protections we put in place in each televised scene. Finally, we hope to correct several misleading examples cited by the authors as well as their offhand mischaracterization of our program as a "reality" show.

  15. Public medical shows.


    Walusinski, Olivier


    In the second half of the 19th century, Jean-Martin Charcot (1825-1893) became famous for the quality of his teaching and his innovative neurological discoveries, bringing many French and foreign students to Paris. A hunger for recognition, together with progressive and anticlerical ideals, led Charcot to invite writers, journalists, and politicians to his lessons, during which he presented the results of his work on hysteria. These events became public performances, for which physicians and patients were transformed into actors. Major newspapers ran accounts of these consultations, more like theatrical shows in some respects. The resultant enthusiasm prompted other physicians in Paris and throughout France to try and imitate them. We will compare the form and substance of Charcot's lessons with those given by Jules-Bernard Luys (1828-1897), Victor Dumontpallier (1826-1899), Ambroise-Auguste Liébault (1823-1904), Hippolyte Bernheim (1840-1919), Joseph Grasset (1849-1918), and Albert Pitres (1848-1928). We will also note their impact on contemporary cinema and theatre.

  16. The Great Cometary Show

    NASA Astrophysics Data System (ADS)


    its high spatial and spectral resolution, it was possible to zoom into the very heart of this very massive star. In this innermost region, the observations are dominated by the extremely dense stellar wind that totally obscures the underlying central star. The AMBER observations show that this dense stellar wind is not spherically symmetric, but exhibits a clearly elongated structure. Overall, the AMBER observations confirm that the extremely high mass loss of Eta Carinae's massive central star is non-spherical and much stronger along the poles than in the equatorial plane. This is in agreement with theoretical models that predict such an enhanced polar mass-loss in the case of rapidly rotating stars. ESO PR Photo 06c/07 ESO PR Photo 06c/07 RS Ophiuchi in Outburst Several papers from this special feature focus on the later stages in a star's life. One looks at the binary system Gamma 2 Velorum, which contains the closest example of a star known as a Wolf-Rayet. A single AMBER observation allowed the astronomers to separate the spectra of the two components, offering new insights in the modeling of Wolf-Rayet stars, but made it also possible to measure the separation between the two stars. This led to a new determination of the distance of the system, showing that previous estimates were incorrect. The observations also revealed information on the region where the winds from the two stars collide. The famous binary system RS Ophiuchi, an example of a recurrent nova, was observed just 5 days after it was discovered to be in outburst on 12 February 2006, an event that has been expected for 21 years. AMBER was able to detect the extension of the expanding nova emission. These observations show a complex geometry and kinematics, far from the simple interpretation of a spherical fireball in extension. AMBER has detected a high velocity jet probably perpendicular to the orbital plane of the binary system, and allowed a precise and careful study of the wind and the shockwave

  17. Stretched View Showing 'Victoria'

    NASA Technical Reports Server (NTRS)


    [figure removed for brevity, see original site] Stretched View Showing 'Victoria'

    This pair of images from the panoramic camera on NASA's Mars Exploration Rover Opportunity served as initial confirmation that the two-year-old rover is within sight of 'Victoria Crater,' which it has been approaching for more than a year. Engineers on the rover team were unsure whether Opportunity would make it as far as Victoria, but scientists hoped for the chance to study such a large crater with their roving geologist. Victoria Crater is 800 meters (nearly half a mile) in diameter, about six times wider than 'Endurance Crater,' where Opportunity spent several months in 2004 examining rock layers affected by ancient water.

    When scientists using orbital data calculated that they should be able to detect Victoria's rim in rover images, they scrutinized frames taken in the direction of the crater by the panoramic camera. To positively characterize the subtle horizon profile of the crater and some of the features leading up to it, researchers created a vertically-stretched image (top) from a mosaic of regular frames from the panoramic camera (bottom), taken on Opportunity's 804th Martian day (April 29, 2006).

    The stretched image makes mild nearby dunes look like more threatening peaks, but that is only a result of the exaggerated vertical dimension. This vertical stretch technique was first applied to Viking Lander 2 panoramas by Philip Stooke, of the University of Western Ontario, Canada, to help locate the lander with respect to orbiter images. Vertically stretching the image allows features to be more readily identified by the Mars Exploration Rover science team.

    The bright white dot near the horizon to the right of center (barely visible without labeling or zoom-in) is thought to be a light-toned outcrop on the far wall of the crater, suggesting that the rover can see over the low rim of Victoria. In figure 1, the northeast and southeast rims are labeled

  18. γ Sulphate PNA (PNA S): highly selective DNA binding molecule showing promising antigene activity.


    Avitabile, Concetta; Moggio, Loredana; Malgieri, Gaetano; Capasso, Domenica; Di Gaetano, Sonia; Saviano, Michele; Pedone, Carlo; Romanelli, Alessandra


    Peptide Nucleic Acids (PNAs), nucleic acid analogues showing high stability to enzyme degradation and strong affinity and specificity of binding toward DNA and RNA are widely investigated as tools to interfere in gene expression. Several studies have been focused on PNA analogues with modifications on the backbone and bases in the attempt to overcome solubility, uptake and aggregation issues. γ PNAs, PNA derivatives having a substituent in the γ position of the backbone show interesting properties in terms of secondary structure and affinity of binding toward complementary nucleic acids. In this paper we illustrate our results obtained on new analogues, bearing a sulphate in the γ position of the backbone, developed to be more DNA-like in terms of polarity and charge. The synthesis of monomers and oligomers is described. NMR studies on the conformational properties of monomers and studies on the secondary structure of single strands and triplexes are reported. Furthermore the hybrid stability and the effect of mismatches on the stability have also been investigated. Finally, the ability of the new analogue to work as antigene, interfering with the transcription of the ErbB2 gene on a human cell line overexpressing ErbB2 (SKBR3), assessed by FACS and qPCR, is described.

  19. Conformational transitions of duplex and triplex nucleic acid helices: thermodynamic analysis of effects of salt concentration on stability using preferential interaction coefficients.

    PubMed Central

    Bond, J. P.; Anderson, C. F.; Record, M. T.


    For order-disorder transitions of double- and triple-stranded nucleic acid helices, the midpoint temperatures Tm depend strongly on a +/-, the mean ionic activity of uniunivalent salt. Experimental determinations of dTm/d ln a +/- and of the enthalpy change (delta H(o)) accompanying the transition in excess salt permit evaluation of delta gamma, the stoichiometrically weighted combination of preferential interaction coefficients, each of which reflects thermodynamic effects of interactions of salt ions with a reactant or product of the conformational transition (formula; see text) Here delta H(o) is defined per mole of nucleotide by analogy to delta gamma. Application of Eq. 1 to experimental values of delta H(o) and Tm yields values of delta gamma for the denaturation of B-DNA over the range of NaCl concentrations 0.01-0.20 M (Privalov et al. (1969), Biopolymers 8,559) and for each of four order-disorder transitions of poly rA.(poly rU)n, n = 1, 2 over the range of NaCl concentrations 0.01-1.0 M (Krakauer and Sturtevant (1968), Biopolymers 6, 491). For denaturation of duplexes and triplexes, delta gamma is negative and not significantly dependent on a +/-, but delta gamma is positive and dependent on a +/- for the disproportionation transition of poly rA.poly rU duplexes. Quantitative interpretations of these trends and magnitudes of delta gamma in terms of coulombic and excluded volume effects are obtained by fitting separately each of the two sets of thermodynamic data using Eq. 1 with delta gamma PB evaluated from the cylindrically symmetric Poisson-Boltzmann (PB) equation for a standard model of salt-polyelectrolyte solutions. The only structural parameters required by this model are: b, the mean axial distance between the projections of adjacent polyion charges onto the cylindrical axis; and a, the mean distance of closest approach between a salt ion center and the cylindrical axis. Fixing bMS and aMS for the multi-stranded (ordered) conformations, we

  20. Triplex in-situ hybridization

    SciTech Connect

    Fresco, Jacques R.; Johnson, Marion D.


    Disclosed are methods for detecting in situ the presence of a target sequence in a substantially double-stranded nucleic acid segment, which comprises: a) contacting in situ under conditions suitable for hybridization a substantially double-stranded nucleic acid segment with a detectable third strand, said third strand being capable of hybridizing to at least a portion of the target sequence to form a triple-stranded structure, if said target sequence is present; and b) detecting whether hybridization between the third strand and the target sequence has occured.

  1. 15. Detail showing lower chord pinconnected to vertical member, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Detail showing lower chord pin-connected to vertical member, showing floor beam riveted to extension of vertical member below pin-connection, and showing brackets supporting cantilevered sidewalk. View to southwest. - Selby Avenue Bridge, Spanning Short Line Railways track at Selby Avenue between Hamline & Snelling Avenues, Saint Paul, Ramsey County, MN

  2. Accumulation of RNA homologous to human papillomavirus type 16 open reading frames in genital precancers

    SciTech Connect

    Crum, C.P.; Nuovo, G.; Friedman, D.; Silverstein, S.J.


    The accumulation of human papillomavirus type 16 (HPV-16)-specific RNAs in tissue sections from biopsies of patients with genital precancers was studied by in situ hybridization with single-stranded /sup 35/S-labeled RNA. These analyses revealed that the most abundant early-region RNAs were derived from the E4 and E5 open reading frames (ORFs). RNAs homologous to the E6/E7 ORFs were also detected, whereas RNAs homologous to the intervening E1 ORF were not. This suggest that the E4 and E5 mRNAs are derived by splicing to the upstream E6/E7 ORFs, consistent with studies of HPV-11 in condylomata. Abundant RNAs homologous to the 5' portion of L1 were also detected. These RNAs were localized to the apical strata of the epithelium. HPV-16 RNAs accumulated in discrete regions of these lesions, and when present were most abundant in the upper cell layers of the precancerous epithelium. RNAs homologous to early ORFs were also detected in some germinal cells within the basal layer of the epithelium.

  3. Hey Teacher, Your Personality's Showing!

    ERIC Educational Resources Information Center

    Paulsen, James R.


    A study of 30 fourth, fifth, and sixth grade teachers and 300 of their students showed that a teacher's age, sex, and years of experience did not relate to students' mathematics achievement, but that more effective teachers showed greater "freedom from defensive behavior" than did less effective teachers. (DT)

  4. Planning a Successful Tech Show

    ERIC Educational Resources Information Center

    Nikirk, Martin


    Tech shows are a great way to introduce prospective students, parents, and local business and industry to a technology and engineering or career and technical education program. In addition to showcasing instructional programs, a tech show allows students to demonstrate their professionalism and skills, practice public presentations, and interact…

  5. Satellite Animation Shows California Storms

    NASA Video Gallery

    This animation of visible and infrared imagery from NOAA's GOES-West satellite shows a series of moisture-laden storms affecting California from Jan. 6 through Jan. 9, 2017. TRT: 00:36 Credit: NASA...

  6. Satellite Movie Shows Erika Dissipate

    NASA Video Gallery

    This animation of visible and infrared imagery from NOAA's GOES-West satellite from Aug. 27 to 29 shows Tropical Storm Erika move through the Eastern Caribbean Sea and dissipate near eastern Cuba. ...

  7. National Orange Show Photovoltaic Demonstration

    SciTech Connect

    Dan Jimenez Sheri Raborn, CPA; Tom Baker


    National Orange Show Photovoltaic Demonstration created a 400KW Photovoltaic self-generation plant at the National Orange Show Events Center (NOS). The NOS owns a 120-acre state fairground where it operates an events center and produces an annual citrus fair known as the Orange Show. The NOS governing board wanted to employ cost-saving programs for annual energy expenses. It is hoped the Photovoltaic program will result in overall savings for the NOS, help reduce the State's energy demands as relating to electrical power consumption, improve quality of life within the affected grid area as well as increase the energy efficiency of buildings at our venue. In addition, the potential to reduce operational expenses would have a tremendous effect on the ability of the NOS to service its community.

  8. Phyllodes tumor showing intraductal growth.


    Makidono, Akari; Tsunoda, Hiroko; Mori, Miki; Yagata, Hiroshi; Onoda, Yui; Kikuchi, Mari; Nozaki, Taiki; Saida, Yukihisa; Nakamura, Seigo; Suzuki, Koyu


    Phyllodes tumor of the breast is a rare fibroepithelial lesion and particularly uncommon in adolescent girls. It is thought to arise from the periductal rather than intralobular stroma. Usually, it is seen as a well-defined mass. Phyllodes tumor showing intraductal growth is extremely rare. Here we report a girl who has a phyllodes tumor with intraductal growth.

  9. Magic Carpet Shows Its Colors

    NASA Technical Reports Server (NTRS)


    The upper left image in this display is from the panoramic camera on the Mars Exploration Rover Spirit, showing the 'Magic Carpet' region near the rover at Gusev Crater, Mars, on Sol 7, the seventh martian day of its journey (Jan. 10, 2004). The lower image, also from the panoramic camera, is a monochrome (single filter) image of a rock in the 'Magic Carpet' area. Note that colored portions of the rock correlate with extracted spectra shown in the plot to the side. Four different types of materials are shown: the rock itself, the soil in front of the rock, some brighter soil on top of the rock, and some dust that has collected in small recesses on the rock face ('spots'). Each color on the spectra matches a line on the graph, showing how the panoramic camera's different colored filters are used to broadly assess the varying mineral compositions of martian rocks and soils.

  10. "Medicine show." Alice in Doctorland.



    This is an excerpt from the script of a 1939 play provided to the Institute of Social Medicine and Community Health by the Library of Congress Federal Theater Project Collection at George Mason University Library, Fairfax, Virginia, pages 2-1-8 thru 2-1-14. The Federal Theatre Project (FTP) was part of the New Deal program for the arts 1935-1939. Funded by the Works Progress Administration (WPA) its goal was to employ theater professionals from the relief rolls. A number of FTP plays deal with aspects of medicine and public health. Pageants, puppet shows and documentary plays celebrated progress in medical science while examining social controversies in medical services and the public health movement. "Medicine Show" sharply contrasts technological wonders with social backwardness. The play was rehearsed by the FTP but never opened because funding ended. A revised version ran on Broadway in 1940. The preceding comments are adapted from an excellent, well-illustrated review of five of these plays by Barabara Melosh: "The New Deal's Federal Theatre Project," Medical Heritage, Vol. 2, No. 1 (Jan/Feb 1986), pp. 36-47.

  11. "Show me" bioethics and politics.


    Christopher, Myra J


    Missouri, the "Show Me State," has become the epicenter of several important national public policy debates, including abortion rights, the right to choose and refuse medical treatment, and, most recently, early stem cell research. In this environment, the Center for Practical Bioethics (formerly, Midwest Bioethics Center) emerged and grew. The Center's role in these "cultural wars" is not to advocate for a particular position but to provide well researched and objective information, perspective, and advocacy for the ethical justification of policy positions; and to serve as a neutral convener and provider of a public forum for discussion. In this article, the Center's work on early stem cell research is a case study through which to argue that not only the Center, but also the field of bioethics has a critical role in the politics of public health policy.

  12. Phoenix Scoop Inverted Showing Rasp

    NASA Technical Reports Server (NTRS)


    This image taken by the Surface Stereo Imager on Sol 49, or the 49th Martian day of the mission (July 14, 2008), shows the silver colored rasp protruding from NASA's Phoenix Mars Lander's Robotic Arm scoop. The scoop is inverted and the rasp is pointing up.

    Shown with its forks pointing toward the ground is the thermal and electrical conductivity probe, at the lower right. The Robotic Arm Camera is pointed toward the ground.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is led by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  13. ShowMe3D

    SciTech Connect

    Sinclair, Michael B


    ShowMe3D is a data visualization graphical user interface specifically designed for use with hyperspectral image obtained from the Hyperspectral Confocal Microscope. The program allows the user to select and display any single image from a three dimensional hyperspectral image stack. By moving a slider control, the user can easily move between images of the stack. The user can zoom into any region of the image. The user can select any pixel or region from the displayed image and display the fluorescence spectrum associated with that pixel or region. The user can define up to 3 spectral filters to apply to the hyperspectral image and view the image as it would appear from a filter-based confocal microscope. The user can also obtain statistics such as intensity average and variance from selected regions.

  14. Casimir experiments showing saturation effects

    SciTech Connect

    Sernelius, Bo E.


    We address several different Casimir experiments where theory and experiment disagree. First out is the classical Casimir force measurement between two metal half spaces; here both in the form of the torsion pendulum experiment by Lamoreaux and in the form of the Casimir pressure measurement between a gold sphere and a gold plate as performed by Decca et al.; theory predicts a large negative thermal correction, absent in the high precision experiments. The third experiment is the measurement of the Casimir force between a metal plate and a laser irradiated semiconductor membrane as performed by Chen et al.; the change in force with laser intensity is larger than predicted by theory. The fourth experiment is the measurement of the Casimir force between an atom and a wall in the form of the measurement by Obrecht et al. of the change in oscillation frequency of a {sup 87}Rb Bose-Einstein condensate trapped to a fused silica wall; the change is smaller than predicted by theory. We show that saturation effects can explain the discrepancies between theory and experiment observed in all these cases.

  15. Mimas Showing False Colors #1

    NASA Technical Reports Server (NTRS)


    False color images of Saturn's moon, Mimas, reveal variation in either the composition or texture across its surface.

    During its approach to Mimas on Aug. 2, 2005, the Cassini spacecraft narrow-angle camera obtained multi-spectral views of the moon from a range of 228,000 kilometers (142,500 miles).

    The image at the left is a narrow angle clear-filter image, which was separately processed to enhance the contrast in brightness and sharpness of visible features. The image at the right is a color composite of narrow-angle ultraviolet, green, infrared and clear filter images, which have been specially processed to accentuate subtle changes in the spectral properties of Mimas' surface materials. To create this view, three color images (ultraviolet, green and infrared) were combined into a single black and white picture that isolates and maps regional color differences. This 'color map' was then superimposed over the clear-filter image at the left.

    The combination of color map and brightness image shows how the color differences across the Mimas surface materials are tied to geological features. Shades of blue and violet in the image at the right are used to identify surface materials that are bluer in color and have a weaker infrared brightness than average Mimas materials, which are represented by green.

    Herschel crater, a 140-kilometer-wide (88-mile) impact feature with a prominent central peak, is visible in the upper right of each image. The unusual bluer materials are seen to broadly surround Herschel crater. However, the bluer material is not uniformly distributed in and around the crater. Instead, it appears to be concentrated on the outside of the crater and more to the west than to the north or south. The origin of the color differences is not yet understood. It may represent ejecta material that was excavated from inside Mimas when the Herschel impact occurred. The bluer color of these materials may be caused by subtle differences in

  16. Enhancing analysis throughput, sensitivity and specificity in LC/ESI-MS/MS assay of plasma 25-hydroxyvitamin D3 by derivatization with triplex 4-(4-dimethylaminophenyl)-1,2,4-triazoline-3,5-dione (DAPTAD) isotopologues.


    Ogawa, Shoujiro; Kittaka, Hiroki; Nakata, Akiho; Komatsu, Kenji; Sugiura, Takahiro; Satoh, Mamoru; Nomura, Fumio; Higashi, Tatsuya


    The plasma/serum concentration of 25-hydroxyvitamin D3 [25(OH)D3] is a diagnostic index for vitamin D deficiency/insufficiency, which is associated with a wide range of diseases, such as rickets, cancer and diabetes. We have reported that the derivatization with 4-(4-dimethylaminophenyl)-1,2,4-triazoline-3,5-dione (DAPTAD) works well in the liquid chromatography/electrospray ionization-tandem mass spectrometry (LC/ESI-MS/MS) assay of the serum/plasma 25(OH)D3 for enhancing the sensitivity and the separation from a potent interfering metabolite, 3-epi-25-hydroxyvitamin D3 [3-epi-25(OH)D3]. However, enhancing the analysis throughput remains an issue in the LC/ESI-MS/MS assay of 25(OH)D3. The most obvious restriction of the LC/MS/MS throughput is the chromatographic run time. In this study, we developed an enhanced throughput method for the determination of the plasma 25(OH)D3 by LC/ESI-MS/MS combined with the derivatization using the triplex ((2)H0-, (2)H3- and (2)H6-) DAPTAD isotopologues. After separate derivatization with 1 of 3 different isotopologues, the 3 samples were combined and injected together into LC/ESI-MS/MS. Based on the mass differences between the isotopologues, the derivatized 25(OH)D3 in the 3 different samples were quantified within a single run. The developed method tripled the hourly analysis throughput without sacrificing assay performance, i.e., ease of pretreatment of plasma sample (only deproteinization), limit of quantification (1.0ng/mL when a 5μL-plasma was used), precision (intra-assay RSD≤5.9% and inter-assay RSD≤5.5%), accuracy (98.7-102.2%), matrix effects, and capability of separating from an interfering metabolite, 3-epi-25(OH)D3. The multiplexing of samples by the isotopologue derivatization was applied to the analysis of plasma samples of healthy subjects and the developed method was proven to have a satisfactory applicability.

  17. Triplex Forming Therapeutic Agents for Breast Cancer

    DTIC Science & Technology


    directed pur*pur:pyr triple helix. The relative binding of oligonucleotides containing different substitutions, including an abasic propanediol linker...substitution of the positively charged abasic propanediol linker results in approximately ten fold greater binding than cytosine substitution which in...while HR21Xap interacts weakly only at a distal site in the DHFR promoter. These results suggest that the propanediol linker is able to skip over

  18. Cellular RNA homologous to the Abelson murine leukemia virus transforming gene: expression and relationship to the viral sequence.

    PubMed Central

    Wang, J Y; Baltimore, D


    To examine the expression of the cellular homolog of the Abelson murine leukemia virus transforming gene (the v-abl sequence), a DNA probe representing the v-abl sequence was prepared. The probe detected two cytoplasmic polyadenylic acid-containing c-abl RNAs of about 6.5 and 5.5 kilobases in a variety of rodent cells, and slightly larger RNAs were detected in human cells. These two RNA species were found in all normal tissues or cell lines examined, but at differing concentrations: liver cells had the least, fibroblastic cell lines had the most. By using a probe able to detect the cellular but not the viral gene, the two RNAs were shown to be present in Abelson murine leukemia virus-transformed cells at levels found either in their untransformed counterparts or in similar cell types transformed by other means. The target cells of the virus have a somewhat elevated level of the two RNAs although expression of the c-abl gene is not restricted to these cells. The v-abl sequence lacks 0.35 and 0.85 kilobases of the c-abl RNA on the 5' and 3' ends, respectively. Thus, the Abelson murine leukemia virus transforming gene is an internal fragment of the transcript of a normal cellular gene. Images PMID:6306446

  19. The Physics of Equestrian Show Jumping

    ERIC Educational Resources Information Center

    Stinner, Art


    This article discusses the kinematics and dynamics of equestrian show jumping. For some time I have attended a series of show jumping events at Spruce Meadows, an international equestrian center near Calgary, Alberta, often referred to as the "Wimbledon of equestrian jumping." I have always had a desire to write an article such as this…

  20. Serving Up Activities for TV Cooking Shows.

    ERIC Educational Resources Information Center

    Katchen, Johanna E.

    This paper documents a presentation given on the use of English-language television cooking shows in English-as-a-Second-Language (ESL) and English-as-a-Foreign-Language (EFL) classrooms in Taiwan. Such shows can be ideal for classroom use, since they have a predictable structure consisting of short segments, are of interest to most students,…

  1. 47 CFR 90.505 - Showing required.

    Code of Federal Regulations, 2010 CFR


    ... MOBILE RADIO SERVICES Developmental Operation § 90.505 Showing required. (a) Except as provided in paragraph (b) of this section, each application for developmental operation shall be accompanied by a showing that: (1) The applicant has an organized plan of development leading to a specific objective;...

  2. The Language of Show Biz: A Dictionary.

    ERIC Educational Resources Information Center

    Sergel, Sherman Louis, Ed.

    This dictionary of the language of show biz provides the layman with definitions and essays on terms and expressions often used in show business. The overall pattern of selection was intended to be more rather than less inclusive, though radio, television, and film terms were deliberately omitted. Lengthy explanations are sometimes used to express…

  3. Gene Therapy Shows Promise for Aggressive Lymphoma


    ... fullstory_163824.html Gene Therapy Shows Promise for Aggressive Lymphoma Over one-third of patients appeared disease- ... 2017 (HealthDay News) -- An experimental gene therapy for aggressive non-Hodgkin lymphoma beat back more than a ...

  4. Poverty Harder on Women's Hearts, Research Shows


    ... page: Poverty Harder on Women's Hearts, Research Shows Poor females ... reduce the burden of cardiovascular disease around the world," Peters said. The study findings were published online ...

  5. Do dogs (Canis familiaris) show contagious yawning?


    Harr, Aimee L; Gilbert, Valerie R; Phillips, Kimberley A


    We report an experimental investigation into whether domesticated dogs display contagious yawning. Fifteen dogs were shown video clips of (1) humans and (2) dogs displaying yawns and open-mouth expressions (not yawns) to investigate whether dogs showed contagious yawning to either of these social stimuli. Only one dog performed significantly more yawns during or shortly after viewing yawning videos than to the open-mouth videos, and most of these yawns occurred to the human videos. No dogs showed significantly more yawning to the open-mouth videos (human or dog). The percentage of dogs showing contagious yawning was less than chimpanzees and humans showing this behavior, and considerably less than a recently published report investigating this behavior in dogs (Joly-Mascheroni et al. in Biol Lett 4:446-448, 2008).

  6. Spacecraft Image Mashup Shows Galactic Collision

    NASA Video Gallery

    This new composite image from the Chandra X-ray Observatory, the Hubble Space Telescope, and the Spitzer Space Telescope shows two colliding galaxies more than a 100 million years after they first ...

  7. Study Shows How Zika Attacks Infant Brain


    ... gov/news/fullstory_162514.html Study Shows How Zika Attacks Infant Brain Virus can copy itself thousands ... New research paints a chilling portrait of how Zika ravages the infant brain. Scientists from the U.S. ...

  8. Fecal Transplant Shows Early Promise Against Autism


    ... 163263.html Fecal Transplant Shows Early Promise Against Autism Small study found giving healthy gut bacteria to ... study suggests a novel treatment for kids with autism: Give these young patients a fresh supply of ...

  9. TRMM Satellite Shows Heavy Rainfall in Cristina

    NASA Video Gallery

    NASA's TRMM satellite rainfall data was overlaid on an enhanced visible/infrared image from NOAA's GOES-East satellite showing cloud and rainfall extent. Green areas indicate rainfall at over 20 mm...

  10. GOES Satellite Data Shows Tornado Development

    NASA Video Gallery

    This animation of NOAA's GOES-East satellite data shows the development and movement of the weather system that spawned tornadoes affecting the southern and eastern U.S. states on April 27-29, 2014...

  11. Educational Outreach: The Space Science Road Show

    NASA Astrophysics Data System (ADS)

    Cox, N. L. J.


    The poster presented will give an overview of a study towards a "Space Road Show". The topic of this show is space science. The target group is adolescents, aged 12 to 15, at Dutch high schools. The show and its accompanying experiments would be supported with suitable educational material. Science teachers at schools can decide for themselves if they want to use this material in advance, afterwards or not at all. The aims of this outreach effort are: to motivate students for space science and engineering, to help them understand the importance of (space) research, to give them a positive feeling about the possibilities offered by space and in the process give them useful knowledge on space basics. The show revolves around three main themes: applications, science and society. First the students will get some historical background on the importance of space/astronomy to civilization. Secondly they will learn more about novel uses of space. On the one hand they will learn of "Views on Earth" involving technologies like Remote Sensing (or Spying), Communication, Broadcasting, GPS and Telemedicine. On the other hand they will experience "Views on Space" illustrated by past, present and future space research missions, like the space exploration missions (Cassini/Huygens, Mars Express and Rosetta) and the astronomy missions (Soho and XMM). Meanwhile, the students will learn more about the technology of launchers and satellites needed to accomplish these space missions. Throughout the show and especially towards the end attention will be paid to the third theme "Why go to space"? Other reasons for people to get into space will be explored. An important question in this is the commercial (manned) exploration of space. Thus, the questions of benefit of space to society are integrated in the entire show. It raises some fundamental questions about the effects of space travel on our environment, poverty and other moral issues. The show attempts to connect scientific with

  12. Liquid Crystal Research Shows Deformation By Drying

    NASA Technical Reports Server (NTRS)


    These images, from David Weitz's liquid crystal research, show ordered uniform sized droplets (upper left) before they are dried from their solution. After the droplets are dried (upper right), they are viewed with crossed polarizers that show the deformation caused by drying, a process that orients the bipolar structure of the liquid crystal within the droplets. When an electric field is applied to the dried droplets (lower left), and then increased (lower right), the liquid crystal within the droplets switches its alignment, thereby reducing the amount of light that can be scattered by the droplets when a beam is shone through them.

  13. Show Them You Really Want the Job

    ERIC Educational Resources Information Center

    Perlmutter, David D.


    Showing that one really "wants" the job entails more than just really wanting the job. An interview is part Broadway casting call, part intellectual dating game, part personality test, and part, well, job interview. When there are 300 applicants for a position, many of them will "fit" the required (and even the preferred) skills listed in the job…


    ERIC Educational Resources Information Center



  15. Showing Enantiomorphous Crystals of Tartaric Acid

    ERIC Educational Resources Information Center

    Andrade-Gamboa, Julio


    Most of the articles and textbooks that show drawings of enantiomorphous crystals use an inadequate view to appreciate the fact that they are non-superimposable mirror images of one another. If a graphical presentation of crystal chirality is not evident, the main attribute of crystal enantiomorphism can not be recognized by students. The classic…

  16. Laser entertainment and light shows in education

    NASA Astrophysics Data System (ADS)

    Sabaratnam, Andrew T.; Symons, Charles


    Laser shows and beam effects have been a source of entertainment since its first public performance May 9, 1969, at Mills College in Oakland, California. Since 1997, the Photonics Center, NgeeAnn Polytechnic, Singapore, has been using laser shows as a teaching tool. Students are able to exhibit their creative skills and learn at the same time how lasers are used in the entertainment industry. Students will acquire a number of skills including handling three- phase power supply, operation of cooling system, and laser alignment. Students also acquire an appreciation of the arts, learning about shapes and contours as they develop graphics for the shows. After holography, laser show animation provides a combination of the arts and technology. This paper aims to briefly describe how a krypton-argon laser, galvanometer scanners, a polychromatic acousto-optic modulator and related electronics are put together to develop a laser projector. The paper also describes how students are trained to make their own laser animation and beam effects with music, and at the same time have an appreciation of the operation of a Class IV laser and the handling of optical components.

  17. 47 CFR 90.505 - Showing required.

    Code of Federal Regulations, 2012 CFR


    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Developmental Operation § 90.505 Showing required. (a) Except as provided in...) The actual transmission by radio is essential to proceed beyond the present stage of the program;...

  18. 47 CFR 90.505 - Showing required.

    Code of Federal Regulations, 2011 CFR


    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Developmental Operation § 90.505 Showing required. (a) Except as provided in...) The actual transmission by radio is essential to proceed beyond the present stage of the program;...

  19. Tilapia show immunization response against Ich

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  20. A Talk Show from the Past.

    ERIC Educational Resources Information Center

    Gallagher, Arlene F.


    Describes a two-day activity in which elementary students examine voting rights, the right to assemble, and women's suffrage. Explains the game, "Assemble, Reassemble," and a student-produced talk show with five students playing the roles of leaders of the women's suffrage movement. Profiles Elizabeth Cady Stanton, Lucretia Mott, Susan…

  1. State Data Show Gains in Reading

    ERIC Educational Resources Information Center

    Manzo, Kathleen Kennedy


    Schools taking part in the federal Reading First program are showing significant progress in boosting students' reading fluency and comprehension, according to state-reported data compiled and released by the U.S. Department of Education last week. In releasing for the first time detailed, multiyear data on how Reading First schools are performing…

  2. Human platelet sulfotransferase shows seasonal rhythms.


    Marazziti, D; Palego, L; Mazzanti, C; Silvestri, S; Cassano, G B


    Our study aimed to investigate the possible presence of seasonal changes in platelet phenolsulfotransferase (ST) in a group of 20 healthy, drug-free subjects of both sexes between 24 and 37 years of age. Blood samples were taken four times a year in the period immediately following the equinoxes and the solstices. The results showed that both Sts underwent seasonal changes: the lowest values were found in autumn and in winter, and the highest in the summer. A positive correlation between the two STs and the length of the photoperiod was observed in winter whereas in the spring we detected a negative correlation between the TL ST and the photoperiod length. Future studies should clarify whether platelet ST of patients with mood disorders shows a similar seasonality.

  3. Male genital leiomyomas showing androgen receptor expression.


    Suárez-Peñaranda, José Manuel; Vieites, Begoña; Evgenyeva, Elena; Vázquez-Veiga, Hugo; Forteza, Jeronimo


    Genital leiomyoma in men include those superficial leiomyomas arising in the scrotum and the areola. They are unusual neoplasms: few cases have been reported in the literature and they usually escape clinical diagnosis. Three cases of male genital leiomyomas are reported: two in the scrotum and one in the areola. They were all conservatively excised and the behaviour was completely benign in all cases. Histopathological examination showed the typical findings of superficial leiomyomas, with some minor differences between cases arising in the scrotum and those from the areola. Immunohistochemical findings not only confirmed the smooth muscle nature of all cases but also showed unequivocal immunostaining for androgen receptors in the leiomyomas from the scrotum. Immunostaining for androgen receptors in scrotal leiomyomas is, as far as we are aware, a previously unknown characteristic of male genital leiomyomas. This finding supports the role of steroid hormones in the growth of genital leiomyomas, similar to leiomyomas found in other locations.

  4. Kepler Systems That Show Multiple Transiting Objects

    NASA Astrophysics Data System (ADS)

    Steffen, Jason H.; Fabrycky, D. C.; Ford, E. B.; Holman, M. J.; Lissauer, J. J.; Ragozzine, D.; Welsh, W. F.; Kepler Science Team


    Exoplanetary systems that have multiple transiting planets provide unique and important insight into the formation, evolution, and dynamics of exoplanetary systems. Kepler has announced the discovery of a confirmed planetary system with multiple transiting planets (Kepler 9, Holman et al. 2010) as well as several candidate planetary systems that show multiple transiting objects (Steffen et al. 2010). Kepler 9 shows deviations from a constant period due to the ongoing dynamical interactions between the confirmed planets. From these transit timing variations (TTV) one can measure the planetary masses from the photometric data alone. The presence of several systems with multiple transiting candidates from the first quarter of data indicate that Kepler should continue to find systems with multiple transiting planets. Such systems will provide important, general information about the histories of planetary systems.

  5. Latest European coelacanth shows Gondwanan affinities.


    Cavin, Lionel; Forey, Peter L; Buffetaut, Eric; Tong, Haiyan


    The last European fossil occurrence of a coelacanth is from the Mid-Cretaceous of the English Chalk (Turonian, 90 million years ago). Here, we report the discovery of a coelacanth from Late Cretaceous non-marine rocks in southern France. It consists of a left angular bone showing structures that imply close phylogenetic affinities with some extinct Mawsoniidae. The closest relatives are otherwise known from Cretaceous continental deposits of southern continents and suggest that the dispersal of freshwater organisms from Africa to Europe occurred in the Late Cretaceous.

  6. Show Me the Invisible: Visualizing Hidden Content

    PubMed Central

    Geymayer, Thomas; Steinberger, Markus; Lex, Alexander; Streit, Marc; Schmalstieg, Dieter


    Content on computer screens is often inaccessible to users because it is hidden, e.g., occluded by other windows, outside the viewport, or overlooked. In search tasks, the efficient retrieval of sought content is important. Current software, however, only provides limited support to visualize hidden occurrences and rarely supports search synchronization crossing application boundaries. To remedy this situation, we introduce two novel visualization methods to guide users to hidden content. Our first method generates awareness for occluded or out-of-viewport content using see-through visualization. For content that is either outside the screen’s viewport or for data sources not opened at all, our second method shows off-screen indicators and an on-demand smart preview. To reduce the chances of overlooking content, we use visual links, i.e., visible edges, to connect the visible content or the visible representations of the hidden content. We show the validity of our methods in a user study, which demonstrates that our technique enables a faster localization of hidden content compared to traditional search functionality and thereby assists users in information retrieval tasks. PMID:25325078

  7. Surveys show support for green 'activities'.


    Baillie, Jonathan


    Two independently conducted surveys on sustainability - one into the 'views and values' of NHS 'leaders', and the other questioning the public about the importance of the 'green agenda' in the NHS, and their opinions on how the service might most effectively reduce its carbon footprint, form the basis of Sustainability in the NHS: Health Check 2012, a new NHS Sustainable Development Unit (NHS SDU) publication. As HEJ editor Jonathan Baillie reports, the new document also presents updated data on the 'size' of the carbon footprint of the NHS in England, showing that, although good work by a number of Trusts in the past two years has seen healthcare-generated carbon emissions start to 'level off', the biggest contributors have been the current health service spending review, and the increased national availability of renewable energy.

  8. Star Shows It Has The Right Stuff

    NASA Astrophysics Data System (ADS)


    Astronomers have used an observation by NASA's Chandra X-ray Observatory to make the best case yet that a star can be engulfed by its companion star and survive. This discovery will help astronomers better understand how closely coupled stars, and perhaps even stars and planets, evolve when one of the stars expands enormously in its red giant phase. The binary star system known as V471 Tauri comprises a white dwarf star (the primary) in a close orbit -- one thirtieth of the distance between Mercury and the Sun -- with a normal Sun-like star (the secondary). Chandra's data showed that the hot upper atmosphere of the secondary star has a deficit of carbon atoms relative to nitrogen atoms. "This deficit of carbon atoms is the first clear observational evidence that the normal star was engulfed by its companion in the past," according to Jeremy Drake of the Smithsonian Astrophysical Observatory in Cambridge, MA, who coauthored an article on V471 in The Astrophysical Journal Letters with Marek Sarna of the N. Copernicus Astronomical Center in Poland. The white dwarf star was once a star several times as massive as the Sun. Nuclear fusion reactions in the core of such a star convert carbon into nitrogen over a period of about a billion years. When the fuel in the core of the star is exhausted, the core collapses, triggering more energetic nuclear reactions that cause the star to expand and transform into a red giant before eventually collapsing to become a white dwarf. The carbon-poor material in the core of the red giant is mixed with outer part of the star, so its atmosphere shows a deficit of carbon, as compared with Sun-like stars. The X-ray spectra of a red giant star (top panel) and a Sun-like star (bottom panel) show the large difference in the peaks due to carbon atoms in the two stars. Theoretical calculations indicate that a red giant in a binary system can completely envelop its companion star and dramatically affect its evolution. During this common envelope

  9. Microbiological and environmental issues in show caves.


    Saiz-Jimenez, Cesareo


    Cultural tourism expanded in the last half of the twentieth century, and the interest of visitors has come to include caves containing archaeological remains. Some show caves attracted mass tourism, and economical interests prevailed over conservation, which led to a deterioration of the subterranean environment and the rock art. The presence and the role of microorganisms in caves is a topic that is often ignored in cave management. Knowledge of the colonisation patterns, the dispersion mechanisms, and the effect on human health and, when present, over rock art paintings of these microorganisms is of the utmost importance. In this review the most recent advances in the study of microorganisms in caves are presented, together with the environmental implications of the findings.

  10. Mesenchymal stem cells show radioresistance in vivo.


    Singh, Sarvpreet; Kloss, Frank R; Brunauer, Regina; Schimke, Magdalena; Jamnig, Angelika; Greiderer-Kleinlercher, Brigitte; Klima, Günter; Rentenberger, Julia; Auberger, Thomas; Hächl, Oliver; Rasse, Michael; Gassner, Robert; Lepperdinger, Günter


    Irradiation impacts on the viability and differentiation capacity of tissue-borne mesenchymal stem cells (MSC), which play a pivotal role in bone regeneration. As a consequence of radiotherapy, bones may develop osteoradionecrosis. When irradiating human bone-derived MSC in vitro with increasing doses, the cells' self-renewal capabilities were greatly reduced. Mitotically stalled cells were still capable of differentiating into osteoblasts and pre-adipocytes. As a large animal model comparable to the clinical situation, pig mandibles were subjected to fractionized radiation of 2 χ 9 Gy within 1 week. This treatment mimics that of a standardized clinical treatment regimen of head and neck cancer patients irradiated 30 χ 2 Gy. In the pig model, fractures which had been irradiated, showed delayed osseous healing. When isolating MSC at different time points post-irradiation, no significant changes regarding proliferation capacity and osteogenic differentiation potential became apparent. Therefore, pig mandibles were irradiated with a single dose of either 9 or 18 Gy in vivo, and MSC were isolated immediately afterwards. No significant differences between the untreated and 9 Gy irradiated bone with respect to proliferation and osteogenic differentiation were unveiled. Yet, cells isolated from 18 Gy irradiated specimens exhibited a reduced osteogenic differentiation capacity, and during the first 2 weeks proliferation rates were greatly diminished. Thereafter, cells recovered and showed normal proliferation behaviour. These findings imply that MSC can effectively cope with irradiation up to high doses in vivo. This finding should thus be implemented in future therapeutic concepts to protect regenerating tissue from radiation consequences.

  11. VLA Shows "Boiling" in Atmosphere of Betelgeuse

    NASA Astrophysics Data System (ADS)


    A team of astronomers says that observations with the National Science Foundation's Very Large Array (VLA) radio telescope show that a neighboring bloated star has giant convective plumes propelling gas from its surface (photosphere) up into the star's atmosphere. This new information contradicts long-held ideas that such stellar atmospheres are more uniform, and may resolve questions about how the star's atmosphere attains its enormous size as well as how dust and gas is driven away from the star. Jeremy Lim of the Academia Sinica Institute of Astronomy & Astrophysics in Taiwan; Chris Carilli, Anthony Beasley, and Ralph Marson of the National Radio Astronomy Observatory (NRAO) in Socorro, NM; and Stephen White of the University of Maryland studied the red-supergiant star Betelgeuse, about 430 light-years away in the constellation Orion. They reported their findings in the April 9 issue of the scientific journal Nature. "These radio-telescope images confirm that Betelgeuse -- already more than 600 times larger than our Sun -- has a dense atmosphere that extends to many times larger still than the star itself," said Lim. "The highest-resolution image shows the star's atmosphere to have a remarkably complex structure." "To our surprise," added White, "the images also show that most of the gas in the atmosphere is only about as hot as that on the surface. Previously, all of it was thought to be very much hotter." The astronomers used the VLA to make images of Betelgeuse at a variety of radio frequencies. The series of radio observations measured the temperature of the star's atmosphere at different heights. Previous observations with the Hubble Space Telescope (HST) at ultraviolet wavelengths showed that the star's atmosphere contains very hot gas at about twice the surface temperature. The VLA images showed that there also is lower-temperature gas throughout the atmosphere. This gas is near the surface temperature at low heights and decreases in temperature

  12. The earliest published electrocardiogram showing ventricular preexcitation.


    Von Knorre, Georg H


    When in 1930, Wolff, Parkinson, and White published what is today known as the WPW, or preexcitation syndrome, they, and subsequently others, found few comparable cases in the preceding literature. Among these the report of Cohn and Fraser, published in 1913, was the earliest. However, another even earlier documentation in a 1909 article by Hoffmann escaped notice till now. The ECG of a patient with paroxysmal tachycardia reveals a short PR interval and a delta-wave-induced widening of the QRS complex, even though the reproduced tachycardia was not preexcitation related. The interpretation of this poorly reproduced ECG can be confirmed by another and more detailed description of the patient in an electrocardiography textbook published in 1914 by the same author. Thus, the earliest publication of an ECG showing ventricular preexcitation now can be dated back to 1909. Moreover, the Hoffmann monograph contains two additional examples of the WPW syndrome not noticed until now. All three cases published by Hoffmann had their first ECG recordings in 1912 or earlier.

  13. NASA GIBS Use in Live Planetarium Shows

    NASA Astrophysics Data System (ADS)

    Emmart, C. B.


    The American Museum of Natural History's Hayden Planetarium was rebuilt in year 2000 as an immersive theater for scientific data visualization to show the universe in context to our planet. Specific astrophysical movie productions provide the main daily programming, but interactive control software, developed at AMNH allows immersive presentation within a data aggregation of astronomical catalogs called the Digital Universe 3D Atlas. Since 2006, WMS globe browsing capabilities have been built into a software development collaboration with Sweden's Linkoping University (LiU). The resulting Uniview software, now a product of the company SCISS, is operated by about fifty planetariums around that world with ability to network amongst the sites for global presentations. Public presentation of NASA GIBS has allowed authoritative narratives to be presented within the range of data available in context to other sources such as Science on a Sphere, NASA Earth Observatory and Google Earth KML resources. Specifically, the NOAA supported World Views Network conducted a series of presentations across the US that focused on local ecological issues that could then be expanded in the course of presentation to national and global scales of examination. NASA support of for GIBS resources in an easy access multi scale streaming format like WMS has tremendously enabled particularly facile presentations of global monitoring like never before. Global networking of theaters for distributed presentations broadens out the potential for impact of this medium. Archiving and refinement of these presentations has already begun to inform new types of documentary productions that examine pertinent, global interdependency topics.

  14. Tetrahydrobiopterin shows chaperone activity for tyrosine hydroxylase.


    Thöny, Beat; Calvo, Ana C; Scherer, Tanja; Svebak, Randi M; Haavik, Jan; Blau, Nenad; Martinez, Aurora


    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in the synthesis of catecholamine neurotransmitters. Primary inherited defects in TH have been associated with l-DOPA responsive and non-responsive dystonia and infantile parkinsonism. In this study, we show that both the cofactor (6R)-l-erythro-5,6,7,8-tetrahydrobiopterin (BH(4)) and the feedback inhibitor and catecholamine product dopamine increase the kinetic stability of human TH isoform 1 in vitro. Activity measurements and synthesis of the enzyme by in vitro transcription-translation revealed a complex regulation by the cofactor including both enzyme inactivation and conformational stabilization. Oral BH(4) supplementation to mice increased TH activity and protein levels in brain extracts, while the Th-mRNA level was not affected. All together our results indicate that the molecular mechanisms for the stabilization are a primary folding-aid effect of BH(4) and a secondary effect by increased synthesis and binding of catecholamine ligands. Our results also establish that orally administered BH(4) crosses the blood-brain barrier and therapeutic regimes based on BH(4) supplementation should thus consider the effect on TH. Furthermore, BH(4) supplementation arises as a putative therapeutic agent in the treatment of brain disorders associated with TH misfolding, such as for the human TH isoform 1 mutation L205P.

  15. Temperature Data Shows Warming in 2001

    NASA Technical Reports Server (NTRS)


    TThe figure above depicts how much air temperatures near the Earth's surface changed relative to the global mean temperature from 1951 to 1980. NASA researchers used maps of urban areas derived from city lights data to account for the 'heat island' effect of cities. The red and orange colors show that temperatures are warmer in most regions of the world when compared to the 1951 to 1980 'normal' temperatures. Warming around the world has been widespread, but it is not present everywhere. The largest warming is in Northern Canada, Alaska and Siberia, as indicated by the deeper red colors. The lower 48 United States have become warmer recently, but only enough to make the temperatures comparable to what they were in the 1930s. The scale on the bottom of these temperature anomaly images represent degrees in Celsius. The negative numbers represent cooling and the positive numbers depict warming. Overall, the air temperature near the Earth's surface has warmed by 1oF (0.6oC) globally, on average, over the last century. For more information and additional images, read Satellites Shed Light on a Warmer World. Image courtesy Goddard Institute for Space Studies (GISS).

  16. First K2 mutiplanatary system showing TTVs

    NASA Astrophysics Data System (ADS)

    Barros, Susana C. C.


    In traditional transit timing variations (TTVs) analysis of multi-planetary systems, the individual TTVs are first derived from transit fitting and later modeled using n-body dynamic simulations to constrain planetary masses.I will show that fitting simultaneously the transit light curves with the system dynamics (photo-dynamical model) increases the precision of the TTV measurements and helps constrain the system architecture. I will exemplify the advantages of applying this photo-dynamical model to a multi-planetary system found in K2 data very close to 3:2 mean motion resonance. In this case the period of the larger TTV variations (libration period) is much longer (~1.5 years) than the duration of the K2 observations (~80 days). However, our method allows to detect the short period TTVs produced by the orbital conjunctions between the planets that in turn permits to uniquely characterize the system. Therefore, our method can be used to constrain the masses of near-resonant systems even when the full libration curve is not observed and hence will help understanding evolution of these interesting systems.

  17. Ancient bacteria show evidence of DNA repair

    PubMed Central

    Johnson, Sarah Stewart; Hebsgaard, Martin B.; Christensen, Torben R.; Mastepanov, Mikhail; Nielsen, Rasmus; Munch, Kasper; Brand, Tina; Gilbert, M. Thomas P.; Zuber, Maria T.; Bunce, Michael; Rønn, Regin; Gilichinsky, David; Froese, Duane; Willerslev, Eske


    Recent claims of cultivable ancient bacteria within sealed environments highlight our limited understanding of the mechanisms behind long-term cell survival. It remains unclear how dormancy, a favored explanation for extended cellular persistence, can cope with spontaneous genomic decay over geological timescales. There has been no direct evidence in ancient microbes for the most likely mechanism, active DNA repair, or for the metabolic activity necessary to sustain it. In this paper, we couple PCR and enzymatic treatment of DNA with direct respiration measurements to investigate long-term survival of bacteria sealed in frozen conditions for up to one million years. Our results show evidence of bacterial survival in samples up to half a million years in age, making this the oldest independently authenticated DNA to date obtained from viable cells. Additionally, we find strong evidence that this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability. PMID:17728401

  18. AD-1 multiple exposure showing wing sweep

    NASA Technical Reports Server (NTRS)


    This photograph is a multiple exposure showing the AD-1 aircraft with its wing swept at different angles between zero and 60 degrees. The Ames-Dryden-1 (AD-1) aircraft was designed to investigate the concept of an oblique (pivoting) wing. The wing could be rotated on its center pivot, so that it could be set at its most efficient angle for the speed at which the aircraft was flying. NASA Ames Research Center Aeronautical Engineer Robert T. Jones conceived the idea of an oblique wing. His wind tunnel studies at Ames (Moffett Field, CA) indicated that an oblique wing design on a supersonic transport might achieve twice the fuel economy of an aircraft with conventional wings. The oblique wing on the AD-1 pivoted about the fuselage, remaining perpendicular to it during slow flight and rotating to angles of up to 60 degrees as aircraft speed increased. Analytical and wind tunnel studiesthat Jones conducted at Ames indicated that a transport-sized oblique-wing aircraft flying at speeds of up to Mach 1.4 (1.4 times the speed of sound) would have substantially better aerodynamic performance than aircraft with conventional wings. The AD-1 structure allowed the project to complete all of its technical objectives. The type of low-speed, low-cost vehicle - as expected - exhibited aeroelastic and pitch-roll-coupling effects that contributed to poor handling at sweep angles above 45 degrees. The fiberglass structure limited the wing stiffness that would have improved the handling qualities. Thus, after completion of the AD-1 project, there was still a need for a transonic oblique-wing research aircraft to assess the effects of compressibility, evaluate a more representative structure, and analyze flight performance at transonic speeds (those on either side of the speed of sound). The aircraft was delivered to the Dryden Flight Research Center, Edwards, CA, in March 1979 and its first flight was on December 21, 1979. Piloting the aircraft on that flight, as well as on its last

  19. Mercury's Core Molten, Radar Study Shows

    NASA Astrophysics Data System (ADS)


    100 times, and showed that Mercury's spin axis is almost, but not exactly, perpendicular to the plane of its rotation around the Sun," Margot said. Margot worked with Stanton Peale of the University of California, Santa Barbara, Raymond Jurgens and Martin Slade of NASA's Jet Propulsion Laboratory, and Igor Holin of the Space Research Institute in Moscow. The National Radio Astronomy Observatory is a facility of the National Science Foundation, operated under cooperative agreement by Associated Universities, Inc. The Arecibo Observatory is part of the National Astronomy and Ionosphere Center, which is operated by Cornell University under a cooperative agreement with the NSF. Part of this work was supported by the Jet Propulsion Laboratory, operated by Caltech under contract with NASA.

  20. Showing and Telling Farming: Agricultural Shows and Re-Imaging British Agriculture

    ERIC Educational Resources Information Center

    Holloway, Lewis


    Some actors in the ''mainstream'' agricultural sector are beginning to engage in strategies of influencing public perceptions of farming, responding to public anxieties over industrialised agriculture and to a supposed separation of non-farming publics from food production. This paper focuses on agricultural shows as sites and events central to…

  1. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.


    Mohan, Vijee; Gupta, Soni; Thomas, Sherinmol; Mickey, Hanjabam; Charakana, Chaitanya; Chauhan, Vineeta Singh; Sharma, Kapil; Kumar, Rakesh; Tyagi, Kamal; Sarma, Supriya; Gupta, Suresh Kumar; Kilambi, Himabindu Vasuki; Nongmaithem, Sapana; Kumari, Alka; Gupta, Prateek; Sreelakshmi, Yellamaraju; Sharma, Rameshwar


    Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS), carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1) involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  2. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity

    PubMed Central

    Mohan, Vijee; Gupta, Soni; Thomas, Sherinmol; Mickey, Hanjabam; Charakana, Chaitanya; Chauhan, Vineeta Singh; Sharma, Kapil; Kumar, Rakesh; Tyagi, Kamal; Sarma, Supriya; Gupta, Suresh Kumar; Kilambi, Himabindu Vasuki; Nongmaithem, Sapana; Kumari, Alka; Gupta, Prateek; Sreelakshmi, Yellamaraju; Sharma, Rameshwar


    Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS), carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1) involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima’D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future. PMID:27077652

  3. Identification and molecular structure analysis of a new noncoding RNA, a sbRNA homolog, in the silkworm Bombyx mori genome.


    Duarte Junior, Francisco Ferreira; de Lima Neto, Quirino Alves; Rando, Fabiana Dos Santos; de Freitas, Douglas Vinícius Bassalobre; Pattaro Júnior, José Renato; Polizelli, Lorena Gomes; Munhoz, Roxelle Ethienne Ferreira; Seixas, Flavio Augusto Vicente; Fernandez, Maria Aparecida


    The small noncoding group of RNAs called stem-bulge RNAs (sbRNAs), first reported in Caenorhabditis elegans, is described as molecules homologous to the Y RNAs, a specific class of noncoding RNAs that is present in vertebrates. This homology indicates the possibility of the existence of sbRNAs in other invertebrate organisms. In this work, we used bioinformatic tools and conserved sequences of sbRNAs from C. Elegans and Y RNAs to search for homologous sbRNA sequences in the Bombyx mori genome. This analysis led to the discovery of one noncoding gene, which was translated into RNA segments and comparatively analysed with segments from human and hamster Y RNAs and C. elegans sbRNAs in molecular dynamic simulations. This gene represents the first evidence for a new sbRNA-like noncoding RNA, the BmsbRNA gene, in this Lepidoptera genome.

  4. RNAi-mediated Mortality of the Whitefly through Transgenic Expression of Double-stranded RNA Homologous to Acetylcholinesterase and Ecdysone Receptor in Tobacco Plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  5. site plan, floor plan, southeast and east elevations, detail showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    site plan, floor plan, southeast and east elevations, detail showing original front entrance, interior detail showing fireplace in elevation - Neiman House, 1930 Providence Road, Charlotte, Mecklenburg County, NC

  6. 42 CFR 456.655 - Validation of showings.

    Code of Federal Regulations, 2010 CFR


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Validation of showings. 456.655 Section 456.655... Showing of an Effective Institutional Utilization Control Program § 456.655 Validation of showings. (a) The Administrator will periodically validate showings submitted under § 456.654. Validation...

  7. 42 CFR 456.655 - Validation of showings.

    Code of Federal Regulations, 2011 CFR


    ... 42 Public Health 4 2011-10-01 2011-10-01 false Validation of showings. 456.655 Section 456.655... Showing of an Effective Institutional Utilization Control Program § 456.655 Validation of showings. (a) The Administrator will periodically validate showings submitted under § 456.654. Validation...

  8. TRMM Satellite Shows Bertha's Heavy Rain Pushed From Wind Shear

    NASA Video Gallery

    TRMM Satellite Shows Bertha's Heavy Rain Pushed From Wind Shear This 3-D flyby of Tropical Storm Bertha on Aug. 1 was created from TRMM satellite data. It shows (from the south) intense thunderstor...


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. AERIAL VIEW, LOOKING NORTH, SHOWING COVERED BARGE (VESSEL 37) IN CENTER OF PICTURE WITH FOUR HATCHES SHOWING IN SUPERSTRUCTURE Charles Wisniewski, photographer, January 1985 - Shooters Island, Ships Graveyard, Vessel No. 37, Newark Bay, Staten Island (subdivision), Richmond County, NY


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  13. 94. View looking south showing foundation equipment at work on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    94. View looking south showing foundation equipment at work on two of the piers. The view also shows the two completed cylinders in the midstream cluster of four. - Carquinez Bridge, Spanning Carquinez Strait at Interstate 80, Vallejo, Solano County, CA

  14. 21 CFR 1314.150 - Order To show cause.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Order To show cause. 1314.150 Section 1314.150 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE RETAIL SALE OF SCHEDULED LISTED CHEMICAL PRODUCTS Order to Show Cause § 1314.150 Order To show cause. (a) If, upon information gathered...


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. MEMBER 'A' SHOWS TENON AS USED IN POST 'A' (TN-159A-19), MEMBER 'B' IS BEAM 'B' IN TN-159A-19 AND SHOWS METHOD OF JOINING THESE MEMBERS. MEMBER 'C' SHOWS MORTISE IN BEAM 'B'. - Caleb Crosby Threshing Barn, Noeton (moved to Norris Dam State Park, Lake City), Morristown, Hamblen County, TN

  16. 56. View looking east. Detail showing an end of three ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. View looking east. Detail showing an end of three crib side walls, being flown by the derrick. The upper part of the fourth member, marked with an identifying tag, shows evidence of burning. Notice how well the lower members fit together. This view shows that individual timber members were worked, in part, after assembly. - Wabash & Erie Canal, Lock No. 2, 8 miles east of Fort Wayne, adjacent to U.S. Route 24, New Haven, Allen County, IN

  17. 52. View from ground level showing lower radar scanner switch ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. View from ground level showing lower radar scanner switch with open port door in radar scanner building 105 showing emanating waveguides from lower switch in vertical run; photograph also shows catwalk to upper scanner switch in upper left side of photograph and structural supports. - Clear Air Force Station, Ballistic Missile Early Warning System Site II, One mile west of mile marker 293.5 on Parks Highway, 5 miles southwest of Anderson, Anderson, Denali Borough, AK


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    26. VIEW, LOOKING NORTHWEST INSIDE TRANSFORMER ROOM, SHOWING OIL- FILLED TRANSFORMER POTS - Sacramento River Bridge, Spanning Sacramento River at California State Highway 275, Sacramento, Sacramento County, CA

  19. 4. View facing southwest showing the Silvertop Diner, Providence Fruit ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. View facing southwest showing the Silvertop Diner, Providence Fruit & Produce Building, and Merchants' Cold Storage Warehouse. - Provisions Warehouse Historic District, Kinsley & Harris Avenues, Providence, Providence County, RI

  20. 29. Detail view north showing amperage and voltage meters, operator's ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. Detail view north showing amperage and voltage meters, operator's room, west operator's house. - Yellow Mill Bridge, Spanning Yellow Mill Channel at Stratford Avenue, Bridgeport, Fairfield County, CT

  1. 11. Exterior detail view of northeast corner, showing stucco finish ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Exterior detail view of northeast corner, showing stucco finish and woodwork details - American Railway Express Company Freight Building, 1060 Northeast Division Street, Bend, Deschutes County, OR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    EAST AND NORTH SIDES OF BLOWER HOUSE SHOWING POWER WHEELS AND RACEWAY, LOOKING SOUTH. - Tannehill Furnace, 12632 Confederate Parkway, Tannehill Historical State Park, Bucksville, Tuscaloosa County, AL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW LOOKING NORTHEAST, SHOWING SORTING AND SHIPPING SHED WITH SAWMILL BEHIND - Ichabod T. Williams & Sons Sawmill & Veneer Plant, Roosevelt Avenue at Carteret Avenue, Carteret, Middlesex County, NJ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. VIEW, LOOKING SOUTHWEST INSIDE TRANSFORMER ROOM, SHOWING TRANSFORMERS AND KNIFE SWITCHES - Sacramento River Bridge, Spanning Sacramento River at California State Highway 275, Sacramento, Sacramento County, CA

  5. Contextual view showing northeastern eucalyptus windbreak and portion of citrus ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Contextual view showing northeastern eucalyptus windbreak and portion of citrus orchard. Camera facing 118" east-southeast. - Goerlitz House, 9893 Highland Avenue, Rancho Cucamonga, San Bernardino County, CA

  6. 14. View showing detail of truss (unidentified). Drawing courtesy Engineering ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View showing detail of truss (unidentified). Drawing courtesy Engineering Department, City of Cleveland. - Superior Avenue Viaduct, Cleveland East & West side, Cuyahoga Valley Vicinity, Cleveland, Cuyahoga County, OH


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. PERSPECTIVE VIEW OF MAIN AND EAST ELEVATIONS, SHOWING VIEW TOWARD CARPENTER'S HALL - Carpenters' Company, Front Store, 322 Chestnut Street & Carpenters' Court, Philadelphia, Philadelphia County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    54. VIEW SHOWING THE PLACEMENT OF SPIDER WEB BRACING, SHOOFLY BRIDGE, January 1935 - Sacramento River Bridge, Spanning Sacramento River at California State Highway 275, Sacramento, Sacramento County, CA

  9. 246. View showing the curvilinear alignment of the parkway on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    246. View showing the curvilinear alignment of the parkway on a ridge. Looking northeast. - Blue Ridge Parkway, Between Shenandoah National Park & Great Smoky Mountains, Asheville, Buncombe County, NC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. VIEW, LOOKING NORTHEAST, SHOWING BRIDGE COUNTERWEIGHT - New York, New Haven & Hartford Railroad, Niantic Bridge, Spanning Niantic River between East Lyme & Waterford, Old Lyme, New London County, CT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. GENERAL VIEW FROM SOUTH SHOWING SOUTHWEST AND SOUTHEAST SIDES AND CLERESTORY ARRANGEMENT - Sulphur Springs Methodist Campground, Sulphur Springs Road (Sulphur Springs), Sulphur Springs, Washington County, TN

  12. New rain shed (Building No. 241) interior showing posts, braces, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    New rain shed (Building No. 241) interior showing posts, braces, and roof structure. - Hawaii Volcanoes National Park Water Collection System, Hawaii Volcanoes National Park, Volcano, Hawaii County, HI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. VIEW INTO BLOCK AREA SHOWING KEY MECHANISM, NOTE FLOOR SEPARATION AT THRESHOLD AND KEY-WINDING MECHANISM - Montgomery County Jail, Washington & Spring Streets, Crawfordsville, Montgomery County, IN

  14. 1. Aerial view, looking northeast up Newark Bay, showing entire ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Aerial view, looking northeast up Newark Bay, showing entire island Charles Wisniewski, photographer, January 1985 - Shooters Island, Ships Graveyard, Newark Bay, Staten Island (subdivision), Richmond County, NY


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PERSPECTIVE VIEW SHOWING SOUTH SIDE OF BUILDING, LOOKING WEST-NORTHWEST DOWN HARRISON AVENUE - Pearce Manufacturing Company, Factory A, Harrison Avenue West at Wilkens, Latrobe, Westmoreland County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  17. Interior view, detail of the staircase to show the burnished ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, detail of the staircase to show the burnished aluminum and brass balustrade - Departmental Auditorium, Constitution Avenue between Twelfth and Fourteenth Streets, Washington, District of Columbia, DC

  18. 7. Photocopy of photograph (from Broome County Historical Society) showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. Photocopy of photograph (from Broome County Historical Society) showing SWIMMERS, PHOTOGRAPH TAKEN FACING NORTHEAST - Charles F. Johnson Pool, Charles F. Johnson Park, Johnson City, Broome County, NY


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. GENERAL VIEW, SECOND FLOOR, SHOWING TYPICAL WINDOW TRIM AND THE PRESSED METAL CEILING, VIEW FROM SOUTHWEST. - 443 Seventh Street, Northwest (Commercial Building), Washington, District of Columbia, DC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW SHOWING SALT RIVER PROJECT CREWS SLIPFORMING LATERAL DURING REHABILITATION AND BETTERMENT PROGRAM Photographer: unknown. April 1968 - Arizona Canal, North of Salt River, Phoenix, Maricopa County, AZ

  1. 1. Southeast elevation of Oil House showing loading platform. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Southeast elevation of Oil House showing loading platform. - Delaware, Lackawanna & Western Railroad, Scranton Yards, Oil House, 650 feet Southeast of Cliff & Mechanic Streets, Scranton, Lackawanna County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    24. CONSTRUCTION PROGRESS VIEW TO NORTHWEST, SHOWING BLOWER BUILDING. INEEL PHOTO NUMBER NRTS-60-4407. - Idaho National Engineering Laboratory, Old Waste Calcining Facility, Scoville, Butte County, ID

  3. Detail view of upper southwest corner, showing representative view of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail view of upper southwest corner, showing representative view of cornice and window ornamentation - Hungarian Sick Benefit Societies Building, 1406-1418 State Street, Bridgeport, Fairfield County, CT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. FOURTH FLOOR ROASTING ROOM, SHOWING CLERESTORY. VIEW TO SOUTH. - Commercial & Industrial Buildings, McFadden Coffee & Spice Company, Factory & Warehouse, 145 First Street, Dubuque, Dubuque County, IA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. TRANSMISSION GEARING SHOWING RELATION TO SEGMENT GEAR ON WATERWHEEL william E. Barrett, photographer, 1973 (copy negative) - Thomas Shepherd's Grist Mill, High Street Vicinity, Shepherdstown, Jefferson County, WV


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. VIEW SOUTH SHOWING NORTHEAST ELEVATION; BRICK CORBELLING, BUTTRESSES AND ART DECO STAINED GLASS - Poletown Historic District, St. Michael's Greek Catholic Church, 2390 East Grand Boulevard, Detroit, MI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. SOUTHEAST ABUTMENT AT CALVERT STREET, SHOWING LEON HERMANT ALLEGORICAL RELIEF OF TRANSPORTATION BY AUTOMOBILE - Calvert Street Bridge, Spanning Rock Creek & Potomac Parkway, Washington, District of Columbia, DC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    25. DETAIL SHOWING BRAKING MECHANISM FOR TRAIN, NOTE HOT RAIL ON LEFT - Jefferson National Expansion Memorial Arch, Mississippi River between Washington & Poplar Streets, Saint Louis, Independent City, MO

  9. 3. Photocopy of 1932 photograph showing another general view of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Photocopy of 1932 photograph showing another general view of the mansion, looking northwest. Original photograph at the Philadelphia Museum of Art. - Strawberry Mansion, Philadelphia, Philadelphia County, PA

  10. 13. Detail showing canopy at southeast corner; note single column ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. Detail showing canopy at southeast corner; note single column supporting structure - Fort Hood, World War II Temporary Buildings, Cold Storage Building, Seventeenth Street, Killeen, Bell County, TX

  11. Time dependent patient no-show predictive modelling development.


    Huang, Yu-Li; Hanauer, David A


    Purpose - The purpose of this paper is to develop evident-based predictive no-show models considering patients' each past appointment status, a time-dependent component, as an independent predictor to improve predictability. Design/methodology/approach - A ten-year retrospective data set was extracted from a pediatric clinic. It consisted of 7,291 distinct patients who had at least two visits along with their appointment characteristics, patient demographics, and insurance information. Logistic regression was adopted to develop no-show models using two-thirds of the data for training and the remaining data for validation. The no-show threshold was then determined based on minimizing the misclassification of show/no-show assignments. There were a total of 26 predictive model developed based on the number of available past appointments. Simulation was employed to test the effective of each model on costs of patient wait time, physician idle time, and overtime. Findings - The results demonstrated the misclassification rate and the area under the curve of the receiver operating characteristic gradually improved as more appointment history was included until around the 20th predictive model. The overbooking method with no-show predictive models suggested incorporating up to the 16th model and outperformed other overbooking methods by as much as 9.4 per cent in the cost per patient while allowing two additional patients in a clinic day. Research limitations/implications - The challenge now is to actually implement the no-show predictive model systematically to further demonstrate its robustness and simplicity in various scheduling systems. Originality/value - This paper provides examples of how to build the no-show predictive models with time-dependent components to improve the overbooking policy. Accurately identifying scheduled patients' show/no-show status allows clinics to proactively schedule patients to reduce the negative impact of patient no-shows.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. DETAIL VIEW SHOWING WOODEN CRIBBING WITH LOWERED LAKE LEVEL, EAST DAM, LOOKING NORTHEAST (View is middle of the perimeter showing in MT-88-A-1 above.) - Three Bears Lake & Dams, East Dam, North of Marias Pass, East Glacier Park, Glacier County, MT

  14. 47 CFR 101.411 - Supplementary showing required.

    Code of Federal Regulations, 2012 CFR


    ... 47 Telecommunication 5 2012-10-01 2012-10-01 false Supplementary showing required. 101.411 Section 101.411 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Developmental Authorizations § 101.411 Supplementary showing required....

  15. Cross Section; Half Longitudinal Section Showing Middle Wall Reinforced with ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Cross Section; Half Longitudinal Section Showing Middle Wall Reinforced with Arch; Part Long Section Showing Inside of External Side Wall; East Entrance; Part Side South External; Part Reflected Plan of Soffite of Floor; Part Reflected Plan of Soffite of Roof - Blenheim Covered Bridge, Spanning Schoharie River, North Blenheim, Schoharie County, NY

  16. Showing and Telling: The Difference That Makes a Difference.

    ERIC Educational Resources Information Center

    Lewis, David


    Attempts to clarify an essential difference between the ways in which pictures and words convey meaning. Examines one attempt to differentiate and characterize various types of picture books and concludes by showing how Anthony Browne exploits the distinction between showing and telling to create the atmosphere of uncertainty and mystery in his…

  17. 47 CFR 73.33 - Antenna systems; showing required.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Antenna systems; showing required. 73.33... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.33 Antenna systems; showing required. (a) An application for authority to install a broadcast antenna shall specify a definite site and include...

  18. 47 CFR 73.33 - Antenna systems; showing required.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Antenna systems; showing required. 73.33... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.33 Antenna systems; showing required. (a) An application for authority to install a broadcast antenna shall specify a definite site and include...

  19. 47 CFR 73.33 - Antenna systems; showing required.

    Code of Federal Regulations, 2014 CFR


    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false Antenna systems; showing required. 73.33... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.33 Antenna systems; showing required. (a) An application for authority to install a broadcast antenna shall specify a definite site and include...

  20. 47 CFR 73.33 - Antenna systems; showing required.

    Code of Federal Regulations, 2013 CFR


    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false Antenna systems; showing required. 73.33... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.33 Antenna systems; showing required. (a) An application for authority to install a broadcast antenna shall specify a definite site and include...

  1. 47 CFR 73.33 - Antenna systems; showing required.

    Code of Federal Regulations, 2012 CFR


    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false Antenna systems; showing required. 73.33... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.33 Antenna systems; showing required. (a) An application for authority to install a broadcast antenna shall specify a definite site and include...

  2. 31. Photographic copy of drawing showing profile of bridge after ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Photographic copy of drawing showing profile of bridge after the 1888-1889 and 1899-1900 reconstructions; also shows profile of bridge before 1888 (Martin Sigvart Grytbak, Wabasha St. Bridge, Formerly St. Paul Bridge, 1919); profile of Wabasha street bridge - Wabasha Street Bridge, Spanning Mississippi River at Wabasha Street, Saint Paul, Ramsey County, MN


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  4. 77 FR 1513 - Air Show and Air Races; Public Hearing

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office NATIONAL TRANSPORTATION SAFETY BOARD Air Show and Air Races; Public Hearing TIME AND DATE: 9 a.m., Tuesday, January 10, 2012... hearing is to examine current regulations and oversight practices for air shows and air races,...

  5. TV shows on Light Pollution Education for the Public

    NASA Astrophysics Data System (ADS)

    Grigore, Valentin


    TV shows have the biggest impact for the public, so we can use them to inform and educate the public about light pollution and the importance of the dark sky for humanity and for the contemporary society. Some examples used in the TV show Us and the Sky at Columna TV, Romania, are presented.

  6. Survey Shows Blacks Not Concerned Enough about Kidney Disease

    ERIC Educational Resources Information Center

    Black Issues in Higher Education, 2004


    Health officials may have an uphill battle in educating Blacks about a disease that's being called a "silent killer," a recent survey shows. Kidney disease is an illness that's become more prevalent, especially in the nation's Black population, but a survey conducted in Jackson, Atlanta, Baltimore and Cleveland shows only 15 percent of those…

  7. Computer Slide Shows: A Trap for Bad Teaching

    ERIC Educational Resources Information Center

    Klemm, W. R.


    Slide shows presented with software such as PowerPoint or WordPerfect Presentations can trap instructors into bad teaching practices. Research on memory suggests that slide-show instruction can actually be less effective than traditional lecturing when the teacher uses a blackboard or overhead projector. The author proposes a model of classroom…

  8. The Easy Way to Create Computer Slide Shows.

    ERIC Educational Resources Information Center

    Anderson, Mary Alice


    Discusses techniques for creating computer slide shows. Topics include memory; format; color use; HyperCard and CD-ROM; font styles and sizes; graphs and graphics; the slide show option; special effects; and tips for effective presentation. (Author/AEF)

  9. 43 CFR 3430.2-1 - Initial showing.

    Code of Federal Regulations, 2013 CFR


    ...-1 Initial showing. All preference right coal lease applications shall have contained or shall have... analysis, sulfur content and BTU content of the coal, and all supporting geological and geophysical data... to be mined by surface mining methods, isopachous maps of the overburden. These maps shall show...

  10. The Presentation of Science in Everyday Life: The Science Show

    ERIC Educational Resources Information Center

    Watermeyer, Richard


    This paper constitutes a case-study of the "science show" model of public engagement employed by a company of science communicators focused on the popularization of science, technology, engineering and mathematics (STEM) subject disciplines with learner constituencies. It examines the potential of the science show to foster the interest…

  11. 47 CFR 73.24 - Broadcast facilities; showing required.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Broadcast facilities; showing required. 73.24... RADIO BROADCAST SERVICES AM Broadcast Stations § 73.24 Broadcast facilities; showing required. An authorization for a new AM broadcast station or increase in facilities of an existing station will be...

  12. 47 CFR 101.411 - Supplementary showing required.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Supplementary showing required. 101.411 Section 101.411 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Developmental Authorizations § 101.411 Supplementary showing required....

  13. 47 CFR 101.411 - Supplementary showing required.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 5 2011-10-01 2011-10-01 false Supplementary showing required. 101.411 Section 101.411 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Developmental Authorizations § 101.411 Supplementary showing required....

  14. "The Daily Show with Jon Stewart": Part 1

    ERIC Educational Resources Information Center

    Trier, James


    Comedy Central's popular program "The Daily Show With Jon Stewart" is the best critical media literacy program on television, and it can be used in valuable ways in the classroom as part of a media literacy pedagogy. This Media Literacy column provides an overview of the show and its accompanying website and considers ways it might be used in the…

  15. The Daily Show with Jon Stewart: Part 2

    ERIC Educational Resources Information Center

    Trier, James


    "The Daily Show With Jon Stewart" is one of the best critical literacy programs on television, and in this Media Literacy column the author suggests ways that teachers can use video clips from the show in their classrooms. (For Part 1, see EJ784683.)

  16. View of Lake Sabrina Dam showing wooden planks along the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of Lake Sabrina Dam showing wooden planks along the upstream face and concrete base added in 1916/1917 and showing the iron grating covering upstream side of outlet structure is visible at lower photo center, view northeast - Bishop Creek Hydroelectric System, Plant 2, Lake Sabrina Dam, Bishop Creek, Bishop, Inyo County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  18. 108. View showing storage yard where material is received and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    108. View showing storage yard where material is received and sorted: also shows derrick framed to raise material from tracks and land on deck of approach. Material is then moved by narrow gage locomotive out to erection traveler. - Carquinez Bridge, Spanning Carquinez Strait at Interstate 80, Vallejo, Solano County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  20. 15. Photocopy of historic view No. 31001 showing expansion of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Photocopy of historic view No. 31001 showing expansion of Building 461 (9/4/56) showing Building 463 tanks to the right of the photo. Original is on file Mare Island Naval Shipyard-Photography Lab. Photographer unknown. - Mare Island Naval Shipyard, Acid Mixing Facility, California Avenue & E Street, Vallejo, Solano County, CA

  1. Game Show Mathematics: Specializing, Conjecturing, Generalizing, and Convincing

    ERIC Educational Resources Information Center

    Lane, Catherine Pullin; Harkness, Shelly Sheats


    This article describes the authors' use of three game shows--"Survivor," "The Biggest Loser," and "Deal or No Deal?"--to determine to what degree students engaged in mathematical thinking: specializing, conjecturing, generalizing, and convincing (Burton, 1984). Student responses to the task of creating winning strategies to these shows were…

  2. ShowFlow: A practical interface for groundwater modeling

    SciTech Connect

    Tauxe, J.D.


    ShowFlow was created to provide a user-friendly, intuitive environment for researchers and students who use computer modeling software. What traditionally has been a workplace available only to those familiar with command-line based computer systems is now within reach of almost anyone interested in the subject of modeling. In the case of this edition of ShowFlow, the user can easily experiment with simulations using the steady state gaussian plume groundwater pollutant transport model SSGPLUME, though ShowFlow can be rewritten to provide a similar interface for any computer model. Included in this thesis is all the source code for both the ShowFlow application for Microsoft{reg sign} Windows{trademark} and the SSGPLUME model, a User's Guide, and a Developer's Guide for converting ShowFlow to run other model programs. 18 refs., 13 figs.

  3. Dolphin shows and interaction programs: benefits for conservation education?


    Miller, L J; Zeigler-Hill, V; Mellen, J; Koeppel, J; Greer, T; Kuczaj, S


    Dolphin shows and dolphin interaction programs are two types of education programs within zoological institutions used to educate visitors about dolphins and the marine environment. The current study examined the short- and long-term effects of these programs on visitors' conservation-related knowledge, attitude, and behavior. Participants of both dolphin shows and interaction programs demonstrated a significant short-term increase in knowledge, attitudes, and behavioral intentions. Three months following the experience, participants of both dolphin shows and interaction programs retained the knowledge learned during their experience and reported engaging in more conservation-related behaviors. Additionally, the number of dolphin shows attended in the past was a significant predictor of recent conservation-related behavior suggesting that repetition of these types of experiences may be important in inspiring people to conservation action. These results suggest that both dolphin shows and dolphin interaction programs can be an important part of a conservation education program for visitors of zoological facilities.

  4. Snacking on Television: A Content Analysis of Adolescents’ Favorite Shows

    PubMed Central

    Larson, Nicole I.; Gollust, Sarah E.; Neumark-Sztainer, Dianne


    Introduction Snacking is a complex behavior that may be influenced by entertainment media. Research suggests that snacking and unhealthy foods are commonly shown in programming that targets young audiences, but shows selected for study have been limited. We conducted a content analysis on shows that were named as favorites by adolescents to characterize portrayals of snacking on popular television. Methods A diverse sample of 2,130 adolescents (mean age, 14.3 y) listed 3 favorite television shows in a 2010 school-based survey. Three episodes each of the 25 most popular shows were coded for food-related content, including healthfulness, portion size, screen time use, setting, and social context. We also analyzed the characteristics of characters involved in eating incidents, the show type, and the show rating. We used χ2 tests, binomial tests, and multilevel regression models to compare incidence of snacks versus meals, the characteristics of those involved, and snacking across show characteristics. Results Almost half of food incidents on television shows were snacks. Snacks were significantly more likely than meals to be “mostly unhealthy” (69.3% vs 22.6%, P < .001) and were more likely to include screen time use (25.0% of snacking incidents vs 4.0% of meals, P < .001). Young characters and those coded as being of low socioeconomic status or overweight were overrepresented in snacking incidents. Sitcoms and shows rated for a youth audience were significantly more likely to portray snacking than were shows for adult audiences. Conclusion Media awareness and literacy programs should include foods and snacking behaviors among the issues they address. More healthful portrayals of food and dietary intake in entertainment shows’ content would create a healthier media environment for youth. PMID:27197079


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  7. 42. View forward on afterdeck, showing steering gear box in ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. View forward on afterdeck, showing steering gear box in foreground, aft elevation of cabin beyond; weather canopy overhead is not an original or permanent feature - Schooner WAWONA, 1018 Valley Street, Seattle, King County, WA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  9. 17. Building 202, observation room for test cell, showing panel, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. Building 202, observation room for test cell, showing panel, abort button, phones, and observation window. View looking northwest. - Rocket Engine Testing Facility, GRC Building No. 202, NASA Glenn Research Center, Cleveland, Cuyahoga County, OH

  10. Detail of smokestack base on east side, showing door manufactured ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail of smokestack base on east side, showing door manufactured by Heine Chimney Co., Chicago. - Fitzsimons General Hospital, Power House, Northwest Corner of East Harlow Avenue & North Page Street, Aurora, Adams County, CO

  11. North side, showing ramp at western section but photograph taken ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    North side, showing ramp at western section but photograph taken to east of CO-172-BR-8 and looking southwesterly. - Fitzsimons General Hospital, Infirmary, Northwest Corner of East Bushnell Avenue & South Page Street, Aurora, Adams County, CO

  12. East side, middle section, looking southwest, shows slightly more northerly ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    East side, middle section, looking southwest, shows slightly more northerly section than CO-172-AO-4. - Fitzsimons General Hospital, Quartermaster's Storehouse, Southwest Corner of East I Avenue & North Twelfth Street, Aurora, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. INTERIOR OF BUILDING 313, SHOWING LABORATORY. VIEW TO EAST. - Rocky Mountain Arsenal, Laboratory Building, 510 feet South of December Seventh Avenue; 175 feet East of D Street, Commerce City, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. INTERIOR OF BUILDING 313, SHOWING LABORATORY. VIEW TO SOUTHEAST. - Rocky Mountain Arsenal, Laboratory Building, 510 feet South of December Seventh Avenue; 175 feet East of D Street, Commerce City, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. INTERIOR OF BUILDING 313, SHOWING LABORATORY. VIEW TO NORTHWEST. - Rocky Mountain Arsenal, Laboratory Building, 510 feet South of December Seventh Avenue; 175 feet East of D Street, Commerce City, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. INTERIOR OF BUILDING 313, SHOWING LABORATORY. VIEW TO SOUTHWEST. - Rocky Mountain Arsenal, Laboratory Building, 510 feet South of December Seventh Avenue; 175 feet East of D Street, Commerce City, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. INTERIOR OF BUILDING 313, SHOWING LABORATORY. VIEW TO NORTHEAST. - Rocky Mountain Arsenal, Laboratory Building, 510 feet South of December Seventh Avenue; 175 feet East of D Street, Commerce City, Adams County, CO


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. OFFSHORE VIEW OF PIER, LOOKING EAST, SHOWING LIFEGUARD TOWER AND 2ND TEE (CENTER), REFUGE BAY (RIGHT) - Huntington Beach Municipal Pier, Pacific Coast Highway at Main Street, Huntington Beach, Orange County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. GROUND VIEW OF PIER, LOOKING SOUTH FROM WATERLINE; SHOWING LIFEGUARD TOWER TO END OF PIER - Huntington Beach Municipal Pier, Pacific Coast Highway at Main Street, Huntington Beach, Orange County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. OFFSHORE VIEW OF PIER, LOOKING SOUTHEAST, SHOWING (LEFT-RIGHT) PUMPHOUSE, TACKLE BOX, RESTROOMS ON 3RD TEE - Huntington Beach Municipal Pier, Pacific Coast Highway at Main Street, Huntington Beach, Orange County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. GROUND VIEW OF PIERS, LOOKING SOUTHEAST, SHOWING BENTS 1-3, STAIRWAY (RIGHT), RESTROOMS UNDER PIER (CENTER), MAXWELL'S RESTAURANT IN BACKGROUND - Huntington Beach Municipal Pier, Pacific Coast Highway at Main Street, Huntington Beach, Orange County, CA

  2. Oblique view showing western abutment, looking ENE along main line. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique view showing western abutment, looking ENE along main line. Septa commuter train in foreground. - Pennsylvania Railroad, Whitford Bridge, Spanning Amtrak tracks at Whitford Road, Whitford, Chester County, PA

  3. 4. Building 11 north elevation oblique, showing detail of concrete ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. Building 11 north elevation oblique, showing detail of concrete landings, window treatments. Very obscured by unremovable vegetation. View looking west. - John & James Dobson Carpet Mill (West Parcel), Building No. 11, 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA

  4. 3. Front of Mansion, facing east, shows portico, raised section ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Front of Mansion, facing east, shows portico, raised section of second story, and section (south of extreme left chimney) added c. 1914. Winter view. - Sotterly, State Route 245 & Vista Road Vicinity, Hollywood, St. Mary's County, MD


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. VIEW, LOOKING NORTHEAST, SHOWING A SMALL FIELD-STONE DAM (KNOWN LOCALLY AS DAM NO. 2), BUILT BY THE CCC - J. Clark Salyer National Wildlife Refuge Dams, Along Lower Souris River, Kramer, Bottineau County, ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF DAM 83, SHOWING OLD SOURIS RIVER CHANNEL FROM THE DOWNSTREAM FACE OF THE DAM WITH POND A IN THE BACKGROUND, LOOKING SOUTH - Upper Souris National Wildlife Refuge, Dam 83, Souris River Basin, Foxholm, Surrey (England), ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. VIEW OF SPILLWAY AT DAM 83, SHOWING REFUGE HEADQUARTERS ON THE HORIZON (LEFT, CENTER), LOOKING EAST - Upper Souris National Wildlife Refuge, Dam 83, Souris River Basin, Foxholm, Surrey (England), ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. VIEW OF SPILLWAY AT DAM 83, SHOWING LOCATION OF FORMER CONCRETE FLASHBOARD STRUCTURE ON RIGHT, LOOKING WEST - Upper Souris National Wildlife Refuge, Dam 83, Souris River Basin, Foxholm, Surrey (England), ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. VIEW, LOOKING SOUTHWEST, SHOWING A LARGE FIELD-STONE DAM (KNOWN LOCALLY AS DAM NO. 1), BUILT BY THE CCC - J. Clark Salyer National Wildlife Refuge Dams, Along Lower Souris River, Kramer, Bottineau County, ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. DETAIL VIEW SHOWING BASE OF LIGHT TOWER, LOOKING SOUTHEAST - Monomoy Point Light Station, Approximately 3500 feet Northeast Powder Hole Pond, Monomoy National Wildlife Refuge, Chatham, Barnstable County, MA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. DETAIL VIEW OF SPILLWAY AT DAM 83, SHOWING RIVER COBBLE PAVING (FOREGROUND) AND WINGWALL, LOOKING EAST - Upper Souris National Wildlife Refuge, Dam 83, Souris River Basin, Foxholm, Surrey (England), ND


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. VIEW OF A SINGLE BEEHIVE COKE OVEN SHOWING THE INTERIOR STRUCTURE OF THE OVEN. - Tower Hill No. 2 Mine, Approximately 0.47 mile Southwest of intersection of Stone Church Road & Township Route 561, Hibbs, Fayette County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. DETAIL OF THE FAN HOUSE INTERIOR, SHOWING FAN OPENINGS. - Tower Hill No. 2 Mine, Approximately 0.47 mile Southwest of intersection of Stone Church Road & Township Route 561, Hibbs, Fayette County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR VIEW OF THE GENERATOR HOUSE, SHOWING CONCRETE MACHINERY FOOTINGS, LOOKING SOUTHWEST. - Tower Hill No. 2 Mine, Approximately 0.47 mile Southwest of intersection of Stone Church Road & Township Route 561, Hibbs, Fayette County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    28. CROSS SECTION OF A RECTANGULAR COKE OVEN SHOWING THE INTERNAL STRUCTURE OF THE OVEN. - Tower Hill No. 2 Mine, Approximately 0.47 mile Southwest of intersection of Stone Church Road & Township Route 561, Hibbs, Fayette County, PA

  17. Detail unit 5, showing discharge pipe and vacuum valve on ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail unit 5, showing discharge pipe and vacuum valve on discharge side of pump - Wellton-Mohawk Irrigation System, Pumping Plant No. 1, Bounded by Gila River & Union Pacific Railroad, Wellton, Yuma County, AZ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. VIEW LOOKING WEST SHOWING UNIT #3. VACUUM PUMP ON LEFT, CONDENSER TURBINE ON RIGHT, JET CONDENSER IN CENTER REAR - Georgetown Steam Plant, South Warsaw Street, King County Airport, Seattle, King County, WA

  19. South side. Also showing forebay, wing for the main control ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    South side. Also showing forebay, wing for the main control room, and evaporative cooling unit at left - Wellton-Mohawk Irrigation System, Pumping Plant No. 2, Bounded by Interstate 8 to south, Wellton, Yuma County, AZ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  1. Genital Herpes Vaccine Shows Promise in Animal Trials


    ... Genital Herpes Vaccine Shows Promise in Animal Trials Two-pronged approach ... THURSDAY, Jan. 19, 2017 (HealthDay News) -- A new vaccine for genital herpes could be nearing human clinical ...


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. EXTERIOR OF REAR (EAST END) AND NORTH SIDE SHOWING ASBESTOS SIDING, BACKYARD LAWN, AND CLOTHESLINE. VIEW TO SOUTHWEST. - Bishop Creek Hydroelectric System, Plant 4, Worker Cottage, Bishop Creek, Bishop, Inyo County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BLDG 101, CENTRAL ENTRY/ PASSAGE SHOWING LEAD FLOOR, STEEL WALLS AND ASBESTOS CEILING - Naval Magazine Lualualei, Headquarters Branch, Operational Storage Building, Fifteenth Street near Kolekole Road intersection, Pearl City, Honolulu County, HI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FEATURE 3, LARGE GUN POSITION, SHOWING MULTIPLE COMPARTMENTS, VIEW FACING SOUTH. - Naval Air Station Barbers Point, Anti-Aircraft Battery Complex-Large Gun Position, East of Coral Sea Road, northwest of Hamilton Road, Ewa, Honolulu County, HI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FEATURE A. CONCRETE ANTI-AIRCRAFT GUN POSITION, SHOWING CORAL RUBBLE BERM, VIEW FACING SOUTHEAST. - Naval Air Station Barbers Point, Battery-Anti-Aircraft Gun Position, South of Point Cruz Road & west of Coral Sea Road, Ewa, Honolulu County, HI

  6. Satellite Movie Shows Hurricane Cristobal Speeding Through North Atlantic

    NASA Video Gallery

    This animation of NOAA's GOES-East satellite imagery from August 26 through 29 shows Hurricane Cristobal changing into a post-tropical storm in the North Atlantic Ocean. Credit: NASA/NOAA GOES Project

  7. 8. Environmental view facing northwest showing pond in relationship to ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. Environmental view facing northwest showing pond in relationship to house - John Bly House, East side of County Road 857, just north of intersection with Quarry Run Road, Cheat Neck, Monongalia County, WV

  8. 7. William E. Barrett, Photographer, 1974. SKEWED VIEW SHOWING CHEAT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. William E. Barrett, Photographer, 1974. SKEWED VIEW SHOWING CHEAT RIVER VALLEY, REMAINS OF 1887 PIER AND c. 1900 MASONRY ARCHES. - Baltimore & Ohio Railroad, Tray Run Viaduct, Spanning Tray Run, Rowlesburg, Preston County, WV

  9. Environmental perspective facing south showing chicken house, tractor shed, and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Environmental perspective facing south showing chicken house, tractor shed, and homestead - Norris Farm, .5 mile west of County Road 857 & .25 mile east of County Road 88/1, Cheat Neck, Monongalia County, WV


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. GENERAL VIEW LOOKING EAST SHOWING SOUTH SIDE OF BRIDGE. SHALLOW ARCH ON EXTREME RIGHT SPANS ELLIS ST. - Sudbury River Aqueduct, Echo Bridge, Spanning Charles River at Upper Newton Falls, Newton, Middlesex County, MA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  12. 1. View southeast showing Kenyon Village from bridge over tracks ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. View southeast showing Kenyon Village from bridge over tracks on Main Street in village of Shamrock, Richmond-Charlestown, Rhode Island. - Kenyon Village, Kenyon School Road, Sherman Avenue, & Lewiston Avenue, Richmond (historical), Providence County, RI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  14. 34. View of pier 3, showing supporting main anchor arm ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. View of pier 3, showing supporting main anchor arm and cantilever arm spans, as seen from shore near pier 4, looking north - Williamstown-Marietta Bridge, Spanning Ohio River between Williamstown & Marietta, Williamstown, Wood County, WV


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. DETAIL VIEW OF ROCKER ARM, SHOWING POCKETS, LUGS, INCLINED STOPPING BLOCK AT SHOREWARD END OF TRACK GIRDER - Seddon Island Scherzer Rolling Lift Bridge, Spanning Garrison Channel from Tampa to Seddon Island, Tampa, Hillsborough County, FL

  16. 22. View showing main anchor arm, as viewed from main ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. View showing main anchor arm, as viewed from main cantilever arm looking south. Note upper chord eyebar arrangement. - Williamstown-Marietta Bridge, Spanning Ohio River between Williamstown & Marietta, Williamstown, Wood County, WV


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. DETAIL VIEW OF NORTHEAST END OF BRIDGE, SHOWING ROCKER ARM PORTION OF BASCULE - Seddon Island Scherzer Rolling Lift Bridge, Spanning Garrison Channel from Tampa to Seddon Island, Tampa, Hillsborough County, FL

  18. Interior view, detail view of southeast elevation to show niche ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, detail view of southeast elevation to show niche four tiers down from the east/one up from the south corner; bust is of Mendelssohn - National Park Seminary, Ballroom, Linden Lane, Silver Spring, Montgomery County, MD

  19. Interior view, close view of northwest elevation to show niche ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, close view of northwest elevation to show niche two tiers down from the west corner (niche also shown in MD-1109-F-8) - National Park Seminary, Ballroom, Linden Lane, Silver Spring, Montgomery County, MD

  20. Interior view, close view of the northwest elevation to show ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, close view of the northwest elevation to show niche four tiers down from the west corner/one from the north - National Park Seminary, Ballroom, Linden Lane, Silver Spring, Montgomery County, MD

  1. Interior view, close view of northwest elevation to show niche ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, close view of northwest elevation to show niche one tier down from the west corner; here the bust is of Beethoven - National Park Seminary, Ballroom, Linden Lane, Silver Spring, Montgomery County, MD

  2. 7. Building 7 interior, west end of building showing tier ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. Building 7 interior, west end of building showing tier of skylight windows and modern equipment. View looking west. - John & James Dobson Carpet Mill (West Parcel), Building No. 7, 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. NORTHWEST END OF WHITSETT PLANT SHOWING PIPELINES PROBABLY FOR FIRE WATER STORAGE, LOOKING SOUTHWEST. - Whitsett Pump Plant, West side of Colorado River, north of Parker Dam, Parker Dam, San Bernardino County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. VIEW OF SPILLWAY TIMBERS AND WATER CONTROL BOX, SHOWING WATER CONTROL BOX WITH LOWERED LAKE LEVEL - Three Bears Lake & Dams, Water Control Box, North of Marias Pass, East Glacier Park, Glacier County, MT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. June 1988 INTERIOR, SOUTHWEST CORNER; SHOWING FIREFINDER (FOREGROUND), LIGHTNING STOOL AND BED (BOTH TO RIGHT OF FIREFINDER) - Suntop Lookout, Forest Road 510, Mt. Baker-Snoqualmie National Forest, Greenwater, Pierce County, WA

  6. Overview of transformer platform showing three original stepup transformer (center), ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of transformer platform showing three original step-up transformer (center), steel switchback (right), and modern step-down transformer (foreground), view to northwest - Morony Hydroelectric Facility, Dam and Powerhouse, Morony Dam Road, Great Falls, Cascade County, MT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    45. SELAH LINE, LOOKING NORTHEAST, SHOWING END OF LINE AT LARSON FRUIT COMPANY - Yakima Valley Transportation Company Interurban Railroad, Connecting towns of Yakima, Selah & Wiley City, Yakima, Yakima County, WA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. ORCHARD LINE, LOOKING SOUTH, SHOWING PACIFIC FRUIT PACKING HOUSE NEAR END OF LINE - Yakima Valley Transportation Company Interurban Railroad, Connecting towns of Yakima, Selah & Wiley City, Yakima, Yakima County, WA

  9. 2. View facing east showing the south elevation (rear) of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. View facing east showing the south elevation (rear) of the garage, loading docks and rail spur, with Providence Fruit & Produce Building beyond. - Armour & Company Building, 100 Harris Avenue, Providence, Providence County, RI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  11. 13. View South, showing the remaining pier footings for the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. View South, showing the remaining pier footings for the steam engine water tower for the Chesapeake and Ohio Railroad. - Cotton Hill Station Bridge, Spanning New River at State Route 16, Cotton Hill, Fayette County, WV


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  13. Interior view of bedroom 2 showing louvers in former exterior ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of bedroom 2 showing louvers in former exterior window opening, facing northwest. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  14. Interior view of groundfloor servants bath showing original casement windows, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of ground-floor servants bath showing original casement windows, shower stall, and pipes at ceiling, facing southeast. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  15. General view of building in context showing residences fronting Dargue ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    General view of building in context showing residences fronting Dargue Avenue Circle, facing south. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  16. View of southwest corner showing ell addition and carport, facing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of southwest corner showing ell addition and carport, facing northeast. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  17. Interior view of hall to bath 1 showing typical doors ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of hall to bath 1 showing typical doors and attic scuttle, facing east. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  18. Oblique view of northwest corner showing screened openings at ground ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Oblique view of northwest corner showing screened openings at ground floor and mission scrolls, facing east. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  19. Interior view of groundfloor porch showing exposed concrete floor slab ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of ground-floor porch showing exposed concrete floor slab system, facing west. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ

  20. Interior view of bath 1 showing original tub and shower ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of bath 1 showing original tub and shower stall, facing southwest. - Albrook Air Force Station, Field Officer's Quarters, West side of Dargue Avenue Circle, Balboa, Former Panama Canal Zone, CZ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. INTERIOR VIEW OF TRANSFORMER BUILDING, HIGHLINE PUMP PLANT, SHOWING NEW SWITCHES AND METERS, December 3, 1952 - Highline Canal & Pumping Station, South side of Salt River between Tempe, Phoenix & Mesa, Tempe, Maricopa County, AZ

  2. 8. Close view looking from the east to show cistern ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. Close view looking from the east to show cistern and electric meter - Piece Sur Piece Building (House), On dirt road off of Highway 494, about 1 1/2 miles Northwest of Bermuda, Bermuda, Natchitoches Parish, LA

  3. 49. Photocopy of photograph, AERIAL PHOTOGRAPH SHOWING VIEW OF CNJ ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    49. Photocopy of photograph, AERIAL PHOTOGRAPH SHOWING VIEW OF CNJ BRIDGE PRIOR TO DEVELOPMENT OF PORT ELIZABETH - Central Railroad of New Jersey, Newark Bay Lift Bridge, Spanning Newark Bay, Newark, Essex County, NJ

  4. 39. Historic photograph, photographer unknown, c. 1944. VIEW SHOWING SHEEP ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. Historic photograph, photographer unknown, c. 1944. VIEW SHOWING SHEEP CROSSING BRIDGE, LOOKING WEST FROM CORRAL AT EAST APPROACH TO WALKWAY. - Verde River Sheep Bridge, Spanning Verde River (Tonto National Forest), Cave Creek, Maricopa County, AZ

  5. 34. Historic photograph, photographer unknown, October 10, 1944. VIEW SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. Historic photograph, photographer unknown, October 10, 1944. VIEW SHOWING HORSESHOE DAM UNDER CONSTRUCTION, LOOKING WEST. ONLY THE BRIDGE TOWERS REMAIN. - Verde River Sheep Bridge, Spanning Verde River (Tonto National Forest), Cave Creek, Maricopa County, AZ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. AERIAL VIEW SHOWING THE ENTIRE BRIDGE FROM EAST CABLE ANCHORAGE (EXTREME LEFT) TO WEST CABLE ANCHORAGE (UPPER RIGHT CORNER). March 1987. - Verde River Sheep Bridge, Spanning Verde River (Tonto National Forest), Cave Creek, Maricopa County, AZ

  7. 38. Historic photograph, photographer unknown, c. 1944. VIEW SHOWING BURROS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. Historic photograph, photographer unknown, c. 1944. VIEW SHOWING BURROS (OR MULES) CROSSING BRIDGE, LOOKING NORTHEAST. - Verde River Sheep Bridge, Spanning Verde River (Tonto National Forest), Cave Creek, Maricopa County, AZ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. DETAIL VIEW OF ENTRANCE GATES, SHOWING IRON GATE, STONE WORK, AND GATE STOP FROM SOUTHEAST OF NORTHWEST ELEMENTS. - William Enston Home, Entrance Gate, 900 King Street, Charleston, Charleston County, SC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. UNDERSIDE FROM SOUTH ABUTMENT SHOWING FLOOR SYSTEM, WALKWAY, AND FIRST PIER. LOOKING NORTH. - Rue Road Bridge, Rue Road, spanning Matchaponix Brook, .35 mile east of intersection with Route 613, Jamesburg, Middlesex County, NJ

  11. 12. Exterior detail view of roof structure at eave, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Exterior detail view of roof structure at eave, showing exposed rafter tails, skip sheathing and gutter - American Railway Express Company Freight Building, 1060 Northeast Division Street, Bend, Deschutes County, OR

  12. GPM Shows Large Rainfall Totals from Typhoon Dujuan

    NASA Video Gallery

    GPM showed that Taiwan's heaviest rainfall totals of over 275 mm (10.8 inches) were located along the coast south of where Typhoon Dujuan made landfall. The highest rainfall totals were found over ...

  13. East side, showing ruin of brownstone column capital that originally ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    East side, showing ruin of brownstone column capital that originally supported the east side portico, a feature that was destroyed in the 1886 earthquake - William Ravenel House, 13 East Battery Street, Charleston, Charleston County, SC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CRIB DAM, LOOKING ALONG DAM FROM WEST ABUTMENT, SHOWING PLANK SHEATHING IN FOREGROUND. VIEW TO EAST - Kachess Dam, 1904 Cascade Canal Company Crib Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA

  16. View of submerged remains of Read Sawmill, showing floor boards, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of submerged remains of Read Sawmill, showing floor boards, cross beams and notches for wall post beams. - Silas C. Read Sawmill, Outlet of Maxwell Lake near North Range Road, Fort Gordon, Richmond County, GA

  17. View of double floor boards with mortises cross beams, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of double floor boards with mortises cross beams, showing spikes and flooring nails (Lower board layer exposed) - Silas C. Read Sawmill, Outlet of Maxwell Lake near North Range Road, Fort Gordon, Richmond County, GA

  18. View of Northwest corner of the Merry Generator House showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of Northwest corner of the Merry Generator House showing floor boards and cross beams. Shifting of structure evident in staggered wall board profile. - Arthur Holmes Merry Generator House, Signal Lake North of Range Road, Fort Gordon, Richmond County, GA

  19. View of submerged remains of Read Sawmill, showing floor boards, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    View of submerged remains of Read Sawmill, showing floor boards, wall boards, tenoned uprights and mortised sill beams. - Silas C. Read Sawmill, Outlet of Maxwell Lake near North Range Road, Fort Gordon, Richmond County, GA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. MASONRY DETAIL NO. 2, NORTH TRAINING WALL, SHOWING THE RUBBLE CORE WHERE THE FACING STONES HAVE BEEN REMOVED. - Oakland Harbor Training Walls, Mouth of Federal Channel to Inner Harbor, Oakland, Alameda County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. UPSTREAM SIDE OF UPPER MITER GATES SHOWING STOWED LEFT WING OF UPPER GUARD GATE (FAR LEFT). VIEW TO NORTHWEST. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. GENERAL VIEW SHOWING (FROM LEFT TO RIGHT) LOCKMASTER'S HOUSE, VISITORS CENTER, AND NEW GARAGE. VIEW TO SOUTHWEST. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. FRONT (SOUTH) SIDE OF LOCKMASTER'S HOUSE SHOWING PORTION OF LOCK CHAMBER IN FOREGROUND. VIEW TO NORTH. - Starved Rock Locks & Dam, Lockmaster's House, Illinois Waterway River mile 231, Peru, La Salle County, IL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW, FROM EAST, SHOWING DIVING AND MAIN POOLS AND WEST ELEVATION OF OFFICE AND FIRST AID BUILDING - Glen Echo Park, Crystal Swimming Pool, 7300 McArthur Boulevard, Glen Echo, Montgomery County, MD

  7. 5. South wall of Gas House showing connection to bridge. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. South wall of Gas House showing connection to bridge. - Delaware, Lackawanna & Western Railroad, Scranton Yards, Gas House, 100 block of South Washington Avenue, west side, Scranton, Lackawanna County, PA

  8. 32. Otter Lake Dam. View from downstream show how the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. Otter Lake Dam. View from downstream show how the dam blends into its environment. Looking east-northeast. - Blue Ridge Parkway, Between Shenandoah National Park & Great Smoky Mountains, Asheville, Buncombe County, NC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    58. VIEW SHOWING GRAFFITI IN STAIRWELL INSIDE 'CATFISH' SILO Everett Weinreb, photographer, March 1988 - Mount Gleason Nike Missile Site, Angeles National Forest, South of Soledad Canyon, Sylmar, Los Angeles County, CA

  10. 23. Surrender interview site, showing Pemberton Avenue concrete slab road ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. Surrender interview site, showing Pemberton Avenue concrete slab road type with gutter (asphalt construction typical on Union and Confederate Avenues), view to the sw. - Vicksburg National Military Park Roads & Bridges, Vicksburg, Warren County, MS


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. EAST SIDE SHOWING LOW CINDER-BLOCK WALL AND ASPHALT-PAVED PARKING LOT FOR NEW CONTROL BUILDING. VIEW TO NORTHWEST. - Bishop Creek Hydroelectric System, Control Station, Hydrographer's Office, Bishop Creek, Bishop, Inyo County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. VIEW NORTH, ACROSS DECK CENTER AREA SHOWING ASPHALT AND NORTH SIDE GUARD WALL - Route 1 Extension, South Street Viaduct, Spanning Conrail & Wheeler Point Road at South Street, Newark, Essex County, NJ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. VIEW NORTH, ACROSS DECK AT EAST SIDE SHOWING GRANITE BLOCK PAVING, EXPANSION JOINT AND NORTH SIDE PIPE RAILING - Route 1 Extension, South Street Viaduct, Spanning Conrail & Wheeler Point Road at South Street, Newark, Essex County, NJ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  15. 13. Interior, Hangar 1301, showing bottom of a truss, steel ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. Interior, Hangar 1301, showing bottom of a truss, steel hinge point and expansion joint, and concrete buttress, looking north northwest - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. VIEW LOOKING INSIDE SILO, SHOWING ELEVATOR (ON LEFT) AND AIR CONDITIONING UNIT Everett Weinreb, photographer, April 1988 - Los Pinetos Nike Missile Site, Santa Clara Road, Los Angeles National Forest, Sylmar, Los Angeles County, CA

  17. 9. Roof. A view looking north, showing the elevator bulkheads ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Roof. A view looking north, showing the elevator bulkheads and the retrofit air-conditioning compressors and air handlers. - John T. Beasley Building, 632 Cherry Street (between Sixth & Seventh Streets), Terre Haute, Vigo County, IN

  18. 32. Coffee bean sluiceway on ground floor showing chute bringing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. Coffee bean sluiceway on ground floor showing chute bringing beans from first floor hopper. HAER PR, 6-MAGU, 1B-17 - Hacienda Buena Vista, PR Route 10 (Ponce to Arecibo), Magueyes, Ponce Municipio, PR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. DETAIL: GENERATOR FLOOR DIABLO POWERHOUSE SHOWING BUTTERFLY VALVE CONTROL, MOSAIC TILE FLOOR, AS SEEN FROM VISITORS GALLERY, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

  1. Detail of exciter turbine showing shaft, scroll case, servomotor and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail of exciter turbine showing shaft, scroll case, servo-motor and operating ring (left foreground) and hand wheel for butterfly valve (right background) - Morony Hydroelectric Facility, Dam and Powerhouse, Morony Dam Road, Great Falls, Cascade County, MT

  2. 6. Photocopy of drawing showing pile bridge construction on Erie ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Photocopy of drawing showing pile bridge construction on Erie Railway in 1841. Original illustration in DeGolyer Collection, Dallas, Texas. - Erie Railway, New Jersey, New York, Pennsylvania, Deposit, Broome County, NY

  3. 1. Photocopy of drawing showing pile superstructure of early railroad ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Photocopy of drawing showing pile superstructure of early railroad track construction. Original illustration in Degolyer Collection, Dallas, Texas - Erie Railway, New Jersey, New York, Pennsylvania, Deposit, Broome County, NY

  4. Interior view of coffee processing structure No. 1, showing concrete ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of coffee processing structure No. 1, showing concrete reservoirs on floor, view towards the west - Finca Silem, Coffee Processing Structure No. 1, Highway 139, Kilometer 9.3, Maraguez, Ponce Municipio, PR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  6. EPA Survey Shows $271 Billion Needed for Nations Wastewater Infrastructure

    EPA Pesticide Factsheets

    WASHINGTON - The U.S. Environmental Protection Agency (EPA) today released a survey showing that $271 billion is needed to maintain and improve the nation's wastewater infrastructure, including the pipes that carry wastewater to treatment plants, th

  7. 5. View showing Crooked River High Bridge in background and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. View showing Crooked River High Bridge in background and Ralph Modjeski railroad bridge in foreground - Crooked River High Bridge, Spanning Crooked River Gorge at Dalles-California Highway, Terrebonne, Deschutes County, OR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  9. GOES-West Shows U.S. West's Record Rainfall

    NASA Video Gallery

    A new time-lapse animation of data from NOAA's GOES-West satellite provides a good picture of why the U.S. West Coast continues to experience record rainfall. The new animation shows the movement o...

  10. 2. Looking West, showing a view of the two through ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Looking West, showing a view of the two through trusses and only two of the pony trusses from the downstream side of the structure. - Weidemeyer Bridge, Spanning Thomes Creek at Rawson Road, Corning, Tehama County, CA

  11. 2. View of NE elevation of corn crib showing doubletrack ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. View of NE elevation of corn crib showing double-track rail system leading to upper level. - Laurel Valley Sugar Plantation, Corn Crib, 2 miles South of Thibodaux on State Route 308, Thibodaux, Lafourche Parish, LA

  12. 3. Interior view of corn crib showing heavytimber framing, railed ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Interior view of corn crib showing heavy-timber framing, railed trackway and corn car at upper level. - Laurel Valley Sugar Plantation, Corn Crib, 2 miles South of Thibodaux on State Route 308, Thibodaux, Lafourche Parish, LA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. DETAIL VIEW OF GENERATOR NO. 1, GENERATOR ROOM, SHOWING GRAVITY LUBRICATING OIL BOX ABOVE GENERATOR - Nine Mile Hydroelectric Development, Powerhouse, State Highway 291 along Spokane River, Nine Mile Falls, Spokane County, WA

  14. 30. Photocopy of lithograph showing Empire Stores at corner (Baker, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. Photocopy of lithograph showing Empire Stores at corner (Baker, Ostheimer and Co.) from Everts, Ensign & Everts, Combination Atlas Map of Erie County, 1876 - Empire Stores, 501-505 State Street, Erie, Erie County, PA

  15. Interior view, detail to show the ornate bronze doors to ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, detail to show the ornate bronze doors to the entrance lobby elevators - United States Department of Commerce, Bounded by Fourteenth, Fifteenth, and E streets and Constitution Avenue, Washington, District of Columbia, DC

  16. Interior view, law library closer view to show painted details ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view, law library closer view to show painted details on the groin vaults - United States Department of Commerce, Bounded by Fourteenth, Fifteenth, and E streets and Constitution Avenue, Washington, District of Columbia, DC

  17. Detail view to show richness of materials such as the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail view to show richness of materials such as the Fourteenth Street vestibule with its gilded groin-vaulted ceiling - United States Department of Commerce, Bounded by Fourteenth, Fifteenth, and E streets and Constitution Avenue, Washington, District of Columbia, DC


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    129. FULL AERIAL VIEW SHOWING FORWARD PORT QUARTER, ENTERING PEARL HARBOR AFTER APOLLO 11 RECOVERY. 26 JULY 1969. (NATIONAL ARCHIVES NO. 428-KN-18090) - U.S.S. HORNET, Puget Sound Naval Shipyard, Sinclair Inlet, Bremerton, Kitsap County, WA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. VIEW SHOWING TRUSSES FROM DECK WITH 4' RANGE POLE AT SECOND VERTICAL POST ON SOUTH SIDE, LOOKING WEST - White River Bridge, Spanning White River at U.S. Highway 70, De Valls Bluff, Prairie County, AR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. LOOKING EAST FROM TOP OF WATER TOWER: VIEW SHOWS BUILDING #626 AND PORTION OF QUADRANGLE - Fort Sam Houston, San Antonio Depot, Water-Watch Tower, Grayson Street & New Braunfels Avenue, San Antonio, Bexar County, TX

  1. General view of the archaeological site showing excavation and revealing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    General view of the archaeological site showing excavation and revealing the steps leading down into the eighteenth-century burial vault - Harry Buck House, North of Main Street (14800 Governor Oden Bowie Drive), Upper Marlboro, Prince George's County, MD

  2. Detail view of stone entrance gate pylon showing carved site ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail view of stone entrance gate pylon showing carved site name and Great Seal of the United States. View looking northeast. - Flanders Field American Cemetery & Memorial, Wortegemseweg 117, Waregem, West Flanders (Belgium)


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. IRON MOUNTAIN SHAFT ROOM TO UNIT #5 SHOWING TYPICAL ARRANGEMENT OF SHAFT AND PUMP IN COLORADO RIVER AQUEDUCT PUMPHOUSES. - Iron Mountain Pump Plant, South of Danby Lake, north of Routes 62 & 177 junction, Rice, San Bernardino County, CA

  4. 19. Interior view of eastern segment of Roundhouse showing clerestory ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. Interior view of eastern segment of Roundhouse showing clerestory lighting and locomotive smoke flues. - Central of Georgia Railway, Savannah Repair Shops & Terminal Facilities, Roundhouse, Site Bounded by West Broad, Jones, West Boundary & Hull, Savannah, Chatham County, GA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. VENTILATION FAN SHOWING RELATIVE POSITION IN THE AIR TUNNEL. - Hot Springs National Park, Bathhouse Row, Ozark Bathhouse: Mechanical & Piping Systems, State Highway 7, 1 mile north of U.S. Highway 70, Hot Springs, Garland County, AR

  8. 3. General view showing rear of looking glass aircraft. View ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. General view showing rear of looking glass aircraft. View to north. - Offutt Air Force Base, Looking Glass Airborne Command Post, Looking Glass Aircraft, On Operational Apron covering northeast half of Project Looking Glass Historic District, Bellevue, Sarpy County, NE

  9. 4. View showing underside of wing, looking glass aircraft. View ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. View showing underside of wing, looking glass aircraft. View to north. - Offutt Air Force Base, Looking Glass Airborne Command Post, Looking Glass Aircraft, On Operational Apron covering northeast half of Project Looking Glass Historic District, Bellevue, Sarpy County, NE


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. INTERIOR OF KITCHEN NO. 1 SHOWING STAINED CABINETRY ON OPPOSITE WALL FROM PAINTED CABINETS. VIEW TO NORTHEAST. - Bishop Creek Hydroelectric System, Plant 6, Cashbaugh-Kilpatrick House, Bishop Creek, Bishop, Inyo County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. GENERAL VIEW, LOOKING NORTH, SHOWING BRIDGE PARAPETS AND SETTING (SCALE ROD IS MEASURED IN FEET) - Spring Lake Bridge, Spanning Bob Barnes Branch at County Road No. 36D, Belleville, Yell County, AR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. DETAIL VIEW, LOOKING NORTH, SHOWING DRAINAGE HOLE AT BASE OF THE INTERIOR NORTH WALL OF THE NORTH ARCH - Spring Lake Bridge, Spanning Bob Barnes Branch at County Road No. 36D, Belleville, Yell County, AR

  16. Overview of interior showing turbine (center) and transformer (left). View ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of interior showing turbine (center) and transformer (left). View to north-northwest - Flint Creek Hydroelectric Project, Powerhouse, Approximately 3 miles southeast of Porters Corner on Powerhouse Road, Philipsburg, Granite County, MT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. DETAIL ALONG WEST SIDE, SHOWING EXTERIOR STAIRWAY, BUILDING NO. 1 IN THE CENTER DISTANCE, AND ONE OF THE BENDING SHOPS AT RIGHT. - United Engineering Company Shipyard, Engineering Building, 2900 Main Street, Alameda, Alameda County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. GENERAL VIEW LOOKING NORTHEAST, SHOWING COKE MACHINE (CENTER), INTERMEDIATE TIPPLE (RIGHT), AND OVENS - Shoaf Mine & Coke Works, East side of Shoaf, off Township Route 472, Shoaf, Fayette County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  2. 30. Perimeter acquisition radar building room #318, showing radar control. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. Perimeter acquisition radar building room #318, showing radar control. Console and line printers - Stanley R. Mickelsen Safeguard Complex, Perimeter Acquisition Radar Building, Limited Access Area, between Limited Access Patrol Road & Service Road A, Nekoma, Cavalier County, ND

  3. 20. Third approach span, comparing pier types and showing guardrail ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. Third approach span, comparing pier types and showing guardrail and connection to arch spring point, looking east - U.S. Route 1 Nottoway River Bridge, U.S. Route 1 spanning Nottoway River, McKenney, Dinwiddie County, VA

  4. 3. Historic American Buildings Survey February, 1953 LOOKING EAST, SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Historic American Buildings Survey February, 1953 LOOKING EAST, SHOWING A GROUP OF HAGERSTOWN HIGH SCHOOL STUDENTS IN THE PROCESS OF UNCOVERING THE ADDITIONAL FOUNDATION - Jonathan Hager House (Foundation), Hagerstown, Washington County, MD


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. VIEW, LOOKING NORTH FROM BOSTON, SHOWING RAILING, PEDESTRIAN STAIR, AND '10 SMOOT' MARKER (see data pages) - Harvard Bridge, Spanning Charles River at Massachusetts Avenue, Boston, Suffolk County, MA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  8. Detail view of Fanno Creek trestle, showing trestle substructure, view ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail view of Fanno Creek trestle, showing trestle substructure, view looking north - Oregon Electric Railroad, Fanno Creek Trestle, Garden Home to Wilsonville Segment, Milepost 34.7, Garden Home, Washington County, OR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. VIEW NORTHWEST SHOWING AQUEDUCT PRISM. NOTE INTERIOR STONE WORK OF THE PARAPET WALL AND REMAINS OF 1920 TIMBER AND CONCRETE FLOORING SYSTEM. - Chesapeake & Ohio Canal, Conococheague Creek Aqueduct, Milepost 99.80, Williamsport, Washington County, MD


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. SOUTH SIDE, EAST HALF, PART 3, SHOWING THE EASTERN PART OF THE OFFICES AND BUILDING NO. 12 IN THE DISTANCE BEYOND THE EAST END. - United Engineering Company Shipyard, Inspection & Repair Shops, 2900 Main Street, Alameda, Alameda County, CA

  11. Interior view of living and dining areas, showing their separation ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Interior view of living and dining areas, showing their separation by medio punto, view towards the north, northeast - Pou Coffee Processing Structure, Casa No. 2, Highway 139, Kilometer 12, Maraguez, Ponce Municipio, PR


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. August, 1971. VIEW ALONG CANAL SHOWING BORDER PATH AND BRIDGE FOR INSPECTION - ABOUT ONE MILE FROM CANAL HEAD. - Hurricane Irrigation Canal, State Route 15 Vicinity, Hurricane, Washington County, UT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    VIEW FROM PLATFORM FACING ROOMS AND SHOWING TRENCH PLATES. - U.S. Naval Base, Pearl Harbor, Drum & Can Loading Facility, South of Arizona Street near Kamehameha Highway, Pearl City, Honolulu County, HI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. GENERAL VIEW SHOWING EARTHEN BERM AROUND STRUCTURE. NOTE INSTRUMENTATION TRENCH IN FOREGROUND RIGHT; VIEW TO WEST. - Cape Canaveral Air Station, Launch Complex 17, Facility 28401, East end of Lighthouse Road, Cape Canaveral, Brevard County, FL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. DETAIL VIEW OF EAST (FRONT) ELEVATION, WITH SCALE, SHOWING ENTRY, WALL FINISH, VARIOUS WINDOWS AND CORNICE - Sacred Heart Church at Whitemarsh, 16101 Annapolis Road, Bowie, Prince George's County, MD

  17. 7. Contextual view to eastnortheast showing downstream (west) side of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. Contextual view to east-northeast showing downstream (west) side of bridge in setting, depicting dense riparian nature of area. - Stanislaus River Bridge, Atchison, Topeka & Santa Fe Railway at Stanislaus River, Riverbank, Stanislaus County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  20. Detail, east truss of south span, showing railing, vertical UL, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Detail, east truss of south span, showing railing, vertical U-L, diagonal eyebar U-L with turnbuckle - Castle Garden Bridge, Township Route 343 over Bennetts Branch of Sinnemahoning Creek, Driftwood, Cameron County, PA

  1. 1. General view of stockyards from livestock exchange building showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. General view of stockyards from livestock exchange building showing (l-r) cattle pens and Buckingham Road, which terminates at "L" Street. View to north. - South Omaha Union Stock Yards, 2900 "O" Plaza, Omaha, Douglas County, NE


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. FIRST FLOOR, FIRE ENGINE GARAGE, VIEW SHOWING STAIRWAY AND FIRE POLE (NOTE THE STAMPWORK ON WALL AND CEILING) - Hoboken Fire Engine Company Number Two, 1313 Washington Street, Hoboken, Hudson County, NJ


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. SHOWING RELATION OF FIRE CONTROL BUILDING, WATER TANK, AND TOWER, LOOKING SOUTH - Boswell Bay White Alice Site, Fire Control Building, Chugach National Forest, Cordova, Valdez-Cordova Census Area, AK

  4. 3. Oblique view of 215 Division Street, looking southeast, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Oblique view of 215 Division Street, looking southeast, showing rear (west) facade and north side, Fairbanks Company appears at left and 215 Division Street is visible at right - 215 Division Street (House), Rome, Floyd County, GA

  5. 1. Oblique view of 215 Division Street, looking southwest, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Oblique view of 215 Division Street, looking southwest, showing front (east) facade and north side, 213 Division Street is visible at left and 217 Division Street appears at right - 215 Division Street (House), Rome, Floyd County, GA

  6. 2. Oblique view of 215 Division Street, looking northeast, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Oblique view of 215 Division Street, looking northeast, showing rear (west) facade and south side, 217 Division Street is visible at left and Fairbanks Company appears at right - 215 Division Street (House), Rome, Floyd County, GA

  7. 3. Oblique view of 213 Division Street, looking northeast, showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Oblique view of 213 Division Street, looking northeast, showing rear (west) facade and south side, 215 Division Street is visible at left and Fairbanks Company appears at right - 213 Division Street (House), Rome, Floyd County, GA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. VIEW OF CENTER OF NORTH SECTION, SECOND FLOOR, SHOWING TYPICAL SPACE AND STRUCTURAL CONFIGURATION, LOOKING EAST - Massachusetts Mills, Cloth Room-Section 15, 95 Bridge Street, Lowell, Middlesex County, MA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. SOUTHWEST CORNER OF BANKING ROOM, FROM EAST, SHOWING CLOCK ON SOUTH WALL AND TWO MEZZANINES BEYOND COLUMNS - Philadelphia Saving Fund Society, Twelfth & Market Streets, Philadelphia, Philadelphia County, PA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. VIEW FROM SOUTHWEST SHOWING WEST SIDE OF PIER AND PEDESTRIAN BRIDGE CONNECTING MARINE MAMMAL PAVILION WITH BALTIMORE AQUARIUM - Baltimore Inner Harbor, Pier 4, South side of Pratt Street between Frederick Street & Market Place, Baltimore, Independent City, MD


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GROUND VIEW OF PIER, LOOKING SOUTH FROM BEACH; SHOWING (LEFT-RIGHT) CAPTAIN'S GALLEY'S GALLEY TO END OF PIER - Huntington Beach Municipal Pier, Pacific Coast Highway at Main Street, Huntington Beach, Orange County, CA


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BEACH ROAD SHOWING THE LAWN WITH KIAWE TREES BETWEEN THE ROAD AND THE BEACH. BEACH ROAD IS 14' WIDE. VIEW FACING SOUTH. - Hickam Field, Fort Kamehameha Historic Housing, Along Worchester Avenue & Hope Street, Honolulu, Honolulu County, HI


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. LARGE MOLD MAKING MACHINE, GREY IRON UNIT #4 SHOWING PATTERNS THAT FLASKS FIT OVER PRIOR TO BEING FILLED WITH SAND AND COMPRESSED. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    OVERALL VIEW OF SOUTHERN DUCTILE'S PATTERN REPAIR SHOP, SHOWING A SPANISH-MADE FORADIA BORING MACHINE IN THE FOREGROUND. - Southern Ductile Casting Company, Mold Making, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  20. Center pivot, showing substantial beams that support the trusses. Looking ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Center pivot, showing substantial beams that support the trusses. Looking north from civilian land. - Naval Supply Annex Stockton, Daggett Road Bridge, Daggett Road traversing Burns Cut Off, Stockton, San Joaquin County, CA