Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Single molecule counting and assessment of random molecular tagging errors with transposable giga-scale error-correcting barcodes.

PubMed

Lau, Billy T; Ji, Hanlee P

2017-09-21

RNA-Seq measures gene expression by counting sequence reads belonging to unique cDNA fragments. Molecular barcodes commonly in the form of random nucleotides were recently introduced to improve gene expression measures by detecting amplification duplicates, but are susceptible to errors generated during PCR and sequencing. This results in false positive counts, leading to inaccurate transcriptome quantification especially at low input and single-cell RNA amounts where the total number of molecules present is minuscule. To address this issue, we demonstrated the systematic identification of molecular species using transposable error-correcting barcodes that are exponentially expanded to tens of billions of unique labels. We experimentally showed random-mer molecular barcodes suffer from substantial and persistent errors that are difficult to resolve. To assess our method's performance, we applied it to the analysis of known reference RNA standards. By including an inline random-mer molecular barcode, we systematically characterized the presence of sequence errors in random-mer molecular barcodes. We observed that such errors are extensive and become more dominant at low input amounts. We described the first study to use transposable molecular barcodes and its use for studying random-mer molecular barcode errors. Extensive errors found in random-mer molecular barcodes may warrant the use of error correcting barcodes for transcriptome analysis as input amounts decrease.

Optimization of High-Throughput Sequencing Kinetics for determining enzymatic rate constants of thousands of RNA substrates

PubMed Central

Niland, Courtney N.; Jankowsky, Eckhard; Harris, Michael E.

2016-01-01

Quantification of the specificity of RNA binding proteins and RNA processing enzymes is essential to understanding their fundamental roles in biological processes. High Throughput Sequencing Kinetics (HTS-Kin) uses high throughput sequencing and internal competition kinetics to simultaneously monitor the processing rate constants of thousands of substrates by RNA processing enzymes. This technique has provided unprecedented insight into the substrate specificity of the tRNA processing endonuclease ribonuclease P. Here, we investigate the accuracy and robustness of measurements associated with each step of the HTS-Kin procedure. We examine the effect of substrate concentration on the observed rate constant, determine the optimal kinetic parameters, and provide guidelines for reducing error in amplification of the substrate population. Importantly, we find that high-throughput sequencing, and experimental reproducibility contribute their own sources of error, and these are the main sources of imprecision in the quantified results when otherwise optimized guidelines are followed. PMID:27296633

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki)

PubMed Central

2013-01-01

Background The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. Results We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Conclusions Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools. PMID:24209455

Design of RNA splicing analysis null models for post hoc filtering of Drosophila head RNA-Seq data with the splicing analysis kit (Spanki).

PubMed

Sturgill, David; Malone, John H; Sun, Xia; Smith, Harold E; Rabinow, Leonard; Samson, Marie-Laure; Oliver, Brian

2013-11-09

The production of multiple transcript isoforms from one gene is a major source of transcriptome complexity. RNA-Seq experiments, in which transcripts are converted to cDNA and sequenced, allow the resolution and quantification of alternative transcript isoforms. However, methods to analyze splicing are underdeveloped and errors resulting in incorrect splicing calls occur in every experiment. We used RNA-Seq data to develop sequencing and aligner error models. By applying these error models to known input from simulations, we found that errors result from false alignment to minor splice motifs and antisense stands, shifted junction positions, paralog joining, and repeat induced gaps. By using a series of quantitative and qualitative filters, we eliminated diagnosed errors in the simulation, and applied this to RNA-Seq data from Drosophila melanogaster heads. We used high-confidence junction detections to specifically interrogate local splicing differences between transcripts. This method out-performed commonly used RNA-seq methods to identify known alternative splicing events in the Drosophila sex determination pathway. We describe a flexible software package to perform these tasks called Splicing Analysis Kit (Spanki), available at http://www.cbcb.umd.edu/software/spanki. Splice-junction centric analysis of RNA-Seq data provides advantages in specificity for detection of alternative splicing. Our software provides tools to better understand error profiles in RNA-Seq data and improve inference from this new technology. The splice-junction centric approach that this software enables will provide more accurate estimates of differentially regulated splicing than current tools.

Exome Sequence Reveals Mutations in CoA Synthase as a Cause of Neurodegeneration with Brain Iron Accumulation

PubMed Central

Dusi, Sabrina; Valletta, Lorella; Haack, Tobias B.; Tsuchiya, Yugo; Venco, Paola; Pasqualato, Sebastiano; Goffrini, Paola; Tigano, Marco; Demchenko, Nikita; Wieland, Thomas; Schwarzmayr, Thomas; Strom, Tim M.; Invernizzi, Federica; Garavaglia, Barbara; Gregory, Allison; Sanford, Lynn; Hamada, Jeffrey; Bettencourt, Conceição; Houlden, Henry; Chiapparini, Luisa; Zorzi, Giovanna; Kurian, Manju A.; Nardocci, Nardo; Prokisch, Holger; Hayflick, Susan; Gout, Ivan; Tiranti, Valeria

2014-01-01

Neurodegeneration with brain iron accumulation (NBIA) comprises a clinically and genetically heterogeneous group of disorders with progressive extrapyramidal signs and neurological deterioration, characterized by iron accumulation in the basal ganglia. Exome sequencing revealed the presence of recessive missense mutations in COASY, encoding coenzyme A (CoA) synthase in one NBIA-affected subject. A second unrelated individual carrying mutations in COASY was identified by Sanger sequence analysis. CoA synthase is a bifunctional enzyme catalyzing the final steps of CoA biosynthesis by coupling phosphopantetheine with ATP to form dephospho-CoA and its subsequent phosphorylation to generate CoA. We demonstrate alterations in RNA and protein expression levels of CoA synthase, as well as CoA amount, in fibroblasts derived from the two clinical cases and in yeast. This is the second inborn error of coenzyme A biosynthesis to be implicated in NBIA. PMID:24360804

Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

PubMed Central

Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

2012-01-01

RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.

PubMed

Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi

2016-11-15

Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.

Mutation-adapted U1 snRNA corrects a splicing error of the dopa decarboxylase gene.

PubMed

Lee, Ni-Chung; Lee, Yu-May; Chen, Pin-Wen; Byrne, Barry J; Hwu, Wuh-Liang

2016-12-01

Aromatic l-amino acid decarboxylase (AADC) deficiency is an inborn error of monoamine neurotransmitter synthesis, which results in dopamine, serotonin, epinephrine and norepinephrine deficiencies. The DDC gene founder mutation IVS6 + 4A > T is highly prevalent in Chinese patients with AADC deficiency. In this study, we designed several U1 snRNA vectors to adapt U1 snRNA binding sequences of the mutated DDC gene. We found that only the modified U1 snRNA (IVS-AAA) that completely matched both the intronic and exonic U1 binding sequences of the mutated DDC gene could correct splicing errors of either the mutated human DDC minigene or the mouse artificial splicing construct in vitro. We further injected an adeno-associated viral (AAV) vector to express IVS-AAA in the brain of a knock-in mouse model. This treatment was well tolerated and improved both the survival and brain dopamine and serotonin levels of mice with AADC deficiency. Therefore, mutation-adapted U1 snRNA gene therapy can be a promising method to treat genetic diseases caused by splicing errors, but the efficiency of such a treatment still needs improvements. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Thermodynamic Basis for the Emergence of Genomes during Prebiotic Evolution

PubMed Central

Woo, Hyung-June; Vijaya Satya, Ravi; Reifman, Jaques

2012-01-01

The RNA world hypothesis views modern organisms as descendants of RNA molecules. The earliest RNA molecules must have been random sequences, from which the first genomes that coded for polymerase ribozymes emerged. The quasispecies theory by Eigen predicts the existence of an error threshold limiting genomic stability during such transitions, but does not address the spontaneity of changes. Following a recent theoretical approach, we applied the quasispecies theory combined with kinetic/thermodynamic descriptions of RNA replication to analyze the collective behavior of RNA replicators based on known experimental kinetics data. We find that, with increasing fidelity (relative rate of base-extension for Watson-Crick versus mismatched base pairs), replications without enzymes, with ribozymes, and with protein-based polymerases are above, near, and below a critical point, respectively. The prebiotic evolution therefore must have crossed this critical region. Over large regions of the phase diagram, fitness increases with increasing fidelity, biasing random drifts in sequence space toward ‘crystallization.’ This region encloses the experimental nonenzymatic fidelity value, favoring evolutions toward polymerase sequences with ever higher fidelity, despite error rates above the error catastrophe threshold. Our work shows that experimentally characterized kinetics and thermodynamics of RNA replication allow us to determine the physicochemical conditions required for the spontaneous crystallization of biological information. Our findings also suggest that among many potential oligomers capable of templated replication, RNAs may have evolved to form prebiotic genomes due to the value of their nonenzymatic fidelity. PMID:22693440

Local neutral networks help maintain inaccurately replicating ribozymes.

PubMed

Szilágyi, András; Kun, Ádám; Szathmáry, Eörs

2014-01-01

The error threshold of replication limits the selectively maintainable genome size against recurrent deleterious mutations for most fitness landscapes. In the context of RNA replication a distinction between the genotypic and the phenotypic error threshold has been made; where the latter concerns the maintenance of secondary structure rather than sequence. RNA secondary structure is treated as a proxy for function. The phenotypic error threshold allows higher per digit mutation rates than its genotypic counterpart, and is known to increase with the frequency of neutral mutations in sequence space. Here we show that the degree of neutrality, i.e. the frequency of nearest-neighbour (one-step) neutral mutants is a remarkably accurate proxy for the overall frequency of such mutants in an experimentally verifiable formula for the phenotypic error threshold; this we achieve by the full numerical solution for the concentration of all sequences in mutation-selection balance up to length 16. We reinforce our previous result that currently known ribozymes could be selectively maintained by the accuracy known from the best available polymerase ribozymes. Furthermore, we show that in silico stabilizing selection can increase the mutational robustness of ribozymes due to the fact that they were produced by artificial directional selection in the first place. Our finding offers a better understanding of the error threshold and provides further insight into the plausibility of an ancient RNA world.

Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

2008-06-06

Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

Circular RNAs are abundant, conserved, and associated with ALU repeats

PubMed Central

Jeck, William R.; Sorrentino, Jessica A.; Wang, Kai; Slevin, Michael K.; Burd, Christin E.; Liu, Jinze; Marzluff, William F.; Sharpless, Norman E.

2013-01-01

Circular RNAs composed of exonic sequence have been described in a small number of genes. Thought to result from splicing errors, circular RNA species possess no known function. To delineate the universe of endogenous circular RNAs, we performed high-throughput sequencing (RNA-seq) of libraries prepared from ribosome-depleted RNA with or without digestion with the RNA exonuclease, RNase R. We identified >25,000 distinct RNA species in human fibroblasts that contained non-colinear exons (a “backsplice”) and were reproducibly enriched by exonuclease degradation of linear RNA. These RNAs were validated as circular RNA (ecircRNA), rather than linear RNA, and were more stable than associated linear mRNAs in vivo. In some cases, the abundance of circular molecules exceeded that of associated linear mRNA by >10-fold. By conservative estimate, we identified ecircRNAs from 14.4% of actively transcribed genes in human fibroblasts. Application of this method to murine testis RNA identified 69 ecircRNAs in precisely orthologous locations to human circular RNAs. Of note, paralogous kinases HIPK2 and HIPK3 produce abundant ecircRNA from their second exon in both humans and mice. Though HIPK3 circular RNAs contain an AUG translation start, it and other ecircRNAs were not bound to ribosomes. Circular RNAs could be degraded by siRNAs and, therefore, may act as competing endogenous RNAs. Bioinformatic analysis revealed shared features of circularized exons, including long bordering introns that contained complementary ALU repeats. These data show that ecircRNAs are abundant, stable, conserved and nonrandom products of RNA splicing that could be involved in control of gene expression. PMID:23249747

Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stenger, Drake C., E-mail: drake.stenger@ars.usda.

Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

The organization and expression of the mdm2 gene.

PubMed

de Oca Luna, R M; Tabor, A D; Eberspaecher, H; Hulboy, D L; Worth, L L; Colman, M S; Finlay, C A; Lozano, G

1996-05-01

The mdm2 gene encodes a zinc finger protein that negatively regulates p53 function by binding and masking the p53 transcriptional activation domain. Two different promoters control expression of mdm2, one of which is also transactivated by p53. We cloned and characterized the mdm2 gene from a murine 129 library. It contained at least 12 exons and spanned approximately 25 kb of DNA. Sequencing of the mdm2 gene revealed three nucleotide differences that resulted in amino acid substitutions in the previously published mdm2 sequence. Sequencing of normal BalbC/J DNA and the original cosmid clone isolated from the 3T3DM cell line revealed that they are identical, suggesting that the published sequence is in error at these three positions. In addition, we analyzed the expression pattern of mdm2 and found ubiquitous low-level expression throughout embryo development and in adult tissues. Analysis of mRNA from numerous tissues for several mdm2 spliced variants that had been identified in the transformed 3T3DM cell line revealed that these variants could not be detected in the developing embryo or in adult tissues.

Exome sequence reveals mutations in CoA synthase as a cause of neurodegeneration with brain iron accumulation.

PubMed

Dusi, Sabrina; Valletta, Lorella; Haack, Tobias B; Tsuchiya, Yugo; Venco, Paola; Pasqualato, Sebastiano; Goffrini, Paola; Tigano, Marco; Demchenko, Nikita; Wieland, Thomas; Schwarzmayr, Thomas; Strom, Tim M; Invernizzi, Federica; Garavaglia, Barbara; Gregory, Allison; Sanford, Lynn; Hamada, Jeffrey; Bettencourt, Conceição; Houlden, Henry; Chiapparini, Luisa; Zorzi, Giovanna; Kurian, Manju A; Nardocci, Nardo; Prokisch, Holger; Hayflick, Susan; Gout, Ivan; Tiranti, Valeria

2014-01-02

Neurodegeneration with brain iron accumulation (NBIA) comprises a clinically and genetically heterogeneous group of disorders with progressive extrapyramidal signs and neurological deterioration, characterized by iron accumulation in the basal ganglia. Exome sequencing revealed the presence of recessive missense mutations in COASY, encoding coenzyme A (CoA) synthase in one NBIA-affected subject. A second unrelated individual carrying mutations in COASY was identified by Sanger sequence analysis. CoA synthase is a bifunctional enzyme catalyzing the final steps of CoA biosynthesis by coupling phosphopantetheine with ATP to form dephospho-CoA and its subsequent phosphorylation to generate CoA. We demonstrate alterations in RNA and protein expression levels of CoA synthase, as well as CoA amount, in fibroblasts derived from the two clinical cases and in yeast. This is the second inborn error of coenzyme A biosynthesis to be implicated in NBIA. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Single-cell full-length total RNA sequencing uncovers dynamics of recursive splicing and enhancer RNAs.

PubMed

Hayashi, Tetsutaro; Ozaki, Haruka; Sasagawa, Yohei; Umeda, Mana; Danno, Hiroki; Nikaido, Itoshi

2018-02-12

Total RNA sequencing has been used to reveal poly(A) and non-poly(A) RNA expression, RNA processing and enhancer activity. To date, no method for full-length total RNA sequencing of single cells has been developed despite the potential of this technology for single-cell biology. Here we describe random displacement amplification sequencing (RamDA-seq), the first full-length total RNA-sequencing method for single cells. Compared with other methods, RamDA-seq shows high sensitivity to non-poly(A) RNA and near-complete full-length transcript coverage. Using RamDA-seq with differentiation time course samples of mouse embryonic stem cells, we reveal hundreds of dynamically regulated non-poly(A) transcripts, including histone transcripts and long noncoding RNA Neat1. Moreover, RamDA-seq profiles recursive splicing in >300-kb introns. RamDA-seq also detects enhancer RNAs and their cell type-specific activity in single cells. Taken together, we demonstrate that RamDA-seq could help investigate the dynamics of gene expression, RNA-processing events and transcriptional regulation in single cells.

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.

PubMed

Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne

2011-06-01

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

PubMed

Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

2016-11-01

High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Fast preparation of a long chimeric armored RNA as controls for external quality assessment for molecular detection of Zika virus.

PubMed

Lin, Guigao; Zhang, Kuo; Zhang, Dong; Han, Yanxi; Xie, Jiehong; Li, Jinming

2017-03-01

The emergence of Zika virus demands accurate laboratory diagnostics. Nucleic acid testing is currently the definitive method for diagnosis of Zika infection. In 2016, an external quality assurance (EQA) for assessing the quality of molecular testing of Zika virus was carried out in China. A single armored RNA encapsulating a 4942-nucleotides (nt) long specific RNA sequence of Zika virus was prepared and used as positive samples. A pre-tested EQA panel, consisting of 4 negative and 6 positive samples with different concentrations of armored RNA, was distributed to 38 laboratories that perform molecular detection of Zika virus. A total of 39 data sets (1 laboratory used two test kits in parallel), produced by using commercial (n=38) or laboratory developed (n=1) quantitative reverse-transcriptase PCR (qRT-PCR) kits, were received. Of these, 35 (89.7%) had correct results for all 10 samples, and 4 (10.3%) reported at least 1 error (11 in total). The testing errors were all false-negatives, highlighting the need of improvements in detecting sensitivity. The EQA reveals that the majority of participating laboratories are proficient in molecular testing of Zika virus. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular dynamics simulations of viral RNA polymerases link conserved and correlated motions of functional elements to fidelity

PubMed Central

Moustafa, Ibrahim M.; Shen, Hujun; Morton, Brandon; Colina, Coray M.; Cameron, Craig E.

2011-01-01

The viral RNA-dependent RNA polymerase (RdRp) is essential for multiplication of all RNA viruses. The sequence diversity of an RNA virus population contributes to its ability to infect the host. This diversity emanates from errors made by the RdRp during RNA synthesis. The physical basis for RdRp fidelity is unclear but is linked to conformational changes occurring during the nucleotide-addition cycle. To understand RdRp dynamics that might influence RdRp function, we have analyzed all-atom molecular dynamics (MD) simulations on the nanosecond timescale of four RdRps from the picornavirus family that exhibit 30–74% sequence identity. Principal component analysis showed that the major motions observed during the simulations derived from conserved structural motifs and regions of known function. Dynamics of residues participating in the same biochemical property, for example RNA binding, nucleotide binding or catalysis, were correlated even when spatially distant on the RdRp structure. The conserved and correlated dynamics of functional, structural elements suggest co-evolution of dynamics with structure and function of the RdRp. Crystal structures of all picornavirus RdRps exhibit a template-nascent RNA duplex channel too small to fully accommodate duplex RNA. Simulations revealed opening and closing motions of the RNA and NTP channels, which might be relevant to NTP entry, PPi exit and translocation. A role for nanosecond timescale dynamics in RdRp fidelity is supported by altered dynamics of the high-fidelity G64S derivative of PV RdRp relative to wild-type enzyme. PMID:21575642

Mapping RNA-seq Reads with STAR

PubMed Central

Dobin, Alexander; Gingeras, Thomas R.

2015-01-01

Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, signal visualization, and so forth. In this unit we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is Open Source software that can be run on Unix, Linux or Mac OS X systems. PMID:26334920

Mapping RNA-seq Reads with STAR.

PubMed

Dobin, Alexander; Gingeras, Thomas R

2015-09-03

Mapping of large sets of high-throughput sequencing reads to a reference genome is one of the foundational steps in RNA-seq data analysis. The STAR software package performs this task with high levels of accuracy and speed. In addition to detecting annotated and novel splice junctions, STAR is capable of discovering more complex RNA sequence arrangements, such as chimeric and circular RNA. STAR can align spliced sequences of any length with moderate error rates, providing scalability for emerging sequencing technologies. STAR generates output files that can be used for many downstream analyses such as transcript/gene expression quantification, differential gene expression, novel isoform reconstruction, and signal visualization. In this unit, we describe computational protocols that produce various output files, use different RNA-seq datatypes, and utilize different mapping strategies. STAR is open source software that can be run on Unix, Linux, or Mac OS X systems. Copyright © 2015 John Wiley & Sons, Inc.

Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steven, Blaire; Hesse, Cedar; Soghigian, John

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Simulated rRNA/DNA Ratios Show Potential To Misclassify Active Populations as Dormant

DOE PAGES

Steven, Blaire; Hesse, Cedar; Soghigian, John; ...

2017-03-31

The use of rRNA/DNA ratios derived from surveys of rRNA sequences in RNA and DNA extracts is an appealing but poorly validated approach to infer the activity status of environmental microbes. To improve the interpretation of rRNA/DNA ratios, we performed simulations to investigate the effects of community structure, rRNA amplification, and sampling depth on the accuracy of rRNA/DNA ratios in classifying bacterial populations as “active” or “dormant.” Community structure was an insignificant factor. In contrast, the extent of rRNA amplification that occurs as cells transition from dormant to growing had a significant effect (P < 0.0001) on classification accuracy, withmore » misclassification errors ranging from 16 to 28%, depending on the rRNA amplification model. The error rate increased to 47% when communities included a mixture of rRNA amplification models, but most of the inflated error was false negatives (i.e., active populations misclassified as dormant). Sampling depth also affected error rates (P < 0.001). Inadequate sampling depth produced various artifacts that are characteristic of rRNA/DNA ratios generated from real communities. These data show important constraints on the use of rRNA/DNA ratios to infer activity status. Whereas classification of populations as active based on rRNA/DNA ratios appears generally valid, classification of populations as dormant is potentially far less accurate.« less

Rational truncation of an RNA aptamer to prostate-specific membrane antigen using computational structural modeling.

PubMed

Rockey, William M; Hernandez, Frank J; Huang, Sheng-You; Cao, Song; Howell, Craig A; Thomas, Gregory S; Liu, Xiu Ying; Lapteva, Natalia; Spencer, David M; McNamara, James O; Zou, Xiaoqin; Chen, Shi-Jie; Giangrande, Paloma H

2011-10-01

RNA aptamers represent an emerging class of pharmaceuticals with great potential for targeted cancer diagnostics and therapy. Several RNA aptamers that bind cancer cell-surface antigens with high affinity and specificity have been described. However, their clinical potential has yet to be realized. A significant obstacle to the clinical adoption of RNA aptamers is the high cost of manufacturing long RNA sequences through chemical synthesis. Therapeutic aptamers are often truncated postselection by using a trial-and-error process, which is time consuming and inefficient. Here, we used a "rational truncation" approach guided by RNA structural prediction and protein/RNA docking algorithms that enabled us to substantially truncateA9, an RNA aptamer to prostate-specific membrane antigen (PSMA),with great potential for targeted therapeutics. This truncated PSMA aptamer (A9L; 41mer) retains binding activity, functionality, and is amenable to large-scale chemical synthesis for future clinical applications. In addition, the modeled RNA tertiary structure and protein/RNA docking predictions revealed key nucleotides within the aptamer critical for binding to PSMA and inhibiting its enzymatic activity. Finally, this work highlights the utility of existing RNA structural prediction and protein docking techniques that may be generally applicable to developing RNA aptamers optimized for therapeutic use.

Transcription profile of boar spermatozoa as revealed by RNA-sequencing

USDA-ARS?s Scientific Manuscript database

High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...

Evaluation of logistic regression models and effect of covariates for case-control study in RNA-Seq analysis.

PubMed

Choi, Seung Hoan; Labadorf, Adam T; Myers, Richard H; Lunetta, Kathryn L; Dupuis, Josée; DeStefano, Anita L

2017-02-06

Next generation sequencing provides a count of RNA molecules in the form of short reads, yielding discrete, often highly non-normally distributed gene expression measurements. Although Negative Binomial (NB) regression has been generally accepted in the analysis of RNA sequencing (RNA-Seq) data, its appropriateness has not been exhaustively evaluated. We explore logistic regression as an alternative method for RNA-Seq studies designed to compare cases and controls, where disease status is modeled as a function of RNA-Seq reads using simulated and Huntington disease data. We evaluate the effect of adjusting for covariates that have an unknown relationship with gene expression. Finally, we incorporate the data adaptive method in order to compare false positive rates. When the sample size is small or the expression levels of a gene are highly dispersed, the NB regression shows inflated Type-I error rates but the Classical logistic and Bayes logistic (BL) regressions are conservative. Firth's logistic (FL) regression performs well or is slightly conservative. Large sample size and low dispersion generally make Type-I error rates of all methods close to nominal alpha levels of 0.05 and 0.01. However, Type-I error rates are controlled after applying the data adaptive method. The NB, BL, and FL regressions gain increased power with large sample size, large log2 fold-change, and low dispersion. The FL regression has comparable power to NB regression. We conclude that implementing the data adaptive method appropriately controls Type-I error rates in RNA-Seq analysis. Firth's logistic regression provides a concise statistical inference process and reduces spurious associations from inaccurately estimated dispersion parameters in the negative binomial framework.

Experimental evidence that RNA recombination occurs in the Japanese encephalitis virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, C.-K.; Chen, W.-J., E-mail: wjchen@mail.cgu.edu.t; Department of Public Health and Parasitology, Chang Gung University, Kwei-San, Tao-Yuan 33332, Taiwan

2009-11-25

Due to the lack of a proofreading function and error-repairing ability of genomic RNA, accumulated mutations are known to be a force driving viral evolution in the genus Flavivirus, including the Japanese encephalitis (JE) virus. Based on sequencing data, RNA recombination was recently postulated to be another factor associated with genomic variations in these viruses. We herein provide experimental evidence to demonstrate the occurrence of RNA recombination in the JE virus using two local pure clones (T1P1-S1 and CJN-S1) respectively derived from the local strains, T1P1 and CJN. Based on results from a restriction fragment length polymorphism (RFLP) assay onmore » the C/preM junction comprising a fragment of 868 nucleotides (nt 10-877), the recombinant progeny virus was primarily formed in BHK-21 cells that had been co-infected with the two clones used in this study. Nine of 20 recombinant forms of the JE virus had a crossover in the nt 123-323 region. Sequencing data derived from these recombinants revealed that no nucleotide deletion or insertion occurred in this region favoring crossovers, indicating that precisely, not aberrantly, homologous recombination was involved. With site-directed mutagenesis, three stem-loop secondary structures were destabilized and re-stabilized in sequence, leading to changes in the frequency of recombination. This suggests that the conformation, not the free energy, of the secondary structure is important in modulating RNA recombination of the virus. It was concluded that because RNA recombination generates genetic diversity in the JE virus, this must be considered particularly in studies of viral evolution, epidemiology, and possible vaccine safety.« less

Insight into biases and sequencing errors for amplicon sequencing with the Illumina MiSeq platform.

PubMed

Schirmer, Melanie; Ijaz, Umer Z; D'Amore, Rosalinda; Hall, Neil; Sloan, William T; Quince, Christopher

2015-03-31

With read lengths of currently up to 2 × 300 bp, high throughput and low sequencing costs Illumina's MiSeq is becoming one of the most utilized sequencing platforms worldwide. The platform is manageable and affordable even for smaller labs. This enables quick turnaround on a broad range of applications such as targeted gene sequencing, metagenomics, small genome sequencing and clinical molecular diagnostics. However, Illumina error profiles are still poorly understood and programs are therefore not designed for the idiosyncrasies of Illumina data. A better knowledge of the error patterns is essential for sequence analysis and vital if we are to draw valid conclusions. Studying true genetic variation in a population sample is fundamental for understanding diseases, evolution and origin. We conducted a large study on the error patterns for the MiSeq based on 16S rRNA amplicon sequencing data. We tested state-of-the-art library preparation methods for amplicon sequencing and showed that the library preparation method and the choice of primers are the most significant sources of bias and cause distinct error patterns. Furthermore we tested the efficiency of various error correction strategies and identified quality trimming (Sickle) combined with error correction (BayesHammer) followed by read overlapping (PANDAseq) as the most successful approach, reducing substitution error rates on average by 93%. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of the mammalian miRNA turnover landscape

PubMed Central

Guo, Yanwen; Liu, Jun; Elfenbein, Sarah J.; Ma, Yinghong; Zhong, Mei; Qiu, Caihong; Ding, Ye; Lu, Jun

2015-01-01

Steady state cellular microRNA (miRNA) levels represent the balance between miRNA biogenesis and turnover. The kinetics and sequence determinants of mammalian miRNA turnover during and after miRNA maturation are not fully understood. Through a large-scale study on mammalian miRNA turnover, we report the co-existence of multiple cellular miRNA pools with distinct turnover kinetics and biogenesis properties and reveal previously unrecognized sequence features for fast turnover miRNAs. We measured miRNA turnover rates in eight mammalian cell types with a combination of expression profiling and deep sequencing. While most miRNAs are stable, a subset of miRNAs, mostly miRNA*s, turnovers quickly, many of which display a two-step turnover kinetics. Moreover, different sequence isoforms of the same miRNA can possess vastly different turnover rates. Fast turnover miRNA isoforms are enriched for 5′ nucleotide bias against Argonaute-(AGO)-loading, but also additional 3′ and central sequence features. Modeling based on two fast turnover miRNA*s miR-222-5p and miR-125b-1-3p, we unexpectedly found that while both miRNA*s are associated with AGO, they strongly differ in HSP90 association and sensitivity to HSP90 inhibition. Our data characterize the landscape of genome-wide miRNA turnover in cultured mammalian cells and reveal differential HSP90 requirements for different miRNA*s. Our findings also implicate rules for designing stable small RNAs, such as siRNAs. PMID:25653157

Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions

PubMed Central

Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.

2011-01-01

SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238

How Messenger RNA and Nascent Chain Sequences Regulate Translation Elongation.

PubMed

Choi, Junhong; Grosely, Rosslyn; Prabhakar, Arjun; Lapointe, Christopher P; Wang, Jinfan; Puglisi, Joseph D

2018-06-20

Translation elongation is a highly coordinated, multistep, multifactor process that ensures accurate and efficient addition of amino acids to a growing nascent-peptide chain encoded in the sequence of translated messenger RNA (mRNA). Although translation elongation is heavily regulated by external factors, there is clear evidence that mRNA and nascent-peptide sequences control elongation dynamics, determining both the sequence and structure of synthesized proteins. Advances in methods have driven experiments that revealed the basic mechanisms of elongation as well as the mechanisms of regulation by mRNA and nascent-peptide sequences. In this review, we highlight how mRNA and nascent-peptide elements manipulate the translation machinery to alter the dynamics and pathway of elongation.

Complete nucleotide sequences and genome characterization of a novel double-stranded RNA virus infecting Rosa multiflora.

PubMed

Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib

2008-01-01

The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.

The Model-Based Study of the Effectiveness of Reporting Lists of Small Feature Sets Using RNA-Seq Data.

PubMed

Kim, Eunji; Ivanov, Ivan; Hua, Jianping; Lampe, Johanna W; Hullar, Meredith Aj; Chapkin, Robert S; Dougherty, Edward R

2017-01-01

Ranking feature sets for phenotype classification based on gene expression is a challenging issue in cancer bioinformatics. When the number of samples is small, all feature selection algorithms are known to be unreliable, producing significant error, and error estimators suffer from different degrees of imprecision. The problem is compounded by the fact that the accuracy of classification depends on the manner in which the phenomena are transformed into data by the measurement technology. Because next-generation sequencing technologies amount to a nonlinear transformation of the actual gene or RNA concentrations, they can potentially produce less discriminative data relative to the actual gene expression levels. In this study, we compare the performance of ranking feature sets derived from a model of RNA-Seq data with that of a multivariate normal model of gene concentrations using 3 measures: (1) ranking power, (2) length of extensions, and (3) Bayes features. This is the model-based study to examine the effectiveness of reporting lists of small feature sets using RNA-Seq data and the effects of different model parameters and error estimators. The results demonstrate that the general trends of the parameter effects on the ranking power of the underlying gene concentrations are preserved in the RNA-Seq data, whereas the power of finding a good feature set becomes weaker when gene concentrations are transformed by the sequencing machine.

Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

PubMed Central

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

PubMed

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Integrated sequencing of exome and mRNA of large-sized single cells.

PubMed

Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang

2018-01-10

Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.

Methods of automatic nucleotide-sequence analysis. Multicomponent spectrophotometric analysis of mixtures of nucleic acid components by a least-squares procedure

PubMed Central

Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.

1965-01-01

1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087

Mutation in a primate-conserved retrotransposon reveals a noncoding RNA as a mediator of infantile encephalopathy

PubMed Central

Cartault, François; Munier, Patrick; Benko, Edgar; Desguerre, Isabelle; Hanein, Sylvain; Boddaert, Nathalie; Bandiera, Simonetta; Vellayoudom, Jeanine; Krejbich-Trotot, Pascale; Bintner, Marc; Hoarau, Jean-Jacques; Girard, Muriel; Génin, Emmanuelle; de Lonlay, Pascale; Fourmaintraux, Alain; Naville, Magali; Rodriguez, Diana; Feingold, Josué; Renouil, Michel; Munnich, Arnold; Westhof, Eric; Fähling, Michael; Lyonnet, Stanislas; Henrion-Caude, Alexandra

2012-01-01

The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. Here we report homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. We show here that a mutation in a unique transposable element-containing RNA is associated with lethal encephalopathy, and we suggest that RNAs that harbor evolutionarily recent repetitive elements may play important roles in human brain development. PMID:22411793

Integrative analysis of Arabidopsis thaliana transcriptomics reveals intuitive splicing mechanism for circular RNA.

PubMed

Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei

2016-10-01

A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.

3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

PubMed

Goldfarb, Katherine C; Cech, Thomas R

2013-09-21

Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

REDO: RNA Editing Detection in Plant Organelles Based on Variant Calling Results.

PubMed

Wu, Shuangyang; Liu, Wanfei; Aljohi, Hasan Awad; Alromaih, Sarah A; Alanazi, Ibrahim O; Lin, Qiang; Yu, Jun; Hu, Songnian

2018-05-01

RNA editing is a post-transcriptional or cotranscriptional process that changes the sequence of the precursor transcript by substitutions, insertions, or deletions. Almost all of the land plants undergo RNA editing in organelles (plastids and mitochondria). Although several software tools have been developed to identify RNA editing events, there has been a great challenge to distinguish true RNA editing events from genome variation, sequencing errors, and other factors. Here we introduce REDO, a comprehensive application tool for identifying RNA editing events in plant organelles based on variant call format files from RNA-sequencing data. REDO is a suite of Perl scripts that illustrate a bunch of attributes of RNA editing events in figures and tables. REDO can also detect RNA editing events in multiple samples simultaneously and identify the significant differential proportion of RNA editing loci. Comparing with similar tools, such as REDItools, REDO runs faster with higher accuracy, and more specificity at the cost of slightly lower sensitivity. Moreover, REDO annotates each RNA editing site in RNAs, whereas REDItools reports only possible RNA editing sites in genome, which need additional steps to obtain RNA editing profiles for RNAs. Overall, REDO can identify potential RNA editing sites easily and provide several functions such as detailed annotations, statistics, figures, and significantly differential proportion of RNA editing sites among different samples.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

The Shine-Dalgarno sequence of riboswitch-regulated single mRNAs shows ligand-dependent accessibility bursts

NASA Astrophysics Data System (ADS)

Rinaldi, Arlie J.; Lund, Paul E.; Blanco, Mario R.; Walter, Nils G.

2016-01-01

In response to intracellular signals in Gram-negative bacteria, translational riboswitches--commonly embedded in messenger RNAs (mRNAs)--regulate gene expression through inhibition of translation initiation. It is generally thought that this regulation originates from occlusion of the Shine-Dalgarno (SD) sequence upon ligand binding; however, little direct evidence exists. Here we develop Single Molecule Kinetic Analysis of RNA Transient Structure (SiM-KARTS) to investigate the ligand-dependent accessibility of the SD sequence of an mRNA hosting the 7-aminomethyl-7-deazaguanine (preQ1)-sensing riboswitch. Spike train analysis reveals that individual mRNA molecules alternate between two conformational states, distinguished by `bursts' of probe binding associated with increased SD sequence accessibility. Addition of preQ1 decreases the lifetime of the SD's high-accessibility (bursting) state and prolongs the time between bursts. In addition, ligand-jump experiments reveal imperfect riboswitching of single mRNA molecules. Such complex ligand sensing by individual mRNA molecules rationalizes the nuanced ligand response observed during bulk mRNA translation.

mRNA Translation Gone Awry: Translation Fidelity and Neurological Disease.

PubMed

Kapur, Mridu; Ackerman, Susan L

2018-03-01

Errors during mRNA translation can lead to a reduction in the levels of functional proteins and an increase in deleterious molecules. Advances in next-generation sequencing have led to the discovery of rare genetic disorders, many caused by mutations in genes encoding the mRNA translation machinery, as well as to a better understanding of translational dynamics through ribosome profiling. We discuss here multiple neurological disorders that are linked to errors in tRNA aminoacylation and ribosome decoding. We draw on studies from genetic models, including yeast and mice, to enhance our understanding of the translational defects observed in these diseases. Finally, we emphasize the importance of tRNA, their associated enzymes, and the inextricable link between accuracy and efficiency in the maintenance of translational fidelity. Copyright © 2017 Elsevier Ltd. All rights reserved.

The analysis of novel microRNA mimic sequences in cancer cells reveals lack of specificity in stem-loop RT-qPCR-based microRNA detection.

PubMed

Winata, Patrick; Williams, Marissa; McGowan, Eileen; Nassif, Najah; van Zandwijk, Nico; Reid, Glen

2017-11-17

MicroRNAs are frequently downregulated in cancer, and restoring expression has tumour suppressive activity in tumour cells. Our recent phase I clinical trial investigated microRNA-based therapy in patients with malignant pleural mesothelioma. Treatment with TargomiRs, microRNA mimics with novel sequence packaged in EGFR antibody-targeted bacterial minicells, revealed clear signs of clinical activity. In order to detect delivery of microRNA mimics to tumour cells in future clinical trials, we tested hydrolysis probe-based assays specific for the sequence of the novel mimics in transfected mesothelioma cell lines using RT-qPCR. The custom assays efficiently and specifically amplified the consensus mimics. However, we found that these assays gave a signal when total RNA from untransfected and control mimic-transfected cells were used as templates. Further investigation revealed that the reverse transcription step using stem-loop primers appeared to introduce substantial non-specific amplification with either total RNA or synthetic RNA templates. This suggests that reverse transcription using stem-loop primers suffers from an intrinsic lack of specificity for the detection of highly similar microRNAs in the same family, especially when analysing total RNA. These results suggest that RT-qPCR is unlikely to be an effective means to detect delivery of microRNA mimic-based drugs to tumour cells in patients.

Toxins of Prokaryotic Toxin-Antitoxin Systems with Sequence-Specific Endoribonuclease Activity

PubMed Central

Masuda, Hisako; Inouye, Masayori

2017-01-01

Protein translation is the most common target of toxin-antitoxin system (TA) toxins. Sequence-specific endoribonucleases digest RNA in a sequence-specific manner, thereby blocking translation. While past studies mainly focused on the digestion of mRNA, recent analysis revealed that toxins can also digest tRNA, rRNA and tmRNA. Purified toxins can digest single-stranded portions of RNA containing recognition sequences in the absence of ribosome in vitro. However, increasing evidence suggests that in vivo digestion may occur in association with ribosomes. Despite the prevalence of recognition sequences in many mRNA, preferential digestion seems to occur at specific positions within mRNA and also in certain reading frames. In this review, a variety of tools utilized to study the nuclease activities of toxins over the past 15 years will be reviewed. A recent adaptation of an RNA-seq-based technique to analyze entire sets of cellular RNA will be introduced with an emphasis on its strength in identifying novel targets and redefining recognition sequences. The differences in biochemical properties and postulated physiological roles will also be discussed. PMID:28420090

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Hybrid error correction and de novo assembly of single-molecule sequencing reads

PubMed Central

Koren, Sergey; Schatz, Michael C.; Walenz, Brian P.; Martin, Jeffrey; Howard, Jason; Ganapathy, Ganeshkumar; Wang, Zhong; Rasko, David A.; McCombie, W. Richard; Jarvis, Erich D.; Phillippy, Adam M.

2012-01-01

Emerging single-molecule sequencing instruments can generate multi-kilobase sequences with the potential to dramatically improve genome and transcriptome assembly. However, the high error rate of single-molecule reads is challenging, and has limited their use to resequencing bacteria. To address this limitation, we introduce a novel correction algorithm and assembly strategy that utilizes shorter, high-identity sequences to correct the error in single-molecule sequences. We demonstrate the utility of this approach on Pacbio RS reads of phage, prokaryotic, and eukaryotic whole genomes, including the novel genome of the parrot Melopsittacus undulatus, as well as for RNA-seq reads of the corn (Zea mays) transcriptome. Our approach achieves over 99.9% read correction accuracy and produces substantially better assemblies than current sequencing strategies: in the best example, quintupling the median contig size relative to high-coverage, second-generation assemblies. Greater gains are predicted if read lengths continue to increase, including the prospect of single-contig bacterial chromosome assembly. PMID:22750884

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Deep sequencing and genome-wide analysis reveals the expansion of MicroRNA genes in the gall midge Mayetiola destructor

PubMed Central

2013-01-01

Background MicroRNAs (miRNAs) are small non-coding RNAs that play critical roles in regulating post transcriptional gene expression. Gall midges encompass a large group of insects that are of economic importance and also possess fascinating biological traits. The gall midge Mayetiola destructor, commonly known as the Hessian fly, is a destructive pest of wheat and model organism for studying gall midge biology and insect – host plant interactions. Results In this study, we systematically analyzed miRNAs from the Hessian fly. Deep-sequencing a Hessian fly larval transcriptome led to the identification of 89 miRNA species that are either identical or very similar to known miRNAs from other insects, and 184 novel miRNAs that have not been reported from other species. A genome-wide search through a draft Hessian fly genome sequence identified a total of 611 putative miRNA-encoding genes based on sequence similarity and the existence of a stem-loop structure for miRNA precursors. Analysis of the 611 putative genes revealed a striking feature: the dramatic expansion of several miRNA gene families. The largest family contained 91 genes that encoded 20 different miRNAs. Microarray analyses revealed the expression of miRNA genes was strictly regulated during Hessian fly larval development and abundance of many miRNA genes were affected by host genotypes. Conclusion The identification of a large number of miRNAs for the first time from a gall midge provides a foundation for further studies of miRNA functions in gall midge biology and behavior. The dramatic expansion of identical or similar miRNAs provides a unique system to study functional relations among miRNA iso-genes as well as changes in sequence specificity due to small changes in miRNAs and in their mRNA targets. These results may also facilitate the identification of miRNA genes for potential pest control through transgenic approaches. PMID:23496979

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Evaluation of normalization methods in mammalian microRNA-Seq data

PubMed Central

Garmire, Lana Xia; Subramaniam, Shankar

2012-01-01

Simple total tag count normalization is inadequate for microRNA sequencing data generated from the next generation sequencing technology. However, so far systematic evaluation of normalization methods on microRNA sequencing data is lacking. We comprehensively evaluate seven commonly used normalization methods including global normalization, Lowess normalization, Trimmed Mean Method (TMM), quantile normalization, scaling normalization, variance stabilization, and invariant method. We assess these methods on two individual experimental data sets with the empirical statistical metrics of mean square error (MSE) and Kolmogorov-Smirnov (K-S) statistic. Additionally, we evaluate the methods with results from quantitative PCR validation. Our results consistently show that Lowess normalization and quantile normalization perform the best, whereas TMM, a method applied to the RNA-Sequencing normalization, performs the worst. The poor performance of TMM normalization is further evidenced by abnormal results from the test of differential expression (DE) of microRNA-Seq data. Comparing with the models used for DE, the choice of normalization method is the primary factor that affects the results of DE. In summary, Lowess normalization and quantile normalization are recommended for normalizing microRNA-Seq data, whereas the TMM method should be used with caution. PMID:22532701

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

PubMed Central

2013-01-01

Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.

PubMed

Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko

2018-05-17

RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.

Low-coverage single-cell mRNA sequencing reveals cellular heterogeneity and activated signaling pathways in developing cerebral cortex.

PubMed

Pollen, Alex A; Nowakowski, Tomasz J; Shuga, Joe; Wang, Xiaohui; Leyrat, Anne A; Lui, Jan H; Li, Nianzhen; Szpankowski, Lukasz; Fowler, Brian; Chen, Peilin; Ramalingam, Naveen; Sun, Gang; Thu, Myo; Norris, Michael; Lebofsky, Ronald; Toppani, Dominique; Kemp, Darnell W; Wong, Michael; Clerkson, Barry; Jones, Brittnee N; Wu, Shiquan; Knutsson, Lawrence; Alvarado, Beatriz; Wang, Jing; Weaver, Lesley S; May, Andrew P; Jones, Robert C; Unger, Marc A; Kriegstein, Arnold R; West, Jay A A

2014-10-01

Large-scale surveys of single-cell gene expression have the potential to reveal rare cell populations and lineage relationships but require efficient methods for cell capture and mRNA sequencing. Although cellular barcoding strategies allow parallel sequencing of single cells at ultra-low depths, the limitations of shallow sequencing have not been investigated directly. By capturing 301 single cells from 11 populations using microfluidics and analyzing single-cell transcriptomes across downsampled sequencing depths, we demonstrate that shallow single-cell mRNA sequencing (~50,000 reads per cell) is sufficient for unbiased cell-type classification and biomarker identification. In the developing cortex, we identify diverse cell types, including multiple progenitor and neuronal subtypes, and we identify EGR1 and FOS as previously unreported candidate targets of Notch signaling in human but not mouse radial glia. Our strategy establishes an efficient method for unbiased analysis and comparison of cell populations from heterogeneous tissue by microfluidic single-cell capture and low-coverage sequencing of many cells.

Comparing K-mer based methods for improved classification of 16S sequences.

PubMed

Vinje, Hilde; Liland, Kristian Hovde; Almøy, Trygve; Snipen, Lars

2015-07-01

The need for precise and stable taxonomic classification is highly relevant in modern microbiology. Parallel to the explosion in the amount of sequence data accessible, there has also been a shift in focus for classification methods. Previously, alignment-based methods were the most applicable tools. Now, methods based on counting K-mers by sliding windows are the most interesting classification approach with respect to both speed and accuracy. Here, we present a systematic comparison on five different K-mer based classification methods for the 16S rRNA gene. The methods differ from each other both in data usage and modelling strategies. We have based our study on the commonly known and well-used naïve Bayes classifier from the RDP project, and four other methods were implemented and tested on two different data sets, on full-length sequences as well as fragments of typical read-length. The difference in classification error obtained by the methods seemed to be small, but they were stable and for both data sets tested. The Preprocessed nearest-neighbour (PLSNN) method performed best for full-length 16S rRNA sequences, significantly better than the naïve Bayes RDP method. On fragmented sequences the naïve Bayes Multinomial method performed best, significantly better than all other methods. For both data sets explored, and on both full-length and fragmented sequences, all the five methods reached an error-plateau. We conclude that no K-mer based method is universally best for classifying both full-length sequences and fragments (reads). All methods approach an error plateau indicating improved training data is needed to improve classification from here. Classification errors occur most frequent for genera with few sequences present. For improving the taxonomy and testing new classification methods, the need for a better and more universal and robust training data set is crucial.

Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.

PubMed

Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W

2010-04-01

Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.

Inertial-ordering-assisted droplet microfluidics for high-throughput single-cell RNA-sequencing.

PubMed

Moon, Hui-Sung; Je, Kwanghwi; Min, Jae-Woong; Park, Donghyun; Han, Kyung-Yeon; Shin, Seung-Ho; Park, Woong-Yang; Yoo, Chang Eun; Kim, Shin-Hyun

2018-02-27

Single-cell RNA-seq reveals the cellular heterogeneity inherent in the population of cells, which is very important in many clinical and research applications. Recent advances in droplet microfluidics have achieved the automatic isolation, lysis, and labeling of single cells in droplet compartments without complex instrumentation. However, barcoding errors occurring in the cell encapsulation process because of the multiple-beads-in-droplet and insufficient throughput because of the low concentration of beads for avoiding multiple-beads-in-a-droplet remain important challenges for precise and efficient expression profiling of single cells. In this study, we developed a new droplet-based microfluidic platform that significantly improved the throughput while reducing barcoding errors through deterministic encapsulation of inertially ordered beads. Highly concentrated beads containing oligonucleotide barcodes were spontaneously ordered in a spiral channel by an inertial effect, which were in turn encapsulated in droplets one-by-one, while cells were simultaneously encapsulated in the droplets. The deterministic encapsulation of beads resulted in a high fraction of single-bead-in-a-droplet and rare multiple-beads-in-a-droplet although the bead concentration increased to 1000 μl -1 , which diminished barcoding errors and enabled accurate high-throughput barcoding. We successfully validated our device with single-cell RNA-seq. In addition, we found that multiple-beads-in-a-droplet, generated using a normal Drop-Seq device with a high concentration of beads, underestimated transcript numbers and overestimated cell numbers. This accurate high-throughput platform can expand the capability and practicality of Drop-Seq in single-cell analysis.

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

PubMed

Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M

2007-01-01

DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

PubMed

Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

1993-05-03

The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

Missing data and technical variability in single-cell RNA-sequencing experiments.

PubMed

Hicks, Stephanie C; Townes, F William; Teng, Mingxiang; Irizarry, Rafael A

2017-11-06

Until recently, high-throughput gene expression technology, such as RNA-Sequencing (RNA-seq) required hundreds of thousands of cells to produce reliable measurements. Recent technical advances permit genome-wide gene expression measurement at the single-cell level. Single-cell RNA-Seq (scRNA-seq) is the most widely used and numerous publications are based on data produced with this technology. However, RNA-seq and scRNA-seq data are markedly different. In particular, unlike RNA-seq, the majority of reported expression levels in scRNA-seq are zeros, which could be either biologically-driven, genes not expressing RNA at the time of measurement, or technically-driven, genes expressing RNA, but not at a sufficient level to be detected by sequencing technology. Another difference is that the proportion of genes reporting the expression level to be zero varies substantially across single cells compared to RNA-seq samples. However, it remains unclear to what extent this cell-to-cell variation is being driven by technical rather than biological variation. Furthermore, while systematic errors, including batch effects, have been widely reported as a major challenge in high-throughput technologies, these issues have received minimal attention in published studies based on scRNA-seq technology. Here, we use an assessment experiment to examine data from published studies and demonstrate that systematic errors can explain a substantial percentage of observed cell-to-cell expression variability. Specifically, we present evidence that some of these reported zeros are driven by technical variation by demonstrating that scRNA-seq produces more zeros than expected and that this bias is greater for lower expressed genes. In addition, this missing data problem is exacerbated by the fact that this technical variation varies cell-to-cell. Then, we show how this technical cell-to-cell variability can be confused with novel biological results. Finally, we demonstrate and discuss how batch-effects and confounded experiments can intensify the problem. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

NASA Technical Reports Server (NTRS)

Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

1994-01-01

When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

PubMed

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification of MicroRNAs in Helicoverpa armigera and Spodoptera litura Based on Deep Sequencing and Homology Analysis

PubMed Central

Ge, Xie; Zhang, Yong; Jiang, Jianhao; Zhong, Yi; Yang, Xiaonan; Li, Zhiqian; Huang, Yongping; Tan, Anjiang

2013-01-01

The current identification of microRNAs (miRNAs) in insects is largely dependent on genome sequences. However, the lack of available genome sequences inhibits the identification of miRNAs in various insect species. In this study, we used a miRNA database of the silkworm Bombyx mori as a reference to identify miRNAs in Helicoverpa armigera and Spodoptera litura using deep sequencing and homology analysis. Because all three species belong to the Lepidoptera, the experiment produced reliable results. Our study identified 97 and 91 conserved miRNAs in H. armigera and S. litura, respectively. Using the genome of B. mori and BAC sequences of H. armigera as references, 1 novel miRNA and 8 novel miRNA candidates were identified in H. armigera, and 4 novel miRNA candidates were identified in S. litura. An evolutionary analysis revealed that most of the identified miRNAs were insect-specific, and more than 20 miRNAs were Lepidoptera-specific. The investigation of the expression patterns of miR-2a, miR-34, miR-2796-3p and miR-11 revealed their potential roles in insect development. miRNA target prediction revealed that conserved miRNA target sites exist in various genes in the 3 species. Conserved miRNA target sites for the Hsp90 gene among the 3 species were validated in the mammalian 293T cell line using a dual-luciferase reporter assay. Our study provides a new approach with which to identify miRNAs in insects lacking genome information and contributes to the functional analysis of insect miRNAs. PMID:23289012

Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

PubMed Central

Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

2006-01-01

RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

The role of consolidation in learning context-dependent phonotactic patterns in speech and digital sequence production.

PubMed

Anderson, Nathaniel D; Dell, Gary S

2018-04-03

Speakers implicitly learn novel phonotactic patterns by producing strings of syllables. The learning is revealed in their speech errors. First-order patterns, such as "/f/ must be a syllable onset," can be distinguished from contingent, or second-order, patterns, such as "/f/ must be an onset if the vowel is /a/, but a coda if the vowel is /o/." A metaanalysis of 19 experiments clearly demonstrated that first-order patterns affect speech errors to a very great extent in a single experimental session, but second-order vowel-contingent patterns only affect errors on the second day of testing, suggesting the need for a consolidation period. Two experiments tested an analogue to these studies involving sequences of button pushes, with fingers as "consonants" and thumbs as "vowels." The button-push errors revealed two of the key speech-error findings: first-order patterns are learned quickly, but second-order thumb-contingent patterns are only strongly revealed in the errors on the second day of testing. The influence of computational complexity on the implicit learning of phonotactic patterns in speech production may be a general feature of sequence production.

High-throughput sequencing reveals circular substrates for an archaeal RNA ligase

PubMed Central

Becker, Hubert F.; Héliou, Alice; Djaout, Kamel; Lestini, Roxane; Regnier, Mireille; Myllykallio, Hannu

2017-01-01

ABSTRACT It is only recently that the abundant presence of circular RNAs (circRNAs) in all kingdoms of Life, including the hyperthermophilic archaeon Pyrococcus abyssi, has emerged. This led us to investigate the physiologic significance of a previously observed weak intramolecular ligation activity of Pab1020 RNA ligase. Here we demonstrate that this enzyme, despite sharing significant sequence similarity with DNA ligases, is indeed an RNA-specific polynucleotide ligase efficiently acting on physiologically significant substrates. Using a combination of RNA immunoprecipitation assays and RNA-seq, our genome-wide studies revealed 133 individual circRNA loci in P. abyssi. The large majority of these loci interacted with Pab1020 in cells and circularization of selected C/D Box and 5S rRNA transcripts was confirmed biochemically. Altogether these studies revealed that Pab1020 is required for RNA circularization. Our results further suggest the functional speciation of an ancestral NTase domain and/or DNA ligase toward RNA ligase activity and prompt for further characterization of the widespread functions of circular RNAs in prokaryotes. Detailed insight into the cellular substrates of Pab1020 may facilitate the development of new biotechnological applications e.g. in ligation of preadenylated adaptors to RNA molecules. PMID:28277897

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Single-Cell RNA-Sequencing in Glioma.

PubMed

Johnson, Eli; Dickerson, Katherine L; Connolly, Ian D; Hayden Gephart, Melanie

2018-04-10

In this review, we seek to summarize the literature concerning the use of single-cell RNA-sequencing for CNS gliomas. Single-cell analysis has revealed complex tumor heterogeneity, subpopulations of proliferating stem-like cells and expanded our view of tumor microenvironment influence in the disease process. Although bulk RNA-sequencing has guided our initial understanding of glioma genetics, this method does not accurately define the heterogeneous subpopulations found within these tumors. Single-cell techniques have appealing applications in cancer research, as diverse cell types and the tumor microenvironment have important implications in therapy. High cost and difficult protocols prevent widespread use of single-cell RNA-sequencing; however, continued innovation will improve accessibility and expand our of knowledge gliomas.

An umbra-like virus of papaya discovered in Ecuador: detection, occurrence and phylogenetic relatedness

USDA-ARS?s Scientific Manuscript database

Double-stranded RNA (dsRNA) extractions from papaya leaves infected with Papaya ringspot virus (PRSV) revealed the presence of an unusual 4kb band, in addition to the presumed PRSV-associated 10kb band. Partial sequence of RT-PCR products from the 4kb dsRNA revealed homology to genomes of several me...

RNA Polymerase III promoter screen uncovers a novel noncoding RNA family conserved in Caenorhabditis and other clade V nematodes.

PubMed

Gruber, Andreas R

2014-07-10

RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantification of HCV RNA in Clinical Specimens by Branched DNA (bDNA) Technology.

PubMed

Wilber, J C; Urdea, M S

1999-01-01

The diagnosis and monitoring of hepatitis C virus (HCV) infection have been aided by the development of HCV RNA quantification assays A direct measure of viral load, HCV RNA quantification has the advantage of providing information on viral kinetics and provides unique insight into the disease process. Branched DNA (bDNA) signal amplification technology provides a novel approach for the direct quantification of HCV RNA in patient specimens. The bDNA assay measures HCV RNA at physiological levels by boosting the reporter signal, rather than by replicating target sequences as the means of detection, and thus avoids the errors inherent in the extraction and amplification of target sequences. Inherently quantitative and nonradioactive, the bDNA assay is amenable to routine use in a clinical research setting, and has been used by several groups to explore the natural history, pathogenesis, and treatment of HCV infection.

Chromosome-based survey sequencing reveals the genome organization of wild wheat progenitor Triticum dicoccoides.

PubMed

Akpinar, Bala Ani; Biyiklioglu, Sezgi; Alptekin, Burcu; Havránková, Miroslava; Vrána, Jan; Doležel, Jaroslav; Distelfeld, Assaf; Hernandez, Pilar; Budak, Hikmet

2018-05-04

Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is the progenitor of wheat. We performed chromosome-based survey sequencing of the 14 chromosomes, examining repetitive sequences, protein-coding genes, miRNA/target pairs and tRNA genes, as well as syntenic relationships with related grasses. We found considerable differences in the content and distribution of repetitive sequences between the A and B subgenomes. The gene contents of individual chromosomes varied widely, not necessarily correlating with chromosome size. We catalogued candidate agronomically important loci, along with new alleles and flanking sequences that can be used to design exome sequencing. Syntenic relationships and virtual gene orders revealed several small-scale evolutionary rearrangements, in addition to providing evidence for the 4AL-5AL-7BS translocation in wild emmer wheat. Chromosome-based sequence assemblies contained five novel miRNA families, among 59 families putatively encoded in the entire genome which provide insight into the domestication of wheat and an overview of the genome content and organization. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Augmenting Chinese hamster genome assembly by identifying regions of high confidence.

PubMed

Vishwanathan, Nandita; Bandyopadhyay, Arpan A; Fu, Hsu-Yuan; Sharma, Mohit; Johnson, Kathryn C; Mudge, Joann; Ramaraj, Thiruvarangan; Onsongo, Getiria; Silverstein, Kevin A T; Jacob, Nitya M; Le, Huong; Karypis, George; Hu, Wei-Shou

2016-09-01

Chinese hamster Ovary (CHO) cell lines are the dominant industrial workhorses for therapeutic recombinant protein production. The availability of genome sequence of Chinese hamster and CHO cells will spur further genome and RNA sequencing of producing cell lines. However, the mammalian genomes assembled using shot-gun sequencing data still contain regions of uncertain quality due to assembly errors. Identifying high confidence regions in the assembled genome will facilitate its use for cell engineering and genome engineering. We assembled two independent drafts of Chinese hamster genome by de novo assembly from shotgun sequencing reads and by re-scaffolding and gap-filling the draft genome from NCBI for improved scaffold lengths and gap fractions. We then used the two independent assemblies to identify high confidence regions using two different approaches. First, the two independent assemblies were compared at the sequence level to identify their consensus regions as "high confidence regions" which accounts for at least 78 % of the assembled genome. Further, a genome wide comparison of the Chinese hamster scaffolds with mouse chromosomes revealed scaffolds with large blocks of collinearity, which were also compiled as high-quality scaffolds. Genome scale collinearity was complemented with EST based synteny which also revealed conserved gene order compared to mouse. As cell line sequencing becomes more commonly practiced, the approaches reported here are useful for assessing the quality of assembly and potentially facilitate the engineering of cell lines. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism.

PubMed

van der Meulen, Sjoerd B; de Jong, Anne; Kok, Jan

2016-01-01

RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species.

Transcriptomic sequencing reveals a set of unique genes activated by butyrate-induced histone modification

USDA-ARS?s Scientific Manuscript database

Butyrate is a nutritional element with strong epigenetic regulatory activity as an inhibitor of histone deacetylases (HDACs). Based on the analysis of differentially expressed genes induced by butyrate in the bovine epithelial cell using deep RNA-sequencing technology (RNA-seq), a set of unique gen...

Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.

PubMed

Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O

2008-04-01

Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Organization and transient expression of the gene for human U11 snRNA

PubMed Central

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

Increased complexity of circRNA expression during species evolution.

PubMed

Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

2017-08-03

Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa

PubMed Central

Morin, Ryan D.; Aksay, Gozde; Dolgosheina, Elena; Ebhardt, H. Alexander; Magrini, Vincent; Mardis, Elaine R.; Sahinalp, S. Cenk; Unrau, Peter J.

2008-01-01

The diversity of microRNAs and small-interfering RNAs has been extensively explored within angiosperms by focusing on a few key organisms such as Oryza sativa and Arabidopsis thaliana. A deeper division of the plants is defined by the radiation of the angiosperms and gymnosperms, with the latter comprising the commercially important conifers. The conifers are expected to provide important information regarding the evolution of highly conserved small regulatory RNAs. Deep sequencing provides the means to characterize and quantitatively profile small RNAs in understudied organisms such as these. Pyrosequencing of small RNAs from O. sativa revealed, as expected, ∼21- and ∼24-nt RNAs. The former contained known microRNAs, and the latter largely comprised intergenic-derived sequences likely representing heterochromatin siRNAs. In contrast, sequences from Pinus contorta were dominated by 21-nt small RNAs. Using a novel sequence-based clustering algorithm, we identified sequences belonging to 18 highly conserved microRNA families in P. contorta as well as numerous clusters of conserved small RNAs of unknown function. Using multiple methods, including expressed sequence folding and machine learning algorithms, we found a further 53 candidate novel microRNA families, 51 appearing specific to the P. contorta library. In addition, alignment of small RNA sequences to the O. sativa genome revealed six perfectly conserved classes of small RNA that included chloroplast transcripts and specific types of genomic repeats. The conservation of microRNAs and other small RNAs between the conifers and the angiosperms indicates that important RNA silencing processes were highly developed in the earliest spermatophytes. Genomic mapping of all sequences to the O. sativa genome can be viewed at http://microrna.bcgsc.ca/cgi-bin/gbrowse/rice_build_3/. PMID:18323537

RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.

PubMed

Widmer, G

1993-03-01

Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.

Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes

PubMed Central

Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.

2016-01-01

DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167

High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs.

PubMed

Panda, Amaresh C; De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B; Abdelmohsen, Kotb; Gorospe, Myriam

2017-07-07

High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs

PubMed Central

De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B.; Gorospe, Myriam

2017-01-01

Abstract High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. PMID:28444238

Genome-wide identification of conserved microRNA and their response to drought stress in Dongxiang wild rice (Oryza rufipogon Griff.).

PubMed

Zhang, Fantao; Luo, Xiangdong; Zhou, Yi; Xie, Jiankun

2016-04-01

To identify drought stress-responsive conserved microRNA (miRNA) from Dongxiang wild rice (Oryza rufipogon Griff., DXWR) on a genome-wide scale, high-throughput sequencing technology was used to sequence libraries of DXWR samples, treated with and without drought stress. 505 conserved miRNAs corresponding to 215 families were identified. 17 were significantly down-regulated and 16 were up-regulated under drought stress. Stem-loop qRT-PCR revealed the same expression patterns as high-throughput sequencing, suggesting the accuracy of the sequencing result was high. Potential target genes of the drought-responsive miRNA were predicted to be involved in diverse biological processes. Furthermore, 16 miRNA families were first identified to be involved in drought stress response from plants. These results present a comprehensive view of the conserved miRNA and their expression patterns under drought stress for DXWR, which will provide valuable information and sequence resources for future basis studies.

Identifying mRNA sequence elements for target recognition by human Argonaute proteins

PubMed Central

Li, Jingjing; Kim, TaeHyung; Nutiu, Razvan; Ray, Debashish; Hughes, Timothy R.; Zhang, Zhaolei

2014-01-01

It is commonly known that mammalian microRNAs (miRNAs) guide the RNA-induced silencing complex (RISC) to target mRNAs through the seed-pairing rule. However, recent experiments that coimmunoprecipitate the Argonaute proteins (AGOs), the central catalytic component of RISC, have consistently revealed extensive AGO-associated mRNAs that lack seed complementarity with miRNAs. We herein test the hypothesis that AGO has its own binding preference within target mRNAs, independent of guide miRNAs. By systematically analyzing the data from in vivo cross-linking experiments with human AGOs, we have identified a structurally accessible and evolutionarily conserved region (∼10 nucleotides in length) that alone can accurately predict AGO–mRNA associations, independent of the presence of miRNA binding sites. Within this region, we further identified an enriched motif that was replicable on independent AGO-immunoprecipitation data sets. We used RNAcompete to enumerate the RNA-binding preference of human AGO2 to all possible 7-mer RNA sequences and validated the AGO motif in vitro. These findings reveal a novel function of AGOs as sequence-specific RNA-binding proteins, which may aid miRNAs in recognizing their targets with high specificity. PMID:24663241

Identification of 15 candidate structured noncoding RNA motifs in fungi by comparative genomics.

PubMed

Li, Sanshu; Breaker, Ronald R

2017-10-13

With the development of rapid and inexpensive DNA sequencing, the genome sequences of more than 100 fungal species have been made available. This dataset provides an excellent resource for comparative genomics analyses, which can be used to discover genetic elements, including noncoding RNAs (ncRNAs). Bioinformatics tools similar to those used to uncover novel ncRNAs in bacteria, likewise, should be useful for searching fungal genomic sequences, and the relative ease of genetic experiments with some model fungal species could facilitate experimental validation studies. We have adapted a bioinformatics pipeline for discovering bacterial ncRNAs to systematically analyze many fungal genomes. This comparative genomics pipeline integrates information on conserved RNA sequence and structural features with alternative splicing information to reveal fungal RNA motifs that are candidate regulatory domains, or that might have other possible functions. A total of 15 prominent classes of structured ncRNA candidates were identified, including variant HDV self-cleaving ribozyme representatives, atypical snoRNA candidates, and possible structured antisense RNA motifs. Candidate regulatory motifs were also found associated with genes for ribosomal proteins, S-adenosylmethionine decarboxylase (SDC), amidase, and HexA protein involved in Woronin body formation. We experimentally confirm that the variant HDV ribozymes undergo rapid self-cleavage, and we demonstrate that the SDC RNA motif reduces the expression of SAM decarboxylase by translational repression. Furthermore, we provide evidence that several other motifs discovered in this study are likely to be functional ncRNA elements. Systematic screening of fungal genomes using a computational discovery pipeline has revealed the existence of a variety of novel structured ncRNAs. Genome contexts and similarities to known ncRNA motifs provide strong evidence for the biological and biochemical functions of some newly found ncRNA motifs. Although initial examinations of several motifs provide evidence for their likely functions, other motifs will require more in-depth analysis to reveal their functions.

Prediction of constitutive A-to-I editing sites from human transcriptomes in the absence of genomic sequences

PubMed Central

2013-01-01

Background Adenosine-to-inosine (A-to-I) RNA editing is recognized as a cellular mechanism for generating both RNA and protein diversity. Inosine base pairs with cytidine during reverse transcription and therefore appears as guanosine during sequencing of cDNA. Current approaches of RNA editing identification largely depend on the comparison between transcriptomes and genomic DNA (gDNA) sequencing datasets from the same individuals, and it has been challenging to identify editing candidates from transcriptomes in the absence of gDNA information. Results We have developed a new strategy to accurately predict constitutive RNA editing sites from publicly available human RNA-seq datasets in the absence of relevant genomic sequences. Our approach establishes new parameters to increase the ability to map mismatches and to minimize sequencing/mapping errors and unreported genome variations. We identified 695 novel constitutive A-to-I editing sites that appear in clusters (named “editing boxes”) in multiple samples and which exhibit spatial and dynamic regulation across human tissues. Some of these editing boxes are enriched in non-repetitive regions lacking inverted repeat structures and contain an extremely high conversion frequency of As to Is. We validated a number of editing boxes in multiple human cell lines and confirmed that ADAR1 is responsible for the observed promiscuous editing events in non-repetitive regions, further expanding our knowledge of the catalytic substrate of A-to-I RNA editing by ADAR enzymes. Conclusions The approach we present here provides a novel way of identifying A-to-I RNA editing events by analyzing only RNA-seq datasets. This method has allowed us to gain new insights into RNA editing and should also aid in the identification of more constitutive A-to-I editing sites from additional transcriptomes. PMID:23537002

Comprehensive discovery of noncoding RNAs in acute myeloid leukemia cell transcriptomes.

PubMed

Zhang, Jin; Griffith, Malachi; Miller, Christopher A; Griffith, Obi L; Spencer, David H; Walker, Jason R; Magrini, Vincent; McGrath, Sean D; Ly, Amy; Helton, Nichole M; Trissal, Maria; Link, Daniel C; Dang, Ha X; Larson, David E; Kulkarni, Shashikant; Cordes, Matthew G; Fronick, Catrina C; Fulton, Robert S; Klco, Jeffery M; Mardis, Elaine R; Ley, Timothy J; Wilson, Richard K; Maher, Christopher A

2017-11-01

To detect diverse and novel RNA species comprehensively, we compared deep small RNA and RNA sequencing (RNA-seq) methods applied to a primary acute myeloid leukemia (AML) sample. We were able to discover previously unannotated small RNAs using deep sequencing of a library method using broader insert size selection. We analyzed the long noncoding RNA (lncRNA) landscape in AML by comparing deep sequencing from multiple RNA-seq library construction methods for the sample that we studied and then integrating RNA-seq data from 179 AML cases. This identified lncRNAs that are completely novel, differentially expressed, and associated with specific AML subtypes. Our study revealed the complexity of the noncoding RNA transcriptome through a combined strategy of strand-specific small RNA and total RNA-seq. This dataset will serve as an invaluable resource for future RNA-based analyses. Copyright © 2017 ISEH – Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

RNA Relics and Origin of Life

PubMed Central

Demongeot, Jacques; Glade, Nicolas; Moreira, Andrés; Vial, Laurent

2009-01-01

A number of small RNA sequences, located in different non-coding sequences and highly preserved across the tree of life, have been suggested to be molecular fossils, of ancient (and possibly primordial) origin. On the other hand, recent years have revealed the existence of ubiquitous roles for small RNA sequences in modern organisms, in functions ranging from cell regulation to antiviral activity. We propose that a single thread can be followed from the beginning of life in RNA structures selected only for stability reasons through the RNA relics and up to the current coevolution of RNA sequences; such an understanding would shed light both on the history and on the present development of the RNA machinery and interactions. After presenting the evidence (by comparing their sequences) that points toward a common thread, we discuss a scenario of genome coevolution (with emphasis on viral infectious processes) and finally propose a plan for the reevaluation of the stereochemical theory of the genetic code; we claim that it may still be relevant, and not only for understanding the origin of life, but also for a comprehensive picture of regulation in present-day cells. PMID:20111682

Evaluation of microRNA alignment techniques

PubMed Central

Kaspi, Antony; El-Osta, Assam

2016-01-01

Genomic alignment of small RNA (smRNA) sequences such as microRNAs poses considerable challenges due to their short length (∼21 nucleotides [nt]) as well as the large size and complexity of plant and animal genomes. While several tools have been developed for high-throughput mapping of longer mRNA-seq reads (>30 nt), there are few that are specifically designed for mapping of smRNA reads including microRNAs. The accuracy of these mappers has not been systematically determined in the case of smRNA-seq. In addition, it is unknown whether these aligners accurately map smRNA reads containing sequence errors and polymorphisms. By using simulated read sets, we determine the alignment sensitivity and accuracy of 16 short-read mappers and quantify their robustness to mismatches, indels, and nontemplated nucleotide additions. These were explored in the context of a plant genome (Oryza sativa, ∼500 Mbp) and a mammalian genome (Homo sapiens, ∼3.1 Gbp). Analysis of simulated and real smRNA-seq data demonstrates that mapper selection impacts differential expression results and interpretation. These results will inform on best practice for smRNA mapping and enable more accurate smRNA detection and quantification of expression and RNA editing. PMID:27284164

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Occurrence of dsRNA Mycovirus (LeV-FMRI0339) in the Edible Mushroom Lentinula edodes and Meiotic Stability of LeV-FMRI0339 among Monokaryotic Progeny

PubMed Central

Kim, Jung-Mi; Yun, Suk-Hyun; Park, Seung-Moon; Ko, Han-Gyu; Kim, Dae-Hyuk

2013-01-01

dsRNA was found in malformed cultures of Lentinula edodes strain FMRI0339, one of the three most popular sawdust cultivated commercial strains of shiitake, and was also found in healthy-looking fruiting bodies and actively growing mycelia. Cloning of the partial genome of the dsRNA revealed the presence of the RdRp sequence of a novel L. edodes mycovirus (LeV), and sequence comparison of the cloned amplicon showed identical sequences sequence to known RNA-dependent RNA polymerase genes of LeV found in strain HKA. The meiotic stability of dsRNA was examined by measuring the ratio of the presence of dsRNA among sexual monokaryotic progeny. More than 40% of the monokaryotic progeny still contained the dsRNA, indicating the persistence of dsRNA during sexual reproduction. Comparing the mycelia growth of monokaryotic progeny suggested that there appeared to be a tendency toward a lower frequency of virus incidence in actively growing progeny. PMID:25288977

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

PubMed

Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

A comprehensive survey of 3' animal miRNA modification events and a possible role for 3' adenylation in modulating miRNA targeting effectiveness.

PubMed

Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O

2010-10-01

Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.

Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs.

PubMed

Chen-Harris, Haiyin; Borucki, Monica K; Torres, Clinton; Slezak, Tom R; Allen, Jonathan E

2013-02-12

High throughput sequencing is beginning to make a transformative impact in the area of viral evolution. Deep sequencing has the potential to reveal the mutant spectrum within a viral sample at high resolution, thus enabling the close examination of viral mutational dynamics both within- and between-hosts. The challenge however, is to accurately model the errors in the sequencing data and differentiate real viral mutations, particularly those that exist at low frequencies, from sequencing errors. We demonstrate that overlapping read pairs (ORP) -- generated by combining short fragment sequencing libraries and longer sequencing reads -- significantly reduce sequencing error rates and improve rare variant detection accuracy. Using this sequencing protocol and an error model optimized for variant detection, we are able to capture a large number of genetic mutations present within a viral population at ultra-low frequency levels (<0.05%). Our rare variant detection strategies have important implications beyond viral evolution and can be applied to any basic and clinical research area that requires the identification of rare mutations.

Microbial community structure in the gut of the New Zealand insect Auckland tree weta (Hemideina thoracica).

PubMed

Waite, David W; Dsouza, Melissa; Biswas, Kristi; Ward, Darren F; Deines, Peter; Taylor, Michael W

2015-05-01

The endemic New Zealand weta is an enigmatic insect. Although the insect is well known by its distinctive name, considerable size, and morphology, many basic aspects of weta biology remain unknown. Here, we employed cultivation-independent enumeration techniques and rRNA gene sequencing to investigate the gut microbiota of the Auckland tree weta (Hemideina thoracica). Fluorescence in situ hybridisation performed on different sections of the gut revealed a bacterial community of fluctuating density, while rRNA gene-targeted amplicon pyrosequencing revealed the presence of a microbial community containing high bacterial diversity, but an apparent absence of archaea. Bacteria were further studied using full-length 16S rRNA gene sequences, with statistical testing of bacterial community membership against publicly available termite- and cockroach-derived sequences, revealing that the weta gut microbiota is similar to that of cockroaches. These data represent the first analysis of the weta microbiota and provide initial insights into the potential function of these microorganisms.

Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

PubMed

Jiang, Xuexia; Jiao, Nianzhi

2016-09-01

Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

RNA editing in the anticodon of tRNA Leu (CAA) occurs before group I intron splicing in plastids of a moss Takakia lepidozioides S. Hatt. & Inoue.

PubMed

Miyata, Y; Sugita, C; Maruyama, K; Sugita, M

2008-03-01

RNA editing of cytidine (C) to uridine (U) transitions occurs in plastids and mitochondria of most land plants. In this study, we amplified and sequenced the group I intron-containing tRNA Leu gene, trnL-CAA, from Takakia lepidozioides, a moss. DNA sequence analysis revealed that the T. lepidozioides tRNA Leu gene consisted of a 35-bp 5' exon, a 469-bp group I intron and a 50-bp 3' exon. The intron was inserted between the first and second position of the tRNA Leu anticodon. In general, plastid tRNA Leu genes with a group I intron code for a TAA anticodon in most land plants. This strongly suggests that the first nucleotide of the CAA anticodon could be edited in T. lepidozioides plastids. To investigate this possibility, we analysed cDNAs derived from the trnL-CAA transcripts. We demonstrated that the first nucleotide C of the anticodon was edited to create a canonical UAA anticodon in T. lepidozioides plastids. cDNA sequencing analyses of the spliced or unspliced tRNA Leu transcripts revealed that, while the spliced tRNA was completely edited, editing in the unspliced tRNAs were only partial. This is the first experimental evidence that the anticodon editing of tRNA occurs before RNA splicing in plastids. This suggests that this editing is a prerequisite to splicing of pre-tRNA Leu.

Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

PubMed

Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

2014-05-27

We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

Deep sequencing and in silico analysis of small RNA library reveals novel miRNA from leaf Persicaria minor transcriptome.

PubMed

Samad, Abdul Fatah A; Nazaruddin, Nazaruddin; Murad, Abdul Munir Abdul; Jani, Jaeyres; Zainal, Zamri; Ismail, Ismanizan

2018-03-01

In current era, majority of microRNA (miRNA) are being discovered through computational approaches which are more confined towards model plants. Here, for the first time, we have described the identification and characterization of novel miRNA in a non-model plant, Persicaria minor ( P . minor ) using computational approach. Unannotated sequences from deep sequencing were analyzed based on previous well-established parameters. Around 24 putative novel miRNAs were identified from 6,417,780 reads of the unannotated sequence which represented 11 unique putative miRNA sequences. PsRobot target prediction tool was deployed to identify the target transcripts of putative novel miRNAs. Most of the predicted target transcripts (mRNAs) were known to be involved in plant development and stress responses. Gene ontology showed that majority of the putative novel miRNA targets involved in cellular component (69.07%), followed by molecular function (30.08%) and biological process (0.85%). Out of 11 unique putative miRNAs, 7 miRNAs were validated through semi-quantitative PCR. These novel miRNAs discoveries in P . minor may develop and update the current public miRNA database.

The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

PubMed Central

De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

1992-01-01

The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

Self-Assembly of Measles Virus Nucleocapsid-like Particles: Kinetics and RNA Sequence Dependence.

PubMed

Milles, Sigrid; Jensen, Malene Ringkjøbing; Communie, Guillaume; Maurin, Damien; Schoehn, Guy; Ruigrok, Rob W H; Blackledge, Martin

2016-08-01

Measles virus RNA genomes are packaged into helical nucleocapsids (NCs), comprising thousands of nucleo-proteins (N) that bind the entire genome. N-RNA provides the template for replication and transcription by the viral polymerase and is a promising target for viral inhibition. Elucidation of mechanisms regulating this process has been severely hampered by the inability to controllably assemble NCs. Here, we demonstrate self-organization of N into NC-like particles in vitro upon addition of RNA, providing a simple and versatile tool for investigating assembly. Real-time NMR and fluorescence spectroscopy reveals biphasic assembly kinetics. Remarkably, assembly depends strongly on the RNA-sequence, with the genomic 5' end and poly-Adenine sequences assembling efficiently, while sequences such as poly-Uracil are incompetent for NC formation. This observation has important consequences for understanding the assembly process. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

RNA 3D Modules in Genome-Wide Predictions of RNA 2D Structure

PubMed Central

Theis, Corinna; Zirbel, Craig L.; zu Siederdissen, Christian Höner; Anthon, Christian; Hofacker, Ivo L.; Nielsen, Henrik; Gorodkin, Jan

2015-01-01

Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution. These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D module prediction tools and apply them on a 13-way vertebrate sequence-based alignment. We find that RNA 3D modules predicted by metaRNAmodules and JAR3D are significantly enriched in the screened windows compared to their shuffled counterparts. The initially estimated FDR of 47.0% is lowered to below 25% when certain 3D module predictions are present in the window of the 2D prediction. We discuss the implications and prospects for further development of computational strategies for detection of RNA 2D structure in genomic sequence. PMID:26509713

Single-Cell Analysis of Human Pancreas Reveals Transcriptional Signatures of Aging and Somatic Mutation Patterns.

PubMed

Enge, Martin; Arda, H Efsun; Mignardi, Marco; Beausang, John; Bottino, Rita; Kim, Seung K; Quake, Stephen R

2017-10-05

As organisms age, cells accumulate genetic and epigenetic errors that eventually lead to impaired organ function or catastrophic transformation such as cancer. Because aging reflects a stochastic process of increasing disorder, cells in an organ will be individually affected in different ways, thus rendering bulk analyses of postmitotic adult cells difficult to interpret. Here, we directly measure the effects of aging in human tissue by performing single-cell transcriptome analysis of 2,544 human pancreas cells from eight donors spanning six decades of life. We find that islet endocrine cells from older donors display increased levels of transcriptional noise and potential fate drift. By determining the mutational history of individual cells, we uncover a novel mutational signature in healthy aging endocrine cells. Our results demonstrate the feasibility of using single-cell RNA sequencing (RNA-seq) data from primary cells to derive insights into genetic and transcriptional processes that operate on aging human tissue. Copyright © 2017 Elsevier Inc. All rights reserved.

Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

PubMed Central

Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

1980-01-01

The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246

Optimized approach for Ion Proton RNA sequencing reveals details of RNA splicing and editing features of the transcriptome.

PubMed

Brown, Roger B; Madrid, Nathaniel J; Suzuki, Hideaki; Ness, Scott A

2017-01-01

RNA-sequencing (RNA-seq) has become the standard method for unbiased analysis of gene expression but also provides access to more complex transcriptome features, including alternative RNA splicing, RNA editing, and even detection of fusion transcripts formed through chromosomal translocations. However, differences in library methods can adversely affect the ability to recover these different types of transcriptome data. For example, some methods have bias for one end of transcripts or rely on low-efficiency steps that limit the complexity of the resulting library, making detection of rare transcripts less likely. We tested several commonly used methods of RNA-seq library preparation and found vast differences in the detection of advanced transcriptome features, such as alternatively spliced isoforms and RNA editing sites. By comparing several different protocols available for the Ion Proton sequencer and by utilizing detailed bioinformatics analysis tools, we were able to develop an optimized random primer based RNA-seq technique that is reliable at uncovering rare transcript isoforms and RNA editing features, as well as fusion reads from oncogenic chromosome rearrangements. The combination of optimized libraries and rapid Ion Proton sequencing provides a powerful platform for the transcriptome analysis of research and clinical samples.

A tale of two sequences: microRNA-target chimeric reads.

PubMed

Broughton, James P; Pasquinelli, Amy E

2016-04-04

In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

PubMed Central

Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

2016-01-01

Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from <1 ng of plasma RNA in <5 h. TGIRT-seq of RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

Deep Sequencing Reveals a Divergent Ugandan cassava brown streak virus Isolate from Malawi

PubMed Central

Winter, Stephan; Mukasa, Settumba; Tairo, Fred; Sseruwagi, Peter; Ndunguru, Joseph; Duffy, Siobain

2017-01-01

ABSTRACT Illumina sequencing of RNA from a cassava cutting from northern Malawi produced a genome of Ugandan cassava brown streak virus (UCBSV-MW-NB7_2013). Sequence comparisons revealed stronger similarity to an isolate from nearby Tanzania (93.4% pairwise nucleotide identity) than to those previously reported from Malawi (86.9 to 87.0%). PMID:28818908

On the path to genetic novelties: insights from programmed DNA elimination and RNA splicing.

PubMed

Catania, Francesco; Schmitz, Jürgen

2015-01-01

Understanding how genetic novelties arise is a central goal of evolutionary biology. To this end, programmed DNA elimination and RNA splicing deserve special consideration. While programmed DNA elimination reshapes genomes by eliminating chromatin during organismal development, RNA splicing rearranges genetic messages by removing intronic regions during transcription. Small RNAs help to mediate this class of sequence reorganization, which is not error-free. It is this imperfection that makes programmed DNA elimination and RNA splicing excellent candidates for generating evolutionary novelties. Leveraging a number of these two processes' mechanistic and evolutionary properties, which have been uncovered over the past years, we present recently proposed models and empirical evidence for how splicing can shape the structure of protein-coding genes in eukaryotes. We also chronicle a number of intriguing similarities between the processes of programmed DNA elimination and RNA splicing, and highlight the role that the variation in the population-genetic environment may play in shaping their target sequences. © 2015 Wiley Periodicals, Inc.

SELEX and SHAPE reveal that sequence motifs and an extended hairpin in the 5' portion of Turnip crinkle virus satellite RNA C mediate fitness in plants.

PubMed

Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B

2018-07-01

Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.

Sequence specificity of the human mRNA N6-adenosine methylase in vitro.

PubMed Central

Harper, J E; Miceli, S M; Roberts, R J; Manley, J L

1990-01-01

N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767

Transcriptogenomics identification and characterization of RNA editing sites in human primary monocytes using high-depth next generation sequencing data.

PubMed

Leong, Wai-Mun; Ripen, Adiratna Mat; Mirsafian, Hoda; Mohamad, Saharuddin Bin; Merican, Amir Feisal

2018-06-07

High-depth next generation sequencing data provide valuable insights into the number and distribution of RNA editing events. Here, we report the RNA editing events at cellular level of human primary monocyte using high-depth whole genomic and transcriptomic sequencing data. We identified over a ten thousand putative RNA editing sites and 69% of the sites were A-to-I editing sites. The sites enriched in repetitive sequences and intronic regions. High-depth sequencing datasets revealed that 90% of the canonical sites were edited at lower frequencies (<0.7). Single and multiple human monocytes and brain tissues samples were analyzed through genome sequence independent approach. The later approach was observed to identify more editing sites. Monocytes was observed to contain more C-to-U editing sites compared to brain tissues. Our results establish comparable pipeline that can address current limitations as well as demonstrate the potential for highly sensitive detection of RNA editing events in single cell type. Copyright © 2018 Elsevier Inc. All rights reserved.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

Metagenomic Analysis of Cucumber RNA from East Timor Reveals an Aphid lethal paralysis virus Genome

PubMed Central

Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel

2017-01-01

ABSTRACT We present here the first complete genomic Aphid lethal paralysis virus (ALPV) sequence isolated from cucumber plant RNA from East Timor. We compare it with two complete ALPV genome sequences from China, and one each from Israel, South Africa, and the United States. It most closely resembled the Chinese isolate LGH genome. PMID:28082492

Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria.

PubMed

Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A

2002-11-01

Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).

Novel Virus Discovery and Genome Reconstruction from Field RNA Samples Reveals Highly Divergent Viruses in Dipteran Hosts

PubMed Central

Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.

2013-01-01

We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463

Unravelling the complexity of microRNA-mediated gene regulation in black pepper (Piper nigrum L.) using high-throughput small RNA profiling.

PubMed

Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V

2016-01-01

Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.

Emergence of Distinct Brome Mosaic Virus Recombinants Is Determined by the Polarity of the Inoculum RNA

PubMed Central

Kwon, Sun-Jung

2012-01-01

Despite overwhelming interest in the impact exerted by recombination during evolution of RNA viruses, the relative contribution of the polarity of inoculum templates remains poorly understood. Here, by agroinfiltrating Nicotiana benthamiana leaves, we show that brome mosaic virus (BMV) replicase is competent to initiate positive-strand [(+)-strand] synthesis on an ectopically expressed RNA3 negative strand [(−) strand] and faithfully complete the replication cycle. Consequently, we sought to examine the role of RNA polarity in BMV recombination by expressing a series of replication-defective mutants of BMV RNA3 in (+) or (−) polarity. Temporal analysis of progeny sequences revealed that the genetic makeup of the primary recombinant pool is determined by the polarity of the inoculum template. When the polarity of the inoculum template was (+), the recombinant pool that accumulated during early phases of replication was a mixture of nonhomologous recombinants. These are longer than the inoculum template length, and a nascent 3′ untranslated region (UTR) of wild-type (WT) RNA1 or RNA2 was added to the input mutant RNA3 3′ UTR due to end-to-end template switching by BMV replicase during (−)-strand synthesis. In contrast, when the polarity of the inoculum was (−), the progeny contained a pool of native-length homologous recombinants generated by template switching of BMV replicase with a nascent UTR from WT RNA1 or RNA2 during (+)-strand synthesis. Repair of a point mutation caused by polymerase error occurred only when the polarity of the inoculum template was (+). These results contribute to the explanation of the functional role of RNA polarity in recombination mediated by copy choice mechanisms. PMID:22357282

Systematically frameshifting by deletion of every 4th or 4th and 5th nucleotides during mitochondrial transcription: RNA self-hybridization regulates delRNA expression.

PubMed

Seligmann, Hervé

2016-01-01

In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Advances in single-cell RNA sequencing and its applications in cancer research.

PubMed

Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming

2017-08-08

Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years' development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5.

Advances in single-cell RNA sequencing and its applications in cancer research

PubMed Central

Zhu, Sibo; Qing, Tao; Zheng, Yuanting; Jin, Li; Shi, Leming

2017-01-01

Unlike population-level approaches, single-cell RNA sequencing enables transcriptomic analysis of an individual cell. Through the combination of high-throughput sequencing and bioinformatic tools, single-cell RNA-seq can detect more than 10,000 transcripts in one cell to distinguish cell subsets and dynamic cellular changes. After several years’ development, single-cell RNA-seq can now achieve massively parallel, full-length mRNA sequencing as well as in situ sequencing and even has potential for multi-omic detection. One appealing area of single-cell RNA-seq is cancer research, and it is regarded as a promising way to enhance prognosis and provide more precise target therapy by identifying druggable subclones. Indeed, progresses have been made regarding solid tumor analysis to reveal intratumoral heterogeneity, correlations between signaling pathways, stemness, drug resistance, and tumor architecture shaping the microenvironment. Furthermore, through investigation into circulating tumor cells, many genes have been shown to promote a propensity toward stemness and the epithelial-mesenchymal transition, to enhance anchoring and adhesion, and to be involved in mechanisms of anoikis resistance and drug resistance. This review focuses on advances and progresses of single-cell RNA-seq with regard to the following aspects: 1. Methodologies of single-cell RNA-seq 2. Single-cell isolation techniques 3. Single-cell RNA-seq in solid tumor research 4. Single-cell RNA-seq in circulating tumor cell research 5. Perspectives PMID:28881849

A folded viral noncoding RNA blocks host cell exoribonucleases through a conformationally dynamic RNA structure.

PubMed

Steckelberg, Anna-Lena; Akiyama, Benjamin M; Costantino, David A; Sit, Tim L; Nix, Jay C; Kieft, Jeffrey S

2018-06-19

Folded RNA elements that block processive 5' → 3' cellular exoribonucleases (xrRNAs) to produce biologically active viral noncoding RNAs have been discovered in flaviviruses, potentially revealing a new mode of RNA maturation. However, whether this RNA structure-dependent mechanism exists elsewhere and, if so, whether a singular RNA fold is required, have been unclear. Here we demonstrate the existence of authentic RNA structure-dependent xrRNAs in dianthoviruses, plant-infecting viruses unrelated to animal-infecting flaviviruses. These xrRNAs have no sequence similarity to known xrRNAs; thus, we used a combination of biochemistry and virology to characterize their sequence requirements and mechanism of stopping exoribonucleases. By solving the structure of a dianthovirus xrRNA by X-ray crystallography, we reveal a complex fold that is very different from that of the flavivirus xrRNAs. However, both versions of xrRNAs contain a unique topological feature, a pseudoknot that creates a protective ring around the 5' end of the RNA structure; this may be a defining structural feature of xrRNAs. Single-molecule FRET experiments reveal that the dianthovirus xrRNAs undergo conformational changes and can use "codegradational remodeling," exploiting the exoribonucleases' degradation-linked helicase activity to help form their resistant structure; such a mechanism has not previously been reported. Convergent evolution has created RNA structure-dependent exoribonuclease resistance in different contexts, which establishes it as a general RNA maturation mechanism and defines xrRNAs as an authentic functional class of RNAs.

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing

PubMed Central

Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759

The Complex Exogenous RNA Spectra in Human Plasma: An Interface with Human Gut Biota?

PubMed Central

Wang, Kai; Li, Hong; Yuan, Yue; Etheridge, Alton; Zhou, Yong; Huang, David; Wilmes, Paul; Galas, David

2012-01-01

Human plasma has long been a rich source for biomarker discovery. It has recently become clear that plasma RNA molecules, such as microRNA, in addition to proteins are common and can serve as biomarkers. Surveying human plasma for microRNA biomarkers using next generation sequencing technology, we observed that a significant fraction of the circulating RNA appear to originate from exogenous species. With careful analysis of sequence error statistics and other controls, we demonstrated that there is a wide range of RNA from many different organisms, including bacteria and fungi as well as from other species. These RNAs may be associated with protein, lipid or other molecules protecting them from RNase activity in plasma. Some of these RNAs are detected in intracellular complexes and may be able to influence cellular activities under in vitro conditions. These findings raise the possibility that plasma RNAs of exogenous origin may serve as signaling molecules mediating for example the human-microbiome interaction and may affect and/or indicate the state of human health. PMID:23251414

Transcriptome and Small RNA Deep Sequencing Reveals Deregulation of miRNA Biogenesis in Human Glioma

PubMed Central

Moore, Lynette M.; Kivinen, Virpi; Liu, Yuexin; Annala, Matti; Cogdell, David; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Yli-Harja, Olli; Shmulevich, Ilya; Fuller, Gregory N.; Zhang, Wei; Nykter, Matti

2013-01-01

Altered expression of oncogenic and tumor-suppressing microRNAs (miRNAs) is widely associated with tumorigenesis. However, the regulatory mechanisms underlying these alterations are poorly understood. We sought to shed light on the deregulation of miRNA biogenesis promoting the aberrant miRNA expression profiles identified in these tumors. Using sequencing technology to perform both whole-transcriptome and small RNA sequencing of glioma patient samples, we examined precursor and mature miRNAs to directly evaluate the miRNA maturation process, and interrogated expression profiles for genes involved in the major steps of miRNA biogenesis. We found that ratios of mature to precursor forms of a large number of miRNAs increased with the progression from normal brain to low-grade and then to high-grade gliomas. The expression levels of genes involved in each of the three major steps of miRNA biogenesis (nuclear processing, nucleo-cytoplasmic transport, and cytoplasmic processing) were systematically altered in glioma tissues. Survival analysis of an independent data set demonstrated that the alteration of genes involved in miRNA maturation correlates with survival in glioma patients. Direct quantification of miRNA maturation with deep sequencing demonstrated that deregulation of the miRNA biogenesis pathway is a hallmark for glioma genesis and progression. PMID:23007860

Swellix: a computational tool to explore RNA conformational space.

PubMed

Sloat, Nathan; Liu, Jui-Wen; Schroeder, Susan J

2017-11-21

The sequence of nucleotides in an RNA determines the possible base pairs for an RNA fold and thus also determines the overall shape and function of an RNA. The Swellix program presented here combines a helix abstraction with a combinatorial approach to the RNA folding problem in order to compute all possible non-pseudoknotted RNA structures for RNA sequences. The Swellix program builds on the Crumple program and can include experimental constraints on global RNA structures such as the minimum number and lengths of helices from crystallography, cryoelectron microscopy, or in vivo crosslinking and chemical probing methods. The conceptual advance in Swellix is to count helices and generate all possible combinations of helices rather than counting and combining base pairs. Swellix bundles similar helices and includes improvements in memory use and efficient parallelization. Biological applications of Swellix are demonstrated by computing the reduction in conformational space and entropy due to naturally modified nucleotides in tRNA sequences and by motif searches in Human Endogenous Retroviral (HERV) RNA sequences. The Swellix motif search reveals occurrences of protein and drug binding motifs in the HERV RNA ensemble that do not occur in minimum free energy or centroid predicted structures. Swellix presents significant improvements over Crumple in terms of efficiency and memory use. The efficient parallelization of Swellix enables the computation of sequences as long as 418 nucleotides with sufficient experimental constraints. Thus, Swellix provides a practical alternative to free energy minimization tools when multiple structures, kinetically determined structures, or complex RNA-RNA and RNA-protein interactions are present in an RNA folding problem.

Small-RNA Deep Sequencing Reveals Arctium tomentosum as a Natural Host of Alstroemeria virus X and a New Putative Emaravirus

PubMed Central

Bi, Yaqi; Tugume, Arthur K.; Valkonen, Jari P. T.

2012-01-01

Background Arctium species (Asteraceae) are distributed worldwide and are used as food and rich sources of secondary metabolites for the pharmaceutical industry, e.g., against avian influenza virus. RNA silencing is an antiviral defense mechanism that detects and destroys virus-derived double-stranded RNA, resulting in accumulation of virus-derived small RNAs (21–24 nucleotides) that can be used for generic detection of viruses by small-RNA deep sequencing (SRDS). Methodology/Principal Findings SRDS was used to detect viruses in the biennial wild plant species Arctium tomentosum (woolly burdock; family Asteraceae) displaying virus-like symptoms of vein yellowing and leaf mosaic in southern Finland. Assembly of the small-RNA reads resulted in contigs homologous to Alstroemeria virus X (AlsVX), a positive/single-stranded RNA virus of genus Potexvirus (family Alphaflexiviridae), or related to negative/single-stranded RNA viruses of the genus Emaravirus. The coat protein gene of AlsVX was 81% and 89% identical to the two AlsVX isolates from Japan and Norway, respectively. The deduced, partial nucleocapsid protein amino acid sequence of the emara-like virus was only 78% or less identical to reported emaraviruses and showed no variability among the virus isolates characterized. This virus—tentatively named as Woolly burdock yellow vein virus—was exclusively associated with yellow vein and leaf mosaic symptoms in woolly burdock, whereas AlsVX was detected in only one of the 52 plants tested. Conclusions/Significance These results provide novel information about natural virus infections in Acrtium species and reveal woolly burdock as the first natural host of AlsVX besides Alstroemeria (family Alstroemeriaceae). Results also revealed a new virus related to the recently emerged Emaravirus genus and demonstrated applicability of SRDS to detect negative-strand RNA viruses. SRDS potentiates virus surveys of wild plants, a research area underrepresented in plant virology, and helps reveal natural reservoirs of viruses that cause yield losses in cultivated plants. PMID:22912734

Deep sequencing reveals cell-type-specific patterns of single-cell transcriptome variation.

PubMed

Dueck, Hannah; Khaladkar, Mugdha; Kim, Tae Kyung; Spaethling, Jennifer M; Francis, Chantal; Suresh, Sangita; Fisher, Stephen A; Seale, Patrick; Beck, Sheryl G; Bartfai, Tamas; Kuhn, Bernhard; Eberwine, James; Kim, Junhyong

2015-06-09

Differentiation of metazoan cells requires execution of different gene expression programs but recent single-cell transcriptome profiling has revealed considerable variation within cells of seeming identical phenotype. This brings into question the relationship between transcriptome states and cell phenotypes. Additionally, single-cell transcriptomics presents unique analysis challenges that need to be addressed to answer this question. We present high quality deep read-depth single-cell RNA sequencing for 91 cells from five mouse tissues and 18 cells from two rat tissues, along with 30 control samples of bulk RNA diluted to single-cell levels. We find that transcriptomes differ globally across tissues with regard to the number of genes expressed, the average expression patterns, and within-cell-type variation patterns. We develop methods to filter genes for reliable quantification and to calibrate biological variation. All cell types include genes with high variability in expression, in a tissue-specific manner. We also find evidence that single-cell variability of neuronal genes in mice is correlated with that in rats consistent with the hypothesis that levels of variation may be conserved. Single-cell RNA-sequencing data provide a unique view of transcriptome function; however, careful analysis is required in order to use single-cell RNA-sequencing measurements for this purpose. Technical variation must be considered in single-cell RNA-sequencing studies of expression variation. For a subset of genes, biological variability within each cell type appears to be regulated in order to perform dynamic functions, rather than solely molecular noise.

Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs

PubMed Central

Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten

2014-01-01

Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from <40 nt, 40–150 nt and >150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

Bacterial community comparisons by taxonomy-supervised analysis independent of sequence alignment and clustering

PubMed Central

Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.

2011-01-01

High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204

Microprocessor activity controls differential miRNA biogenesis In Vivo.

PubMed

Conrad, Thomas; Marsico, Annalisa; Gehre, Maja; Orom, Ulf Andersson

2014-10-23

In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

PubMed Central

Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

2014-01-01

Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

The use of high-throughput small RNA sequencing reveals differentially expressed microRNAs in response to aster yellows phytoplasma-infection in Vitis vinifera cv. ‘Chardonnay’

PubMed Central

Solofoharivelo, Marie-Chrystine; Souza-Richards, Rose; Stephan, Dirk; Murray, Shane; Burger, Johan T.

2017-01-01

Phytoplasmas are cell wall-less plant pathogenic bacteria responsible for major crop losses throughout the world. In grapevine they cause grapevine yellows, a detrimental disease associated with a variety of symptoms. The high economic impact of this disease has sparked considerable interest among researchers to understand molecular mechanisms related to pathogenesis. Increasing evidence exist that a class of small non-coding endogenous RNAs, known as microRNAs (miRNAs), play an important role in post-transcriptional gene regulation during plant development and responses to biotic and abiotic stresses. Thus, we aimed to dissect complex high-throughput small RNA sequencing data for the genome-wide identification of known and novel differentially expressed miRNAs, using read libraries constructed from healthy and phytoplasma-infected Chardonnay leaf material. Furthermore, we utilised computational resources to predict putative miRNA targets to explore the involvement of possible pathogen response pathways. We identified multiple known miRNA sequence variants (isomiRs), likely generated through post-transcriptional modifications. Sequences of 13 known, canonical miRNAs were shown to be differentially expressed. A total of 175 novel miRNA precursor sequences, each derived from a unique genomic location, were predicted, of which 23 were differentially expressed. A homology search revealed that some of these novel miRNAs shared high sequence similarity with conserved miRNAs from other plant species, as well as known grapevine miRNAs. The relative expression of randomly selected known and novel miRNAs was determined with real-time RT-qPCR analysis, thereby validating the trend of expression seen in the normalised small RNA sequencing read count data. Among the putative miRNA targets, we identified genes involved in plant morphology, hormone signalling, nutrient homeostasis, as well as plant stress. Our results may assist in understanding the role that miRNA pathways play during plant pathogenesis, and may be crucial in understanding disease symptom development in aster yellows phytoplasma-infected grapevines. PMID:28813447

A family of long intergenic non-coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence

PubMed Central

2018-01-01

FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722

Mitochondrial Genome Sequence of the Legume Vicia faba

PubMed Central

Negruk, Valentine

2013-01-01

The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

NASA Astrophysics Data System (ADS)

Antonielli, Livio; Sessitsch, Angela

2016-04-01

Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

Genome-wide identification and analysis of A-to-I RNA editing events in bovine by transcriptome sequencing

PubMed Central

Salehi, Abdolreza; Rivera, Rocío Melissa

2018-01-01

RNA editing increases the diversity of the transcriptome and proteome. Adenosine-to-inosine (A-to-I) editing is the predominant type of RNA editing in mammals and it is catalyzed by the adenosine deaminases acting on RNA (ADARs) family. Here, we used a largescale computational analysis of transcriptomic data from brain, heart, colon, lung, spleen, kidney, testes, skeletal muscle and liver, from three adult animals in order to identify RNA editing sites in bovine. We developed a computational pipeline and used a rigorous strategy to identify novel editing sites from RNA-Seq data in the absence of corresponding DNA sequence information. Our methods take into account sequencing errors, mapping bias, as well as biological replication to reduce the probability of obtaining a false-positive result. We conducted a detailed characterization of sequence and structural features related to novel candidate sites and found 1,600 novel canonical A-to-I editing sites in the nine bovine tissues analyzed. Results show that these sites 1) occur frequently in clusters and short interspersed nuclear elements (SINE) repeats, 2) have a preference for guanines depletion/enrichment in the flanking 5′/3′ nucleotide, 3) occur less often in coding sequences than other regions of the genome, and 4) have low evolutionary conservation. Further, we found that a positive correlation exists between expression of ADAR family members and tissue-specific RNA editing. Most of the genes with predicted A-to-I editing in each tissue were significantly enriched in biological terms relevant to the function of the corresponding tissue. Lastly, the results highlight the importance of the RNA editome in nervous system regulation. The present study extends the list of RNA editing sites in bovine and provides pipelines that may be used to investigate the editome in other organisms. PMID:29470549

Discovery and molecular characterization of a new cryptovirus dsRNA genome from Japanese persimmon through conventional cloning and high-throughput sequencing.

PubMed

Morelli, M; Chiumenti, M; De Stradis, A; La Notte, P; Minafra, A

2015-02-01

Through the application of next generation sequencing, in synergy with conventional cloning of DOP-PCR fragments, two double-stranded RNA (dsRNA) molecules of about 1.5 kbp in size were isolated from leaf tissue of a Japanese persimmon (accession SSPI) from Apulia (southern Italy) showing veinlets necrosis. High-throughput sequencing allowed whole genome sequence assembly, yielding a 1,577 and a 1,491 bp contigs identified as dsRNA-1 and dsRNA-2 of a previously undescribed virus, provisionally named as Persimmon cryptic virus (PeCV). In silico analysis showed that both dsRNA fragments were monocistronic and comprised the RNA-dependent RNA polymerase (RdRp) and the capsid protein (CP) genes, respectively. Phylogenetic reconstruction revealed a close relationship of these dsRNAs with those of cryptoviruses described in woody and herbaceous hosts, recently gathered in genus Deltapartitivirus. Virus-specific primers for RT-PCR, designed in the CP cistron, detected viral RNAs also in symptomless persimmon trees sampled from the same geographical area of SSPI, thus proving that PeCV infection may be fairly common and presumably latent.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

Combinatorial delivery of small interfering RNAs reduces RNAi efficacy by selective incorporation into RISC

PubMed Central

Castanotto, Daniela; Sakurai, Kumi; Lingeman, Robert; Li, Haitang; Shively, Louise; Aagaard, Lars; Soifer, Harris; Gatignol, Anne; Riggs, Arthur; Rossi, John J.

2007-01-01

Despite the great potential of RNAi, ectopic expression of shRNA or siRNAs holds the inherent risk of competition for critical RNAi components, thus altering the regulatory functions of some cellular microRNAs. In addition, specific siRNA sequences can potentially hinder incorporation of other siRNAs when used in a combinatorial approach. We show that both synthetic siRNAs and expressed shRNAs compete against each other and with the endogenous microRNAs for transport and for incorporation into the RNA induced silencing complex (RISC). The same siRNA sequences do not display competition when expressed from a microRNA backbone. We also show that TAR RNA binding protein (TRBP) is one of the sensors for selection and incorporation of the guide sequence of interfering RNAs. These findings reveal that combinatorial siRNA approaches can be problematic and have important implications for the methodology of expression and use of therapeutic interfering RNAs. PMID:17660190

Improve homology search sensitivity of PacBio data by correcting frameshifts.

PubMed

Du, Nan; Sun, Yanni

2016-09-01

Single-molecule, real-time sequencing (SMRT) developed by Pacific BioSciences produces longer reads than secondary generation sequencing technologies such as Illumina. The long read length enables PacBio sequencing to close gaps in genome assembly, reveal structural variations, and identify gene isoforms with higher accuracy in transcriptomic sequencing. However, PacBio data has high sequencing error rate and most of the errors are insertion or deletion errors. During alignment-based homology search, insertion or deletion errors in genes will cause frameshifts and may only lead to marginal alignment scores and short alignments. As a result, it is hard to distinguish true alignments from random alignments and the ambiguity will incur errors in structural and functional annotation. Existing frameshift correction tools are designed for data with much lower error rate and are not optimized for PacBio data. As an increasing number of groups are using SMRT, there is an urgent need for dedicated homology search tools for PacBio data. In this work, we introduce Frame-Pro, a profile homology search tool for PacBio reads. Our tool corrects sequencing errors and also outputs the profile alignments of the corrected sequences against characterized protein families. We applied our tool to both simulated and real PacBio data. The results showed that our method enables more sensitive homology search, especially for PacBio data sets of low sequencing coverage. In addition, we can correct more errors when comparing with a popular error correction tool that does not rely on hybrid sequencing. The source code is freely available at https://sourceforge.net/projects/frame-pro/ yannisun@msu.edu. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Genome sequence analysis of five Canadian isolates of strawberry mottle virus reveals extensive intra-species diversity and a longer RNA2 with increased coding capacity compared to a previously characterized European isolate.

PubMed

Bhagwat, Basdeo; Dickison, Virginia; Ding, Xinlun; Walker, Melanie; Bernardy, Michael; Bouthillier, Michel; Creelman, Alexa; DeYoung, Robyn; Li, Yinzi; Nie, Xianzhou; Wang, Aiming; Xiang, Yu; Sanfaçon, Hélène

2016-06-01

In this study, we report the genome sequence of five isolates of strawberry mottle virus (family Secoviridae, order Picornavirales) from strawberry field samples with decline symptoms collected in Eastern Canada. The Canadian isolates differed from the previously characterized European isolate 1134 in that they had a longer RNA2, resulting in a 239-amino-acid extension of the C-terminal region of the polyprotein. Sequence analysis suggests that reassortment and recombination occurred among the isolates. Phylogenetic analysis revealed that the Canadian isolates are diverse, grouping in two separate branches along with isolates from Europe and the Americas.

Tissue- and Time-Specific Expression of Otherwise Identical tRNA Genes

PubMed Central

Adir, Idan; Dahan, Orna; Broday, Limor; Pilpel, Yitzhak; Rechavi, Oded

2016-01-01

Codon usage bias affects protein translation because tRNAs that recognize synonymous codons differ in their abundance. Although the current dogma states that tRNA expression is exclusively regulated by intrinsic control elements (A- and B-box sequences), we revealed, using a reporter that monitors the levels of individual tRNA genes in Caenorhabditis elegans, that eight tryptophan tRNA genes, 100% identical in sequence, are expressed in different tissues and change their expression dynamically. Furthermore, the expression levels of the sup-7 tRNA gene at day 6 were found to predict the animal’s lifespan. We discovered that the expression of tRNAs that reside within introns of protein-coding genes is affected by the host gene’s promoter. Pairing between specific Pol II genes and the tRNAs that are contained in their introns is most likely adaptive, since a genome-wide analysis revealed that the presence of specific intronic tRNAs within specific orthologous genes is conserved across Caenorhabditis species. PMID:27560950

Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

PubMed

Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

2013-01-01

Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

Short interfering RNA confers intracellular antiviral immunity in human cells.

PubMed

Gitlin, Leonid; Karelsky, Sveta; Andino, Raul

2002-07-25

Gene silencing mediated by double-stranded RNA (dsRNA) is a sequence-specific, highly conserved mechanism in eukaryotes. In plants, it serves as an antiviral defence mechanism. Animal cells also possess this machinery but its specific function is unclear. Here we demonstrate that dsRNA can effectively protect human cells against infection by a rapidly replicating and highly cytolytic RNA virus. Pre-treatment of human and mouse cells with double-stranded, short interfering RNAs (siRNAs) to the poliovirus genome markedly reduces the titre of virus progeny and promotes clearance of the virus from most of the infected cells. The antiviral effect is sequence-specific and is not attributable to either classical antisense mechanisms or to interferon and the interferon response effectors protein kinase R (PKR) and RNaseL. Protection is the result of direct targeting of the viral genome by siRNA, as sequence analysis of escape virus (resistant to siRNAs) reveals one nucleotide substitution in the middle of the targeted sequence. Thus, siRNAs elicit specific intracellular antiviral resistance that may provide a therapeutic strategy against human viruses.

Circular RNA expression in basal cell carcinoma.

PubMed

Sand, Michael; Bechara, Falk G; Sand, Daniel; Gambichler, Thilo; Hahn, Stephan A; Bromba, Michael; Stockfleth, Eggert; Hessam, Schapoor

2016-05-01

Circular RNAs (circRNAs), are nonprotein coding RNAs consisting of a circular loop with multiple miRNA, binding sites called miRNA response elements (MREs), functioning as miRNA sponges. This study was performed to identify differentially expressed circRNAs and their MREs in basal cell carcinoma (BCC). Microarray circRNA expression profiles were acquired from BCC and control followed by qRT-PCR validation. Bioinformatical target prediction revealed multiple MREs. Sequence analysis was performed concerning MRE interaction potential with the BCC miRNome. We identified 23 upregulated and 48 downregulated circRNAs with 354 miRNA response elements capable of sequestering miRNA target sequences of the BCC miRNome. The present study describes a variety of circRNAs that are potentially involved in the molecular pathogenesis of BCC.

Recovering complete mitochondrial genome sequences from RNA-Seq: A case study of Polytomella non-photosynthetic green algae.

PubMed

Tian, Yao; Smith, David Roy

2016-05-01

Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293

PubMed Central

Kanhayuwa, Lakkhana; Coutts, Robert H. A.

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869

Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

PubMed

Kanhayuwa, Lakkhana; Coutts, Robert H A

2016-01-01

Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

PubMed Central

Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

2013-01-01

There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

Clinically Relevant Cytotoxic Immune Cell Signatures and Clonal Expansion of T Cell Receptors in High-risk MYCN-not-amplified Human Neuroblastoma | Office of Cancer Genomics

Cancer.gov

Purpose: High-risk neuroblastoma is an aggressive disease. DNA sequencing studies have revealed a paucity of actionable genomic alterations and a low mutation burden, posing challenges to develop effective novel therapies. We used RNA sequencing (RNA-seq) to investigate the biology of this disease including a focus on tumor-infiltrating lymphocytes (TILs). Experimental Design: We performed deep RNA-seq on pre-treatment diagnostic tumors from 129 high-risk and 21 low- or intermediate-risk patients with neuroblastomas.

mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus.

PubMed

Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

2010-05-01

Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic "virion factory," we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5' and 3' extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus "virophage." These results-validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)--will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system.

Simultaneous sequencing of coding and noncoding RNA reveals a human transcriptome dominated by a small number of highly expressed noncoding genes.

PubMed

Boivin, Vincent; Deschamps-Francoeur, Gabrielle; Couture, Sonia; Nottingham, Ryan M; Bouchard-Bourelle, Philia; Lambowitz, Alan M; Scott, Michelle S; Abou-Elela, Sherif

2018-07-01

Comparing the abundance of one RNA molecule to another is crucial for understanding cellular functions but most sequencing techniques can target only specific subsets of RNA. In this study, we used a new fragmented ribodepleted TGIRT sequencing method that uses a thermostable group II intron reverse transcriptase (TGIRT) to generate a portrait of the human transcriptome depicting the quantitative relationship of all classes of nonribosomal RNA longer than 60 nt. Comparison between different sequencing methods indicated that FRT is more accurate in ranking both mRNA and noncoding RNA than viral reverse transcriptase-based sequencing methods, even those that specifically target these species. Measurements of RNA abundance in different cell lines using this method correlate with biochemical estimates, confirming tRNA as the most abundant nonribosomal RNA biotype. However, the single most abundant transcript is 7SL RNA, a component of the signal recognition particle. S tructured n on c oding RNAs (sncRNAs) associated with the same biological process are expressed at similar levels, with the exception of RNAs with multiple functions like U1 snRNA. In general, sncRNAs forming RNPs are hundreds to thousands of times more abundant than their mRNA counterparts. Surprisingly, only 50 sncRNA genes produce half of the non-rRNA transcripts detected in two different cell lines. Together the results indicate that the human transcriptome is dominated by a small number of highly expressed sncRNAs specializing in functions related to translation and splicing. © 2018 Boivin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Single-cell analysis of HIV-1 transcriptional activity reveals expression of proviruses in expanded clones during ART.

PubMed

Wiegand, Ann; Spindler, Jonathan; Hong, Feiyu F; Shao, Wei; Cyktor, Joshua C; Cillo, Anthony R; Halvas, Elias K; Coffin, John M; Mellors, John W; Kearney, Mary F

2017-05-02

Little is known about the fraction of human immunodeficiency virus type 1 (HIV-1) proviruses that express unspliced viral RNA in vivo or about the levels of HIV RNA expression within single infected cells. We developed a sensitive cell-associated HIV RNA and DNA single-genome sequencing (CARD-SGS) method to investigate fractional proviral expression of HIV RNA (1.3-kb fragment of p6, protease, and reverse transcriptase) and the levels of HIV RNA in single HIV-infected cells from blood samples obtained from individuals with viremia or individuals on long-term suppressive antiretroviral therapy (ART). Spiking experiments show that the CARD-SGS method can detect a single cell expressing HIV RNA. Applying CARD-SGS to blood mononuclear cells in six samples from four HIV-infected donors (one with viremia and not on ART and three with viremia suppressed on ART) revealed that an average of 7% of proviruses (range: 2-18%) expressed HIV RNA. Levels of expression varied from one to 62 HIV RNA molecules per cell (median of 1). CARD-SGS also revealed the frequent expression of identical HIV RNA sequences across multiple single cells and across multiple time points in donors on suppressive ART consistent with constitutive expression of HIV RNA in infected cell clones. Defective proviruses were found to express HIV RNA at levels similar to those proviruses that had no obvious defects. CARD-SGS is a useful tool to characterize fractional proviral expression in single infected cells that persist despite ART and to assess the impact of experimental interventions on proviral populations and their expression.

High-Throughput Single-Cell RNA Sequencing and Data Analysis.

PubMed

Sagar; Herman, Josip Stefan; Pospisilik, John Andrew; Grün, Dominic

2018-01-01

Understanding biological systems at a single cell resolution may reveal several novel insights which remain masked by the conventional population-based techniques providing an average readout of the behavior of cells. Single-cell transcriptome sequencing holds the potential to identify novel cell types and characterize the cellular composition of any organ or tissue in health and disease. Here, we describe a customized high-throughput protocol for single-cell RNA-sequencing (scRNA-seq) combining flow cytometry and a nanoliter-scale robotic system. Since scRNA-seq requires amplification of a low amount of endogenous cellular RNA, leading to substantial technical noise in the dataset, downstream data filtering and analysis require special care. Therefore, we also briefly describe in-house state-of-the-art data analysis algorithms developed to identify cellular subpopulations including rare cell types as well as to derive lineage trees by ordering the identified subpopulations of cells along the inferred differentiation trajectories.

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency.

PubMed

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua

2016-09-22

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.

Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast.

PubMed

Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A

2016-06-01

Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3' end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. Copyright © 2016 Larson et al.

Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast

PubMed Central

Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A.

2016-01-01

Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3ʹ end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. PMID:27172183

Development of a genus-specific next generation sequencing approach for sensitive and quantitative determination of the Legionella microbiome in freshwater systems.

PubMed

Pereira, Rui P A; Peplies, Jörg; Brettar, Ingrid; Höfle, Manfred G

2017-03-31

Next Generation Sequencing (NGS) has revolutionized the analysis of natural and man-made microbial communities by using universal primers for bacteria in a PCR based approach targeting the 16S rRNA gene. In our study we narrowed primer specificity to a single, monophyletic genus because for many questions in microbiology only a specific part of the whole microbiome is of interest. We have chosen the genus Legionella, comprising more than 20 pathogenic species, due to its high relevance for water-based respiratory infections. A new NGS-based approach was designed by sequencing 16S rRNA gene amplicons specific for the genus Legionella using the Illumina MiSeq technology. This approach was validated and applied to a set of representative freshwater samples. Our results revealed that the generated libraries presented a low average raw error rate per base (<0.5%); and substantiated the use of high-fidelity enzymes, such as KAPA HiFi, for increased sequence accuracy and quality. The approach also showed high in situ specificity (>95%) and very good repeatability. Only in samples in which the gammabacterial clade SAR86 was present more than 1% non-Legionella sequences were observed. Next-generation sequencing read counts did not reveal considerable amplification/sequencing biases and showed a sensitive as well as precise quantification of L. pneumophila along a dilution range using a spiked-in, certified genome standard. The genome standard and a mock community consisting of six different Legionella species demonstrated that the developed NGS approach was quantitative and specific at the level of individual species, including L. pneumophila. The sensitivity of our genus-specific approach was at least one order of magnitude higher compared to the universal NGS approach. Comparison of quantification by real-time PCR showed consistency with the NGS data. Overall, our NGS approach can determine the quantitative abundances of Legionella species, i. e. the complete Legionella microbiome, without the need for species-specific primers. The developed NGS approach provides a new molecular surveillance tool to monitor all Legionella species in qualitative and quantitative terms if a spiked-in genome standard is used to calibrate the method. Overall, the genus-specific NGS approach opens up a new avenue to massive parallel diagnostics in a quantitative, specific and sensitive way.

The mitochondrial genomes of Campodea fragilis and C. lubbocki(Hexapoda: Diplura): high genetic divergence in a morphologically uniformtaxon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Podsiadlowski, L.; Carapelli, A.; Nardi, F.

2005-12-01

Mitochondrial genomes from two dipluran hexapods of the genus Campodea have been sequenced. Gene order is the same as in most other hexapods and crustaceans. Secondary structures of tRNAs reveal specific structural changes in tRNA-C, tRNA-R, tRNA-S1 and tRNA-S2. Comparative analyses of nucleotide and amino acid composition, as well as structural features of both ribosomal RNA subunits, reveal substantial differences among the analyzed taxa. Although the two Campodea species are morphologically highly uniform, genetic divergence is larger than expected, suggesting a long evolutionary history under stable ecological conditions.

The technology and biology of single-cell RNA sequencing.

PubMed

Kolodziejczyk, Aleksandra A; Kim, Jong Kyoung; Svensson, Valentine; Marioni, John C; Teichmann, Sarah A

2015-05-21

The differences between individual cells can have profound functional consequences, in both unicellular and multicellular organisms. Recently developed single-cell mRNA-sequencing methods enable unbiased, high-throughput, and high-resolution transcriptomic analysis of individual cells. This provides an additional dimension to transcriptomic information relative to traditional methods that profile bulk populations of cells. Already, single-cell RNA-sequencing methods have revealed new biology in terms of the composition of tissues, the dynamics of transcription, and the regulatory relationships between genes. Rapid technological developments at the level of cell capture, phenotyping, molecular biology, and bioinformatics promise an exciting future with numerous biological and medical applications. Copyright © 2015 Elsevier Inc. All rights reserved.

Full genome sequence of Rocio virus reveal substantial variations from the prototype Rocio virus SPH 34675 sequence.

PubMed

Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A

2018-01-01

Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).

A Comprehensive Approach to Sequence-oriented IsomiR annotation (CASMIR): demonstration with IsomiR profiling in colorectal neoplasia.

PubMed

Wu, Chung Wah; Evans, Jared M; Huang, Shengbing; Mahoney, Douglas W; Dukek, Brian A; Taylor, William R; Yab, Tracy C; Smyrk, Thomas C; Jen, Jin; Kisiel, John B; Ahlquist, David A

2018-05-25

MicroRNA (miRNA) profiling is an important step in studying biological associations and identifying marker candidates. miRNA exists in isoforms, called isomiRs, which may exhibit distinct properties. With conventional profiling methods, limitations in assay and analysis platforms may compromise isomiR interrogation. We introduce a comprehensive approach to sequence-oriented isomiR annotation (CASMIR) to allow unbiased identification of global isomiRs from small RNA sequencing data. In this approach, small RNA reads are maintained as independent sequences instead of being summarized under miRNA names. IsomiR features are identified through step-wise local alignment against canonical forms and precursor sequences. Through customizing the reference database, CASMIR is applicable to isomiR annotation across species. To demonstrate its application, we investigated isomiR profiles in normal and neoplastic human colorectal epithelia. We also ran miRDeep2, a popular miRNA analysis algorithm to validate isomiRs annotated by CASMIR. With CASMIR, specific and biologically relevant isomiR patterns could be identified. We note that specific isomiRs are often more abundant than their canonical forms. We identify isomiRs that are commonly up-regulated in both colorectal cancer and advanced adenoma, and illustrate advantages in targeting isomiRs as potential biomarkers over canonical forms. Studying miRNAs at the isomiR level could reveal new insight into miRNA biology and inform assay design for specific isomiRs. CASMIR facilitates comprehensive annotation of isomiR features in small RNA sequencing data for isomiR profiling and differential expression analysis.

Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support.

PubMed

Yang, Kai-Chien; Yamada, Kathryn A; Patel, Akshar Y; Topkara, Veli K; George, Isaac; Cheema, Faisal H; Ewald, Gregory A; Mann, Douglas L; Nerbonne, Jeanne M

2014-03-04

Microarrays have been used extensively to profile transcriptome remodeling in failing human heart, although the genomic coverage provided is limited and fails to provide a detailed picture of the myocardial transcriptome landscape. Here, we describe sequencing-based transcriptome profiling, providing comprehensive analysis of myocardial mRNA, microRNA (miRNA), and long noncoding RNA (lncRNA) expression in failing human heart before and after mechanical support with a left ventricular (LV) assist device (LVAD). Deep sequencing of RNA isolated from paired nonischemic (NICM; n=8) and ischemic (ICM; n=8) human failing LV samples collected before and after LVAD and from nonfailing human LV (n=8) was conducted. These analyses revealed high abundance of mRNA (37%) and lncRNA (71%) of mitochondrial origin. miRNASeq revealed 160 and 147 differentially expressed miRNAs in ICM and NICM, respectively, compared with nonfailing LV. Among these, only 2 (ICM) and 5 (NICM) miRNAs are normalized with LVAD. RNASeq detected 18 480, including 113 novel, lncRNAs in human LV. Among the 679 (ICM) and 570 (NICM) lncRNAs differentially expressed with heart failure, ≈10% are improved or normalized with LVAD. In addition, the expression signature of lncRNAs, but not miRNAs or mRNAs, distinguishes ICM from NICM. Further analysis suggests that cis-gene regulation represents a major mechanism of action of human cardiac lncRNAs. The myocardial transcriptome is dynamically regulated in advanced heart failure and after LVAD support. The expression profiles of lncRNAs, but not mRNAs or miRNAs, can discriminate failing hearts of different pathologies and are markedly altered in response to LVAD support. These results suggest an important role for lncRNAs in the pathogenesis of heart failure and in reverse remodeling observed with mechanical support.

Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells

PubMed Central

Natarajan, Sivaraman; Carter, Robert; Brown, Patrick O.

2016-01-01

Circular RNAs comprise a poorly understood new class of noncoding RNA. In this study, we used a combination of targeted deletion, high-resolution splicing detection, and single-cell sequencing to deeply probe ASXL1 circular splicing. We found that efficient circular splicing required the canonical transcriptional start site and inverted AluSx elements. Sequencing-based interrogation of isoforms after ASXL1 overexpression identified promiscuous linear splicing between all exons, with the two most abundant non-canonical linear products skipping the exons that produced the circular isoforms. Single-cell sequencing revealed a strong preference for either the linear or circular ASXL1 isoforms in each cell, and found the predominant exon skipping product is frequently co-expressed with its reciprocal circular isoform. Finally, absolute quantification of ASXL1 isoforms confirmed our findings and suggests that standard methods overestimate circRNA abundance. Taken together, these data reveal a dynamic new view of circRNA genesis, providing additional framework for studying their roles in cellular biology. PMID:27736885

Evaluation of genomic high-throughput sequencing data generated on Illumina HiSeq and Genome Analyzer systems

PubMed Central

2011-01-01

Background The generation and analysis of high-throughput sequencing data are becoming a major component of many studies in molecular biology and medical research. Illumina's Genome Analyzer (GA) and HiSeq instruments are currently the most widely used sequencing devices. Here, we comprehensively evaluate properties of genomic HiSeq and GAIIx data derived from two plant genomes and one virus, with read lengths of 95 to 150 bases. Results We provide quantifications and evidence for GC bias, error rates, error sequence context, effects of quality filtering, and the reliability of quality values. By combining different filtering criteria we reduced error rates 7-fold at the expense of discarding 12.5% of alignable bases. While overall error rates are low in HiSeq data we observed regions of accumulated wrong base calls. Only 3% of all error positions accounted for 24.7% of all substitution errors. Analyzing the forward and reverse strands separately revealed error rates of up to 18.7%. Insertions and deletions occurred at very low rates on average but increased to up to 2% in homopolymers. A positive correlation between read coverage and GC content was found depending on the GC content range. Conclusions The errors and biases we report have implications for the use and the interpretation of Illumina sequencing data. GAIIx and HiSeq data sets show slightly different error profiles. Quality filtering is essential to minimize downstream analysis artifacts. Supporting previous recommendations, the strand-specificity provides a criterion to distinguish sequencing errors from low abundance polymorphisms. PMID:22067484

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

Analysis of plant-derived miRNAs in animal small RNA datasets

PubMed Central

2012-01-01

Background Plants contain significant quantities of small RNAs (sRNAs) derived from various sRNA biogenesis pathways. Many of these sRNAs play regulatory roles in plants. Previous analysis revealed that numerous sRNAs in corn, rice and soybean seeds have high sequence similarity to animal genes. However, exogenous RNA is considered to be unstable within the gastrointestinal tract of many animals, thus limiting potential for any adverse effects from consumption of dietary RNA. A recent paper reported that putative plant miRNAs were detected in animal plasma and serum, presumably acquired through ingestion, and may have a functional impact in the consuming organisms. Results To address the question of how common this phenomenon could be, we searched for plant miRNAs sequences in public sRNA datasets from various tissues of mammals, chicken and insects. Our analyses revealed that plant miRNAs were present in the animal sRNA datasets, and significantly miR168 was extremely over-represented. Furthermore, all or nearly all (>96%) miR168 sequences were monocot derived for most datasets, including datasets for two insects reared on dicot plants in their respective experiments. To investigate if plant-derived miRNAs, including miR168, could accumulate and move systemically in insects, we conducted insect feeding studies for three insects including corn rootworm, which has been shown to be responsive to plant-produced long double-stranded RNAs. Conclusions Our analyses suggest that the observed plant miRNAs in animal sRNA datasets can originate in the process of sequencing, and that accumulation of plant miRNAs via dietary exposure is not universal in animals. PMID:22873950

Spliced leader RNA of trypanosomes: in vivo mutational analysis reveals extensive and distinct requirements for trans splicing and cap4 formation.

PubMed Central

Lücke, S; Xu, G L; Palfi, Z; Cross, M; Bellofatto, V; Bindereif, A

1996-01-01

In trypanosomes mRNAs are generated through trans splicing. The spliced leader (SL) RNA, which donates the 5'-terminal mini-exon to each of the protein coding exons, plays a central role in the trans splicing process. We have established in vivo assays to study in detail trans splicing, cap4 modification, and RNP assembly of the SL RNA in the trypanosomatid species Leptomonas seymouri. First, we found that extensive sequences within the mini-exon are required for SL RNA function in vivo, although a conserved length of 39 nt is not essential. In contrast, the intron sequence appears to be surprisingly tolerant to mutation; only the stem-loop II structure is indispensable. The asymmetry of the sequence requirements in the stem I region suggests that this domain may exist in different functional conformations. Second, distinct mini-exon sequences outside the modification site are important for efficient cap4 formation. Third, all SL RNA mutations tested allowed core RNP assembly, suggesting flexible requirements for core protein binding. In sum, the results of our mutational analysis provide evidence for a discrete domain structure of the SL RNA and help to explain the strong phylogenetic conservation of the mini-exon sequence and of the overall SL RNA secondary structure; they also suggest that there may be certain differences between trans splicing in nematodes and trypanosomes. This approach provides a basis for studying RNA-RNA interactions in the trans spliceosome. Images PMID:8861965

Codon-Anticodon Recognition in the Bacillus subtilis glyQS T Box Riboswitch

PubMed Central

Caserta, Enrico; Liu, Liang-Chun; Grundy, Frank J.; Henkin, Tina M.

2015-01-01

Many amino acid-related genes in Gram-positive bacteria are regulated by the T box riboswitch. The leader RNA of genes in the T box family controls the expression of downstream genes by monitoring the aminoacylation status of the cognate tRNA. Previous studies identified a three-nucleotide codon, termed the “Specifier Sequence,” in the riboswitch that corresponds to the amino acid identity of the downstream genes. Pairing of the Specifier Sequence with the anticodon of the cognate tRNA is the primary determinant of specific tRNA recognition. This interaction mimics codon-anticodon pairing in translation but occurs in the absence of the ribosome. The goal of the current study was to determine the effect of a full range of mismatches for comparison with codon recognition in translation. Mutations were individually introduced into the Specifier Sequence of the glyQS leader RNA and tRNAGly anticodon to test the effect of all possible pairing combinations on tRNA binding affinity and antitermination efficiency. The functional role of the conserved purine 3′ of the Specifier Sequence was also verifiedin this study. We found that substitutions at the Specifier Sequence resulted in reduced binding, the magnitude of which correlates well with the predicted stability of the RNA-RNA pairing. However, the tolerance for specific mismatches in antitermination was generally different from that during decoding, which reveals a unique tRNA recognition pattern in the T box antitermination system. PMID:26229106

Homology of aspartyl- and lysyl-tRNA synthetases.

PubMed Central

Gampel, A; Tzagoloff, A

1989-01-01

The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

Accelerating calculations of RNA secondary structure partition functions using GPUs

PubMed Central

2013-01-01

Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

Yeast mitochondrial threonyl-tRNA synthetase recognizes tRNA isoacceptors by distinct mechanisms and promotes CUN codon reassignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ling, Jiqiang; Peterson, Kaitlyn M.; Simonovic, Ivana

2014-03-12

Aminoacyl-tRNA synthetases (aaRSs) ensure faithful translation of mRNA into protein by coupling an amino acid to a set of tRNAs with conserved anticodon sequences. Here, we show that in mitochondria of Saccharomyces cerevisiae, a single aaRS (MST1) recognizes and aminoacylates two natural tRNAs that contain anticodon loops of different size and sequence. Besides a regular ?? with a threonine (Thr) anticodon, MST1 also recognizes an unusual ??, which contains an enlarged anticodon loop and an anticodon triplet that reassigns the CUN codons from leucine to threonine. Our data show that MST1 recognizes the anticodon loop in both tRNAs, but employsmore » distinct recognition mechanisms. The size but not the sequence of the anticodon loop is critical for ?? recognition, whereas the anticodon sequence is essential for aminoacylation of ??. The crystal structure of MST1 reveals that, while lacking the N-terminal editing domain, the enzyme closely resembles the bacterial threonyl-tRNA synthetase (ThrRS). A detailed structural comparison with Escherichia coli ThrRS, which is unable to aminoacylate ??, reveals differences in the anticodon-binding domain that probably allow recognition of the distinct anticodon loops. Finally, our mutational and modeling analyses identify the structural elements in MST1 (e.g., helix {alpha}11) that define tRNA selectivity. Thus, MTS1 exemplifies that a single aaRS can recognize completely divergent anticodon loops of natural isoacceptor tRNAs and that in doing so it facilitates the reassignment of the genetic code in yeast mitochondria.« less

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.

PubMed

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells

PubMed Central

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629

High throughput deep degradome sequencing reveals microRNAs and their targets in response to drought stress in mulberry (Morus alba).

PubMed

Li, Ruixue; Chen, Dandan; Wang, Taichu; Wan, Yizhen; Li, Rongfang; Fang, Rongjun; Wang, Yuting; Hu, Fei; Zhou, Hong; Li, Long; Zhao, Weiguo

2017-01-01

MicroRNAs (miRNAs) play important regulatory roles by targeting mRNAs for cleavage or translational repression. Identification of miRNA targets is essential to better understanding the roles of miRNAs. miRNA targets have not been well characterized in mulberry (Morus alba). To anatomize miRNA guided gene regulation under drought stress, transcriptome-wide high throughput degradome sequencing was used in this study to directly detect drought stress responsive miRNA targets in mulberry. A drought library (DL) and a contrast library (CL) were constructed to capture the cleaved mRNAs for sequencing. In CL, 409 target genes of 30 conserved miRNA families and 990 target genes of 199 novel miRNAs were identified. In DL, 373 target genes of 30 conserved miRNA families and 950 target genes of 195 novel miRNAs were identified. Of the conserved miRNA families in DL, mno-miR156, mno-miR172, and mno-miR396 had the highest number of targets with 54, 52 and 41 transcripts, respectively, indicating that these three miRNA families and their target genes might play important functions in response to drought stress in mulberry. Additionally, we found that many of the target genes were transcription factors. By analyzing the miRNA-target molecular network, we found that the DL independent networks consisted of 838 miRNA-mRNA pairs (63.34%). The expression patterns of 11 target genes and 12 correspondent miRNAs were detected using qRT-PCR. Six miRNA targets were further verified by RNA ligase-mediated 5' rapid amplification of cDNA ends (RLM-5' RACE). Gene Ontology (GO) annotations and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that these target transcripts were implicated in a broad range of biological processes and various metabolic pathways. This is the first study to comprehensively characterize target genes and their associated miRNAs in response to drought stress by degradome sequencing in mulberry. This study provides a framework for understanding the molecular mechanisms of drought resistance in mulberry.

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA

PubMed Central

Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo

2015-01-01

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. PMID:26674414

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

PubMed

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Phenotype classification of single cells using SRS microscopy, RNA sequencing, and microfluidics (Conference Presentation)

NASA Astrophysics Data System (ADS)

Streets, Aaron M.; Cao, Chen; Zhang, Xiannian; Huang, Yanyi

2016-03-01

Phenotype classification of single cells reveals biological variation that is masked in ensemble measurement. This heterogeneity is found in gene and protein expression as well as in cell morphology. Many techniques are available to probe phenotypic heterogeneity at the single cell level, for example quantitative imaging and single-cell RNA sequencing, but it is difficult to perform multiple assays on the same single cell. In order to directly track correlation between morphology and gene expression at the single cell level, we developed a microfluidic platform for quantitative coherent Raman imaging and immediate RNA sequencing (RNA-Seq) of single cells. With this device we actively sort and trap cells for analysis with stimulated Raman scattering microscopy (SRS). The cells are then processed in parallel pipelines for lysis, and preparation of cDNA for high-throughput transcriptome sequencing. SRS microscopy offers three-dimensional imaging with chemical specificity for quantitative analysis of protein and lipid distribution in single cells. Meanwhile, the microfluidic platform facilitates single-cell manipulation, minimizes contamination, and furthermore, provides improved RNA-Seq detection sensitivity and measurement precision, which is necessary for differentiating biological variability from technical noise. By combining coherent Raman microscopy with RNA sequencing, we can better understand the relationship between cellular morphology and gene expression at the single-cell level.

The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

PubMed

Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

2018-02-02

Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease

PubMed Central

Braun, Terry A.; Mullins, Robert F.; Wagner, Alex H.; Andorf, Jeaneen L.; Johnston, Rebecca M.; Bakall, Benjamin B.; Deluca, Adam P.; Fishman, Gerald A.; Lam, Byron L.; Weleber, Richard G.; Cideciyan, Artur V.; Jacobson, Samuel G.; Sheffield, Val C.; Tucker, Budd A.; Stone, Edwin M.

2013-01-01

Mutations in ABCA4 cause Stargardt disease and other blinding autosomal recessive retinal disorders. However, sequencing of the complete coding sequence in patients with clinical features of Stargardt disease sometimes fails to detect one or both mutations. For example, among 208 individuals with clear clinical evidence of ABCA4 disease ascertained at a single institution, 28 had only one disease-causing allele identified in the exons and splice junctions of the primary retinal transcript of the gene. Haplotype analysis of these 28 probands revealed 3 haplotypes shared among ten families, suggesting that 18 of the 28 missing alleles were rare enough to be present only once in the cohort. We hypothesized that mutations near rare alternate splice junctions in ABCA4 might cause disease by increasing the probability of mis-splicing at these sites. Next-generation sequencing of RNA extracted from human donor eyes revealed more than a dozen alternate exons that are occasionally incorporated into the ABCA4 transcript in normal human retina. We sequenced the genomic DNA containing 15 of these minor exons in the 28 one-allele subjects and observed five instances of two different variations in the splice signals of exon 36.1 that were not present in normal individuals (P < 10−6). Analysis of RNA obtained from the keratinocytes of patients with these mutations revealed the predicted alternate transcript. This study illustrates the utility of RNA sequence analysis of human donor tissue and patient-derived cell lines to identify mutations that would be undetectable by exome sequencing. PMID:23918662

International Standards for Genomes, Transcriptomes, and Metagenomes

PubMed Central

Mason, Christopher E.; Afshinnekoo, Ebrahim; Tighe, Scott; Wu, Shixiu; Levy, Shawn

2017-01-01

Challenges and biases in preparing, characterizing, and sequencing DNA and RNA can have significant impacts on research in genomics across all kingdoms of life, including experiments in single-cells, RNA profiling, and metagenomics (across multiple genomes). Technical artifacts and contamination can arise at each point of sample manipulation, extraction, sequencing, and analysis. Thus, the measurement and benchmarking of these potential sources of error are of paramount importance as next-generation sequencing (NGS) projects become more global and ubiquitous. Fortunately, a variety of methods, standards, and technologies have recently emerged that improve measurements in genomics and sequencing, from the initial input material to the computational pipelines that process and annotate the data. Here we review current standards and their applications in genomics, including whole genomes, transcriptomes, mixed genomic samples (metagenomes), and the modified bases within each (epigenomes and epitranscriptomes). These standards, tools, and metrics are critical for quantifying the accuracy of NGS methods, which will be essential for robust approaches in clinical genomics and precision medicine. PMID:28337071

Identification of a conserved branched RNA structure that functions as a factor-independent terminator.

PubMed

Johnson, Christopher M; Chen, Yuqing; Lee, Heejin; Ke, Ailong; Weaver, Keith E; Dunny, Gary M

2014-03-04

Anti-Q is a small RNA encoded on pCF10, an antibiotic resistance plasmid of Enterococcus faecalis, which negatively regulates conjugation of the plasmid. In this study we sought to understand how Anti-Q is generated relative to larger transcripts of the same operon. We found that Anti-Q folds into a branched structure that functions as a factor-independent terminator. In vitro and in vivo, termination is dependent on the integrity of this structure as well as the presence of a 3' polyuridine tract, but is not dependent on other downstream sequences. In vitro, terminated transcripts are released from RNA polymerase after synthesis. In vivo, a mutant with reduced termination efficiency demonstrated loss of tight control of conjugation function. A search of bacterial genomes revealed the presence of sequences that encode Anti-Q-like RNA structures. In vitro and in vivo experiments demonstrated that one of these functions as a terminator. This work reveals a previously unappreciated flexibility in the structure of factor-independent terminators and identifies a mechanism for generation of functional small RNAs; it should also inform annotation of bacterial sequence features, such as terminators, functional sRNAs, and operons.

Identification of a conserved branched RNA structure that functions as a factor-independent terminator

PubMed Central

Johnson, Christopher M.; Chen, Yuqing; Lee, Heejin; Ke, Ailong; Weaver, Keith E.; Dunny, Gary M.

2014-01-01

Anti-Q is a small RNA encoded on pCF10, an antibiotic resistance plasmid of Enterococcus faecalis, which negatively regulates conjugation of the plasmid. In this study we sought to understand how Anti-Q is generated relative to larger transcripts of the same operon. We found that Anti-Q folds into a branched structure that functions as a factor-independent terminator. In vitro and in vivo, termination is dependent on the integrity of this structure as well as the presence of a 3′ polyuridine tract, but is not dependent on other downstream sequences. In vitro, terminated transcripts are released from RNA polymerase after synthesis. In vivo, a mutant with reduced termination efficiency demonstrated loss of tight control of conjugation function. A search of bacterial genomes revealed the presence of sequences that encode Anti-Q–like RNA structures. In vitro and in vivo experiments demonstrated that one of these functions as a terminator. This work reveals a previously unappreciated flexibility in the structure of factor-independent terminators and identifies a mechanism for generation of functional small RNAs; it should also inform annotation of bacterial sequence features, such as terminators, functional sRNAs, and operons. PMID:24550474

Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

PubMed Central

Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

2017-01-01

Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

Identification of the cleavage sites of the RNA2-encoded polyproteins for two members of the genus Torradovirus by N-terminal sequencing of the virion capsid proteins.

PubMed

Ferriol, I; Silva Junior, D M; Nigg, J C; Zamora-Macorra, E J; Falk, B W

2016-11-01

Torradoviruses, family Secoviridae, are emergent bipartite RNA plant viruses. RNA1 is ca. 7kb and has one open reading frame (ORF) encoding for the protease, helicase and RNA-dependent RNA polymerase (RdRp). RNA2 is ca. 5kb and has two ORFs. RNA2-ORF1 encodes for a putative protein with unknown function(s). RNA2-ORF2 encodes for a putative movement protein and three capsid proteins. Little is known about the replication and polyprotein processing strategies of torradoviruses. Here, the cleavage sites in the RNA2-ORF2-encoded polyproteins of two torradoviruses, Tomato marchitez virus isolate M (ToMarV-M) and tomato chocolate spot virus, were determined by N-terminal sequencing, revealing that the amino acid (aa) at the -1 position of the cleavage sites is a glutamine. Multiple aa sequence comparison confirmed that this glutamine is conserved among other torradoviruses. Finally, site-directed mutagenesis of conserved aas in the ToMarV-M RdRp and protease prevented substantial accumulation of viral coat proteins or RNAs. Copyright © 2016 Elsevier Inc. All rights reserved.

Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

NASA Astrophysics Data System (ADS)

Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

2015-11-01

MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

PubMed

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

PubMed

Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

2017-10-18

Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the study of packaging signals in other RNA viruses. Improved understanding of RNA packaging may lead to novel vaccine approaches or targets for antiviral drugs with broad spectrum activity. Copyright © 2017 Logan et al.

Deep sequencing of small RNA repertoires in mice reveals metabolic disorders-associated hepatic miRNAs.

PubMed

Liang, Tingming; Liu, Chang; Ye, Zhenchao

2013-01-01

Obesity and associated metabolic disorders contribute importantly to the metabolic syndrome. On the other hand, microRNAs (miRNAs) are a class of small non-coding RNAs that repress target gene expression by inducing mRNA degradation and/or translation repression. Dysregulation of specific miRNAs in obesity may influence energy metabolism and cause insulin resistance, which leads to dyslipidemia, steatosis hepatis and type 2 diabetes. In the present study, we comprehensively analyzed and validated dysregulated miRNAs in ob/ob mouse liver, as well as miRNA groups based on miRNA gene cluster and gene family by using deep sequencing miRNA datasets. We found that over 13.8% of the total analyzed miRNAs were dysregulated, of which 37 miRNA species showed significantly differential expression. Further RT-qPCR analysis in some selected miRNAs validated the similar expression patterns observed in deep sequencing. Interestingly, we found that miRNA gene cluster and family always showed consistent dysregulation patterns in ob/ob mouse liver, although they had various enrichment levels. Functional enrichment analysis revealed the versatile physiological roles (over six signal pathways and five human diseases) of these miRNAs. Biological studies indicated that overexpression of miR-126 or inhibition of miR-24 in AML-12 cells attenuated free fatty acids-induced fat accumulation. Taken together, our data strongly suggest that obesity and metabolic disturbance are tightly associated with functional miRNAs. We also identified hepatic miRNA candidates serving as potential biomarkers for the diagnose of the metabolic syndrome.

Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

PubMed Central

Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

2013-01-01

Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

Single-cell analysis of HIV-1 transcriptional activity reveals expression of proviruses in expanded clones during ART

PubMed Central

Wiegand, Ann; Spindler, Jonathan; Hong, Feiyu F.; Shao, Wei; Cyktor, Joshua C.; Cillo, Anthony R.; Halvas, Elias K.; Coffin, John M.; Mellors, John W.; Kearney, Mary F.

2017-01-01

Little is known about the fraction of human immunodeficiency virus type 1 (HIV-1) proviruses that express unspliced viral RNA in vivo or about the levels of HIV RNA expression within single infected cells. We developed a sensitive cell-associated HIV RNA and DNA single-genome sequencing (CARD-SGS) method to investigate fractional proviral expression of HIV RNA (1.3-kb fragment of p6, protease, and reverse transcriptase) and the levels of HIV RNA in single HIV-infected cells from blood samples obtained from individuals with viremia or individuals on long-term suppressive antiretroviral therapy (ART). Spiking experiments show that the CARD-SGS method can detect a single cell expressing HIV RNA. Applying CARD-SGS to blood mononuclear cells in six samples from four HIV-infected donors (one with viremia and not on ART and three with viremia suppressed on ART) revealed that an average of 7% of proviruses (range: 2–18%) expressed HIV RNA. Levels of expression varied from one to 62 HIV RNA molecules per cell (median of 1). CARD-SGS also revealed the frequent expression of identical HIV RNA sequences across multiple single cells and across multiple time points in donors on suppressive ART consistent with constitutive expression of HIV RNA in infected cell clones. Defective proviruses were found to express HIV RNA at levels similar to those proviruses that had no obvious defects. CARD-SGS is a useful tool to characterize fractional proviral expression in single infected cells that persist despite ART and to assess the impact of experimental interventions on proviral populations and their expression. PMID:28416661

Identification of Two Novel Amalgaviruses in the Common Eelgrass (Zostera marina) and in Silico Analysis of the Amalgavirus +1 Programmed Ribosomal Frameshifting Sites.

PubMed

Park, Dongbin; Goh, Chul Jun; Kim, Hyein; Hahn, Yoonsoo

2018-04-01

The genome sequences of two novel monopartite RNA viruses were identified in a common eelgrass ( Zostera marina ) transcriptome dataset. Sequence comparison and phylogenetic analyses revealed that these two novel viruses belong to the genus Amalgavirus in the family Amalgaviridae . They were named Zostera marina amalgavirus 1 (ZmAV1) and Zostera marina amalgavirus 2 (ZmAV2). Genomes of both ZmAV1 and ZmAV2 contain two overlapping open reading frames (ORFs). ORF1 encodes a putative replication factory matrix-like protein, while ORF2 encodes a RNA-dependent RNA polymerase (RdRp) domain. The fusion protein (ORF1+2) of ORF1 and ORF2, which mediates RNA replication, was produced using the +1 programmed ribosomal frameshifting (PRF) mechanism. The +1 PRF motif sequence, UUU_CGN, which is highly conserved among known amalgaviruses, was also found in ZmAV1 and ZmAV2. Multiple sequence alignment of the ORF1+2 fusion proteins from 24 amalgaviruses revealed that +1 PRF occurred only at three different positions within the 13-amino acid-long segment, which was surrounded by highly conserved regions on both sides. This suggested that the +1 PRF may be constrained by the structure of fusion proteins. Genome sequences of ZmAV1 and ZmAV2, which are the first viruses to be identified in common eelgrass, will serve as useful resources for studying evolution and diversity of amalgaviruses.

Identification of Two Novel Amalgaviruses in the Common Eelgrass (Zostera marina) and in Silico Analysis of the Amalgavirus +1 Programmed Ribosomal Frameshifting Sites

PubMed Central

Park, Dongbin; Goh, Chul Jun; Kim, Hyein; Hahn, Yoonsoo

2018-01-01

The genome sequences of two novel monopartite RNA viruses were identified in a common eelgrass (Zostera marina) transcriptome dataset. Sequence comparison and phylogenetic analyses revealed that these two novel viruses belong to the genus Amalgavirus in the family Amalgaviridae. They were named Zostera marina amalgavirus 1 (ZmAV1) and Zostera marina amalgavirus 2 (ZmAV2). Genomes of both ZmAV1 and ZmAV2 contain two overlapping open reading frames (ORFs). ORF1 encodes a putative replication factory matrix-like protein, while ORF2 encodes a RNA-dependent RNA polymerase (RdRp) domain. The fusion protein (ORF1+2) of ORF1 and ORF2, which mediates RNA replication, was produced using the +1 programmed ribosomal frameshifting (PRF) mechanism. The +1 PRF motif sequence, UUU_CGN, which is highly conserved among known amalgaviruses, was also found in ZmAV1 and ZmAV2. Multiple sequence alignment of the ORF1+2 fusion proteins from 24 amalgaviruses revealed that +1 PRF occurred only at three different positions within the 13-amino acid-long segment, which was surrounded by highly conserved regions on both sides. This suggested that the +1 PRF may be constrained by the structure of fusion proteins. Genome sequences of ZmAV1 and ZmAV2, which are the first viruses to be identified in common eelgrass, will serve as useful resources for studying evolution and diversity of amalgaviruses. PMID:29628822

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

PubMed

Hargreaves, Adam D; Mulley, John F

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

PubMed Central

Hargreaves, Adam D.

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

Identification of microRNAs differentially expressed involved in male flower development.

PubMed

Wang, Zhengjia; Huang, Jianqin; Sun, Zhichao; Zheng, Bingsong

2015-03-01

Hickory (Carya cathayensis Sarg.) is one of the most economically important woody trees in eastern China, but its long flowering phase delays yield. Our understanding of the regulatory roles of microRNAs (miRNAs) in male flower development in hickory remains poor. Using high-throughput sequencing technology, we have pyrosequenced two small RNA libraries from two male flower differentiation stages in hickory. Analysis of the sequencing data identified 114 conserved miRNAs that belonged to 23 miRNA families, five novel miRNAs including their corresponding miRNA*s, and 22 plausible miRNA candidates. Differential expression analysis revealed 12 miRNA sequences that were upregulated in the later (reproductive) stage of male flower development. Quantitative real-time PCR showed similar expression trends as that of the deep sequencing. Novel miRNAs and plausible miRNA candidates were predicted using bioinformatic analysis methods. The miRNAs newly identified in this study have increased the number of known miRNAs in hickory, and the identification of differentially expressed miRNAs will provide new avenues for studies into miRNAs involved in the process of male flower development in hickory and other related trees.

mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus

PubMed Central

Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

2010-01-01

Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic “virion factory,” we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5′ and 3′ extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus “virophage.” These results—validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)—will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system. PMID:20360389

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

The Post-Apoptotic Fate of RNAs Identified Through High-Throughput Sequencing of Human Hair

PubMed Central

Lefkowitz, Gloria K.; Mukhopadhyay, Anandaroop; Cowing-Zitron, Christopher; Yu, Benjamin D.

2011-01-01

The hair of all mammals consists of terminally differentiated cells that undergo a specialized form of apoptosis called cornification. While DNA is destroyed during cornification, the extent to which RNA is lost is unknown. Here we find that multiple types of RNA are incompletely degraded after hair shaft formation in both mouse and human. Notably, mRNAs and short regulatory microRNAs (miRNAs) are stable in the hair as far as 10 cm from the scalp. To better characterize the post-apoptotic RNAs that escape degradation in the hair, we performed sequencing (RNA-seq) on RNA isolated from hair shafts pooled from several individuals. This hair shaft RNA library, which encompasses different hair types, genders, and populations, revealed 7,193 mRNAs, 449 miRNAs and thousands of unannotated transcripts that remain in the post-apoptotic hair. A comparison of the hair shaft RNA library to that of viable keratinocytes revealed surprisingly similar patterns of gene coverage and indicates that degradation of RNA is highly inefficient during apoptosis of hair lineages. The generation of a hair shaft RNA library could be used as months of accumulated transcriptional history useful for retrospective detection of disease, drug response and environmental exposure. PMID:22110684

Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.

PubMed Central

Jeruzalmi, D; Steitz, T A

1998-01-01

The T7 RNA polymerase-T7 lysozyme complex regulates phage gene expression during infection of Escherichia coli. The 2.8 A crystal structure of the complex reveals that lysozyme binds at a site remote from the polymerase active site, suggesting an indirect mechanism of inhibition. Comparison of the T7 RNA polymerase structure with that of the homologous pol I family of DNA polymerases reveals identities in the catalytic site but also differences specific to RNA polymerase function. The structure of T7 RNA polymerase presented here differs significantly from a previously published structure. Sequence similarities between phage RNA polymerases and those from mitochondria and chloroplasts, when interpreted in the context of our revised model of T7 RNA polymerase, suggest a conserved fold. PMID:9670025

Xenoepitope substitution avoids deceptive imprinting and broadens the immune response to foot-and-mouth disease virus.

PubMed

Szczepanek, Steven M; Barrette, Roger W; Rood, Debra; Alejo, Diana; Silbart, Lawrence K

2012-04-01

Many RNA viruses encode error-prone polymerases which introduce mutations into B and T cell epitopes, providing a mechanism for immunological escape. When regions of hypervariability are found within immunodominant epitopes with no known function, they are referred to as "decoy epitopes," which often deceptively imprint the host's immune response. In this work, a decoy epitope was identified in the foot-and-mouth disease virus (FMDV) serotype O VP1 G-H loop after multiple sequence alignment of 118 isolates. A series of chimeric cyclic peptides resembling the type O G-H loop were prepared, each bearing a defined "B cell xenoepitope" from another virus in place of the native decoy epitope. These sequences were derived from porcine respiratory and reproductive syndrome virus (PRRSV), from HIV, or from a presumptively tolerogenic sequence from murine albumin and were subsequently used as immunogens in BALB/c mice. Cross-reactive antibody responses against all peptides were compared to a wild-type peptide and ovalbumin (OVA). A broadened antibody response was generated in animals inoculated with the PRRSV chimeric peptide, in which virus binding of serum antibodies was also observed. A B cell epitope mapping experiment did not reveal recognition of any contiguous linear epitopes, raising the possibility that the refocused response was directed to a conformational epitope. Taken together, these results indicate that xenoepitope substitution is a novel method for immune refocusing against decoy epitopes of RNA viruses such as FMDV as part of the rational design of next-generation vaccines.

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates.

PubMed

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates

PubMed Central

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

Comprehensive definition of genome features in Spirodela polyrhiza by high-depth physical mapping and short-read DNA sequencing strategies.

PubMed

Michael, Todd P; Bryant, Douglas; Gutierrez, Ryan; Borisjuk, Nikolai; Chu, Philomena; Zhang, Hanzhong; Xia, Jing; Zhou, Junfei; Peng, Hai; El Baidouri, Moaine; Ten Hallers, Boudewijn; Hastie, Alex R; Liang, Tiffany; Acosta, Kenneth; Gilbert, Sarah; McEntee, Connor; Jackson, Scott A; Mockler, Todd C; Zhang, Weixiong; Lam, Eric

2017-02-01

Spirodela polyrhiza is a fast-growing aquatic monocot with highly reduced morphology, genome size and number of protein-coding genes. Considering these biological features of Spirodela and its basal position in the monocot lineage, understanding its genome architecture could shed light on plant adaptation and genome evolution. Like many draft genomes, however, the 158-Mb Spirodela genome sequence has not been resolved to chromosomes, and important genome characteristics have not been defined. Here we deployed rapid genome-wide physical maps combined with high-coverage short-read sequencing to resolve the 20 chromosomes of Spirodela and to empirically delineate its genome features. Our data revealed a dramatic reduction in the number of the rDNA repeat units in Spirodela to fewer than 100, which is even fewer than that reported for yeast. Consistent with its unique phylogenetic position, small RNA sequencing revealed 29 Spirodela-specific microRNA, with only two being shared with Elaeis guineensis (oil palm) and Musa balbisiana (banana). Combining DNA methylation data and small RNA sequencing enabled the accurate prediction of 20.5% long terminal repeats (LTRs) that doubled the previous estimate, and revealed a high Solo:Intact LTR ratio of 8.2. Interestingly, we found that Spirodela has the lowest global DNA methylation levels (9%) of any plant species tested. Taken together our results reveal a genome that has undergone reduction, likely through eliminating non-essential protein coding genes, rDNA and LTRs. In addition to delineating the genome features of this unique plant, the methodologies described and large-scale genome resources from this work will enable future evolutionary and functional studies of this basal monocot family. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Using deep RNA sequencing for the structural annotation of the laccaria bicolor mycorrhizal transcriptome.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larsen, P. E.; Trivedi, G.; Sreedasyam, A.

2010-07-06

Accurate structural annotation is important for prediction of function and required for in vitro approaches to characterize or validate the gene expression products. Despite significant efforts in the field, determination of the gene structure from genomic data alone is a challenging and inaccurate process. The ease of acquisition of transcriptomic sequence provides a direct route to identify expressed sequences and determine the correct gene structure. We developed methods to utilize RNA-seq data to correct errors in the structural annotation and extend the boundaries of current gene models using assembly approaches. The methods were validated with a transcriptomic data set derivedmore » from the fungus Laccaria bicolor, which develops a mycorrhizal symbiotic association with the roots of many tree species. Our analysis focused on the subset of 1501 gene models that are differentially expressed in the free living vs. mycorrhizal transcriptome and are expected to be important elements related to carbon metabolism, membrane permeability and transport, and intracellular signaling. Of the set of 1501 gene models, 1439 (96%) successfully generated modified gene models in which all error flags were successfully resolved and the sequences aligned to the genomic sequence. The remaining 4% (62 gene models) either had deviations from transcriptomic data that could not be spanned or generated sequence that did not align to genomic sequence. The outcome of this process is a set of high confidence gene models that can be reliably used for experimental characterization of protein function. 69% of expressed mycorrhizal JGI 'best' gene models deviated from the transcript sequence derived by this method. The transcriptomic sequence enabled correction of a majority of the structural inconsistencies and resulted in a set of validated models for 96% of the mycorrhizal genes. The method described here can be applied to improve gene structural annotation in other species, provided that there is a sequenced genome and a set of gene models.« less

Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

PubMed Central

Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

2016-01-01

ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115

A long natural-antisense RNA is accumulated in the conidia of Aspergillus oryzae.

PubMed

Tsujii, Masaru; Okuda, Satoshi; Ishi, Kazutomo; Madokoro, Kana; Takeuchi, Michio; Yamagata, Youhei

2016-01-01

Analysis of expressed sequence tag libraries from various culture conditions revealed the existence of conidia-specific transcripts assembled to putative conidiation-specific reductase gene (csrA) in Aspergillus oryzae. However, the all transcripts were transcribed with opposite direction to the gene csrA. The sequence analysis of the transcript revealed that the RNA overlapped mRNA of csrA with 3'-end, and did not code protein longer than 60 amino acid residues. We designated the transcript Conidia Specific Long Natural-antisense RNA (CSLNR). The real-time PCR analysis demonstrated that the CSLNR is conidia-specific transcript, which cannot be transcribed in the absence of brlA, and the amount of CSLNR was much more than that of the transcript from csrA in conidia. Furthermore, the csrA deletion, also lacking coding region of CSLNR in A. oryzae reduced the number of conidia. Overexpression of CsrA demonstrated the inhibition of growth and conidiation, while CSLNR did not affect conidiation.

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

PubMed

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Stable RNA nanoparticles as potential new generation drugs for cancer therapy☆

PubMed Central

Shu, Yi; Pi, Fengmei; Sharma, Ashwani; Rajabi, Mehdi; Haque, Farzin; Shu, Dan; Leggas, Markos; Evers, B. Mark; Guo, Peixuan

2014-01-01

Human genome sequencing revealed that only ~1.5% of the DNA sequence coded for proteins. More and more evidence has uncovered that a substantial part of the 98.5% so-called “junk” DNAs actually code for noncoding RNAs. Two milestones, chemical drugs and protein drugs, have already appeared in the history of drug development, and it is expected that the third milestone in drug development will be RNA drugs or drugs that target RNA. This review focuses on the development of RNA therapeutics for potential cancer treatment by applying RNA nanotechnology. A therapeutic RNA nanoparticle is unique in that its scaffold, ligand, and therapeutic component can all be composed of RNA. The special physicochemical properties lend to the delivery of siRNA, miRNA, ribozymes, or riboswitches; imaging using fluogenenic RNA; and targeting using RNA aptamers. With recent advances in solving the chemical, enzymatic, and thermodynamic stability issues, RNA nanoparticles have been found to be advantageous for in vivo applications due to their uniform nano-scale size, precise stoichiometry, polyvalent nature, low immunogenicity, low toxicity, and target specificity. In vivo animal studies have revealed that RNA nanoparticles can specifically target tumors with favorable pharmacokinetic and pharmacodynamic parameters without unwanted accumulation in normal organs. This review summarizes the key studies that have led to the detailed understanding of RNA nanoparticle formation as well as chemical and thermodynamic stability issue. The methods for RNA nanoparticle construction, and the current challenges in the clinical application of RNA nanotechnology, such as endosome trapping and production costs, are also discussed. PMID:24270010

Population-genomic variation within RNA viruses of the Western honey bee, Apis mellifera, inferred from deep sequencing

USDA-ARS?s Scientific Manuscript database

Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RN...

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

PubMed Central

Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

2016-01-01

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

PubMed Central

Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

2005-01-01

The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

Combinatory RNA-Sequencing Analyses Reveal a Dual Mode of Gene Regulation by ADAR1 in Gastric Cancer.

PubMed

Cho, Charles J; Jung, Jaeeun; Jiang, Lushang; Lee, Eun Ji; Kim, Dae-Soo; Kim, Byung Sik; Kim, Hee Sung; Jung, Hwoon-Yong; Song, Ho-June; Hwang, Sung Wook; Park, Yangsoon; Jung, Min Kyo; Pack, Chan Gi; Myung, Seung-Jae; Chang, Suhwan

2018-04-25

Adenosine deaminase acting on RNA 1 (ADAR1) is known to mediate deamination of adenosine-to-inosine through binding to double-stranded RNA, the phenomenon known as RNA editing. Currently, the function of ADAR1 in gastric cancer is unclear. This study was aimed at investigating RNA editing-dependent and editing-independent functions of ADAR1 in gastric cancer, especially focusing on its influence on editing of 3' untranslated regions (UTRs) and subsequent changes in expression of messenger RNAs (mRNAs) as well as microRNAs (miRNAs). RNA-sequencing and small RNA-sequencing were performed on AGS and MKN-45 cells with a stable ADAR1 knockdown. Changed frequencies of editing and mRNA and miRNA expression were then identified by bioinformatic analyses. Targets of RNA editing were further validated in patients' samples. In the Alu region of both gastric cell lines, editing was most commonly of the A-to-I type in 3'-UTR or intron. mRNA and protein levels of PHACTR4 increased in ADAR1 knockdown cells, because of the loss of seed sequences in 3'-UTR of PHACTR4 mRNA that are required for miRNA-196a-3p binding. Immunohistochemical analyses of tumor and paired normal samples from 16 gastric cancer patients showed that ADAR1 expression was higher in tumors than in normal tissues and inversely correlated with PHACTR4 staining. On the other hand, decreased miRNA-148a-3p expression in ADAR1 knockdown cells led to increased mRNA and protein expression of NFYA, demonstrating ADAR1's editing-independent function. ADAR1 regulates post-transcriptional gene expression in gastric cancer through both RNA editing-dependent and editing-independent mechanisms.

Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

NASA Technical Reports Server (NTRS)

Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

1991-01-01

Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

omiRas: a Web server for differential expression analysis of miRNAs derived from small RNA-Seq data.

PubMed

Müller, Sören; Rycak, Lukas; Winter, Peter; Kahl, Günter; Koch, Ina; Rotter, Björn

2013-10-15

Small RNA deep sequencing is widely used to characterize non-coding RNAs (ncRNAs) differentially expressed between two conditions, e.g. healthy and diseased individuals and to reveal insights into molecular mechanisms underlying condition-specific phenotypic traits. The ncRNAome is composed of a multitude of RNAs, such as transfer RNA, small nucleolar RNA and microRNA (miRNA), to name few. Here we present omiRas, a Web server for the annotation, comparison and visualization of interaction networks of ncRNAs derived from next-generation sequencing experiments of two different conditions. The Web tool allows the user to submit raw sequencing data and results are presented as: (i) static annotation results including length distribution, mapping statistics, alignments and quantification tables for each library as well as lists of differentially expressed ncRNAs between conditions and (ii) an interactive network visualization of user-selected miRNAs and their target genes based on the combination of several miRNA-mRNA interaction databases. The omiRas Web server is implemented in Python, PostgreSQL, R and can be accessed at: http://tools.genxpro.net/omiras/.

The identification and functional annotation of RNA structures conserved in vertebrates

PubMed Central

Seemann, Stefan E.; Mirza, Aashiq H.; Hansen, Claus; Bang-Berthelsen, Claus H.; Garde, Christian; Christensen-Dalsgaard, Mikkel; Torarinsson, Elfar; Yao, Zizhen; Workman, Christopher T.; Pociot, Flemming; Nielsen, Henrik; Tommerup, Niels; Ruzzo, Walter L.; Gorodkin, Jan

2017-01-01

Structured elements of RNA molecules are essential in, e.g., RNA stabilization, localization, and protein interaction, and their conservation across species suggests a common functional role. We computationally screened vertebrate genomes for conserved RNA structures (CRSs), leveraging structure-based, rather than sequence-based, alignments. After careful correction for sequence identity and GC content, we predict ∼516,000 human genomic regions containing CRSs. We find that a substantial fraction of human–mouse CRS regions (1) colocalize consistently with binding sites of the same RNA binding proteins (RBPs) or (2) are transcribed in corresponding tissues. Additionally, a CaptureSeq experiment revealed expression of many of our CRS regions in human fetal brain, including 662 novel ones. For selected human and mouse candidate pairs, qRT-PCR and in vitro RNA structure probing supported both shared expression and shared structure despite low abundance and low sequence identity. About 30,000 CRS regions are located near coding or long noncoding RNA genes or within enhancers. Structured (CRS overlapping) enhancer RNAs and extended 3′ ends have significantly increased expression levels over their nonstructured counterparts. Our findings of transcribed uncharacterized regulatory regions that contain CRSs support their RNA-mediated functionality. PMID:28487280

Programmable RNA recognition and cleavage by CRISPR/Cas9.

PubMed

O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

2014-12-11

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

Programmable RNA recognition and cleavage by CRISPR/Cas9

PubMed Central

O’Connell, Mitchell R.; Oakes, Benjamin L.; Sternberg, Samuel H.; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A.

2014-01-01

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific doublestranded DNA (dsDNA) cleavage1-5. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, the protospacer adjacent motif (PAM), next to and on the strand opposite the 20-nucleotide target site in dsDNA4-7. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in many cell types and organisms8, but it has been thought to be incapable of targeting RNA5. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalyzed DNA cleavage7. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous mRNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable and tagless transcript recognition. PMID:25274302

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

PubMed Central

Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

2015-01-01

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

PubMed

Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

2008-06-05

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

Topological Structure of the Space of Phenotypes: The Case of RNA Neutral Networks

PubMed Central

Aguirre, Jacobo; Buldú, Javier M.; Stich, Michael; Manrubia, Susanna C.

2011-01-01

The evolution and adaptation of molecular populations is constrained by the diversity accessible through mutational processes. RNA is a paradigmatic example of biopolymer where genotype (sequence) and phenotype (approximated by the secondary structure fold) are identified in a single molecule. The extreme redundancy of the genotype-phenotype map leads to large ensembles of RNA sequences that fold into the same secondary structure and can be connected through single-point mutations. These ensembles define neutral networks of phenotypes in sequence space. Here we analyze the topological properties of neutral networks formed by 12-nucleotides RNA sequences, obtained through the exhaustive folding of sequence space. A total of 412 sequences fragments into 645 subnetworks that correspond to 57 different secondary structures. The topological analysis reveals that each subnetwork is far from being random: it has a degree distribution with a well-defined average and a small dispersion, a high clustering coefficient, and an average shortest path between nodes close to its minimum possible value, i.e. the Hamming distance between sequences. RNA neutral networks are assortative due to the correlation in the composition of neighboring sequences, a feature that together with the symmetries inherent to the folding process explains the existence of communities. Several topological relationships can be analytically derived attending to structural restrictions and generic properties of the folding process. The average degree of these phenotypic networks grows logarithmically with their size, such that abundant phenotypes have the additional advantage of being more robust to mutations. This property prevents fragmentation of neutral networks and thus enhances the navigability of sequence space. In summary, RNA neutral networks show unique topological properties, unknown to other networks previously described. PMID:22028856

A MicroRNA Superfamily Regulates Nucleotide Binding Site–Leucine-Rich Repeats and Other mRNAs[W][OA

PubMed Central

Shivaprasad, Padubidri V.; Chen, Ho-Ming; Patel, Kanu; Bond, Donna M.; Santos, Bruno A.C.M.; Baulcombe, David C.

2012-01-01

Analysis of tomato (Solanum lycopersicum) small RNA data sets revealed the presence of a regulatory cascade affecting disease resistance. The initiators of the cascade are microRNA members of an unusually diverse superfamily in which miR482 and miR2118 are prominent members. Members of this superfamily are variable in sequence and abundance in different species, but all variants target the coding sequence for the P-loop motif in the mRNA sequences for disease resistance proteins with nucleotide binding site (NBS) and leucine-rich repeat (LRR) motifs. We confirm, using transient expression in Nicotiana benthamiana, that miR482 targets mRNAs for NBS-LRR disease resistance proteins with coiled-coil domains at their N terminus. The targeting causes mRNA decay and production of secondary siRNAs in a manner that depends on RNA-dependent RNA polymerase 6. At least one of these secondary siRNAs targets other mRNAs of a defense-related protein. The miR482-mediated silencing cascade is suppressed in plants infected with viruses or bacteria so that expression of mRNAs with miR482 or secondary siRNA target sequences is increased. We propose that this process allows pathogen-inducible expression of NBS-LRR proteins and that it contributes to a novel layer of defense against pathogen attack. PMID:22408077

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Complementary DNA cloning, sequence analysis, and tissue transcription profile of a novel U2AF2 gene from the Chinese Banna mini-pig inbred line.

PubMed

Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z

2013-04-02

U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.

Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models

PubMed Central

Mueller, Ulrich G.; Ishak, Heather; Lee, Jung C.; Sen, Ruchira; Gutell, Robin R.

2010-01-01

We reconstruct the phylogenetic relationships within the bacterial genus Pseudonocardia to evaluate two models explaining how and why Pseudonocardia bacteria colonize the microbial communities on the integument of fungus-gardening ant species (Attini, Formicidae). The traditional Coevolution-Codivergence model views the integument-colonizing Pseudonocardia as mutualistic microbes that are largely vertically transmitted between ant generations and that supply antibiotics that specifically suppress the garden pathogen Escovopsis. The more recent Acquisition model views Pseudonocardia as part of a larger integumental microbe community that frequently colonizes the ant integument from environmental sources (e.g., soil, plant material). Under this latter model, ant-associated Pseudonocardia may have diverse ecological roles on the ant integument (possibly ranging from pathogenic, to commensal, to mutualistic) and are not necessarily related to Escovopsis suppression. We test distinct predictions of these two models regarding the phylogenetic proximity of ant-associated and environmental Pseudonocardia. We amassed 16S-rRNA gene sequence information for 87 attine-associated and 238 environmental Pseudonocardia, aligned the sequences with the help of RNA secondary structure modeling, and reconstructed phylogenetic relationships using a maximum-likelihood approach. We present 16S-rRNA secondary structure models of representative Pseudonocardia species to improve sequence alignments and identify sequencing errors. Our phylogenetic analyses reveal close affinities and even identical sequence matches between environmental Pseudonocardia and ant-associated Pseudonocardia, as well as nesting of environmental Pseudonocardia in subgroups that were previously thought to be specialized to associate only with attine ants. The great majority of ant associated Pseudonocardia are closely related to autotrophic Pseudonocardia and are placed in a large subgroup of Pseudonocardia that is known essentially only from cultured isolates (rather than cloned 16S sequences). The preponderance of the known ant-associated Pseudonocardia in this latter clade of culturable lineages may not necessarily reflect abundance of these Pseudonocardia types on the ants, but isolation biases when screening for Pseudonocardia (e.g., preferential isolation of autotrophic Pseudonocardia with minimum-nutrient media). The accumulated phylogenetic patterns and the possibility of isolation biases in previous work further erode support for the traditional Coevolution-Codivergence model and calls for continued revision of our understanding how and why Pseudonocardia colonize the microbial communities on the integument of fungus-gardening ant species. PMID:20333466

Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models.

PubMed

Mueller, Ulrich G; Ishak, Heather; Lee, Jung C; Sen, Ruchira; Gutell, Robin R

2010-08-01

We reconstruct the phylogenetic relationships within the bacterial genus Pseudonocardia to evaluate two models explaining how and why Pseudonocardia bacteria colonize the microbial communities on the integument of fungus-gardening ant species (Attini, Formicidae). The traditional Coevolution-Codivergence model views the integument-colonizing Pseudonocardia as mutualistic microbes that are largely vertically transmitted between ant generations and that supply antibiotics that specifically suppress the garden pathogen Escovopsis. The more recent Acquisition model views Pseudonocardia as part of a larger integumental microbe community that frequently colonizes the ant integument from environmental sources (e.g., soil, plant material). Under this latter model, ant-associated Pseudonocardia may have diverse ecological roles on the ant integument (possibly ranging from pathogenic, to commensal, to mutualistic) and are not necessarily related to Escovopsis suppression. We test distinct predictions of these two models regarding the phylogenetic proximity of ant-associated and environmental Pseudonocardia. We amassed 16S-rRNA gene sequence information for 87 attine-associated and 238 environmental Pseudonocardia, aligned the sequences with the help of RNA secondary structure modeling, and reconstructed phylogenetic relationships using a maximum-likelihood approach. We present 16S-rRNA secondary structure models of representative Pseudonocardia species to improve sequence alignments and identify sequencing errors. Our phylogenetic analyses reveal close affinities and even identical sequence matches between environmental Pseudonocardia and ant-associated Pseudonocardia, as well as nesting of environmental Pseudonocardia in subgroups that were previously thought to be specialized to associate only with attine ants. The great majority of ant-associated Pseudonocardia are closely related to autotrophic Pseudonocardia and are placed in a large subgroup of Pseudonocardia that is known essentially only from cultured isolates (rather than cloned 16S sequences). The preponderance of the known ant-associated Pseudonocardia in this latter clade of culturable lineages may not necessarily reflect abundance of these Pseudonocardia types on the ants, but isolation biases when screening for Pseudonocardia (e.g., preferential isolation of autotrophic Pseudonocardia with minimum-nutrient media). The accumulated phylogenetic patterns and the possibility of isolation biases in previous work further erode support for the traditional Coevolution-Codivergence model and calls for continued revision of our understanding how and why Pseudonocardia colonize the microbial communities on the integument of fungus-gardening ant species.

RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA.

PubMed

Cui, Yalei; Huang, Tianzhi; Zhang, Xiaobo

2015-12-01

MicroRNAs (miRNAs) integrate with Argonaut (Ago) to create the RNA-induced silencing complex, and regulate gene expression by silencing target mRNAs. RNA editing of miRNA may affect miRNA processing, assembly of the Ago complex and target mRNA binding. However, the function of edited miRNA, assembled within the Ago complex, has not been extensively investigated. In this study, sequence analysis of the Ago complex of Marsupenaeus japonicus shrimp infected with white spot syndrome virus (WSSV) revealed that host ADAR (adenosine deaminase acting on RNA) catalysed A-to-I RNA editing of a viral miRNA (WSSV-miR-N12) at the +16 site. This editing of the non-seed sequence did not affect association of the edited miRNA with the Ago protein, but inhibited interaction between the miRNA and its target gene (wsv399). The WSSV early gene wsv399 inhibited WSSV infection. As a result, the RNA editing of miRNA caused virus latency. Our results highlight a novel example of miRNA editing in the miRNA-induced silencing complex. © 2015 The Authors.

The RNA methyltransferase Dnmt2 is required for efficient Dicer-2-dependent siRNA pathway activity in Drosophila.

PubMed

Durdevic, Zeljko; Mobin, Mehrpouya Balaghy; Hanna, Katharina; Lyko, Frank; Schaefer, Matthias

2013-09-12

Transfer RNA (tRNA) fragmentation in response to stress conditions has been described in many organisms. tRNA fragments have been found in association with small interfering RNA (siRNA) components, but the biological role of these interactions remains unclear. We report here that the tRNA methyltransferase Dnmt2 is essential for efficient Dicer-2 (Dcr-2) function in Drosophila. Using small RNA (sRNA) sequencing, we confirmed that Dnmt2 limits the extent of tRNA fragmentation during the heat-shock response. tRNAs as well as tRNA fragments serve as Dcr-2 substrates, and Dcr-2 degrades tRNA-derived sequences, especially under heat-shock conditions. tRNA-derived RNAs are able to inhibit Dcr-2 activity on long double-stranded RNAs (dsRNAs). Consequently, heat-shocked Dnmt2 mutant animals accumulate dsRNAs, produce fewer siRNAs, and show misregulation of siRNA pathway-dependent genes. These results reveal the impact of tRNA fragmentation on siRNA pathways and implicate tRNA modifications in the regulation of sRNA homeostasis during the heat-shock response. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Qualitative and quantitative assessment of Illumina's forensic STR and SNP kits on MiSeq FGx™.

PubMed

Sharma, Vishakha; Chow, Hoi Yan; Siegel, Donald; Wurmbach, Elisa

2017-01-01

Massively parallel sequencing (MPS) is a powerful tool transforming DNA analysis in multiple fields ranging from medicine, to environmental science, to evolutionary biology. In forensic applications, MPS offers the ability to significantly increase the discriminatory power of human identification as well as aid in mixture deconvolution. However, before the benefits of any new technology can be employed, a thorough evaluation of its quality, consistency, sensitivity, and specificity must be rigorously evaluated in order to gain a detailed understanding of the technique including sources of error, error rates, and other restrictions/limitations. This extensive study assessed the performance of Illumina's MiSeq FGx MPS system and ForenSeq™ kit in nine experimental runs including 314 reaction samples. In-depth data analysis evaluated the consequences of different assay conditions on test results. Variables included: sample numbers per run, targets per run, DNA input per sample, and replications. Results are presented as heat maps revealing patterns for each locus. Data analysis focused on read numbers (allele coverage), drop-outs, drop-ins, and sequence analysis. The study revealed that loci with high read numbers performed better and resulted in fewer drop-outs and well balanced heterozygous alleles. Several loci were prone to drop-outs which led to falsely typed homozygotes and therefore to genotype errors. Sequence analysis of allele drop-in typically revealed a single nucleotide change (deletion, insertion, or substitution). Analyses of sequences, no template controls, and spurious alleles suggest no contamination during library preparation, pooling, and sequencing, but indicate that sequencing or PCR errors may have occurred due to DNA polymerase infidelities. Finally, we found utilizing Illumina's FGx System at recommended conditions does not guarantee 100% outcomes for all samples tested, including the positive control, and required manual editing due to low read numbers and/or allele drop-in. These findings are important for progressing towards implementation of MPS in forensic DNA testing.

The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.

PubMed Central

Zubiaga, A M; Belasco, J G; Greenberg, M E

1995-01-01

Labile mRNAs that encode cytokine and immediate-early gene products often contain AU-rich sequences within their 3' untranslated region (UTR). These AU-rich sequences appear to be key determinants of the short half-lives of these mRNAs, although the sequence features of these elements and the mechanism by which they target mRNAs for rapid decay have not been fully defined. We have examined the features of AU-rich elements (AREs) that are crucial for their function as determinants of mRNA instability in mammalian cells by testing the ability of various mutant c-fos AREs and synthetic AREs to direct rapid mRNA deadenylation and decay when inserted within the 3' UTR of the normally stable beta-globin mRNA. Evidence is presented that the pentamer AUUUA, which previously was suggested to be the minimal determinant of instability present in mammalian AREs, cannot direct rapid mRNA deadenylation and decay. Instead, the nonomer UUAUUUAUU is the elemental AU-rich sequence motif that destabilizes mRNA. Removal of one uridine residue from either end of the nonamer (UUAUUUAU or UAUUUAUU) results in a decrease of potency of the element, while removal of a uridine residue from both ends of the nonamer (UAUUUAU) eliminates detectable destabilizing activity. The inclusion of an additional uridine residue at both ends of the nonamer (UUUAUUUAUUU) does not further increase the efficacy of the element. Taken together, these findings suggest that the nonamer UUAUUUAUU is the minimal AU-rich motif that effectively destabilizes mRNA. Additional ARE potency is achieved by combining multiple copies of this nonamer in a single mRNA 3' UTR. Furthermore, analysis of poly(A) shortening rates for ARE-containing mRNAs reveals that the UUAUUUAUU sequence also accelerates mRNA deadenylation and suggests that the UUAUUUAUU motif targets mRNA for rapid deadenylation as an early step in the mRNA decay process. PMID:7891716

Genomic organization and sequence of the Gus-s/sup a/ allele of the murine. beta. -glucuronidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funkenstein, B.; Leary, S.L.; Stein, J.C.

1988-03-01

The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

Fluorescence Competition Assay Measurements of Free Energy Changes for RNA Pseudoknots†

PubMed Central

2009-01-01

RNA pseudoknots have important functions, and thermodynamic stability is a key to predicting pseudoknots in RNA sequences and to understanding their functions. Traditional methods, such as UV melting and differential scanning calorimetry, for measuring RNA thermodynamics are restricted to temperature ranges around the melting temperature for a pseudoknot. Here, we report RNA pseudoknot free energy changes at 37 °C measured by fluorescence competition assays. Sequence-dependent studies for the loop 1−stem 2 region reveal (1) the individual nearest-neighbor hydrogen bonding (INN-HB) model provides a reasonable estimate for the free energy change when a Watson−Crick base pair in stem 2 is changed, (2) the loop entropy can be estimated by a statistical polymer model, although some penalty for certain loop sequences is necessary, and (3) tertiary interactions can significantly stabilize pseudoknots and extending the length of stem 2 may alter tertiary interactions such that the INN-HB model does not predict the net effect of adding a base pair. The results can inform writing of algorithms for predicting and/or designing RNA secondary structures. PMID:19921809

Specific and Modular Binding Code for Cytosine Recognition in Pumilio/FBF (PUF) RNA-binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Shuyun; Wang, Yang; Cassidy-Amstutz, Caleb

2011-10-28

Pumilio/fem-3 mRNA-binding factor (PUF) proteins possess a recognition code for bases A, U, and G, allowing designed RNA sequence specificity of their modular Pumilio (PUM) repeats. However, recognition side chains in a PUM repeat for cytosine are unknown. Here we report identification of a cytosine-recognition code by screening random amino acid combinations at conserved RNA recognition positions using a yeast three-hybrid system. This C-recognition code is specific and modular as specificity can be transferred to different positions in the RNA recognition sequence. A crystal structure of a modified PUF domain reveals specific contacts between an arginine side chain and themore » cytosine base. We applied the C-recognition code to design PUF domains that recognize targets with multiple cytosines and to generate engineered splicing factors that modulate alternative splicing. Finally, we identified a divergent yeast PUF protein, Nop9p, that may recognize natural target RNAs with cytosine. This work deepens our understanding of natural PUF protein target recognition and expands the ability to engineer PUF domains to recognize any RNA sequence.« less

SRD: a Staphylococcus regulatory RNA database.

PubMed

Sassi, Mohamed; Augagneur, Yoann; Mauro, Tony; Ivain, Lorraine; Chabelskaya, Svetlana; Hallier, Marc; Sallou, Olivier; Felden, Brice

2015-05-01

An overflow of regulatory RNAs (sRNAs) was identified in a wide range of bacteria. We designed and implemented a new resource for the hundreds of sRNAs identified in Staphylococci, with primary focus on the human pathogen Staphylococcus aureus. The "Staphylococcal Regulatory RNA Database" (SRD, http://srd.genouest.org/) compiled all published data in a single interface including genetic locations, sequences and other features. SRD proposes novel and simplified identifiers for Staphylococcal regulatory RNAs (srn) based on the sRNA's genetic location in S. aureus strain N315 which served as a reference. From a set of 894 sequences and after an in-depth cleaning, SRD provides a list of 575 srn exempt of redundant sequences. For each sRNA, their experimental support(s) is provided, allowing the user to individually assess their validity and significance. RNA-seq analysis performed on strains N315, NCTC8325, and Newman allowed us to provide further details, upgrade the initial annotation, and identified 159 RNA-seq independent transcribed sRNAs. The lists of 575 and 159 sRNAs sequences were used to predict the number and location of srns in 18 S. aureus strains and 10 other Staphylococci. A comparison of the srn contents within 32 Staphylococcal genomes revealed a poor conservation between species. In addition, sRNA structure predictions obtained with MFold are accessible. A BLAST server and the intaRNA program, which is dedicated to target prediction, were implemented. SRD is the first sRNA database centered on a genus; it is a user-friendly and scalable device with the possibility to submit new sequences that should spread in the literature. © 2015 Sassi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The Extent of mRNA Editing Is Limited in Chicken Liver and Adipose, but Impacted by Tissular Context, Genotype, Age, and Feeding as Exemplified with a Conserved Edited Site in COG3.

PubMed

Roux, Pierre-François; Frésard, Laure; Boutin, Morgane; Leroux, Sophie; Klopp, Christophe; Djari, Anis; Esquerré, Diane; Martin, Pascal G P; Zerjal, Tatiana; Gourichon, David; Pitel, Frédérique; Lagarrigue, Sandrine

2015-12-04

RNA editing is a posttranscriptional process leading to differences between genomic DNA and transcript sequences, potentially enhancing transcriptome diversity. With recent advances in high-throughput sequencing, many efforts have been made to describe mRNA editing at the transcriptome scale, especially in mammals, yielding contradictory conclusions regarding the extent of this phenomenon. We show, by detailed description of the 25 studies focusing so far on mRNA editing at the whole-transcriptome scale, that systematic sequencing artifacts are considered in most studies whereas biological replication is often neglected and multi-alignment not properly evaluated, which ultimately impairs the legitimacy of results. We recently developed a rigorous strategy to identify mRNA editing using mRNA and genomic DNA sequencing, taking into account sequencing and mapping artifacts, and biological replicates. We applied this method to screen for mRNA editing in liver and white adipose tissue from eight chickens and confirm the small extent of mRNA recoding in this species. Among the 25 unique edited sites identified, three events were previously described in mammals, attesting that this phenomenon is conserved throughout evolution. Deeper investigations on five sites revealed the impact of tissular context, genotype, age, feeding conditions, and sex on mRNA editing levels. More specifically, this analysis highlighted that the editing level at the site located on COG3 was strongly regulated by four of these factors. By comprehensively characterizing the mRNA editing landscape in chickens, our results highlight how this phenomenon is limited and suggest regulation of editing levels by various genetic and environmental factors. Copyright © 2016 Roux et al.

The Extent of mRNA Editing Is Limited in Chicken Liver and Adipose, but Impacted by Tissular Context, Genotype, Age, and Feeding as Exemplified with a Conserved Edited Site in COG3

PubMed Central

Roux, Pierre-François; Frésard, Laure; Boutin, Morgane; Leroux, Sophie; Klopp, Christophe; Djari, Anis; Esquerré, Diane; Martin, Pascal GP; Zerjal, Tatiana; Gourichon, David; Pitel, Frédérique; Lagarrigue, Sandrine

2015-01-01

RNA editing is a posttranscriptional process leading to differences between genomic DNA and transcript sequences, potentially enhancing transcriptome diversity. With recent advances in high-throughput sequencing, many efforts have been made to describe mRNA editing at the transcriptome scale, especially in mammals, yielding contradictory conclusions regarding the extent of this phenomenon. We show, by detailed description of the 25 studies focusing so far on mRNA editing at the whole-transcriptome scale, that systematic sequencing artifacts are considered in most studies whereas biological replication is often neglected and multi-alignment not properly evaluated, which ultimately impairs the legitimacy of results. We recently developed a rigorous strategy to identify mRNA editing using mRNA and genomic DNA sequencing, taking into account sequencing and mapping artifacts, and biological replicates. We applied this method to screen for mRNA editing in liver and white adipose tissue from eight chickens and confirm the small extent of mRNA recoding in this species. Among the 25 unique edited sites identified, three events were previously described in mammals, attesting that this phenomenon is conserved throughout evolution. Deeper investigations on five sites revealed the impact of tissular context, genotype, age, feeding conditions, and sex on mRNA editing levels. More specifically, this analysis highlighted that the editing level at the site located on COG3 was strongly regulated by four of these factors. By comprehensively characterizing the mRNA editing landscape in chickens, our results highlight how this phenomenon is limited and suggest regulation of editing levels by various genetic and environmental factors. PMID:26637431

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

PubMed

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data.

PubMed

Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong; Li, Mingyao; Zhang, Nancy R

2017-11-02

Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data

PubMed Central

Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong

2017-01-01

Abstract Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. PMID:29036714

The internal transcribed spacer of ribosomal RNA genes in plant trypanosomes (Phytomonas spp.) resolves 10 groups.

PubMed

Dollet, Michel; Sturm, Nancy R; Campbell, David A

2012-03-01

The distinction between plant trypanosomatids and opportunistic monoxenous insect trypanosomatids has not been demarcated clearly due to the mass placement of all trypanosomatids isolated from plants into the arbitrary genus Phytomonas spp. The advent of molecular markers has been useful in distinguishing plant trypanosomatids from the rest of the Trypanosomatidae family. Here we have examined the internal transcribed spacer (ITS) region of the ribosomal RNA (rRNA) locus for classification purposes. This region contains two distinct ITSs flanked by the small subunit and large subunit of ribosomal RNA genes and separated by the 5.8S ribosomal RNA gene. Sequences within the 5.8S ribosomal RNA gene and in the ITS sequences can serve as specific markers for several of the Phytomonas groups. Microsatellite sequences were identified in Phytomonas spp. in both ITS regions. Several classes of microsatellites were seen, with inter-isolate variation that has potential for future use. Maximum Likelihood analysis of the ITS sequences of 20 Phytomonas isolates representing the eight defined groups and a few unclassified isolates revealed a total of 10 distinct subgroups within our collection, of which two are new. The ITS region, which includes the 5.8S sequence, is a robust marker for the subdivisions within the genus Phytomonas spp. Copyright © 2011 Elsevier B.V. All rights reserved.

Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

PubMed

Sánchez-Navarro, J A; Pallás, V

1997-01-01

The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

Bacteremia due to Moraxella atlantae in a cancer patient.

PubMed

De Baere, Thierry; Muylaert, An; Everaert, Els; Wauters, Georges; Claeys, Geert; Verschraegen, Gerda; Vaneechoutte, Mario

2002-07-01

A gram-negative alkaline phosphatase- and pyrrolidone peptidase-positive rod-shaped bacterium (CCUG 45702) was isolated from two aerobic blood cultures from a female cancer patient. No identification could be reached using phenotypic techniques. Amplification of the tRNA intergenic spacers revealed fragments with lengths of 116, 133, and 270 bp, but no such pattern was present in our reference library. Sequencing of the 16S rRNA gene revealed its identity as Moraxella atlantae, a species isolated only rarely and published only once as causing infection. In retrospect, the phenotypic characteristics fit the identification as M. atlantae (formerly known as CDC group M-3). Comparative 16S rRNA sequence analysis indicates that M. atlantae, M. lincolnii, and M. osloensis might constitute three separate genera within the MORAXELLACEAE: After treatment with amoxicillin-clavulanic acid for 2 days, fever subsided and the patient was dismissed.

Bacteremia Due to Moraxella atlantae in a Cancer Patient

PubMed Central

De Baere, Thierry; Muylaert, An; Everaert, Els; Wauters, Georges; Claeys, Geert; Verschraegen, Gerda; Vaneechoutte, Mario

2002-01-01

A gram-negative alkaline phosphatase- and pyrrolidone peptidase-positive rod-shaped bacterium (CCUG 45702) was isolated from two aerobic blood cultures from a female cancer patient. No identification could be reached using phenotypic techniques. Amplification of the tRNA intergenic spacers revealed fragments with lengths of 116, 133, and 270 bp, but no such pattern was present in our reference library. Sequencing of the 16S rRNA gene revealed its identity as Moraxella atlantae, a species isolated only rarely and published only once as causing infection. In retrospect, the phenotypic characteristics fit the identification as M. atlantae (formerly known as CDC group M-3). Comparative 16S rRNA sequence analysis indicates that M. atlantae, M. lincolnii, and M. osloensis might constitute three separate genera within the Moraxellaceae. After treatment with amoxicillin-clavulanic acid for 2 days, fever subsided and the patient was dismissed. PMID:12089312

Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

PubMed

Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

2017-02-14

Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

PubMed

Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

2016-02-25

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.

PubMed Central

del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R

1989-01-01

The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

PubMed

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Bioinformatics analysis of plant orthologous introns: identification of an intronic tRNA-like sequence.

PubMed

Akkuratov, Evgeny E; Walters, Lorraine; Saha-Mandal, Arnab; Khandekar, Sushant; Crawford, Erin; Zirbel, Craig L; Leisner, Scott; Prakash, Ashwin; Fedorova, Larisa; Fedorov, Alexei

2014-09-10

Orthologous introns have identical positions relative to the coding sequence in orthologous genes of different species. By analyzing the complete genomes of five plants we generated a database of 40,512 orthologous intron groups of dicotyledonous plants, 28,519 orthologous intron groups of angiosperms, and 15,726 of land plants (moss and angiosperms). Multiple sequence alignments of each orthologous intron group were obtained using the Mafft algorithm. The number of conserved regions in plant introns appeared to be hundreds of times fewer than that in mammals or vertebrates. Approximately three quarters of conserved intronic regions among angiosperms and dicots, in particular, correspond to alternatively-spliced exonic sequences. We registered only a handful of conserved intronic ncRNAs of flowering plants. However, the most evolutionarily conserved intronic region, which is ubiquitous for all plants examined in this study, including moss, possessed multiple structural features of tRNAs, which caused us to classify it as a putative tRNA-like ncRNA. Intronic sequences encoding tRNA-like structures are not unique to plants. Bioinformatics examination of the presence of tRNA inside introns revealed an unusually long-term association of four glycine tRNAs inside the Vac14 gene of fish, amniotes, and mammals. Copyright © 2014 Elsevier B.V. All rights reserved.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

PubMed

Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

2014-02-01

The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

Genetic diversity among Babesia rossi detected in naturally infected dogs in Abeokuta, Nigeria, based on 18S rRNA gene sequences.

PubMed

Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O

2017-03-01

Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.

First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea.

PubMed

Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi

2016-07-01

In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.

Isolation and genetic characterization of Aurantimonas and Methylobacterium strains from stems of hypernodulated soybeans.

PubMed

Anda, Mizue; Ikeda, Seishi; Eda, Shima; Okubo, Takashi; Sato, Shusei; Tabata, Satoshi; Mitsui, Hisayuki; Minamisawa, Kiwamu

2011-01-01

The aims of this study were to isolate Aurantimonas and Methylobacterium strains that responded to soybean nodulation phenotypes and nitrogen fertilization rates in a previous culture-independent analysis (Ikeda et al. ISME J. 4:315-326, 2010). Two strategies were adopted for isolation from enriched bacterial cells prepared from stems of field-grown, hypernodulated soybeans: PCR-assisted isolation for Aurantimonas and selective cultivation for Methylobacterium. Thirteen of 768 isolates cultivated on Nutrient Agar medium were identified as Aurantimonas by colony PCR specific for Aurantimonas and 16S rRNA gene sequencing. Meanwhile, among 187 isolates on methanol-containing agar media, 126 were identified by 16S rRNA gene sequences as Methylobacterium. A clustering analysis (>99% identity) of the 16S rRNA gene sequences for the combined datasets of the present and previous studies revealed 4 and 8 operational taxonomic units (OTUs) for Aurantimonas and Methylobacterium, respectively, and showed the successful isolation of target bacteria for these two groups. ERIC- and BOX-PCR showed the genomic uniformity of the target isolates. In addition, phylogenetic analyses of Aurantimonas revealed a phyllosphere-specific cluster in the genus. The isolates obtained in the present study will be useful for revealing unknown legume-microbe interactions in relation to the autoregulation of nodulation.

An integrative systems genetics approach reveals potential causal genes and pathways related to obesity.

PubMed

Kogelman, Lisette J A; Zhernakova, Daria V; Westra, Harm-Jan; Cirera, Susanna; Fredholm, Merete; Franke, Lude; Kadarmideen, Haja N

2015-10-20

Obesity is a multi-factorial health problem in which genetic factors play an important role. Limited results have been obtained in single-gene studies using either genomic or transcriptomic data. RNA sequencing technology has shown its potential in gaining accurate knowledge about the transcriptome, and may reveal novel genes affecting complex diseases. Integration of genomic and transcriptomic variation (expression quantitative trait loci [eQTL] mapping) has identified causal variants that affect complex diseases. We integrated transcriptomic data from adipose tissue and genomic data from a porcine model to investigate the mechanisms involved in obesity using a systems genetics approach. Using a selective gene expression profiling approach, we selected 36 animals based on a previously created genomic Obesity Index for RNA sequencing of subcutaneous adipose tissue. Differential expression analysis was performed using the Obesity Index as a continuous variable in a linear model. eQTL mapping was then performed to integrate 60 K porcine SNP chip data with the RNA sequencing data. Results were restricted based on genome-wide significant single nucleotide polymorphisms, detected differentially expressed genes, and previously detected co-expressed gene modules. Further data integration was performed by detecting co-expression patterns among eQTLs and integration with protein data. Differential expression analysis of RNA sequencing data revealed 458 differentially expressed genes. The eQTL mapping resulted in 987 cis-eQTLs and 73 trans-eQTLs (false discovery rate < 0.05), of which the cis-eQTLs were associated with metabolic pathways. We reduced the eQTL search space by focusing on differentially expressed and co-expressed genes and disease-associated single nucleotide polymorphisms to detect obesity-related genes and pathways. Building a co-expression network using eQTLs resulted in the detection of a module strongly associated with lipid pathways. Furthermore, we detected several obesity candidate genes, for example, ENPP1, CTSL, and ABHD12B. To our knowledge, this is the first study to perform an integrated genomics and transcriptomics (eQTL) study using, and modeling, genomic and subcutaneous adipose tissue RNA sequencing data on obesity in a porcine model. We detected several pathways and potential causal genes for obesity. Further validation and investigation may reveal their exact function and association with obesity.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Molecular characterization of sulfate-reducing bacteria in the Guaymas Basin

NASA Technical Reports Server (NTRS)

Dhillon, Ashita; Teske, Andreas; Dillon, Jesse; Stahl, David A.; Sogin, Mitchell L.

2003-01-01

The Guaymas Basin (Gulf of California) is a hydrothermal vent site where thermal alteration of deposited planktonic and terrestrial organic matter forms petroliferous material which supports diverse sulfate-reducing bacteria. We explored the phylogenetic and functional diversity of the sulfate-reducing bacteria by characterizing PCR-amplified dissimilatory sulfite reductase (dsrAB) and 16S rRNA genes from the upper 4 cm of the Guaymas sediment. The dsrAB sequences revealed that there was a major clade closely related to the acetate-oxidizing delta-proteobacterial genus Desulfobacter and a clade of novel, deeply branching dsr sequences related to environmental dsr sequences from marine sediments in Aarhus Bay and Kysing Fjord (Denmark). Other dsr clones were affiliated with gram-positive thermophilic sulfate reducers (genus Desulfotomaculum) and the delta-proteobacterial species Desulforhabdus amnigena and Thermodesulforhabdus norvegica. Phylogenetic analysis of 16S rRNAs from the same environmental samples resulted in identification of four clones affiliated with Desulfobacterium niacini, a member of the acetate-oxidizing, nutritionally versatile genus Desulfobacterium, and one clone related to Desulfobacula toluolica and Desulfotignum balticum. Other bacterial 16S rRNA bacterial phylotypes were represented by non-sulfate reducers and uncultured lineages with unknown physiology, like OP9, OP8, as well as a group with no clear affiliation. In summary, analyses of both 16S rRNA and dsrAB clone libraries resulted in identification of members of the Desulfobacteriales in the Guaymas sediments. In addition, the dsrAB sequencing approach revealed a novel group of sulfate-reducing prokaryotes that could not be identified by 16S rRNA sequencing.

A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.

Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

DOE PAGES

Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.; ...

2014-12-15

Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

Sensing Self and Foreign Circular RNAs by Intron Identity.

PubMed

Chen, Y Grace; Kim, Myoungjoo V; Chen, Xingqi; Batista, Pedro J; Aoyama, Saeko; Wilusz, Jeremy E; Iwasaki, Akiko; Chang, Howard Y

2017-07-20

Circular RNAs (circRNAs) are single-stranded RNAs that are joined head to tail with largely unknown functions. Here we show that transfection of purified in vitro generated circRNA into mammalian cells led to potent induction of innate immunity genes and confers protection against viral infection. The nucleic acid sensor RIG-I is necessary to sense foreign circRNA, and RIG-I and foreign circRNA co-aggregate in cytoplasmic foci. CircRNA activation of innate immunity is independent of a 5' triphosphate, double-stranded RNA structure, or the primary sequence of the foreign circRNA. Instead, self-nonself discrimination depends on the intron that programs the circRNA. Use of a human intron to express a foreign circRNA sequence abrogates immune activation, and mature human circRNA is associated with diverse RNA binding proteins reflecting its endogenous splicing and biogenesis. These results reveal innate immune sensing of circRNA and highlight introns-the predominant output of mammalian transcription-as arbiters of self-nonself identity. Copyright © 2017 Elsevier Inc. All rights reserved.

Quantitative imaging of single mRNA splice variants in living cells

NASA Astrophysics Data System (ADS)

Lee, Kyuwan; Cui, Yi; Lee, Luke P.; Irudayaraj, Joseph

2014-06-01

Alternative messenger RNA (mRNA) splicing is a fundamental process of gene regulation, and errors in RNA splicing are known to be associated with a variety of different diseases. However, there is currently a lack of quantitative technologies for monitoring mRNA splice variants in cells. Here, we show that a combination of plasmonic dimer probes and hyperspectral imaging can be used to detect and quantify mRNA splice variants in living cells. The probes are made from gold nanoparticles functionalized with oligonucleotides and can hybridize to specific mRNA sequences, forming nanoparticle dimers that exhibit distinct spectral shifts due to plasmonic coupling. With this approach, we show that the spatial and temporal distribution of three selected splice variants of the breast cancer susceptibility gene, BRCA1, can be monitored at single-copy resolution by measuring the hybridization dynamics of the nanoplasmonic dimers. Our study provides insights into RNA and its transport in living cells, which could improve our understanding of cellular protein complexes, pharmacogenomics, genetic diagnosis and gene therapies.

The small RNA profile in latex from Hevea brasiliensis trees is affected by tapping panel dryness.

PubMed

Gébelin, Virginie; Leclercq, Julie; Kuswanhadi; Argout, Xavier; Chaidamsari, Tetty; Hu, Songnian; Tang, Chaorong; Sarah, Gautier; Yang, Meng; Montoro, Pascal

2013-10-01

Natural rubber is harvested by tapping Hevea brasiliensis (Willd. ex A. Juss.) Müll. Arg. Harvesting stress can lead to tapping panel dryness (TPD). MicroRNAs (miRNAs) are induced by abiotic stress and regulate gene expression by targeting the cleavage or translational inhibition of target messenger RNAs. This study set out to sequence miRNAs expressed in latex cells and to identify TPD-related putative targets. Deep sequencing of small RNAs was carried out on latex from trees affected by TPD using Solexa technology. The most abundant small RNA class size was 21 nucleotides for TPD trees compared with 24 nucleotides in healthy trees. By combining the LeARN pipeline, data from the Plant MicroRNA database and Hevea EST sequences, we identified 19 additional conserved and four putative species-specific miRNA families not found in previous studies on rubber. The relative transcript abundance of the Hbpre-MIR159b gene increased with TPD. This study revealed a small RNA-specific signature of TPD-affected trees. Both RNA degradation and a shift in miRNA biogenesis are suggested to explain the general decline in small RNAs and, particularly, in miRNAs.

Position-specific binding of FUS to nascent RNA regulates mRNA length

PubMed Central

Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

2015-01-01

More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis.

PubMed

Thirugnanasambantham, Krishnaraj; Saravanan, Subramanian; Karikalan, Kulandaivelu; Bharanidharan, Rajaraman; Lalitha, Perumal; Ilango, S; HairulIslam, Villianur Ibrahim

2015-10-01

Momordica charantia (bitter gourd, bitter melon) is a monoecious Cucurbitaceae with anti-oxidant, anti-microbial, anti-viral and anti-diabetic potential. Molecular studies on this economically valuable plant are very essential to understand its phylogeny and evolution. MicroRNAs (miRNAs) are conserved, small, non-coding RNA with ability to regulate gene expression by bind the 3' UTR region of target mRNA and are evolved at different rates in different plant species. In this study we have utilized homology based computational approach and identified 27 mature miRNAs for the first time from this bio-medically important plant. The phylogenetic tree developed from binary data derived from the data on presence/absence of the identified miRNAs were noticed to be uncertain and biased. Most of the identified miRNAs were highly conserved among the plant species and sequence based phylogeny analysis of miRNAs resolved the above difficulties in phylogeny approach using miRNA. Predicted gene targets of the identified miRNAs revealed their importance in regulation of plant developmental process. Reported miRNAs held sequence conservation in mature miRNAs and the detailed phylogeny analysis of pre-miRNA sequences revealed genus specific segregation of clusters. Copyright © 2015 Elsevier Ltd. All rights reserved.

Novel cis-acting element within the capsid-coding region enhances flavivirus viral-RNA replication by regulating genome cyclization.

PubMed

Liu, Zhong-Yu; Li, Xiao-Feng; Jiang, Tao; Deng, Yong-Qiang; Zhao, Hui; Wang, Hong-Jiang; Ye, Qing; Zhu, Shun-Ya; Qiu, Yang; Zhou, Xi; Qin, E-De; Qin, Cheng-Feng

2013-06-01

cis-Acting elements in the viral genome RNA (vRNA) are essential for the translation, replication, and/or encapsidation of RNA viruses. In this study, a novel conserved cis-acting element was identified in the capsid-coding region of mosquito-borne flavivirus. The downstream of 5' cyclization sequence (5'CS) pseudoknot (DCS-PK) element has a three-stem pseudoknot structure, as demonstrated by structure prediction and biochemical analysis. Using dengue virus as a model, we show that DCS-PK enhances vRNA replication and that its function depends on its secondary structure and specific primary sequence. Mutagenesis revealed that the highly conserved stem 1 and loop 2, which are involved in potential loop-helix interactions, are crucial for DCS-PK function. A predicted loop 1-stem 3 base triple interaction is important for the structural stability and function of DCS-PK. Moreover, the function of DCS-PK depends on its position relative to the 5'CS, and the presence of DCS-PK facilitates the formation of 5'-3' RNA complexes. Taken together, our results reveal that the cis-acting element DCS-PK enhances vRNA replication by regulating genome cyclization, and DCS-PK might interplay with other cis-acting elements to form a functional vRNA cyclization domain, thus playing critical roles during the flavivirus life cycle and evolution.

Novel cis-Acting Element within the Capsid-Coding Region Enhances Flavivirus Viral-RNA Replication by Regulating Genome Cyclization

PubMed Central

Liu, Zhong-Yu; Li, Xiao-Feng; Jiang, Tao; Deng, Yong-Qiang; Zhao, Hui; Wang, Hong-Jiang; Ye, Qing; Zhu, Shun-Ya; Qiu, Yang; Zhou, Xi; Qin, E-De

2013-01-01

cis-Acting elements in the viral genome RNA (vRNA) are essential for the translation, replication, and/or encapsidation of RNA viruses. In this study, a novel conserved cis-acting element was identified in the capsid-coding region of mosquito-borne flavivirus. The downstream of 5′ cyclization sequence (5′CS) pseudoknot (DCS-PK) element has a three-stem pseudoknot structure, as demonstrated by structure prediction and biochemical analysis. Using dengue virus as a model, we show that DCS-PK enhances vRNA replication and that its function depends on its secondary structure and specific primary sequence. Mutagenesis revealed that the highly conserved stem 1 and loop 2, which are involved in potential loop-helix interactions, are crucial for DCS-PK function. A predicted loop 1-stem 3 base triple interaction is important for the structural stability and function of DCS-PK. Moreover, the function of DCS-PK depends on its position relative to the 5′CS, and the presence of DCS-PK facilitates the formation of 5′-3′ RNA complexes. Taken together, our results reveal that the cis-acting element DCS-PK enhances vRNA replication by regulating genome cyclization, and DCS-PK might interplay with other cis-acting elements to form a functional vRNA cyclization domain, thus playing critical roles during the flavivirus life cycle and evolution. PMID:23576500

Improving tRNAscan-SE Annotation Results via Ensemble Classifiers.

PubMed

Zou, Quan; Guo, Jiasheng; Ju, Ying; Wu, Meihong; Zeng, Xiangxiang; Hong, Zhiling

2015-11-01

tRNAScan-SE is a tRNA detection program that is widely used for tRNA annotation; however, the false positive rate of tRNAScan-SE is unacceptable for large sequences. Here, we used a machine learning method to try to improve the tRNAScan-SE results. A new predictor, tRNA-Predict, was designed. We obtained real and pseudo-tRNA sequences as training data sets using tRNAScan-SE and constructed three different tRNA feature sets. We then set up an ensemble classifier, LibMutil, to predict tRNAs from the training data. The positive data set of 623 tRNA sequences was obtained from tRNAdb 2009 and the negative data set was the false positive tRNAs predicted by tRNAscan-SE. Our in silico experiments revealed a prediction accuracy rate of 95.1 % for tRNA-Predict using 10-fold cross-validation. tRNA-Predict was developed to distinguish functional tRNAs from pseudo-tRNAs rather than to predict tRNAs from a genome-wide scan. However, tRNA-Predict can work with the output of tRNAscan-SE, which is a genome-wide scanning method, to improve the tRNAscan-SE annotation results. The tRNA-Predict web server is accessible at http://datamining.xmu.edu.cn/∼gjs/tRNA-Predict. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

PubMed

Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

2014-06-10

Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

PubMed

Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

1996-12-24

Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks

PubMed Central

Trapnell, Cole; Roberts, Adam; Goff, Loyal; Pertea, Geo; Kim, Daehwan; Kelley, David R; Pimentel, Harold; Salzberg, Steven L; Rinn, John L; Pachter, Lior

2012-01-01

Recent advances in high-throughput cDNA sequencing (RNA-seq) can reveal new genes and splice variants and quantify expression genome-wide in a single assay. The volume and complexity of data from RNA-seq experiments necessitate scalable, fast and mathematically principled analysis software. TopHat and Cufflinks are free, open-source software tools for gene discovery and comprehensive expression analysis of high-throughput mRNA sequencing (RNA-seq) data. Together, they allow biologists to identify new genes and new splice variants of known ones, as well as compare gene and transcript expression under two or more conditions. This protocol describes in detail how to use TopHat and Cufflinks to perform such analyses. It also covers several accessory tools and utilities that aid in managing data, including CummeRbund, a tool for visualizing RNA-seq analysis results. Although the procedure assumes basic informatics skills, these tools assume little to no background with RNA-seq analysis and are meant for novices and experts alike. The protocol begins with raw sequencing reads and produces a transcriptome assembly, lists of differentially expressed and regulated genes and transcripts, and publication-quality visualizations of analysis results. The protocol's execution time depends on the volume of transcriptome sequencing data and available computing resources but takes less than 1 d of computer time for typical experiments and ~1 h of hands-on time. PMID:22383036

Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences†

PubMed Central

Speksnijder, Arjen G. C. L.; Kowalchuk, George A.; De Jong, Sander; Kline, Elizabeth; Stephen, John R.; Laanbroek, Hendrikus J.

2001-01-01

A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a mutational hot spot, and cloning of heteroduplexes and chimeras. These data may partially explain the high degree of microheterogeneity typical of sequence clusters detected in environmental clone libraries. PMID:11133483

Brain Microbial Populations in HIV/AIDS: α-Proteobacteria Predominate Independent of Host Immune Status

PubMed Central

Branton, William G.; Ellestad, Kristofor K.; Maingat, Ferdinand; Wheatley, B. Matt; Rud, Erling; Warren, René L.; Holt, Robert A.; Surette, Michael G.; Power, Christopher

2013-01-01

The brain is assumed to be a sterile organ in the absence of disease although the impact of immune disruption is uncertain in terms of brain microbial diversity or quantity. To investigate microbial diversity and quantity in the brain, the profile of infectious agents was examined in pathologically normal and abnormal brains from persons with HIV/AIDS [HIV] (n = 12), other disease controls [ODC] (n = 14) and in cerebral surgical resections for epilepsy [SURG] (n = 6). Deep sequencing of cerebral white matter-derived RNA from the HIV (n = 4) and ODC (n = 4) patients and SURG (n = 2) groups revealed bacterially-encoded 16 s RNA sequences in all brain specimens with α-proteobacteria representing over 70% of bacterial sequences while the other 30% of bacterial classes varied widely. Bacterial rRNA was detected in white matter glial cells by in situ hybridization and peptidoglycan immunoreactivity was also localized principally in glia in human brains. Analyses of amplified bacterial 16 s rRNA sequences disclosed that Proteobacteria was the principal bacterial phylum in all human brain samples with similar bacterial rRNA quantities in HIV and ODC groups despite increased host neuroimmune responses in the HIV group. Exogenous viruses including bacteriophage and human herpes viruses-4, -5 and -6 were detected variably in autopsied brains from both clinical groups. Brains from SIV- and SHIV-infected macaques displayed a profile of bacterial phyla also dominated by Proteobacteria but bacterial sequences were not detected in experimentally FIV-infected cat or RAG1−/− mouse brains. Intracerebral implantation of human brain homogenates into RAG1−/− mice revealed a preponderance of α-proteobacteria 16 s RNA sequences in the brains of recipient mice at 7 weeks post-implantation, which was abrogated by prior heat-treatment of the brain homogenate. Thus, α-proteobacteria represented the major bacterial component of the primate brain’s microbiome regardless of underlying immune status, which could be transferred into naïve hosts leading to microbial persistence in the brain. PMID:23355888

Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes.

PubMed

Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M

2006-07-01

Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.

Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

PubMed

Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

2011-04-28

The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

Molecular characterization of an ependymin precursor from goldfish brain.

PubMed

Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W

1989-01-01

Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.

Quasispecies in population of compositional assemblies.

PubMed

Gross, Renan; Fouxon, Itzhak; Lancet, Doron; Markovitch, Omer

2014-12-30

The quasispecies model refers to information carriers that undergo self-replication with errors. A quasispecies is a steady-state population of biopolymer sequence variants generated by mutations from a master sequence. A quasispecies error threshold is a minimal replication accuracy below which the population structure breaks down. Theory and experimentation of this model often refer to biopolymers, e.g. RNA molecules or viral genomes, while its prebiotic context is often associated with an RNA world scenario. Here, we study the possibility that compositional entities which code for compositional information, intrinsically different from biopolymers coding for sequential information, could show quasispecies dynamics. We employed a chemistry-based model, graded autocatalysis replication domain (GARD), which simulates the network dynamics within compositional molecular assemblies. In GARD, a compotype represents a population of similar assemblies that constitute a quasi-stationary state in compositional space. A compotype's center-of-mass is found to be analogous to a master sequence for a sequential quasispecies. Using single-cycle GARD dynamics, we measured the quasispecies transition matrix (Q) for the probabilities of transition from one center-of-mass Euclidean distance to another. Similarly, the quasispecies' growth rate vector (A) was obtained. This allowed computing a steady state distribution of distances to the center of mass, as derived from the quasispecies equation. In parallel, a steady state distribution was obtained via the GARD equation kinetics. Rewardingly, a significant correlation was observed between the distributions obtained by these two methods. This was only seen for distances to the compotype center-of-mass, and not to randomly selected compositions. A similar correspondence was found when comparing the quasispecies time dependent dynamics towards steady state. Further, changing the error rate by modifying basal assembly joining rate of GARD kinetics was found to display an error catastrophe, similar to the standard quasispecies model. Additional augmentation of compositional mutations leads to the complete disappearance of the master-like composition. Our results show that compositional assemblies, as simulated by the GARD formalism, portray significant attributes of quasispecies dynamics. This expands the applicability of the quasispecies model beyond sequence-based entities, and potentially enhances validity of GARD as a model for prebiotic evolution.

Expression of Small RNA in Aphis gossypii and Its Potential Role in the Resistance Interaction with Melon

PubMed Central

Sattar, Sampurna; Anstead, James A.; Sunkar, Ramanjulu; Thompson, Gary A.

2012-01-01

Background The regulatory role of small RNAs (sRNAs) in various biological processes is an active area of investigation; however, there has been limited information available on the role of sRNAs in plant-insect interactions. This study was designed to identify sRNAs in cotton-melon aphid (Aphis gossypii) during the Vat-mediated resistance interaction with melon (Cucumis melo). Methodology/Principal Findings The role of miRNAs was investigated in response to aphid herbivory, during both resistant and susceptible interactions. sRNA libraries made from A. gossypii tissues feeding on Vat+ and Vat− plants revealed an unexpected abundance of 27 nt long sRNA sequences in the aphids feeding on Vat+ plants. Eighty-one conserved microRNAs (miRNAs), twelve aphid-specific miRNAs, and nine novel candidate miRNAs were also identified. Plant miRNAs found in the aphid libraries were most likely ingested during phloem feeding. The presence of novel miRNAs was verified by qPCR experiments in both resistant Vat+ and susceptible Vat− interactions. The comparative analyses revealed that novel miRNAs were differentially regulated during the resistant and susceptible interactions. Gene targets predicted for the miRNAs identified in this study by in silico analyses revealed their involvement in morphogenesis and anatomical structure determination, signal transduction pathways, cell differentiation and catabolic processes. Conclusion/Significance In this study, conserved and novel miRNAs were reported in A. gossypii. Deep sequencing data showed differences in the abundance of miRNAs and piRNA-like sequences in A. gossypii. Quantitative RT-PCR revealed that A. gossypii miRNAs were differentially regulated during resistant and susceptible interactions. Aphids can also ingest plant miRNAs during phloem feeding that are stable in the insect. PMID:23173035

miRiadne: a web tool for consistent integration of miRNA nomenclature.

PubMed

Bonnal, Raoul J P; Rossi, Riccardo L; Carpi, Donatella; Ranzani, Valeria; Abrignani, Sergio; Pagani, Massimiliano

2015-07-01

The miRBase is the official miRNA repository which keeps the annotation updated on newly discovered miRNAs: it is also used as a reference for the design of miRNA profiling platforms. Nomenclature ambiguities generated by loosely updated platforms and design errors lead to incompatibilities among platforms, even from the same vendor. Published miRNA lists are thus generated with different profiling platforms that refer to diverse and not updated annotations. This greatly compromises searches, comparisons and analyses that rely on miRNA names only without taking into account the mature sequences, which is particularly critic when such analyses are carried over automatically. In this paper we introduce miRiadne, a web tool to harmonize miRNA nomenclature, which takes into account the original miRBase versions from 10 up to 21, and annotations of 40 common profiling platforms from nine brands that we manually curated. miRiadne uses the miRNA mature sequence to link miRBase versions and/or platforms to prevent nomenclature ambiguities. miRiadne was designed to simplify and support biologists and bioinformaticians in re-annotating their own miRNA lists and/or data sets. As Ariadne helped Theseus in escaping the mythological maze, miRiadne will help the miRNA researcher in escaping the nomenclature maze. miRiadne is freely accessible from the URL http://www.miriadne.org. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cryptic tRNAs in chaetognath mitochondrial genomes.

PubMed

Barthélémy, Roxane-Marie; Seligmann, Hervé

2016-06-01

The chaetognaths constitute a small and enigmatic phylum of little marine invertebrates. Both nuclear and mitochondrial genomes have numerous originalities, some phylum-specific. Until recently, their mitogenomes seemed containing only one tRNA gene (trnMet), but a recent study found in two chaetognath mitogenomes two and four tRNA genes. Moreover, apparently two conspecific mitogenomes have different tRNA gene numbers (one and two). Reanalyses by tRNAscan-SE and ARWEN softwares of the five available complete chaetognath mitogenomes suggest numerous additional tRNA genes from different types. Their total number never reaches the 22 found in most other invertebrates using that genetic code. Predicted error compensation between codon-anticodon mismatch and tRNA misacylation suggests translational activity by tRNAs predicted solely according to secondary structure for tRNAs predicted by tRNAscan-SE, not ARWEN. Numbers of predicted stop-suppressor (antitermination) tRNAs coevolve with predicted overlapping, frameshifted protein coding genes including stop codons. Sequence alignments in secondary structure prediction with non-chaetognath tRNAs suggest that the most likely functional tRNAs are in intergenic regions, as regular mt-tRNAs. Due to usually short intergenic regions, generally tRNA sequences partially overlap with flanking genes. Some tRNA pairs seem templated by sense-antisense strands. Moreover, 16S rRNA genes, but not 12S rRNAs, appear as tRNA nurseries, as previously suggested for multifunctional ribosomal-like protogenomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA-Sec and SECIS) insertion machinery in land plants.

PubMed

Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan

2014-02-25

This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.

Minimap2: pairwise alignment for nucleotide sequences.

PubMed

Li, Heng

2018-05-10

Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.

RNA editing: trypanosomes rewrite the genetic code.

PubMed

Stuart, K

1998-01-01

The understanding of how genetic information is stored and expressed has advanced considerably since the "central dogma" asserted that genetic information flows from the nucleotide sequence of DNA to that of messenger RNA (mRNA) which in turn specifies the amino acid sequence of a protein. It was found that genetic information can be stored as RNA (e.g. in RNA viruses) and can flow from RNA to DNA by reverse transcriptase enzyme activity. In addition, some genes contain introns, nucleotide sequences that are removed from their RNA (by RNA splicing) and thus are not represented in the resultant protein. Furthermore, alternative splicing was found to produce variant proteins from a single gene. More recently, the study of trypanosome parasites revealed an unexpected and indeed counter-intuitive genetic complexity. Genetic information for a single protein can be dispersed among several (DNA) genes in these organisms. One of these genes specifies an encrypted precursor mRNA that is converted to a functional mRNA by a process called RNA editing that inserts and deletes uridylate nucleotides. The sequence of the edited mRNA is specified by multiple small RNAs, named guide RNAs, (gRNAs) each of which is encoded in a separate gene. Thus, edited mRNA sequences are assembled from multiple genes by the transfer of information from one type of RNA to another. The existence of editing was surprising but has stimulated the discovery of other types of RNA editing. The Stuart laboratory has been exploring RNA editing in trypanosomes from the time of its discovery. They found dramatic differences between the mitochondrial gene sequences and those of the corresponding mRNAs, which indicated editing by the insertion and deletion of uridylates. Some editing was modest; simply eliminating shifts in sequence register of minimally extending the protein coding sequence. However, editing of many mRNAs was startingly extensive. The RNA sequence was essentially entirely remodeled with its sequence more the result of editing than the gene sequence. The identities of genes for such extensively edited RNA were not recognizable from the DNA sequence but they were readily identifiable from the edited mRNA sequence. Thus, despite the complex and extensive editing the resultant mRNA sequence is precise. Characterization of partially edited RNAs indicated that editing proceeds in the direction opposite to that used to specify the protein which reflects the use of the gRNAs. The numerous gRNAs that are used for editing are encoded in the DNA molecules whose role was previously a mystery. Using information gained in our earlier studies, the Stuart group developed an in vitro system that reproduces the fundamental process of editing in order to resolve the mechanism by which it occurs. They determined that editing entails a series of enzymatic steps rather than the mechanism used in RNA splicing. They also showed that chimeric gRNA-mRNA molecules are aberrant by-products of editing rather than intermediates in the process as had been proposed. Additional studies are exploring precisely how the number of added and deleted uridylates is specified by the gRNA. The Stuart laboratory showed that editing is performed by an aggregation of enzymes that catalyze the separate steps of editing. It also developed a method to purify this multimolecule complex that contains several, perhaps tens of, proteins. This will allow the study of its composition and the functions of its component parts. Indeed, the gene for one component has been identified and its detailed characterization begun. These studies are developing tools to explore related processes. An early finding in the lab was that the various mRNAs are differentially edited during the life cycle of the parasite. The pattern of this editing indicates that editing serves to regulate the alternation between two modes of energy generation. This regulation is coordinated with other events that are occurring during the life c

An mRNA-Derived Noncoding RNA Targets and Regulates the Ribosome

PubMed Central

Pircher, Andreas; Bakowska-Zywicka, Kamilla; Schneider, Lukas; Zywicki, Marek; Polacek, Norbert

2014-01-01

Summary The structural and functional repertoire of small non-protein-coding RNAs (ncRNAs) is central for establishing gene regulation networks in cells and organisms. Here, we show that an mRNA-derived 18-nucleotide-long ncRNA is capable of downregulating translation in Saccharomyces cerevisiae by targeting the ribosome. This 18-mer ncRNA binds to polysomes upon salt stress and is crucial for efficient growth under hyperosmotic conditions. Although the 18-mer RNA originates from the TRM10 locus, which encodes a tRNA methyltransferase, genetic analyses revealed the 18-mer RNA nucleotide sequence, rather than the mRNA-encoded enzyme, as the translation regulator. Our data reveal the ribosome as a target for a small regulatory ncRNA and demonstrate the existence of a yet unkown mechanism of translation regulation. Ribosome-targeted small ncRNAs are found in all domains of life and represent a prevalent but so far largely unexplored class of regulatory molecules. PMID:24685157

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency

PubMed Central

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua

2016-01-01

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

A novel monopartite dsRNA virus isolated from the phytopathogenic fungus Ustilaginoidea virens and ancestrally related to a mitochondria-associated dsRNA in the green alga Bryopsis.

PubMed

Zhang, Tingting; Jiang, Yinhui; Dong, Wubei

2014-08-01

In this study, we describe a novel mycovirus isolated from Ustilaginoidea virens, which was designated Ustilaginoidea virens nonsegmented virus 1 (UvNV-1). The sequence analysis revealed that UvNV-1 has two open reading frames (ORFs). ORF1 encodes an unknown protein, which is similar to the hypothetical protein BN7_5177 of Wickerhamomyces ciferrii. ORF2 encodes a putative RNA-dependent RNA polymerase (RdRp), which is most closely related to Bryopsis mitochondria-associated dsRNA (BDRM) and is likely expressed by a +1 ribosomal frameshift within the sequence CCC_UUU_CGA. The phylogenetic analysis of the RdRp of UvNV-1 showed that UvNV-1 represents a new virus taxon of mycoviruses with a partitivirus-like lineage that is classified into the family of picorna-like viruses. Based on northern hybridization, UvNV-1 was found to be common to U. virens from different geographic locations in China. The biological comparison of virus-free and infected fungal strains revealed that UvNV-1 is likely to be cryptic to its host. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

HITS-CLIP yields genome-wide insights into brain alternative RNA processing

NASA Astrophysics Data System (ADS)

Licatalosi, Donny D.; Mele, Aldo; Fak, John J.; Ule, Jernej; Kayikci, Melis; Chi, Sung Wook; Clark, Tyson A.; Schweitzer, Anthony C.; Blume, John E.; Wang, Xuning; Darnell, Jennifer C.; Darnell, Robert B.

2008-11-01

Protein-RNA interactions have critical roles in all aspects of gene expression. However, applying biochemical methods to understand such interactions in living tissues has been challenging. Here we develop a genome-wide means of mapping protein-RNA binding sites in vivo, by high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP). HITS-CLIP analysis of the neuron-specific splicing factor Nova revealed extremely reproducible RNA-binding maps in multiple mouse brains. These maps provide genome-wide in vivo biochemical footprints confirming the previous prediction that the position of Nova binding determines the outcome of alternative splicing; moreover, they are sufficiently powerful to predict Nova action de novo. HITS-CLIP revealed a large number of Nova-RNA interactions in 3' untranslated regions, leading to the discovery that Nova regulates alternative polyadenylation in the brain. HITS-CLIP, therefore, provides a robust, unbiased means to identify functional protein-RNA interactions in vivo.

A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes.

PubMed

Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

2016-07-01

The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including "codon capture," "genome streamlining," and "ambiguous intermediate" theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNA(Ala) containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. © 2016 Mühlhausen et al.; Published by Cold Spring Harbor Laboratory Press.

The identification and functional annotation of RNA structures conserved in vertebrates.

PubMed

Seemann, Stefan E; Mirza, Aashiq H; Hansen, Claus; Bang-Berthelsen, Claus H; Garde, Christian; Christensen-Dalsgaard, Mikkel; Torarinsson, Elfar; Yao, Zizhen; Workman, Christopher T; Pociot, Flemming; Nielsen, Henrik; Tommerup, Niels; Ruzzo, Walter L; Gorodkin, Jan

2017-08-01

Structured elements of RNA molecules are essential in, e.g., RNA stabilization, localization, and protein interaction, and their conservation across species suggests a common functional role. We computationally screened vertebrate genomes for conserved RNA structures (CRSs), leveraging structure-based, rather than sequence-based, alignments. After careful correction for sequence identity and GC content, we predict ∼516,000 human genomic regions containing CRSs. We find that a substantial fraction of human-mouse CRS regions (1) colocalize consistently with binding sites of the same RNA binding proteins (RBPs) or (2) are transcribed in corresponding tissues. Additionally, a CaptureSeq experiment revealed expression of many of our CRS regions in human fetal brain, including 662 novel ones. For selected human and mouse candidate pairs, qRT-PCR and in vitro RNA structure probing supported both shared expression and shared structure despite low abundance and low sequence identity. About 30,000 CRS regions are located near coding or long noncoding RNA genes or within enhancers. Structured (CRS overlapping) enhancer RNAs and extended 3' ends have significantly increased expression levels over their nonstructured counterparts. Our findings of transcribed uncharacterized regulatory regions that contain CRSs support their RNA-mediated functionality. © 2017 Seemann et al.; Published by Cold Spring Harbor Laboratory Press.

Evolution at increased error rate leads to the coexistence of multiple adaptive pathways in an RNA virus.

PubMed

Cabanillas, Laura; Arribas, María; Lázaro, Ester

2013-01-16

When beneficial mutations present in different genomes spread simultaneously in an asexual population, their fixation can be delayed due to competition among them. This interference among mutations is mainly determined by the rate of beneficial mutations, which in turn depends on the population size, the total error rate, and the degree of adaptation of the population. RNA viruses, with their large population sizes and high error rates, are good candidates to present a great extent of interference. To test this hypothesis, in the current study we have investigated whether competition among beneficial mutations was responsible for the prolonged presence of polymorphisms in the mutant spectrum of an RNA virus, the bacteriophage Qβ, evolved during a large number of generations in the presence of the mutagenic nucleoside analogue 5-azacytidine. The analysis of the mutant spectra of bacteriophage Qβ populations evolved at artificially increased error rate shows a large number of polymorphic mutations, some of them with demonstrated selective value. Polymorphisms distributed into several evolutionary lines that can compete among them, making it difficult the emergence of a defined consensus sequence. The presence of accompanying deleterious mutations, the high degree of recurrence of the polymorphic mutations, and the occurrence of epistatic interactions generate a highly complex interference dynamics. Interference among beneficial mutations in bacteriophage Qβ evolved at increased error rate permits the coexistence of multiple adaptive pathways that can provide selective advantages by different molecular mechanisms. In this way, interference can be seen as a positive factor that allows the exploration of the different local maxima that exist in rugged fitness landscapes.

A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

PubMed Central

Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

2016-01-01

The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

PubMed

Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

2016-06-15

Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

High-Throughput Sequencing and Characterization of the Small RNA Transcriptome Reveal Features of Novel and Conserved MicroRNAs in Panax ginseng

PubMed Central

Ma, Yimian; Yuan, Lichai; Lu, Shanfa

2012-01-01

microRNAs (miRNAs) play vital regulatory roles in many organisms through direct cleavage of transcripts, translational repression, or chromatin modification. Identification of miRNAs has been carried out in various plant species. However, no information is available for miRNAs from Panax ginseng, an economically significant medicinal plant species. Using the next generation high-throughput sequencing technology, we obtained 13,326,328 small RNA reads from the roots, stems, leaves and flowers of P. ginseng. Analysis of these small RNAs revealed the existence of a large, diverse and highly complicated small RNA population in P. ginseng. We identified 73 conserved miRNAs, which could be grouped into 33 families, and 28 non-conserved ones belonging to 9 families. Characterization of P. ginseng miRNA precursors revealed many features, such as production of two miRNAs from distinct regions of a precursor, clusters of two precursors in a transcript, and generation of miRNAs from both sense and antisense transcripts. It suggests the complexity of miRNA production in P. gingseng. Using a computational approach, we predicted for the conserved and non-conserved miRNA families 99 and 31 target genes, respectively, of which eight were experimentally validated. Among all predicted targets, only about 20% are conserved among various plant species, whereas the others appear to be non-conserved, indicating the diversity of miRNA functions. Consistently, many miRNAs exhibited tissue-specific expression patterns. Moreover, we identified five dehydration- and ten heat-responsive miRNAs and found the existence of a crosstalk among some of the stress-responsive miRNAs. Our results provide the first clue to the elucidation of miRNA functions in P. ginseng. PMID:22962612

Harnessing NGS and Big Data Optimally: Comparison of miRNA Prediction from Assembled versus Non-assembled Sequencing Data--The Case of the Grass Aegilops tauschii Complex Genome.

PubMed

Budak, Hikmet; Kantar, Melda

2015-07-01

MicroRNAs (miRNAs) are small, endogenous, non-coding RNA molecules that regulate gene expression at the post-transcriptional level. As high-throughput next generation sequencing (NGS) and Big Data rapidly accumulate for various species, efforts for in silico identification of miRNAs intensify. Surprisingly, the effect of the input genomics sequence on the robustness of miRNA prediction was not evaluated in detail to date. In the present study, we performed a homology-based miRNA and isomiRNA prediction of the 5D chromosome of bread wheat progenitor, Aegilops tauschii, using two distinct sequence data sets as input: (1) raw sequence reads obtained from 454-GS FLX Titanium sequencing platform and (2) an assembly constructed from these reads. We also compared this method with a number of available plant sequence datasets. We report here the identification of 62 and 22 miRNAs from raw reads and the assembly, respectively, of which 16 were predicted with high confidence from both datasets. While raw reads promoted sensitivity with the high number of miRNAs predicted, 55% (12 out of 22) of the assembly-based predictions were supported by previous observations, bringing specificity forward compared to the read-based predictions, of which only 37% were supported. Importantly, raw reads could identify several repeat-related miRNAs that could not be detected with the assembly. However, raw reads could not capture 6 miRNAs, for which the stem-loops could only be covered by the relatively longer sequences from the assembly. In summary, the comparison of miRNA datasets obtained by these two strategies revealed that utilization of raw reads, as well as assemblies for in silico prediction, have distinct advantages and disadvantages. Consideration of these important nuances can benefit future miRNA identification efforts in the current age of NGS and Big Data driven life sciences innovation.

Functional RNA structures throughout the Hepatitis C Virus genome.

PubMed

Adams, Rebecca L; Pirakitikulr, Nathan; Pyle, Anna Marie

2017-06-01

The single-stranded Hepatitis C Virus (HCV) genome adopts a set of elaborate RNA structures that are involved in every stage of the viral lifecycle. Recent advances in chemical probing, sequencing, and structural biology have facilitated analysis of RNA folding on a genome-wide scale, revealing novel structures and networks of interactions. These studies have underscored the active role played by RNA in every function of HCV and they open the door to new types of RNA-targeted therapeutics. Copyright © 2017 Elsevier B.V. All rights reserved.

Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruit development and ripening in kiwifruit (Actinidia chinensis)

USDA-ARS?s Scientific Manuscript database

Genomic and transcriptomic data on kiwifruit (Actinidia chinensis) in public databases are very limited despite its nutritional and economic value. Previously, we have constructed and sequenced nine fruit RNA-Seq libraries of A. chinensis cv. 'Hongyang' at immature, mature, and postharvest ripening...

A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors

PubMed Central

Qin, Xin-Cheng; Shi, Mang; Tian, Jun-Hua; Lin, Xian-Dan; Gao, Dong-Ya; He, Jin-Rong; Wang, Jian-Bo; Li, Ci-Xiu; Kang, Yan-Jun; Yu, Bin; Zhou, Dun-Jin; Xu, Jianguo; Plyusnin, Alexander; Holmes, Edward C.; Zhang, Yong-Zhen

2014-01-01

Although segmented and unsegmented RNA viruses are commonplace, the evolutionary links between these two very different forms of genome organization are unclear. We report the discovery and characterization of a tick-borne virus—Jingmen tick virus (JMTV)—that reveals an unexpected connection between segmented and unsegmented RNA viruses. The JMTV genome comprises four segments, two of which are related to the nonstructural protein genes of the genus Flavivirus (family Flaviviridae), whereas the remaining segments are unique to this virus, have no known homologs, and contain a number of features indicative of structural protein genes. Remarkably, homology searching revealed that sequences related to JMTV were present in the cDNA library from Toxocara canis (dog roundworm; Nematoda), and that shared strong sequence and structural resemblances. Epidemiological studies showed that JMTV is distributed in tick populations across China, especially Rhipicephalus and Haemaphysalis spp., and experiences frequent host-switching and genomic reassortment. To our knowledge, JMTV is the first example of a segmented RNA virus with a genome derived in part from unsegmented viral ancestors. PMID:24753611

Variant discovery in the sheepmeat odour and flavour in javanese fat tailed sheep using RNA sequencing

NASA Astrophysics Data System (ADS)

Abuzahra, M. A. M.; Jakaria; Listyarini, K.; Furqon, A.; Sumantri, C.; Uddin, M. J.; Gunawan, A.

2018-05-01

High-throughput RNA sequencing (RNA-Seq) reveals new challenges for the detection of transcriptome variants (SNPs) in different tissues and species. The aims of this study was to characterize a SNP discovery analysis in the sheep meat odour and flavour transcriptome using RNA-Seq. Six liver samples from divergent sheep meat odour and flavour were analyzed using the Illumina Genome Hiseq 2500 Analyzer. The SNP detection analysis revealed 142 SNPs in sheep meat samples, and a large number of those corresponded to differences between high and low sheep meat odour and flavour ovis genome assembly OAR v4.0. Among them, about 90.4% of genes had multiple polymorphisms within 12 genes (JAML, ANGPTL8, LOC101103463, SEPW1, SCN5A, LOC101113036, DOCK6, GTSE1, KIF12, KCTD17, KANK2, CYP2A6). Several of the SNPs (JAML, CYP2A6, SEPW1, and KIF12) found in this study could be included as suitable markers in genotyping platforms to perform association analyses in commercial populations and apply genomic selection protocols in the sheep meat production.

Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao.

PubMed

Fister, Andrew S; Landherr, Lena; Maximova, Siela N; Guiltinan, Mark J

2018-01-01

Theobroma cacao , the source of cocoa, suffers significant losses to a variety of pathogens resulting in reduced incomes for millions of farmers in developing countries. Development of disease resistant cacao varieties is an essential strategy to combat this threat, but is limited by sources of genetic resistance and the slow generation time of this tropical tree crop. In this study, we present the first application of genome editing technology in cacao, using Agrobacterium-mediated transient transformation to introduce CRISPR/Cas9 components into cacao leaves and cotyledon cells. As a first proof of concept, we targeted the cacao Non-Expressor of Pathogenesis-Related 3 (TcNPR3) gene, a suppressor of the defense response. After demonstrating activity of designed single-guide RNAs (sgRNA) in vitro , we used Agrobacterium to introduce a CRISPR/Cas9 system into leaf tissue, and identified the presence of deletions in 27% of TcNPR3 copies in the treated tissues. The edited tissue exhibited an increased resistance to infection with the cacao pathogen Phytophthora tropicalis and elevated expression of downstream defense genes. Analysis of off-target mutagenesis in sequences similar to sgRNA target sites using high-throughput sequencing did not reveal mutations above background sequencing error rates. These results confirm the function of NPR3 as a repressor of the cacao immune system and demonstrate the application of CRISPR/Cas9 as a powerful functional genomics tool for cacao. Several stably transformed and genome edited somatic embryos were obtained via Agrobacterium -mediated transformation, and ongoing work will test the effectiveness of this approach at a whole plant level.

Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao

PubMed Central

Fister, Andrew S.; Landherr, Lena; Maximova, Siela N.; Guiltinan, Mark J.

2018-01-01

Theobroma cacao, the source of cocoa, suffers significant losses to a variety of pathogens resulting in reduced incomes for millions of farmers in developing countries. Development of disease resistant cacao varieties is an essential strategy to combat this threat, but is limited by sources of genetic resistance and the slow generation time of this tropical tree crop. In this study, we present the first application of genome editing technology in cacao, using Agrobacterium-mediated transient transformation to introduce CRISPR/Cas9 components into cacao leaves and cotyledon cells. As a first proof of concept, we targeted the cacao Non-Expressor of Pathogenesis-Related 3 (TcNPR3) gene, a suppressor of the defense response. After demonstrating activity of designed single-guide RNAs (sgRNA) in vitro, we used Agrobacterium to introduce a CRISPR/Cas9 system into leaf tissue, and identified the presence of deletions in 27% of TcNPR3 copies in the treated tissues. The edited tissue exhibited an increased resistance to infection with the cacao pathogen Phytophthora tropicalis and elevated expression of downstream defense genes. Analysis of off-target mutagenesis in sequences similar to sgRNA target sites using high-throughput sequencing did not reveal mutations above background sequencing error rates. These results confirm the function of NPR3 as a repressor of the cacao immune system and demonstrate the application of CRISPR/Cas9 as a powerful functional genomics tool for cacao. Several stably transformed and genome edited somatic embryos were obtained via Agrobacterium-mediated transformation, and ongoing work will test the effectiveness of this approach at a whole plant level. PMID:29552023

Genetic diversity among pandemic 2009 influenza viruses isolated from a transmission chain

PubMed Central

2013-01-01

Background Influenza viruses such as swine-origin influenza A(H1N1) virus (A(H1N1)pdm09) generate genetic diversity due to the high error rate of their RNA polymerase, often resulting in mixed genotype populations (intra-host variants) within a single infection. This variation helps influenza to rapidly respond to selection pressures, such as those imposed by the immunological host response and antiviral therapy. We have applied deep sequencing to characterize influenza intra-host variation in a transmission chain consisting of three cases due to oseltamivir-sensitive viruses, and one derived oseltamivir-resistant case. Methods Following detection of the A(H1N1)pdm09 infections, we deep-sequenced the complete NA gene from two of the oseltamivir-sensitive virus-infected cases, and all eight gene segments of the viruses causing the remaining two cases. Results No evidence for the resistance-causing mutation (resulting in NA H275Y substitution) was observed in the oseltamivir-sensitive cases. Furthermore, deep sequencing revealed a subpopulation of oseltamivir-sensitive viruses in the case carrying resistant viruses. We detected higher levels of intra-host variation in the case carrying oseltamivir-resistant viruses than in those infected with oseltamivir-sensitive viruses. Conclusions Oseltamivir-resistance was only detected after prophylaxis with oseltamivir, suggesting that the mutation was selected for as a result of antiviral intervention. The persisting oseltamivir-sensitive virus population in the case carrying resistant viruses suggests either that a small proportion survive the treatment, or that the oseltamivir-sensitive virus rapidly re-establishes itself in the virus population after the bottleneck. Moreover, the increased intra-host variation in the oseltamivir-resistant case is consistent with the hypothesis that the population diversity of a RNA virus can increase rapidly following a population bottleneck. PMID:23587185

Structural and Functional Basis of the Fidelity of Nucleotide Selection by Flavivirus RNA-Dependent RNA Polymerases

PubMed Central

Canard, Bruno

2018-01-01

Viral RNA-dependent RNA polymerases (RdRps) play a central role not only in viral replication, but also in the genetic evolution of viral RNAs. After binding to an RNA template and selecting 5′-triphosphate ribonucleosides, viral RdRps synthesize an RNA copy according to Watson-Crick base-pairing rules. The copy process sometimes deviates from both the base-pairing rules specified by the template and the natural ribose selectivity and, thus, the process is error-prone due to the intrinsic (in)fidelity of viral RdRps. These enzymes share a number of conserved amino-acid sequence strings, called motifs A–G, which can be defined from a structural and functional point-of-view. A co-relation is gradually emerging between mutations in these motifs and viral genome evolution or observed mutation rates. Here, we review our current knowledge on these motifs and their role on the structural and mechanistic basis of the fidelity of nucleotide selection and RNA synthesis by Flavivirus RdRps. PMID:29385764

Polyester: simulating RNA-seq datasets with differential transcript expression.

PubMed

Frazee, Alyssa C; Jaffe, Andrew E; Langmead, Ben; Leek, Jeffrey T

2015-09-01

Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Polyester is freely available from Bioconductor (http://bioconductor.org/). jtleek@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

History and current status of wheat miRNAs using next-generation sequencing and their roles in development and stress.

PubMed

Budak, Hikmet; Khan, Zaeema; Kantar, Melda

2015-05-01

As small molecules that aid in posttranscriptional silencing, microRNA (miRNA) discovery and characterization have vastly benefited from the recent development and widespread application of next-generation sequencing (NGS) technologies. Several miRNAs were identified through sequencing of constructed small RNA libraries, whereas others were predicted by in silico methods using the recently accumulating sequence data. NGS was a major breakthrough in efforts to sequence and dissect the genomes of plants, including bread wheat and its progenitors, which have large, repetitive and complex genomes. Availability of survey sequences of wheat whole genome and its individual chromosomes enabled researchers to predict and assess wheat miRNAs both in the subgenomic and whole genome levels. Moreover, small RNA construction and sequencing-based studies identified several putative development- and stress-related wheat miRNAs, revealing their differential expression patterns in specific developmental stages and/or in response to stress conditions. With the vast amount of wheat miRNAs identified in recent years, we are approaching to an overall knowledge on the wheat miRNA repertoire. In the following years, more comprehensive research in relation to miRNA conservation or divergence across wheat and its close relatives or progenitors should be performed. Results may serve valuable in understanding both the significant roles of species-specific miRNAs and also provide us information in relation to the dynamics between miRNAs and evolution in wheat. Furthermore, putative development- or stress-related miRNAs identified should be subjected to further functional analysis, which may be valuable in efforts to develop wheat with better resistance and/or yield. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Fragmentation of tRNA in Phytophthora infestans asexual life cycle stages and during host plant infection.

PubMed

Åsman, Anna K M; Vetukuri, Ramesh R; Jahan, Sultana N; Fogelqvist, Johan; Corcoran, Pádraic; Avrova, Anna O; Whisson, Stephen C; Dixelius, Christina

2014-12-10

The oomycete Phytophthora infestans possesses active RNA silencing pathways, which presumably enable this plant pathogen to control the large numbers of transposable elements present in its 240 Mb genome. Small RNAs (sRNAs), central molecules in RNA silencing, are known to also play key roles in this organism, notably in regulation of critical effector genes needed for infection of its potato host. To identify additional classes of sRNAs in oomycetes, we mapped deep sequencing reads to transfer RNAs (tRNAs) thereby revealing the presence of 19-40 nt tRNA-derived RNA fragments (tRFs). Northern blot analysis identified abundant tRFs corresponding to half tRNA molecules. Some tRFs accumulated differentially during infection, as seen by examining sRNAs sequenced from P. infestans-potato interaction libraries. The putative connection between tRF biogenesis and the canonical RNA silencing pathways was investigated by employing hairpin RNA-mediated RNAi to silence the genes encoding P. infestans Argonaute (PiAgo) and Dicer (PiDcl) endoribonucleases. By sRNA sequencing we show that tRF accumulation is PiDcl1-independent, while Northern hybridizations detected reduced levels of specific tRNA-derived species in the PiAgo1 knockdown line. Our findings extend the sRNA diversity in oomycetes to include fragments derived from non-protein-coding RNA transcripts and identify tRFs with elevated levels during infection of potato by P. infestans.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Identification of a novel plant amalgavirus (Amalgavirus, Amalgaviridae) genome sequence in Cistus incanus.

PubMed

Goh, C J; Park, D; Lee, J S; Sebastiani, F; Hahn, Y

2018-01-01

Amalgaviridae is a family of double-stranded, monosegmented RNA viruses that are associated with plants, fungi, microsporidians, and animals. A sequence contig derived from the transcriptome of a eudicot, Cistus incanus (the family Cistaceae; commonly known as hoary rockrose), was identified as the genome sequence of a novel plant RNA virus and named Cistus incanus RNA virus 1 (CiRV1). Sequence comparison and phylogenetic analysis indicated that CiRV1 is a novel species of the genus Amalgavirus in the family Amalgaviridae. The CiRV1 genome contig has two overlapping open reading frames (ORFs). ORF1 encodes a putative replication factory matrix-like protein, while ORF2 encodes a RNA-dependent RNA polymerase (RdRp) domain. An ORF1+2 fusion protein, which functions in viral RNA replication, is produced by a +1 programmed ribosomal frameshifting (PRF) mechanism. A +1 PRF motif UUU_CGU, which matches the conserved amalgavirus +1 PRF consensus sequence UUU_CGN, was found at the boundary of CiRV1 ORF1 and ORF2. Comparison of 25 amalgavirus ORF1+2 fusion proteins revealed that only three different positions within a 13-amino acid segment were recurrently used at the boundary, possibly being selected so as not to interfere with correct folding and function of the fusion protein. CiRV1 is the first virus found to be associated with the Cistus species and may be useful for studying amalgaviruses.

Site-directed mutagenesis reveals transition-state stabilization as a general catalytic mechanism for aminoacyl-tRNA synthetases.

PubMed

Borgford, T J; Gray, T E; Brand, N J; Fersht, A R

1987-11-17

Some aminoacyl-tRNA synthetases of almost negligible homology do have a small region of similarity around four-residue sequence His-Ile(or Leu or Met)-Gly-His(or Asn), the HIGH sequence. The first histidine in this sequence in the tyrosyl-tRNA synthetase, His-45, has been shown to form part of a binding site for the gamma-phosphate of ATP in the transition state for the reaction as does Thr-40. Residue His-56 in the valyl-tRNA synthetase begins a HIGH sequence, and there is a threonine at position 52, one position closer to the histidine than in the tyrosyl-tRNA synthetase. The mutants Thr----Ala-52 and His----Asn-56 have been made and their complete free energy profiles for the formation of valyl adenylate determined. Difference energy diagrams have been constructed by comparison with the reaction of wild-type enzyme. The difference energy profiles are very similar to those for the mutants Thr----Ala-40 and His----Asn-45 of the tyrosyl-tRNA synthetase. Thr-52 and His-56 of the valyl-tRNA synthetase contribute little binding energy to valine, ATP, and Val-AMP. Instead, the wild-type enzyme binds the transition state and pyrophosphate some 6 kcal/mol more tightly than do the mutants. Preferential transition-state stabilization is thus an important component of catalysis by the valyl-tRNA synthetase. Further, by analogy to the tyrosyl-tRNA synthetase, the valyl-tRNA synthetase has a binding site for the gamma-phosphate of ATP in the transition state, and this is likely to be a general feature of aminoacyl-tRNA synthetases that have a HIGH region.

Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench

PubMed Central

Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

2017-01-01

Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information. A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. PMID:28289155

RNA editing in nascent RNA affects pre-mRNA splicing

PubMed Central

Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni

2018-01-01

In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3′ acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. PMID:29724793

RNA editing in nascent RNA affects pre-mRNA splicing.

PubMed

Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni; Xiao, Xinshu

2018-06-01

In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3' acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. © 2018 Hsiao et al.; Published by Cold Spring Harbor Laboratory Press.

Sequence and expression analyses of porcine ISG15 and ISG43 genes.

PubMed

Huang, Jiangnan; Zhao, Shuhong; Zhu, Mengjin; Wu, Zhenfang; Yu, Mei

2009-08-01

The coding sequences of porcine interferon-stimulated gene 15 (ISG15) and the interferon-stimulated gene (ISG43) were cloned from swine spleen mRNA. The amino acid sequences deduced from porcine ISG15 and ISG43 genes coding sequence shared 24-75% and 29-83% similarity with ISG15s and ISG43s from other vertebrates, respectively. Structural analyses revealed that porcine ISG15 comprises two ubiquitin homologues motifs (UBQ) domain and a conserved C-terminal LRLRGG conjugating motif. Porcine ISG43 contains an ubiquitin-processing proteases-like domain. Phylogenetic analyses showed that porcine ISG15 and ISG43 were mostly related to rat ISG15 and cattle ISG43, respectively. Using quantitative real-time PCR assay, significant increased expression levels of porcine ISG15 and ISG43 genes were detected in porcine kidney endothelial cells (PK15) cells treated with poly I:C. We also observed the enhanced mRNA expression of three members of dsRNA pattern-recognition receptors (PRR), TLR3, DDX58 and IFIH1, which have been reported to act as critical receptors in inducing the mRNA expression of ISG15 and ISG43 genes. However, we did not detect any induced mRNA expression of IFNalpha and IFNbeta, suggesting that transcriptional activations of ISG15 and ISG43 were mediated through IFN-independent signaling pathway in the poly I:C treated PK15 cells. Association analyses in a Landrace pig population revealed that ISG15 c.347T>C (BstUI) polymorphism and the ISG43 c.953T>G (BccI) polymorphism were significantly associated with hematological parameters and immune-related traits.

Phylogenetically Structured Differences in rRNA Gene Sequence Variation among Species of Arbuscular Mycorrhizal Fungi and Their Implications for Sequence Clustering

PubMed Central

Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.

2016-01-01

ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found that the amount of sequence variation in an rRNA gene that is commonly used to identify AM fungal species varied significantly between evolutionary groups that correspond to different genera, with the exception of two genera that are genetically indistinguishable from each other. When we clustered groups of similar sequences into operational taxonomic units (OTUs) using five different clustering methods, these patterns of sequence variation caused the number of OTUs to either over- or underestimate the actual number of AM fungal species, depending on the genus. Our results indicate that OTU-based inferences about AM fungal species composition from environmental sequences can be improved if they take these taxonomically structured patterns of sequence variation into account. PMID:27260357

Viral metagenomics of aphids present in bean and maize plots on mixed-use farms in Kenya reveals the presence of three dicistroviruses including a novel Big Sioux River virus-like dicistrovirus.

PubMed

Wamonje, Francis O; Michuki, George N; Braidwood, Luke A; Njuguna, Joyce N; Musembi Mutuku, J; Djikeng, Appolinaire; Harvey, Jagger J W; Carr, John P

2017-10-02

Aphids are major vectors of plant viruses. Common bean (Phaseolus vulgaris L.) and maize (Zea mays L.) are important crops that are vulnerable to aphid herbivory and aphid-transmitted viruses. In East and Central Africa, common bean is frequently intercropped by smallholder farmers to provide fixed nitrogen for cultivation of starch crops such as maize. We used a PCR-based technique to identify aphids prevalent in smallholder bean farms and next generation sequencing shotgun metagenomics to examine the diversity of viruses present in aphids and in maize leaf samples. Samples were collected from farms in Kenya in a range of agro-ecological zones. Cytochrome oxidase 1 (CO1) gene sequencing showed that Aphis fabae was the sole aphid species present in bean plots in the farms visited. Sequencing of total RNA from aphids using the Illumina platform detected three dicistroviruses. Maize leaf RNA was also analysed. Identification of Aphid lethal paralysis virus (ALPV), Rhopalosiphum padi virus (RhPV), and a novel Big Sioux River virus (BSRV)-like dicistrovirus in aphid and maize samples was confirmed using reverse transcription-polymerase chain reactions and sequencing of amplified DNA products. Phylogenetic, nucleotide and protein sequence analyses of eight ALPV genomes revealed evidence of intra-species recombination, with the data suggesting there may be two ALPV lineages. Analysis of BSRV-like virus genomic RNA sequences revealed features that are consistent with other dicistroviruses and that it is phylogenetically closely related to dicistroviruses of the genus Cripavirus. The discovery of ALPV and RhPV in aphids and maize further demonstrates the broad occurrence of these dicistroviruses. Dicistroviruses are remarkable in that they use plants as reservoirs that facilitate infection of their insect replicative hosts, such as aphids. This is the first report of these viruses being isolated from either organism. The BSRV-like sequences represent a potentially novel dicistrovirus infecting A. fabae.

Detection of 224 candidate structured RNAs by comparative analysis of specific subsets of intergenic regions

PubMed Central

Lünse, Christina E.; Corbino, Keith A.; Ames, Tyler D.; Nelson, James W.; Roth, Adam; Perkins, Kevin R.; Sherlock, Madeline E.

2017-01-01

Abstract The discovery of structured non-coding RNAs (ncRNAs) in bacteria can reveal new facets of biology and biochemistry. Comparative genomics analyses executed by powerful computer algorithms have successfully been used to uncover many novel bacterial ncRNA classes in recent years. However, this general search strategy favors the discovery of more common ncRNA classes, whereas progressively rarer classes are correspondingly more difficult to identify. In the current study, we confront this problem by devising several methods to select subsets of intergenic regions that can concentrate these rare RNA classes, thereby increasing the probability that comparative sequence analysis approaches will reveal their existence. By implementing these methods, we discovered 224 novel ncRNA classes, which include ROOL RNA, an RNA class averaging 581 nt and present in multiple phyla, several highly conserved and widespread ncRNA classes with properties that suggest sophisticated biochemical functions and a multitude of putative cis-regulatory RNA classes involved in a variety of biological processes. We expect that further research on these newly found RNA classes will reveal additional aspects of novel biology, and allow for greater insights into the biochemistry performed by ncRNAs. PMID:28977401

Rice MEL2, the RNA recognition motif (RRM) protein, binds in vitro to meiosis-expressed genes containing U-rich RNA consensus sequences in the 3'-UTR.

PubMed

Miyazaki, Saori; Sato, Yutaka; Asano, Tomoya; Nagamura, Yoshiaki; Nonomura, Ken-Ichi

2015-10-01

Post-transcriptional gene regulation by RNA recognition motif (RRM) proteins through binding to cis-elements in the 3'-untranslated region (3'-UTR) is widely used in eukaryotes to complete various biological processes. Rice MEIOSIS ARRESTED AT LEPTOTENE2 (MEL2) is the RRM protein that functions in the transition to meiosis in proper timing. The MEL2 RRM preferentially associated with the U-rich RNA consensus, UUAGUU[U/A][U/G][A/U/G]U, dependently on sequences and proportionally to MEL2 protein amounts in vitro. The consensus sequences were located in the putative looped structures of the RNA ligand. A genome-wide survey revealed a tendency of MEL2-binding consensus appearing in 3'-UTR of rice genes. Of 249 genes that conserved the consensus in their 3'-UTR, 13 genes spatiotemporally co-expressed with MEL2 in meiotic flowers, and included several genes whose function was supposed in meiosis; such as Replication protein A and OsMADS3. The proteome analysis revealed that the amounts of small ubiquitin-related modifier-like protein and eukaryotic translation initiation factor3-like protein were dramatically altered in mel2 mutant anthers. Taken together with transcriptome and gene ontology results, we propose that the rice MEL2 is involved in the translational regulation of key meiotic genes on 3'-UTRs to achieve the faithful transition of germ cells to meiosis.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Ruiying; Zheng, Han; Preamplume, Gan

The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of amore » noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.« less

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

Diversity of partial RNA-dependent RNA polymerase gene sequences of soybean blotchy mosaic virus isolates from different host-, geographical- and temporal origins.

PubMed

Strydom, Elrea; Pietersen, Gerhard

2018-05-01

Infection of soybean by the plant cytorhabdovirus soybean blotchy mosaic virus (SbBMV) results in significant yield losses in the temperate, lower-lying soybean production regions of South Africa. A 277 bp portion of the RNA-dependent RNA polymerase gene of 66 SbBMV isolates from different: hosts, geographical locations in South Africa, and times of collection (spanning 16 years) were amplified by RT-PCR and sequenced to investigate the genetic diversity of isolates. Phylogenetic reconstruction revealed three main lineages, designated Groups A, B and C, with isolates grouping primarily according to geographic origin. Pairwise nucleotide identities ranged between 85.7% and 100% among all isolates, with isolates in Group A exhibiting the highest degree of sequence identity, and isolates of Groups A and B being more closely related to each other than to those in Group C. This is the first study investigating the genetic diversity of SbBMV.

A bacterial Argonaute with noncanonical guide RNA specificity

PubMed Central

Kaya, Emine; Doxzen, Kevin W.; Knoll, Kilian R.; Wilson, Ross C.; Strutt, Steven C.; Kranzusch, Philip J.; Doudna, Jennifer A.

2016-01-01

Eukaryotic Argonaute proteins induce gene silencing by small RNA-guided recognition and cleavage of mRNA targets. Although structural similarities between human and prokaryotic Argonautes are consistent with shared mechanistic properties, sequence and structure-based alignments suggested that Argonautes encoded within CRISPR-cas [clustered regularly interspaced short palindromic repeats (CRISPR)-associated] bacterial immunity operons have divergent activities. We show here that the CRISPR-associated Marinitoga piezophila Argonaute (MpAgo) protein cleaves single-stranded target sequences using 5′-hydroxylated guide RNAs rather than the 5′-phosphorylated guides used by all known Argonautes. The 2.0-Å resolution crystal structure of an MpAgo–RNA complex reveals a guide strand binding site comprising residues that block 5′ phosphate interactions. Using structure-based sequence alignment, we were able to identify other putative MpAgo-like proteins, all of which are encoded within CRISPR-cas loci. Taken together, our data suggest the evolution of an Argonaute subclass with noncanonical specificity for a 5′-hydroxylated guide. PMID:27035975

Isosteric And Non-Isosteric Base Pairs In RNA Motifs: Molecular Dynamics And Bioinformatics Study Of The Sarcin-Ricin Internal Loop

PubMed Central

Havrila, Marek; Réblová, Kamila; Zirbel, Craig L.; Leontis, Neocles B.; Šponer, Jiří

2013-01-01

The Sarcin-Ricin RNA motif (SR motif) is one of the most prominent recurrent RNA building blocks that occurs in many different RNA contexts and folds autonomously, i.e., in a context-independent manner. In this study, we combined bioinformatics analysis with explicit-solvent molecular dynamics (MD) simulations to better understand the relation between the RNA sequence and the evolutionary patterns of SR motif. SHAPE probing experiment was also performed to confirm fidelity of MD simulations. We identified 57 instances of the SR motif in a non-redundant subset of the RNA X-ray structure database and analyzed their basepairing, base-phosphate, and backbone-backbone interactions. We extracted sequences aligned to these instances from large ribosomal RNA alignments to determine frequency of occurrence for different sequence variants. We then used a simple scoring scheme based on isostericity to suggest 10 sequence variants with highly variable expected degree of compatibility with the SR motif 3D structure. We carried out MD simulations of SR motifs with these base substitutions. Non isosteric base substitutions led to unstable structures, but so did isosteric substitutions which were unable to make key base-phosphate interactions. MD technique explains why some potentially isosteric SR motifs are not realized during evolution. We also found that inability to form stable cWW geometry is an important factor in case of the first base pair of the flexible region of the SR motif. Comparison of structural, bioinformatics, SHAPE probing and MD simulation data reveals that explicit solvent MD simulations neatly reflect viability of different sequence variants of the SR motif. Thus, MD simulations can efficiently complement bioinformatics tools in studies of conservation patterns of RNA motifs and provide atomistic insight into the role of their different signature interactions. PMID:24144333

HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

PubMed

Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

2015-01-01

MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

CoLIde: a bioinformatics tool for CO-expression-based small RNA Loci Identification using high-throughput sequencing data.

PubMed

Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent

2013-07-01

Small RNAs (sRNAs) are 20-25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the genomic location of the constituent sRNAs, hindering existing approaches to identify sRNA loci. To infer the location of significant biological units, we propose an approach for sRNA loci detection called CoLIde (Co-expression based sRNA Loci Identification) that combines genomic location with the analysis of other information such as variation in expression levels (expression pattern) and size class distribution. For CoLIde, we define a locus as a union of regions sharing the same pattern and located in close proximity on the genome. Biological relevance, detected through the analysis of size class distribution, is also calculated for each locus. CoLIde can be applied on ordered (e.g., time-dependent) or un-ordered (e.g., organ, mutant) series of samples both with or without biological/technical replicates. The method reliably identifies known types of loci and shows improved performance on sequencing data from both plants (e.g., A. thaliana, S. lycopersicum) and animals (e.g., D. melanogaster) when compared with existing locus detection techniques. CoLIde is available for use within the UEA Small RNA Workbench which can be downloaded from: http://srna-workbench.cmp.uea.ac.uk.

Confirmation of translatability and functionality certifies the dual endothelin1/VEGFsp receptor (DEspR) protein.

PubMed

Herrera, Victoria L M; Steffen, Martin; Moran, Ann Marie; Tan, Glaiza A; Pasion, Khristine A; Rivera, Keith; Pappin, Darryl J; Ruiz-Opazo, Nelson

2016-06-14

In contrast to rat and mouse databases, the NCBI gene database lists the human dual-endothelin1/VEGFsp receptor (DEspR, formerly Dear) as a unitary transcribed pseudogene due to a stop [TGA]-codon at codon#14 in automated DNA and RNA sequences. However, re-analysis is needed given prior single gene studies detected a tryptophan [TGG]-codon#14 by manual Sanger sequencing, demonstrated DEspR translatability and functionality, and since the demonstration of actual non-translatability through expression studies, the standard-of-excellence for pseudogene designation, has not been performed. Re-analysis must meet UNIPROT criteria for demonstration of a protein's existence at the highest (protein) level, which a priori, would override DNA- or RNA-based deductions. To dissect the nucleotide sequence discrepancy, we performed Maxam-Gilbert sequencing and reviewed 727 RNA-seq entries. To comply with the highest level multiple UNIPROT criteria for determining DEspR's existence, we performed various experiments using multiple anti-DEspR monoclonal antibodies (mAbs) targeting distinct DEspR epitopes with one spanning the contested tryptophan [TGG]-codon#14, assessing: (a) DEspR protein expression, (b) predicted full-length protein size, (c) sequence-predicted protein-specific properties beyond codon#14: receptor glycosylation and internalization, (d) protein-partner interactions, and (e) DEspR functionality via DEspR-inhibition effects. Maxam-Gilbert sequencing and some RNA-seq entries demonstrate two guanines, hence a tryptophan [TGG]-codon#14 within a compression site spanning an error-prone compression sequence motif. Western blot analysis using anti-DEspR mAbs targeting distinct DEspR epitopes detect the identical glycosylated 17.5 kDa pull-down protein. Decrease in DEspR-protein size after PNGase-F digest demonstrates post-translational glycosylation, concordant with the consensus-glycosylation site beyond codon#14. Like other small single-transmembrane proteins, mass spectrometry analysis of anti-DEspR mAb pull-down proteins do not detect DEspR, but detect DEspR-protein interactions with proteins implicated in intracellular trafficking and cancer. FACS analyses also detect DEspR-protein in different human cancer stem-like cells (CSCs). DEspR-inhibition studies identify DEspR-roles in CSC survival and growth. Live cell imaging detects fluorescently-labeled anti-DEspR mAb targeted-receptor internalization, concordant with the single internalization-recognition sequence also located beyond codon#14. Data confirm translatability of DEspR, the full-length DEspR protein beyond codon#14, and elucidate DEspR-specific functionality. Along with detection of the tryptophan [TGG]-codon#14 within an error-prone compression site, cumulative data demonstrating DEspR protein existence fulfill multiple UNIPROT criteria, thus refuting its pseudogene designation.

Short intronic repeat sequences facilitate circular RNA production

PubMed Central

Liang, Dongming

2014-01-01

Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery “backsplices” and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3′ end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. PMID:25281217

Know Your Enemy: Successful Bioinformatic Approaches to Predict Functional RNA Structures in Viral RNAs.

PubMed

Lim, Chun Shen; Brown, Chris M

2017-01-01

Structured RNA elements may control virus replication, transcription and translation, and their distinct features are being exploited by novel antiviral strategies. Viral RNA elements continue to be discovered using combinations of experimental and computational analyses. However, the wealth of sequence data, notably from deep viral RNA sequencing, viromes, and metagenomes, necessitates computational approaches being used as an essential discovery tool. In this review, we describe practical approaches being used to discover functional RNA elements in viral genomes. In addition to success stories in new and emerging viruses, these approaches have revealed some surprising new features of well-studied viruses e.g., human immunodeficiency virus, hepatitis C virus, influenza, and dengue viruses. Some notable discoveries were facilitated by new comparative analyses of diverse viral genome alignments. Importantly, comparative approaches for finding RNA elements embedded in coding and non-coding regions differ. With the exponential growth of computer power we have progressed from stem-loop prediction on single sequences to cutting edge 3D prediction, and from command line to user friendly web interfaces. Despite these advances, many powerful, user friendly prediction tools and resources are underutilized by the virology community.

Know Your Enemy: Successful Bioinformatic Approaches to Predict Functional RNA Structures in Viral RNAs

PubMed Central

Lim, Chun Shen; Brown, Chris M.

2018-01-01

Structured RNA elements may control virus replication, transcription and translation, and their distinct features are being exploited by novel antiviral strategies. Viral RNA elements continue to be discovered using combinations of experimental and computational analyses. However, the wealth of sequence data, notably from deep viral RNA sequencing, viromes, and metagenomes, necessitates computational approaches being used as an essential discovery tool. In this review, we describe practical approaches being used to discover functional RNA elements in viral genomes. In addition to success stories in new and emerging viruses, these approaches have revealed some surprising new features of well-studied viruses e.g., human immunodeficiency virus, hepatitis C virus, influenza, and dengue viruses. Some notable discoveries were facilitated by new comparative analyses of diverse viral genome alignments. Importantly, comparative approaches for finding RNA elements embedded in coding and non-coding regions differ. With the exponential growth of computer power we have progressed from stem-loop prediction on single sequences to cutting edge 3D prediction, and from command line to user friendly web interfaces. Despite these advances, many powerful, user friendly prediction tools and resources are underutilized by the virology community. PMID:29354101

Regulation of miRNA Processing and miRNA Mediated Gene Repression in Cancer

PubMed Central

Bajan, Sarah; Hutvagner, Gyorgy

2014-01-01

The majority of human protein-coding genes are predicted to be targets of miRNA-mediated post-transcriptional regulation. The widespread influence of miRNAs is illustrated by their essential roles in all biological processes. Regulated miRNA expression is essential for maintaining cellular differentiation; therefore alterations in miRNA expression patterns are associated with several diseases, including various cancers. High-throughput sequencing technologies revealed low level expressing miRNA isoforms, termed isomiRs. IsomiRs may differ in sequence, length, target preference and expression patterns from their parental miRNA and can arise from differences in miRNA biosynthesis, RNA editing, or SNPs inherent to the miRNA gene. The association between isomiR expression and disease progression is largely unknown. Misregulated miRNA expression is thought to contribute to the formation and/or progression of cancer. However, due to the diversity of targeted transcripts, miRNAs can function as both tumor-suppressor genes and oncogenes as defined by cellular context. Despite this, miRNA profiling studies concluded that the differential expression of particular miRNAs in diseased tissue could aid the diagnosis and treatment of some cancers. PMID:25069508

Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering.

PubMed

Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko

2017-06-01

Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

High-throughput detection of RNA processing in bacteria.

PubMed

Gill, Erin E; Chan, Luisa S; Winsor, Geoffrey L; Dobson, Neil; Lo, Raymond; Ho Sui, Shannan J; Dhillon, Bhavjinder K; Taylor, Patrick K; Shrestha, Raunak; Spencer, Cory; Hancock, Robert E W; Unrau, Peter J; Brinkman, Fiona S L

2018-03-27

Understanding the RNA processing of an organism's transcriptome is an essential but challenging step in understanding its biology. Here we investigate with unprecedented detail the transcriptome of Pseudomonas aeruginosa PAO1, a medically important and innately multi-drug resistant bacterium. We systematically mapped RNA cleavage and dephosphorylation sites that result in 5'-monophosphate terminated RNA (pRNA) using monophosphate RNA-Seq (pRNA-Seq). Transcriptional start sites (TSS) were also mapped using differential RNA-Seq (dRNA-Seq) and both datasets were compared to conventional RNA-Seq performed in a variety of growth conditions. The pRNA-Seq library revealed known tRNA, rRNA and transfer-messenger RNA (tmRNA) processing sites, together with previously uncharacterized RNA cleavage events that were found disproportionately near the 5' ends of transcripts associated with basic bacterial functions such as oxidative phosphorylation and purine metabolism. The majority (97%) of the processed mRNAs were cleaved at precise codon positions within defined sequence motifs indicative of distinct endonucleolytic activities. The most abundant of these motifs corresponded closely to an E. coli RNase E site previously established in vitro. Using the dRNA-Seq library, we performed an operon analysis and predicted 3159 potential TSS. A correlation analysis uncovered 105 antiparallel pairs of TSS that were separated by 18 bp from each other and were centered on single palindromic TAT(A/T)ATA motifs (likely - 10 promoter elements), suggesting that, consistent with previous in vitro experimentation, these sites can initiate transcription bi-directionally and may thus provide a novel form of transcriptional regulation. TSS and RNA-Seq analysis allowed us to confirm expression of small non-coding RNAs (ncRNAs), many of which are differentially expressed in swarming and biofilm formation conditions. This study uses pRNA-Seq, a method that provides a genome-wide survey of RNA processing, to study the bacterium Pseudomonas aeruginosa and discover extensive transcript processing not previously appreciated. We have also gained novel insight into RNA maturation and turnover as well as a potential novel form of transcription regulation. NOTE: All sequence data has been submitted to the NCBI sequence read archive. Accession numbers are as follows: [NCBI sequence read archive: SRX156386, SRX157659, SRX157660, SRX157661, SRX157683 and SRX158075]. The sequence data is viewable using Jbrowse on www.pseudomonas.com .

The complete chloroplast genome of Aconitum chiisanense Nakai (Ranunculaceae).

PubMed

Lim, Chae Eun; Kim, Goon-Bo; Baek, Seunghoon; Han, Su-Min; Yu, Hee-Ju; Mun, Jeong-Hwan

2017-01-01

We determined the complete chloroplast DNA sequence of Aconitum chiisanense Nakai, a rare Aconitum species endemic to Korea. The chloroplast genome is 155 934 bp in length and contains 4 rRNA, 30 tRNA, and 78 protein-coding genes. Phylogenetic analysis revealed that the chloroplast genome of A. chiisanense is closely related to that of A. barbatum var. puberulum. Sequence comparison with other Ranunculaceae chloroplasts identified a unique deletion in the rps16 gene of A. chiisanense chloroplast DNA that can serve as a molecular marker for species identification.

Deep sequencing and proteomic analysis of the microRNA-induced silencing complex in human red blood cells.

PubMed

Azzouzi, Imane; Moest, Hansjoerg; Wollscheid, Bernd; Schmugge, Markus; Eekels, Julia J M; Speer, Oliver

2015-05-01

During maturation, erythropoietic cells extrude their nuclei but retain their ability to respond to oxidant stress by tightly regulating protein translation. Several studies have reported microRNA-mediated regulation of translation during terminal stages of erythropoiesis, even after enucleation. In the present study, we performed a detailed examination of the endogenous microRNA machinery in human red blood cells using a combination of deep sequencing analysis of microRNAs and proteomic analysis of the microRNA-induced silencing complex. Among the 197 different microRNAs detected, miR-451a was the most abundant, representing more than 60% of all read sequences. In addition, miR-451a and its known target, 14-3-3ζ mRNA, were bound to the microRNA-induced silencing complex, implying their direct interaction in red blood cells. The proteomic characterization of endogenous Argonaute 2-associated microRNA-induced silencing complex revealed 26 cofactor candidates. Among these cofactors, we identified several RNA-binding proteins, as well as motor proteins and vesicular trafficking proteins. Our results demonstrate that red blood cells contain complex microRNA machinery, which might enable immature red blood cells to control protein translation independent of de novo nuclei information. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Genome-wide discovery and differential regulation of conserved and novel microRNAs in chickpea via deep sequencing.

PubMed

Jain, Mukesh; Chevala, V V S Narayana; Garg, Rohini

2014-11-01

MicroRNAs (miRNAs) are essential components of complex gene regulatory networks that orchestrate plant development. Although several genomic resources have been developed for the legume crop chickpea, miRNAs have not been discovered until now. For genome-wide discovery of miRNAs in chickpea (Cicer arietinum), we sequenced the small RNA content from seven major tissues/organs employing Illumina technology. About 154 million reads were generated, which represented more than 20 million distinct small RNA sequences. We identified a total of 440 conserved miRNAs in chickpea based on sequence similarity with known miRNAs in other plants. In addition, 178 novel miRNAs were identified using a miRDeep pipeline with plant-specific scoring. Some of the conserved and novel miRNAs with significant sequence similarity were grouped into families. The chickpea miRNAs targeted a wide range of mRNAs involved in diverse cellular processes, including transcriptional regulation (transcription factors), protein modification and turnover, signal transduction, and metabolism. Our analysis revealed several miRNAs with differential spatial expression. Many of the chickpea miRNAs were expressed in a tissue-specific manner. The conserved and differential expression of members of the same miRNA family in different tissues was also observed. Some of the same family members were predicted to target different chickpea mRNAs, which suggested the specificity and complexity of miRNA-mediated developmental regulation. This study, for the first time, reveals a comprehensive set of conserved and novel miRNAs along with their expression patterns and putative targets in chickpea, and provides a framework for understanding regulation of developmental processes in legumes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Group 16SrXI phytoplasma strains, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D, are associated with sugar cane white leaf.

PubMed

Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong

2016-01-01

Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

Nucleotide sequence of RNA2 of Lettuce big-vein virus and evidence for a possible transcription termination/initiation strategy similar to that of rhabdoviruses.

PubMed

Sasaya, Takahide; Kusaba, Shinnosuke; Ishikawa, Koichi; Koganezawa, Hiroki

2004-09-01

Lettuce big-vein virus (LBVV) is the type species of the genus Varicosavirus and is a two-segmented negative-sense single-stranded RNA virus. The larger LBVV genome segment (RNA1) consists of 6797 nt and encodes an L polymerase that resembles that of rhabdoviruses. Here, the nucleotide sequence of the second LBVV genome segment (RNA2) is reported. LBVV RNA2 consisted of 6081 nt and contained antisense information for five major ORFs: ORF1 (nt 210-1403 on the viral RNA), ORF2 (nt 1493-2494), ORF3 (nt 2617-3489), ORF4 (nt 3843-4337) and ORF5 (nt 4530-5636), which had coding capacities of 44, 36, 32, 19 and 41 kDa, respectively. The gene at the 3' end of the viral RNA encoded a coat protein, while the other four genes encoded proteins of unknown functions. The 3'-terminal 11 nt of LBVV RNA2 were identical to those of LBVV RNA1, and the 5'-terminal regions of LBVV RNA1 and RNA2 contained a long common nucleotide stretch of about 100 nt. Northern blot analysis using probes specific to the individual ORFs revealed that LBVV transcribes monocistronic RNAs. Analysis of the terminal sequences, and primer extension and RNase H digestion analysis of LBVV mRNAs, suggested that LBVV utilizes a transcription termination/initiation strategy comparable with that of rhabdoviruses.

High-Throughput Sequencing of RNA Silencing-Associated Small RNAs in Olive (Olea europaea L.)

PubMed Central

Donaire, Livia; Pedrola, Laia; de la Rosa, Raúl; Llave, César

2011-01-01

Small RNAs (sRNAs) of 20 to 25 nucleotides (nt) in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.). sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA) regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive. PMID:22140484

Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

PubMed

Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

2009-01-01

The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

2010-06-01

The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

Splicing-Related Features of Introns Serve to Propel Evolution

PubMed Central

Luo, Yuping; Li, Chun; Gong, Xi; Wang, Yanlu; Zhang, Kunshan; Cui, Yaru; Sun, Yi Eve; Li, Siguang

2013-01-01

The role of spliceosomal intronic structures played in evolution has only begun to be elucidated. Comparative genomic analyses of fungal snoRNA sequences, which are often contained within introns and/or exons, revealed that about one-third of snoRNA-associated introns in three major snoRNA gene clusters manifested polymorphisms, likely resulting from intron loss and gain events during fungi evolution. Genomic deletions can clearly be observed as one mechanism underlying intron and exon loss, as well as generation of complex introns where several introns lie in juxtaposition without intercalating exons. Strikingly, by tracking conserved snoRNAs in introns, we found that some introns had moved from one position to another by excision from donor sites and insertion into target sties elsewhere in the genome without needing transposon structures. This study revealed the origin of many newly gained introns. Moreover, our analyses suggested that intron-containing sequences were more prone to sustainable structural changes than DNA sequences without introns due to intron's ability to jump within the genome via unknown mechanisms. We propose that splicing-related structural features of introns serve as an additional motor to propel evolution. PMID:23516505

Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2010-04-01

An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot

PubMed Central

2012-01-01

Background MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (Prunus mume Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot. Results Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress. Conclusions This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants. PMID:22863067

Sequence editing by Apolipoprotein B RNA-editing catalytic component-B and epidemiological surveillance of transmitted HIV-1 drug resistance

PubMed Central

Gifford, Robert J.; Rhee, Soo-Yon; Eriksson, Nicolas; Liu, Tommy F.; Kiuchi, Mark; Das, Amar K.; Shafer, Robert W.

2008-01-01

Design Promiscuous guanine (G) to adenine (A) substitutions catalysed by apolipoprotein B RNA-editing catalytic component (APOBEC) enzymes are observed in a proportion of HIV-1 sequences in vivo and can introduce artifacts into some genetic analyses. The potential impact of undetected lethal editing on genotypic estimation of transmitted drug resistance was assessed. Methods Classifiers of lethal, APOBEC-mediated editing were developed by analysis of lentiviral pol gene sequence variation and evaluated using control sets of HIV-1 sequences. The potential impact of sequence editing on genotypic estimation of drug resistance was assessed in sets of sequences obtained from 77 studies of 25 or more therapy-naive individuals, using mixture modelling approaches to determine the maximum likelihood classification of sequences as lethally edited as opposed to viable. Results Analysis of 6437 protease and reverse transcriptase sequences from therapy-naive individuals using a novel classifier of lethal, APOBEC3G-mediated sequence editing, the polypeptide-like 3G (APOBEC3G)-mediated defectives (A3GD) index’, detected lethal editing in association with spurious ‘transmitted drug resistance’ in nearly 3% of proviral sequences obtained from whole blood and 0.2% of samples obtained from plasma. Conclusion Screening for lethally edited sequences in datasets containing a proportion of proviral DNA, such as those likely to be obtained for epidemiological surveillance of transmitted drug resistance in the developing world, can eliminate rare but potentially significant errors in genotypic estimation of transmitted drug resistance. PMID:18356601

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

PubMed

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-07-14

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming

PubMed Central

Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

2015-01-01

The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1–3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN). PMID:26172504

Designing Tyrosinase siRNAs by Multiple Prediction Algorithms and Evaluation of Their Anti-Melanogenic Effects.

PubMed

Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon

2018-05-01

Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥-34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3' overhang at the 3' end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms.

Designing Tyrosinase siRNAs by Multiple Prediction Algorithms and Evaluation of Their Anti-Melanogenic Effects

PubMed Central

Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon

2018-01-01

Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥−34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3′ overhang at the 3′ end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms. PMID:29223142

BlackOPs: increasing confidence in variant detection through mappability filtering.

PubMed

Cabanski, Christopher R; Wilkerson, Matthew D; Soloway, Matthew; Parker, Joel S; Liu, Jinze; Prins, Jan F; Marron, J S; Perou, Charles M; Hayes, D Neil

2013-10-01

Identifying variants using high-throughput sequencing data is currently a challenge because true biological variants can be indistinguishable from technical artifacts. One source of technical artifact results from incorrectly aligning experimentally observed sequences to their true genomic origin ('mismapping') and inferring differences in mismapped sequences to be true variants. We developed BlackOPs, an open-source tool that simulates experimental RNA-seq and DNA whole exome sequences derived from the reference genome, aligns these sequences by custom parameters, detects variants and outputs a blacklist of positions and alleles caused by mismapping. Blacklists contain thousands of artifact variants that are indistinguishable from true variants and, for a given sample, are expected to be almost completely false positives. We show that these blacklist positions are specific to the alignment algorithm and read length used, and BlackOPs allows users to generate a blacklist specific to their experimental setup. We queried the dbSNP and COSMIC variant databases and found numerous variants indistinguishable from mapping errors. We demonstrate how filtering against blacklist positions reduces the number of potential false variants using an RNA-seq glioblastoma cell line data set. In summary, accounting for mapping-caused variants tuned to experimental setups reduces false positives and, therefore, improves genome characterization by high-throughput sequencing.

A Bioinformatic Pipeline for Monitoring of the Mutational Stability of Viral Drug Targets with Deep-Sequencing Technology.

PubMed

Kravatsky, Yuri; Chechetkin, Vladimir; Fedoseeva, Daria; Gorbacheva, Maria; Kravatskaya, Galina; Kretova, Olga; Tchurikov, Nickolai

2017-11-23

The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs), requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s). Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s). The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi) targets in human immunodeficiency virus 1 (HIV-1) subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.

Molecular detection and genetic characterization of Babesia, Theileria and Anaplasma amongst apparently healthy sheep and goats in the central region of Turkey.

PubMed

Zhou, Mo; Cao, Shinuo; Sevinc, Ferda; Sevinc, Mutlu; Ceylan, Onur; Ekici, Sepil; Jirapattharasate, Charoonluk; Moumouni, Paul Franck Adjou; Liu, Mingming; Wang, Guanbo; Iguchi, Aiko; Vudriko, Patrick; Suzuki, Hiroshi; Xuan, Xuenan

2017-02-01

Babesia spp., Theileria spp. and Anaplasma spp. are significant tick-borne pathogens of livestock globally. In this study, we investigated the presence and distribution of Babesia ovis, Theileria ovis and Anaplasma ovis in 343 small ruminants (249 sheep and 94 goats) from 13 towns in the Central Anatolia region of Turkey using species-specific PCR assays. The PCR were conducted using the primers based on the B. ovis ssu rRNA (BoSSUrRNA), T. ovis ssu rRNA (ToSSUrRNA) and A. ovis major surface protein 4 (AoMSP4) genes, respectively. Fragments of these genes were sequenced for phylogenetic analysis. PCR results revealed that the overall infections of A. ovis, T. ovis and B. ovis were 60.0%, 35.9% and 5.2%, respectively. Co-infection of the animals with two or three pathogens was detected in 105/343 (30.6%) of the ovine samples. The results of sequence analysis indicated that AoMSP4 were conserved among the Turkish samples, with 100% sequence identity values. In contrast, the BoSSUrRNA and ToSSUrRNA gene sequences were relatively diverse with identity values of 98.54%-99.82% and 99.23%-99.81%, respectively. Phylograms were inferred based on the BoSSUrRNA, ToSSUrRNA and AoMSP4 sequences obtained in this study and those from previous studies. B. ovis isolates from Turkey were found in the same clade as the isolates from other countries in phylogenetic analysis. On the other hand, the Turkish T. ovis isolates in the present study formed a monophyletic grouping with the isolates from other countries in a phylogeny based on ToSSUrRNA sequences. Furthermore, phylogenetic analysis using AoMSP4 sequences showed the presence of three genotypes of A. ovis. This study provides important data for understanding the epidemiology of tick-borne diseases in small ruminants and the degree of genetic heterogeneities among these pathogens in Turkey. To our knowledge, this is the first study on the co-infection of Babesia, Theileria and Anaplasma in sheep and goats in Turkey. Copyright © 2016 Elsevier GmbH. All rights reserved.

Paralogues of nuclear ribosomal genes conceal phylogenetic signals within the invasive Asian fish tapeworm lineage: evidence from next generation sequencing data.

PubMed

Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D Timothy J

2016-08-01

Complete mitochondrial genomes and nuclear rRNA operons of eight geographically distinct isolates of the Asian fish tapeworm Schyzocotyle acheilognathi (syn. Bothriocephalus acheilognathi), representing the parasite's global diversity spanning four continents, were fully characterised using an Illumina sequencing platform. This cestode species represents an extreme example of a highly invasive, globally distributed pathogen of veterinary importance with exceptionally low host specificity unseen elsewhere within the parasitic flatworms. In addition to eight specimens of S. acheilognathi, we fully characterised its closest known relative and the only congeneric species, Schyzocotyle nayarensis, from cyprinids in the Indian subcontinent. Since previous nucleotide sequence data on the Asian fish tapeworm were restricted to a single molecular locus of questionable phylogenetic utility-the nuclear rRNA genes-separating internal transcribed spacers-the mitogenomic data presented here offer a unique opportunity to gain the first detailed insights into both the intraspecific phylogenetic relationships and population genetic structure of the parasite, providing key baseline information for future research in the field. Additionally, we identify a previously unnoticed source of error and demonstrate the limited utility of the nuclear rRNA sequences, including the internal transcribed spacers that has likely misled most of the previous molecular phylogenetic and population genetic estimates on the Asian fish tapeworm. Copyright © 2016 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

Zipper plot: visualizing transcriptional activity of genomic regions.

PubMed

Avila Cobos, Francisco; Anckaert, Jasper; Volders, Pieter-Jan; Everaert, Celine; Rombaut, Dries; Vandesompele, Jo; De Preter, Katleen; Mestdagh, Pieter

2017-05-02

Reconstructing transcript models from RNA-sequencing (RNA-seq) data and establishing these as independent transcriptional units can be a challenging task. Current state-of-the-art tools for long non-coding RNA (lncRNA) annotation are mainly based on evolutionary constraints, which may result in false negatives due to the overall limited conservation of lncRNAs. To tackle this problem we have developed the Zipper plot, a novel visualization and analysis method that enables users to simultaneously interrogate thousands of human putative transcription start sites (TSSs) in relation to various features that are indicative for transcriptional activity. These include publicly available CAGE-sequencing, ChIP-sequencing and DNase-sequencing datasets. Our method only requires three tab-separated fields (chromosome, genomic coordinate of the TSS and strand) as input and generates a report that includes a detailed summary table, a Zipper plot and several statistics derived from this plot. Using the Zipper plot, we found evidence of transcription for a set of well-characterized lncRNAs and observed that fewer mono-exonic lncRNAs have CAGE peaks overlapping with their TSSs compared to multi-exonic lncRNAs. Using publicly available RNA-seq data, we found more than one hundred cases where junction reads connected protein-coding gene exons with a downstream mono-exonic lncRNA, revealing the need for a careful evaluation of lncRNA 5'-boundaries. Our method is implemented using the statistical programming language R and is freely available as a webtool.

Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

PubMed

Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

2006-07-01

The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

Reference-guided assembly of four diverse Arabidopsis thaliana genomes

PubMed Central

Schneeberger, Korbinian; Ossowski, Stephan; Ott, Felix; Klein, Juliane D.; Wang, Xi; Lanz, Christa; Smith, Lisa M.; Cao, Jun; Fitz, Joffrey; Warthmann, Norman; Henz, Stefan R.; Huson, Daniel H.; Weigel, Detlef

2011-01-01

We present whole-genome assemblies of four divergent Arabidopsis thaliana strains that complement the 125-Mb reference genome sequence released a decade ago. Using a newly developed reference-guided approach, we assembled large contigs from 9 to 42 Gb of Illumina short-read data from the Landsberg erecta (Ler-1), C24, Bur-0, and Kro-0 strains, which have been sequenced as part of the 1,001 Genomes Project for this species. Using alignments against the reference sequence, we first reduced the complexity of the de novo assembly and later integrated reads without similarity to the reference sequence. As an example, half of the noncentromeric C24 genome was covered by scaffolds that are longer than 260 kb, with a maximum of 2.2 Mb. Moreover, over 96% of the reference genome was covered by the reference-guided assembly, compared with only 87% with a complete de novo assembly. Comparisons with 2 Mb of dideoxy sequence reveal that the per-base error rate of the reference-guided assemblies was below 1 in 10,000. Our assemblies provide a detailed, genomewide picture of large-scale differences between A. thaliana individuals, most of which are difficult to access with alignment-consensus methods only. We demonstrate their practical relevance in studying the expression differences of polymorphic genes and show how the analysis of sRNA sequencing data can lead to erroneous conclusions if aligned against the reference genome alone. Genome assemblies, raw reads, and further information are accessible through http://1001genomes.org/projects/assemblies.html. PMID:21646520

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export.

PubMed

Karijolich, John; Zhao, Yang; Alla, Ravi; Glaunsinger, Britt

2017-06-02

Short interspersed nuclear elements (SINEs) are retrotransposons evolutionarily derived from endogenous RNA Polymerase III RNAs. Though SINE elements have undergone exaptation into gene regulatory elements, how transcribed SINE RNA impacts transcriptional and post-transcriptional regulation is largely unknown. This is partly due to a lack of information regarding which of the loci have transcriptional potential. Here, we present an approach (short interspersed nuclear element sequencing, SINE-seq), which selectively profiles RNA Polymerase III-derived SINE RNA, thereby identifying transcriptionally active SINE loci. Applying SINE-seq to monitor murine B2 SINE expression during a gammaherpesvirus infection revealed transcription from 28 270 SINE loci, with ∼50% of active SINE elements residing within annotated RNA Polymerase II loci. Furthermore, B2 RNA can form intermolecular RNA-RNA interactions with complementary mRNAs, leading to nuclear retention of the targeted mRNA via a mechanism involving p54nrb. These findings illuminate a pathway for the selective regulation of mRNA export during stress via retrotransposon activation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The physics of evolution

NASA Astrophysics Data System (ADS)

Eigen, Manfred

1988-12-01

The Darwinian concept of evolution through natural selection has been revised and put on a solid physical basis, in a form which applies to self-replicable macromolecules. Two new concepts are introduced: sequence space and quasi-species. Evolutionary change in the DNA- or RNA-sequence of a gene can be mapped as a trajectory in a sequence space of dimension ν, where ν corresponds to the number of changeable positions in the genomic sequence. Emphasis, however, is shifted from the single surviving wildtype, a single point in the sequence space, to the complex structure of the mutant distribution that constitutes the quasi-species. Selection is equivalent to an establishment of the quasi-species in a localized region of sequence space, subject to threshold conditions for the error rate and sequence length. Arrival of a new mutant may violate the local threshold condition and thereby lead to a displacement of the quasi-species into a different region of sequence space. This transformation is similar to a phase transition; the dynamical equations that describe the quase-species have been shown to be analogous to those of the two-dimensional Ising model of ferromagnetism. The occurrence of a selectively advantageous mutant is biased by the particulars of the quasi-species distribution, whose mutants are populated according to their fitness relative to that of the wild-type. Inasmuch as fitness regions are connected (like mountain ridges) the evolutionary trajectory is guided to regions of optimal fitness. Evolution experiments in test tubes confirm this modification of the simple chance and law nature of the Darwinian concept. The results of the theory can also be applied to the construction of a machine that provides optimal conditions for a rapid evolution of functionally active macromolecules. An introduction to the physics of molecular evolution by the author has appeared recently.1 Detailed studies of the kinetics and mechanisms of replication of RNA, the most likely candidate for early evolution2,3, and of the implications on natural selection have been given in Refs. 4 and 5. The quasi-species model has been constructed in Refs. 6 and 7 using the concept of sequence space. Subsequently various methods have been invented to elucidate this concept and to relate it to the theory of critical phenomena 8-19. The instability of the quasi-species at the error threshold is discussed in Ref. 10. Evolution experiments with RNA strands in test tubes are described in Refs. 21 and 22.

Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells.

PubMed

Macaulay, Iain C; Svensson, Valentine; Labalette, Charlotte; Ferreira, Lauren; Hamey, Fiona; Voet, Thierry; Teichmann, Sarah A; Cvejic, Ana

2016-02-02

The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Detection of microRNAs in color space.

PubMed

Marco, Antonio; Griffiths-Jones, Sam

2012-02-01

Deep sequencing provides inexpensive opportunities to characterize the transcriptional diversity of known genomes. The AB SOLiD technology generates millions of short sequencing reads in color-space; that is, the raw data is a sequence of colors, where each color represents 2 nt and each nucleotide is represented by two consecutive colors. This strategy is purported to have several advantages, including increased ability to distinguish sequencing errors from polymorphisms. Several programs have been developed to map short reads to genomes in color space. However, a number of previously unexplored technical issues arise when using SOLiD technology to characterize microRNAs. Here we explore these technical difficulties. First, since the sequenced reads are longer than the biological sequences, every read is expected to contain linker fragments. The color-calling error rate increases toward the 3(') end of the read such that recognizing the linker sequence for removal becomes problematic. Second, mapping in color space may lead to the loss of the first nucleotide of each read. We propose a sequential trimming and mapping approach to map small RNAs. Using our strategy, we reanalyze three published insect small RNA deep sequencing datasets and characterize 22 new microRNAs. A bash shell script to perform the sequential trimming and mapping procedure, called SeqTrimMap, is available at: http://www.mirbase.org/tools/seqtrimmap/ antonio.marco@manchester.ac.uk Supplementary data are available at Bioinformatics online.

Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

PubMed Central

Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

2014-01-01

The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

Theories of Lethal Mutagenesis: From Error Catastrophe to Lethal Defection.

PubMed

Tejero, Héctor; Montero, Francisco; Nuño, Juan Carlos

2016-01-01

RNA viruses get extinct in a process called lethal mutagenesis when subjected to an increase in their mutation rate, for instance, by the action of mutagenic drugs. Several approaches have been proposed to understand this phenomenon. The extinction of RNA viruses by increased mutational pressure was inspired by the concept of the error threshold. The now classic quasispecies model predicts the existence of a limit to the mutation rate beyond which the genetic information of the wild type could not be efficiently transmitted to the next generation. This limit was called the error threshold, and for mutation rates larger than this threshold, the quasispecies was said to enter into error catastrophe. This transition has been assumed to foster the extinction of the whole population. Alternative explanations of lethal mutagenesis have been proposed recently. In the first place, a distinction is made between the error threshold and the extinction threshold, the mutation rate beyond which a population gets extinct. Extinction is explained from the effect the mutation rate has, throughout the mutational load, on the reproductive ability of the whole population. Secondly, lethal defection takes also into account the effect of interactions within mutant spectra, which have been shown to be determinant for the understanding the extinction of RNA virus due to an augmented mutational pressure. Nonetheless, some relevant issues concerning lethal mutagenesis are not completely understood yet, as so survival of the flattest, i.e. the development of resistance to lethal mutagenesis by evolving towards mutationally more robust regions of sequence space, or sublethal mutagenesis, i.e., the increase of the mutation rate below the extinction threshold which may boost the adaptability of RNA virus, increasing their ability to develop resistance to drugs (including mutagens). A better design of antiviral therapies will still require an improvement of our knowledge about lethal mutagenesis.

Conformational and chemical selection by a trans-acting editing domain

PubMed Central

Danhart, Eric M.; Bakhtina, Marina; Cantara, William A.; Kuzmishin, Alexandra B.; Ma, Xiao; Sanford, Brianne L.; Vargas-Rodriguez, Oscar; Košutić, Marija; Goto, Yuki; Suga, Hiroaki; Nakanishi, Kotaro; Micura, Ronald; Musier-Forsyth, Karin

2017-01-01

Molecular sieves ensure proper pairing of tRNAs and amino acids during aminoacyl-tRNA biosynthesis, thereby avoiding detrimental effects of mistranslation on cell growth and viability. Mischarging errors are often corrected through the activity of specialized editing domains present in some aminoacyl-tRNA synthetases or via single-domain trans-editing proteins. ProXp-ala is a ubiquitous trans-editing enzyme that edits Ala-tRNAPro, the product of Ala mischarging by prolyl-tRNA synthetase, although the structural basis for discrimination between correctly charged Pro-tRNAPro and mischarged Ala-tRNAAla is unclear. Deacylation assays using substrate analogs reveal that size discrimination is only one component of selectivity. We used NMR spectroscopy and sequence conservation to guide extensive site-directed mutagenesis of Caulobacter crescentus ProXp-ala, along with binding and deacylation assays to map specificity determinants. Chemical shift perturbations induced by an uncharged tRNAPro acceptor stem mimic, microhelixPro, or a nonhydrolyzable mischarged Ala-microhelixPro substrate analog identified residues important for binding and deacylation. Backbone 15N NMR relaxation experiments revealed dynamics for a helix flanking the substrate binding site in free ProXp-ala, likely reflecting sampling of open and closed conformations. Dynamics persist on binding to the uncharged microhelix, but are attenuated when the stably mischarged analog is bound. Computational docking and molecular dynamics simulations provide structural context for these findings and predict a role for the substrate primary α-amine group in substrate recognition. Overall, our results illuminate strategies used by a trans-editing domain to ensure acceptance of only mischarged Ala-tRNAPro, including conformational selection by a dynamic helix, size-based exclusion, and optimal positioning of substrate chemical groups. PMID:28768811

The discovery of Halictivirus resolves the Sinaivirus phylogeny.

PubMed

Bigot, Diane; Dalmon, Anne; Roy, Bronwen; Hou, Chunsheng; Germain, Michèle; Romary, Manon; Deng, Shuai; Diao, Qingyun; Weinert, Lucy A; Cook, James M; Herniou, Elisabeth A; Gayral, Philippe

2017-11-01

By providing pollination services, bees are among the most important insects, both in ecological and economical terms. Combined next-generation and classical sequencing approaches were applied to discover and study new insect viruses potentially harmful to bees. A bioinformatics virus discovery pipeline was used on individual Illumina transcriptomes of 13 wild bees from three species from the genus Halictus and 30 ants from six species of the genera Messor and Aphaenogaster. This allowed the discovery and description of three sequences of a new virus termed Halictus scabiosae Adlikon virus (HsAV). Phylogenetic analyses of ORF1, RNA-dependent RNA-polymerase (RdRp) and capsid genes showed that HsAV is closely related to (+)ssRNA viruses of the unassigned Sinaivirus genus but distant enough to belong to a different new genus we called Halictivirus. In addition, our study of ant transcriptomes revealed the first four sinaivirus sequences from ants (Messor barbarus, M. capitatus and M. concolor). Maximum likelihood phylogenetic analyses were performed on a 594 nt fragment of the ORF1/RdRp region from 84 sinaivirus sequences, including 31 new Lake Sinai viruses (LSVs) from honey bees collected in five countries across the globe and the four ant viral sequences. The phylogeny revealed four main clades potentially representing different viral species infecting honey bees. Moreover, the ant viruses belonged to the LSV4 clade, suggesting a possible cross-species transmission between bees and ants. Lastly, wide honey bee screening showed that all four LSV clades have worldwide distributions with no obvious geographical segregation.

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Molecular Characterization of “Candidatus Parilichlamydia carangidicola,” a Novel Chlamydia-Like Epitheliocystis Agent in Yellowtail Kingfish, Seriola lalandi (Valenciennes), and the Proposal of a New Family, “Candidatus Parilichlamydiaceae” fam. nov. (Order Chlamydiales)

PubMed Central

Polkinghorne, A.; Miller, T. L.; Groff, J. M.; LaPatra, S. E.; Nowak, B. F.

2013-01-01

Three cohorts of farmed yellowtail kingfish (Seriola lalandi) from South Australia were examined for Chlamydia-like organisms associated with epitheliocystis. To characterize the bacteria, 38 gill samples were processed for histopathology, electron microscopy, and 16S rRNA amplification, sequencing, and phylogenetic analysis. Microscopically, the presence of membrane-enclosed cysts was observed within the gill lamellae. Also observed was hyperplasia of the epithelial cells with cytoplasmic vacuolization and fusion of the gill lamellae. Transmission electron microscopy revealed morphological features of the reticulate and intermediate bodies typical of members of the order Chlamydiales. A novel 1,393-bp 16S chlamydial rRNA sequence was amplified from gill DNA extracted from fish in all cohorts over a 3-year period that corresponded to the 16S rRNA sequence amplified directly from laser-dissected cysts. This sequence was only 87% similar to the reported “Candidatus Piscichlamydia salmonis” (AY462244) from Atlantic salmon and Arctic charr. Phylogenetic analysis of this sequence against 35 Chlamydia and Chlamydia-like bacteria revealed that this novel bacterium belongs to an undescribed family lineage in the order Chlamydiales. Based on these observations, we propose this bacterium of yellowtail kingfish be known as “Candidatus Parilichlamydia carangidicola” and that the new family be known as “Candidatus Parilichlamydiaceae.” PMID:23275507

Carbohydrate active enzymes revealed in Coptotermes formosanus transcriptome

USDA-ARS?s Scientific Manuscript database

A normalized cDNA library of Coptotermes formosanus was constructed using mixed RNA isolated from workers, soldiers, nymphs and alates of both sexes. Sequencing of this library generated 131,637 EST and 25,939 unigenes were assembled. Carbohydrate active enzymes (CAZymes) revealed in this library we...

Circular RNAs: Unexpected outputs of many protein-coding genes

PubMed Central

Wilusz, Jeremy E.

2017-01-01

ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

Drosophila Nanos acts as a molecular clamp that modulates the RNA-binding and repression activities of Pumilio.

PubMed

Weidmann, Chase A; Qiu, Chen; Arvola, René M; Lou, Tzu-Fang; Killingsworth, Jordan; Campbell, Zachary T; Tanaka Hall, Traci M; Goldstrohm, Aaron C

2016-08-02

Collaboration among the multitude of RNA-binding proteins (RBPs) is ubiquitous, yet our understanding of these key regulatory complexes has been limited to single RBPs. We investigated combinatorial translational regulation by Drosophila Pumilio (Pum) and Nanos (Nos), which control development, fertility, and neuronal functions. Our results show how the specificity of one RBP (Pum) is modulated by cooperative RNA recognition with a second RBP (Nos) to synergistically repress mRNAs. Crystal structures of Nos-Pum-RNA complexes reveal that Nos embraces Pum and RNA, contributes sequence-specific contacts, and increases Pum RNA-binding affinity. Nos shifts the recognition sequence and promotes repression complex formation on mRNAs that are not stably bound by Pum alone, explaining the preponderance of sub-optimal Pum sites regulated in vivo. Our results illuminate the molecular mechanism of a regulatory switch controlling crucial gene expression programs, and provide a framework for understanding how the partnering of RBPs evokes changes in binding specificity that underlie regulatory network dynamics.

Drosophila Nanos acts as a molecular clamp that modulates the RNA-binding and repression activities of Pumilio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weidmann, Chase A.; Qiu, Chen; Arvola, René M.

Collaboration among the multitude of RNA-binding proteins (RBPs) is ubiquitous, yet our understanding of these key regulatory complexes has been limited to single RBPs. We investigated combinatorial translational regulation byDrosophilaPumilio (Pum) and Nanos (Nos), which control development, fertility, and neuronal functions. Our results show how the specificity of one RBP (Pum) is modulated by cooperative RNA recognition with a second RBP (Nos) to synergistically repress mRNAs. Crystal structures of Nos-Pum-RNA complexes reveal that Nos embraces Pum and RNA, contributes sequence-specific contacts, and increases Pum RNA-binding affinity. Nos shifts the recognition sequence and promotes repression complex formation on mRNAs that aremore » not stably bound by Pum alone, explaining the preponderance of sub-optimal Pum sites regulatedin vivo. Our results illuminate the molecular mechanism of a regulatory switch controlling crucial gene expression programs, and provide a framework for understanding how the partnering of RBPs evokes changes in binding specificity that underlie regulatory network dynamics.« less

Genome Sequence of the Bacterium Streptomyces davawensis JCM 4913 and Heterologous Production of the Unique Antibiotic Roseoflavin

PubMed Central

Jankowitsch, Frank; Schwarz, Julia; Rückert, Christian; Gust, Bertolt; Szczepanowski, Rafael; Blom, Jochen; Pelzer, Stefan; Kalinowski, Jörn

2012-01-01

Streptomyces davawensis JCM 4913 synthesizes the antibiotic roseoflavin, a structural riboflavin (vitamin B2) analog. Here, we report the 9,466,619-bp linear chromosome of S. davawensis JCM 4913 and a 89,331-bp linear plasmid. The sequence has an average G+C content of 70.58% and contains six rRNA operons (16S-23S-5S) and 69 tRNA genes. The 8,616 predicted protein-coding sequences include 32 clusters coding for secondary metabolites, several of which are unique to S. davawensis. The chromosome contains long terminal inverted repeats of 33,255 bp each and atypical telomeres. Sequence analysis with regard to riboflavin biosynthesis revealed three different patterns of gene organization in Streptomyces species. Heterologous expression of a set of genes present on a subgenomic fragment of S. davawensis resulted in the production of roseoflavin by the host Streptomyces coelicolor M1152. Phylogenetic analysis revealed that S. davawensis is a close relative of Streptomyces cinnabarinus, and much to our surprise, we found that the latter bacterium is a roseoflavin producer as well. PMID:23043000

Isolation, sequence, and characterization of the Cercospora nicotianae phytoene dehydrogenase gene.

PubMed Central

Ehrenshaft, M; Daub, M E

1994-01-01

We have cloned and sequenced the Cercospora nicotianae gene for the carotenoid biosynthetic enzyme phytoene dehydrogenase. Analysis of the derived amino acid sequence revealed it has greater than 50% identity with its counterpart in Neurospora crassa and approximately 30% identity with prokaryotic phytoene dehydrogenases and is related, but more distantly, to phytoene dehydrogenases from plants and cyanobacteria. Our analysis confirms that phytoene dehydrogenase proteins fall into two groups: those from plants and cyanobacteria and those from eukaryotic and noncyanobacter prokaryotic microbes. Southern analysis indicated that the C. nicotianae phytoene dehydrogenase gene is present in a single copy. Extraction of beta-carotene, the sole carotenoid accumulated by C. nicotianae, showed that both light- and dark-grown cultures synthesize carotenoids, but higher levels accumulate in the light. Northern (RNA) analysis of poly(A)+ RNA, however, showed no differential accumulation of phytoene dehydrogenase mRNA between light- and dark-grown fungal cultures. Images PMID:8085820

Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

PubMed

Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

2007-01-01

In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

PubMed

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

RNA-Seq analyses reveal the order of tRNA processing events and the maturation of C/D box and CRISPR RNAs in the hyperthermophile Methanopyrus kandleri

PubMed Central

Su, Andreas A. H.; Tripp, Vanessa; Randau, Lennart

2013-01-01

The methanogenic archaeon Methanopyrus kandleri grows near the upper temperature limit for life. Genome analyses revealed strategies to adapt to these harsh conditions and elucidated a unique transfer RNA (tRNA) C-to-U editing mechanism at base 8 for 30 different tRNA species. Here, RNA-Seq deep sequencing methodology was combined with computational analyses to characterize the small RNome of this hyperthermophilic organism and to obtain insights into the RNA metabolism at extreme temperatures. A large number of 132 small RNAs were identified that guide RNA modifications, which are expected to stabilize structured RNA molecules. The C/D box guide RNAs were shown to exist as circular RNA molecules. In addition, clustered regularly interspaced short palindromic repeats RNA processing and potential regulatory RNAs were identified. Finally, the identification of tRNA precursors before and after the unique C8-to-U8 editing activity enabled the determination of the order of tRNA processing events with termini truncation preceding intron removal. This order of tRNA maturation follows the compartmentalized tRNA processing order found in Eukaryotes and suggests its conservation during evolution. PMID:23620296

RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug

PubMed Central

2012-01-01

Background Bed bugs (Cimex lectularius) are hematophagous nocturnal parasites of humans that have attained high impact status due to their worldwide resurgence. The sudden and rampant resurgence of C. lectularius has been attributed to numerous factors including frequent international travel, narrower pest management practices, and insecticide resistance. Results We performed a next-generation RNA sequencing (RNA-Seq) experiment to find differentially expressed genes between pesticide-resistant (PR) and pesticide-susceptible (PS) strains of C. lectularius. A reference transcriptome database of 51,492 expressed sequence tags (ESTs) was created by combining the databases derived from de novo assembled mRNA-Seq tags (30,404 ESTs) and our previous 454 pyrosequenced database (21,088 ESTs). The two-way GLMseq analysis revealed ~15,000 highly significant differentially expressed ESTs between the PR and PS strains. Among the top 5,000 differentially expressed ESTs, 109 putative defense genes (cuticular proteins, cytochrome P450s, antioxidant genes, ABC transporters, glutathione S-transferases, carboxylesterases and acetyl cholinesterase) involved in penetration resistance and metabolic resistance were identified. Tissue and development-specific expression of P450 CYP3 clan members showed high mRNA levels in the cuticle, Malpighian tubules, and midgut; and in early instar nymphs, respectively. Lastly, molecular modeling and docking of a candidate cytochrome P450 (CYP397A1V2) revealed the flexibility of the deduced protein to metabolize a broad range of insecticide substrates including DDT, deltamethrin, permethrin, and imidacloprid. Conclusions We developed significant molecular resources for C. lectularius putatively involved in metabolic resistance as well as those participating in other modes of insecticide resistance. RNA-Seq profiles of PR strains combined with tissue-specific profiles and molecular docking revealed multi-level insecticide resistance in C. lectularius. Future research that is targeted towards RNA interference (RNAi) on the identified metabolic targets such as cytochrome P450s and cuticular proteins could lay the foundation for a better understanding of the genetic basis of insecticide resistance in C. lectularius. PMID:22226239

Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

PubMed

Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

2017-09-01

Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

The partial sequence of RNA 1 of the ophiovirus Ranunculus white mottle virus indicates its relationship to rhabdoviruses and provides candidate primers for an ophiovirus-specific RT-PCR test.

PubMed

Vaira, A M; Accotto, G P; Costantini, A; Milne, R G

2003-06-01

A 4018 nucleotide sequence was obtained for RNA 1 of Ranunculus white mottle virus (RWMV), genus Ophiovirus, representing an incomplete ORF of 1339 aa. Amino acid sequence analysis revealed significant similarities with RNA polymerases of viruses in the family Rhabdoviridae and a conserved domain of 685 aa, corresponding to the RdRp domain of those in the order Mononegavirales. Phylogenetic analysis indicated that the genus Ophiovirus is not related to the genus Tenuivirus or the family Bunyaviridae, with which it has been linked, and probably deserves a special taxonomic position, within a new family. A pair of degenerate primers was designed from a consensus sequence obtained from a relatively conserved region in the RNA 1 of two members of the genus, Citrus psorosis virus (CPsV) and RWMV. The primers, used in RT-PCR experiments, amplified a 136 bp DNA fragment from all the three recognized members of the genus, i.e. CPsV, RWMV and Tulip mild mottle mosaic virus (TMMMV) and from two tentative ophioviruses from lettuce and freesia. The amplified DNAs were sequenced and compared with the corresponding sequences of CPsV and RWMV and phylogenetic relationships were evaluated. Assays using extracts from plants infected by viruses belonging to the genera Tospovirus, Tenuivirus, Rhabdovirus and Varicosavirus indicated that the primers are genus-specific.

Evolution of proteins.

NASA Technical Reports Server (NTRS)

Dayhoff, M. O.

1971-01-01

The amino acid sequences of proteins from living organisms are dealt with. The structure of proteins is first discussed; the variation in this structure from one biological group to another is illustrated by the first halves of the sequences of cytochrome c, and a phylogenetic tree is derived from the cytochrome c data. The relative geological times associated with the events of this tree are discussed. Errors which occur in the duplication of cells during the evolutionary process are examined. Particular attention is given to evolution of mutant proteins, globins, ferredoxin, and transfer ribonucleic acids (tRNA's). Finally, a general outline of biological evolution is presented.

Template-Based Modeling of Protein-RNA Interactions.

PubMed

Zheng, Jinfang; Kundrotas, Petras J; Vakser, Ilya A; Liu, Shiyong

2016-09-01

Protein-RNA complexes formed by specific recognition between RNA and RNA-binding proteins play an important role in biological processes. More than a thousand of such proteins in human are curated and many novel RNA-binding proteins are to be discovered. Due to limitations of experimental approaches, computational techniques are needed for characterization of protein-RNA interactions. Although much progress has been made, adequate methodologies reliably providing atomic resolution structural details are still lacking. Although protein-RNA free docking approaches proved to be useful, in general, the template-based approaches provide higher quality of predictions. Templates are key to building a high quality model. Sequence/structure relationships were studied based on a representative set of binary protein-RNA complexes from PDB. Several approaches were tested for pairwise target/template alignment. The analysis revealed a transition point between random and correct binding modes. The results showed that structural alignment is better than sequence alignment in identifying good templates, suitable for generating protein-RNA complexes close to the native structure, and outperforms free docking, successfully predicting complexes where the free docking fails, including cases of significant conformational change upon binding. A template-based protein-RNA interaction modeling protocol PRIME was developed and benchmarked on a representative set of complexes.

A novel RNA species from the turtle mitochondrial genome: induction and regulation of transcription and processing under anoxic and freezing stresses.

PubMed

Cai, Q; Storey, K B

1997-08-01

The present study identifies a previously cloned cDNA, pBTaR914, as homologous to the mitochondrial WANCY (tryptophan, alanine, asparagine, cysteine, and tyrosine) tRNA gene cluster. This cDNA clone has a 304-bp sequence and its homologue, pBTaR09, has a 158-bp sequence with a long poly(A)+ tail (more than 60 adenosines). RNA blotting analysis using pBTaR914 probe against the total RNA from the tissues of adult and hatchling turtles revealed five bands: 540, 1800, 2200, 3200, and 3900 nucleotides (nt). The 540-nt transcript is considered to be an intact mtRNA unit from a novel mtDNA gene designated WANCYHP that overlaps the WANCY tRNA gene cluster region. This transcript was highly induced by both anoxic and freezing stresses in turtle heart. The other transcripts are considered to be the processed intermediates of mtRNA transcripts with WANCYHP sequence. All these transcripts were differentially regulated by anoxia and freezing in different organs. The data suggest that mtRNA processing is sensitive to regulation by external stresses, oxygen deprivation, and freezing. Furthermore, the fact that the WANCYHP transcript is highly induced during anoxic exposure suggests that it may play an important role in the regulation of mitochondrial activities to coordinate the physiological adaptation to anoxia.

Systematics of Cladophora spp. (Chlorophyta) from North Carolina, USA, based upon morphology and DNA sequence data with a description of Cladophora subtilissima sp. nov.

PubMed

Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson

2017-06-01

Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.

C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.

PubMed

Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L

2018-02-01

Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.

Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

PubMed

Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

2017-06-01

Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

NASA Technical Reports Server (NTRS)

Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

1992-01-01

Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing.

PubMed

Jäger, Marten; Ott, Claus-Eric; Grünhagen, Johannes; Hecht, Jochen; Schell, Hanna; Mundlos, Stefan; Duda, Georg N; Robinson, Peter N; Lienau, Jasmin

2011-03-24

The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism.

Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing

PubMed Central

2011-01-01

Background The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Results Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Conclusions Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism. PMID:21435219

Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export

PubMed Central

Zhao, Yang; Alla, Ravi

2017-01-01

Abstract Short interspersed nuclear elements (SINEs) are retrotransposons evolutionarily derived from endogenous RNA Polymerase III RNAs. Though SINE elements have undergone exaptation into gene regulatory elements, how transcribed SINE RNA impacts transcriptional and post-transcriptional regulation is largely unknown. This is partly due to a lack of information regarding which of the loci have transcriptional potential. Here, we present an approach (short interspersed nuclear element sequencing, SINE-seq), which selectively profiles RNA Polymerase III-derived SINE RNA, thereby identifying transcriptionally active SINE loci. Applying SINE-seq to monitor murine B2 SINE expression during a gammaherpesvirus infection revealed transcription from 28 270 SINE loci, with ∼50% of active SINE elements residing within annotated RNA Polymerase II loci. Furthermore, B2 RNA can form intermolecular RNA–RNA interactions with complementary mRNAs, leading to nuclear retention of the targeted mRNA via a mechanism involving p54nrb. These findings illuminate a pathway for the selective regulation of mRNA export during stress via retrotransposon activation. PMID:28334904

Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.

PubMed

Sanitá Lima, Matheus; Smith, David Roy

2017-11-06

Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.

Discovery of precursor and mature microRNAs and their putative gene targets using high-throughput sequencing in pineapple (Ananas comosus var. comosus).

PubMed

Yusuf, Noor Hydayaty Md; Ong, Wen Dee; Redwan, Raimi Mohamed; Latip, Mariam Abd; Kumar, S Vijay

2015-10-15

MicroRNAs (miRNAs) are a class of small, endogenous non-coding RNAs that negatively regulate gene expression, resulting in the silencing of target mRNA transcripts through mRNA cleavage or translational inhibition. MiRNAs play significant roles in various biological and physiological processes in plants. However, the miRNA-mediated gene regulatory network in pineapple, the model tropical non-climacteric fruit, remains largely unexplored. Here, we report a complete list of pineapple mature miRNAs obtained from high-throughput small RNA sequencing and precursor miRNAs (pre-miRNAs) obtained from ESTs. Two small RNA libraries were constructed from pineapple fruits and leaves, respectively, using Illumina's Solexa technology. Sequence similarity analysis using miRBase revealed 579,179 reads homologous to 153 miRNAs from 41 miRNA families. In addition, a pineapple fruit transcriptome library consisting of approximately 30,000 EST contigs constructed using Solexa sequencing was used for the discovery of pre-miRNAs. In all, four pre-miRNAs were identified (MIR156, MIR399, MIR444 and MIR2673). Furthermore, the same pineapple transcriptome was used to dissect the function of the miRNAs in pineapple by predicting their putative targets in conjunction with their regulatory networks. In total, 23 metabolic pathways were found to be regulated by miRNAs in pineapple. The use of high-throughput sequencing in pineapples to unveil the presence of miRNAs and their regulatory pathways provides insight into the repertoire of miRNA regulation used exclusively in this non-climacteric model plant. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of novel microRNAs in Hevea brasiliensis and computational prediction of their targets

PubMed Central

2012-01-01

Background Plants respond to external stimuli through fine regulation of gene expression partially ensured by small RNAs. Of these, microRNAs (miRNAs) play a crucial role. They negatively regulate gene expression by targeting the cleavage or translational inhibition of target messenger RNAs (mRNAs). In Hevea brasiliensis, environmental and harvesting stresses are known to affect natural rubber production. This study set out to identify abiotic stress-related miRNAs in Hevea using next-generation sequencing and bioinformatic analysis. Results Deep sequencing of small RNAs was carried out on plantlets subjected to severe abiotic stress using the Solexa technique. By combining the LeARN pipeline, data from the Plant microRNA database (PMRD) and Hevea EST sequences, we identified 48 conserved miRNA families already characterized in other plant species, and 10 putatively novel miRNA families. The results showed the most abundant size for miRNAs to be 24 nucleotides, except for seven families. Several MIR genes produced both 20-22 nucleotides and 23-27 nucleotides. The two miRNA class sizes were detected for both conserved and putative novel miRNA families, suggesting their functional duality. The EST databases were scanned with conserved and novel miRNA sequences. MiRNA targets were computationally predicted and analysed. The predicted targets involved in "responses to stimuli" and to "antioxidant" and "transcription activities" are presented. Conclusions Deep sequencing of small RNAs combined with transcriptomic data is a powerful tool for identifying conserved and novel miRNAs when the complete genome is not yet available. Our study provided additional information for evolutionary studies and revealed potentially specific regulation of the control of redox status in Hevea. PMID:22330773

U6 small nuclear RNA is transcribed by RNA polymerase III.

PubMed Central

Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

1986-01-01

A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

The bifurcated stem loop 4 (SL4) is crucial for efficient packaging of mouse mammary tumor virus (MMTV) genomic RNA.

PubMed

Mustafa, Farah; Vivet-Boudou, Valérie; Jabeen, Ayesha; Ali, Lizna M; Kalloush, Rawan M; Marquet, Roland; Rizvi, Tahir A

2018-06-21

Packaging the mouse mammary tumor virus (MMTV) genomic RNA (gRNA) requires the entire 5' untranslated region (UTR) in conjunction with the first 120 nucleotides of the gag gene. This region includes several palindromic (pal) sequence(s) and stable stem loops (SLs). Among these, stem loop 4 (SL4) adopts a bifurcated structure consisting of three stems, two apical loops, and an internal loop. Pal II, located in one of the apical loops, mediates gRNA dimerization, a process intricately linked to packaging. We thus hypothesized that the bifurcated SL4 structure could constitute the major gRNA packaging determinant. To test this hypothesis, the two apical loops and the flanking sequences forming the bifurcated SL4 were individually mutated. These mutations all had deleterious effects on gRNA packaging and propagation. Next, single and compensatory mutants were designed to destabilize then recreate the bifurcated SL4 structure. A structure-function analysis using bioinformatics predictions and RNA chemical probing revealed that mutations that led to the loss of the SL4 bifurcated structure abrogated RNA packaging and propagation, while compensatory mutations that recreated the native SL4 structure restored RNA packaging and propagation to wild type levels. Altogether, our results demonstrate that SL4 constitutes the principal packaging determinant of MMTV gRNA. Our findings further suggest that SL4 acts as a structural switch that can not only differentiate between RNA for translation versus packaging/dimerization, but its location also allows differentiation between spliced and unspliced RNAs during gRNA encapsidation.

GC-Content Normalization for RNA-Seq Data

PubMed Central

2011-01-01

Background Transcriptome sequencing (RNA-Seq) has become the assay of choice for high-throughput studies of gene expression. However, as is the case with microarrays, major technology-related artifacts and biases affect the resulting expression measures. Normalization is therefore essential to ensure accurate inference of expression levels and subsequent analyses thereof. Results We focus on biases related to GC-content and demonstrate the existence of strong sample-specific GC-content effects on RNA-Seq read counts, which can substantially bias differential expression analysis. We propose three simple within-lane gene-level GC-content normalization approaches and assess their performance on two different RNA-Seq datasets, involving different species and experimental designs. Our methods are compared to state-of-the-art normalization procedures in terms of bias and mean squared error for expression fold-change estimation and in terms of Type I error and p-value distributions for tests of differential expression. The exploratory data analysis and normalization methods proposed in this article are implemented in the open-source Bioconductor R package EDASeq. Conclusions Our within-lane normalization procedures, followed by between-lane normalization, reduce GC-content bias and lead to more accurate estimates of expression fold-changes and tests of differential expression. Such results are crucial for the biological interpretation of RNA-Seq experiments, where downstream analyses can be sensitive to the supplied lists of genes. PMID:22177264

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

Protein synthesis editing by a DNA aptamer.

PubMed Central

Hale, S P; Schimmel, P

1996-01-01

Potential errors in decoding genetic information are corrected by tRNA-dependent amino acid recognition processes manifested through editing reactions. One example is the rejection of difficult-to-discriminate misactivated amino acids by tRNA synthetases through hydrolytic reactions. Although several crystal structures of tRNA synthetases and synthetase-tRNA complexes exist, none of them have provided insight into the editing reactions. Other work suggested that editing required active amino acid acceptor hydroxyl groups at the 3' end of a tRNA effector. We describe here the isolation of a DNA aptamer that specifically induced hydrolysis of a misactivated amino acid bound to a tRNA synthetase. The aptamer had no effect on the stability of the correctly activated amino acid and was almost as efficient as the tRNA for inducing editing activity. The aptamer has no sequence similarity to that of the tRNA effector and cannot be folded into a tRNA-like structure. These and additional data show that active acceptor hydroxyl groups in a tRNA effector and a tRNA-like structure are not essential for editing. Thus, specific bases in a nucleic acid effector trigger the editing response. Images Fig. 3 Fig. 4 PMID:8610114

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

PubMed

Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas

2016-08-01

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.

Potential functions of microRNAs in starch metabolism and development revealed by miRNA transcriptome profiling of cassava cultivars and their wild progenitor.

PubMed

Chen, Xin; Xia, Jing; Xia, Zhiqiang; Zhang, Hefang; Zeng, Changying; Lu, Cheng; Zhang, Weixiong; Wang, Wenquan

2015-02-04

MicroRNAs (miRNAs) are small (approximately 21 nucleotide) non-coding RNAs that are key post-transcriptional gene regulators in eukaryotic organisms. More than 100 cassava miRNAs have been identified in a conservation analysis and a repertoire of cassava miRNAs have also been characterised by next-generation sequencing (NGS) in recent studies. Here, using NGS, we profiled small non-coding RNAs and mRNA genes in two cassava cultivars and their wild progenitor to identify and characterise miRNAs that are potentially involved in plant growth and starch biosynthesis. Six small RNA and six mRNA libraries from leaves and roots of the two cultivars, KU50 and Arg7, and their wild progenitor, W14, were subjected to NGS. Analysis of the sequencing data revealed 29 conserved miRNA families and 33 new miRNA families. Together, these miRNAs potentially targeted a total of 360 putative target genes. Whereas 16 miRNA families were highly expressed in cultivar leaves, another 13 miRNA families were highly expressed in storage roots of cultivars. Co-expression analysis revealed that the expression level of some targets had negative relationship with their corresponding miRNAs in storage roots and leaves; these targets included MYB33, ARF10, GRF1, RD19, APL2, NF-YA3 and SPL2, which are known to be involved in plant development, starch biosynthesis and response to environmental stimuli. The identified miRNAs, target mRNAs and target gene ontology annotation all shed light on the possible functions of miRNAs in Manihot species. The differential expression of miRNAs between cultivars and their wild progenitor, together with our analysis of GO annotation and confirmation of miRNA: target pairs, might provide insight into know the differences between wild progenitor and cultivated cassava.

Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon

PubMed Central

2013-01-01

Background The wild grass Brachypodium distachyon has emerged as a model system for temperate grasses and biofuel plants. However, the global analysis of miRNAs, molecules known to be key for eukaryotic gene regulation, has been limited in B. distachyon to studies examining a few samples or that rely on computational predictions. Similarly an in-depth global analysis of miRNA-mediated target cleavage using parallel analysis of RNA ends (PARE) data is lacking in B. distachyon. Results B. distachyon small RNAs were cloned and deeply sequenced from 17 libraries that represent different tissues and stresses. Using a computational pipeline, we identified 116 miRNAs including not only conserved miRNAs that have not been reported in B. distachyon, but also non-conserved miRNAs that were not found in other plants. To investigate miRNA-mediated cleavage function, four PARE libraries were constructed from key tissues and sequenced to a total depth of approximately 70 million sequences. The roughly 5 million distinct genome-matched sequences that resulted represent an extensive dataset for analyzing small RNA-guided cleavage events. Analysis of the PARE and miRNA data provided experimental evidence for miRNA-mediated cleavage of 264 sites in predicted miRNA targets. In addition, PARE analysis revealed that differentially expressed miRNAs in the same family guide specific target RNA cleavage in a correspondingly tissue-preferential manner. Conclusions B. distachyon miRNAs and target RNAs were experimentally identified and analyzed. Knowledge gained from this study should provide insights into the roles of miRNAs and the regulation of their targets in B. distachyon and related plants. PMID:24367943

Detection and phylogenetic analysis of hepatitis E viruses from mongooses in Okinawa, Japan.

PubMed

Nidaira, Minoru; Takahashi, Kazuaki; Ogura, Go; Taira, Katsuya; Okano, Shou; Kudaka, Jun; Itokazu, Kiyomasa; Mishiro, Shunji; Nakamura, Masaji

2012-12-01

Hepatitis E virus (HEV) infection has previously been reported in wild mongooses on Okinawa Island; to date however, only one HEV RNA sequence has been identified in a mongoose. Hence, this study was performed to detect HEV RNA in 209 wild mongooses on Okinawa Island. Six (2.9%) samples tested positive for HEV RNA. Phylogenetic analysis revealed that 6 HEV RNAs belonged to genotype 3 and were classified into groups A and B. In group B, mongoose-derived HEV sequences were very similar to mongoose HEV previously detected on Okinawa Island, as well as to those of a pig. This investigation emphasized the possibility that the mongoose is a reservoir animal for HEV on Okinawa Island.

Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

PubMed

McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

2013-06-01

To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

Blackcurrant Leaf Chlorosis Associated Virus: Evidence of the Presence of Circular RNA during Infections.

PubMed

James, Delano; Phelan, James; Sanderson, Daniel

2018-05-15

Blackcurrant leaf chlorosis associated virus (BCLCaV) was detected recently by next-generation sequencing (NGS) and a new and distinct species in the genus Idaeovirus was proposed. Analysis of NGS-derived paired-end reads revealed the existence of bridge reads encompassing the 3'-terminus and 5'-terminus of RNA-2 or RNA-3 of BCLCaV. The full RNA-2 or RNA-3 could be amplified using outward facing or abutting primers; also, RNA-2/RNA-3 could be detected even after three consecutive RNase R enzyme treatments, with denaturation at 95 °C preceding each digestion. Evidence was obtained indicating that there are circular forms of BCLCaV RNA-2 and RNA-3.

QUANTIFYING ALTERNATIVE SPLICING FROM PAIRED-END RNA-SEQUENCING DATA.

PubMed

Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond

2014-03-01

RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely limited, as they ignore a substantial amount of valuable information. Current data analysis methods are based on such summaries and are hence sub-optimal. Further, they have limited flexibility in accounting for technical biases. We propose novel data summaries and a Bayesian modeling framework that overcome these limitations and determine biases in a non-parametric, highly flexible manner. These summaries adapt naturally to the rapid improvements in sequencing technology. We provide efficient point estimates and uncertainty assessments. The approach allows to study alternative splicing patterns for individual samples and can also be the basis for downstream analyses. We found a several fold improvement in estimation mean square error compared popular approaches in simulations, and substantially higher consistency between replicates in experimental data. Our findings indicate the need for adjusting the routine summarization and analysis of alternative splicing RNA-seq studies. We provide a software implementation in the R package casper.

Randomization and In Vivo Selection Reveal a GGRG Motif Essential for Packaging Human Immunodeficiency Virus Type 2 RNA ▿ †

PubMed Central

Baig, Tayyba T.; Lanchy, Jean-Marc; Lodmell, J. Stephen

2009-01-01

The packaging signal (ψ) of human immunodeficiency virus type 2 (HIV-2) is present in the 5′ noncoding region of RNA and contains a 10-nucleotide palindrome (pal; 5′-392-GGAGUGCUCC) located upstream of the dimerization signal stem-loop 1 (SL1). pal has been shown to be functionally important in vitro and in vivo. We previously showed that the 3′ side of pal (GCUCC-3′) is involved in base-pairing interactions with a sequence downstream of SL1 to make an extended SL1, which is important for replication in vivo and the regulation of dimerization in vitro. However, the role of the 5′ side of pal (5′-GGAGU) was less clear. Here, we characterized this role using an in vivo SELEX approach. We produced a population of HIV-2 DNA genomes with random sequences within the 5′ side of pal and transfected these into COS-7 cells. Viruses from COS-7 cells were used to infect C8166 permissive cells. After several weeks of serial passage in C8166 cells, surviving viruses were sequenced. On the 5′ side of pal there was a striking convergence toward a GGRGN consensus sequence. Individual clones with consensus and nonconsensus sequences were tested in infectivity and packaging assays. Analysis of individuals that diverged from the consensus sequence showed normal viral RNA and protein synthesis but had replication defects and impaired RNA packaging. These findings clearly indicate that the GGRG motif is essential for viral replication and genomic RNA packaging. PMID:18971263

dropEst: pipeline for accurate estimation of molecular counts in droplet-based single-cell RNA-seq experiments.

PubMed

Petukhov, Viktor; Guo, Jimin; Baryawno, Ninib; Severe, Nicolas; Scadden, David T; Samsonova, Maria G; Kharchenko, Peter V

2018-06-19

Recent single-cell RNA-seq protocols based on droplet microfluidics use massively multiplexed barcoding to enable simultaneous measurements of transcriptomes for thousands of individual cells. The increasing complexity of such data creates challenges for subsequent computational processing and troubleshooting of these experiments, with few software options currently available. Here, we describe a flexible pipeline for processing droplet-based transcriptome data that implements barcode corrections, classification of cell quality, and diagnostic information about the droplet libraries. We introduce advanced methods for correcting composition bias and sequencing errors affecting cellular and molecular barcodes to provide more accurate estimates of molecular counts in individual cells.

Initial sequence characterization of the rhabdoviruses of squamate reptiles, including a novel rhabdovirus from a caiman lizard (Dracaena guianensis)

PubMed Central

Wellehan, James F.X.; Pessier, Allan P.; Archer, Linda L.; Childress, April L.; Jacobson, Elliott R.; Tesh, Robert B.

2012-01-01

Rhabdoviruses infect a variety of hosts, including non-avian reptiles. Consensus PCR techniques were used to obtain partial RNA-dependent RNA polymerase gene sequence from five rhabdoviruses of South American lizards; Marco, Chaco, Timbo, Sena Madureira, and a rhabdovirus from a caiman lizard (Dracaena guianensis). The caiman lizard rhabdovirus formed inclusions in erythrocytes, which may be a route for infecting hematophagous insects. This is the first information on behavior of a rhabdovirus in squamates. We also obtained sequence from two rhabdoviruses of Australian lizards, confirming previous Charleville virus sequence and finding that, unlike a previous sequence report but in agreement with serologic reports, Almpiwar virus is clearly distinct from Charleville virus. Bayesian and maximum likelihood phylogenetic analysis revealed that most known rhabdoviruses of squamates cluster in the Almpiwar subgroup. The exception is Marco virus, which is found in the Hart Park group. PMID:22397930

Mapping Hfq-RNA interaction surfaces using tryptophan fluorescence quenching

PubMed Central

Robinson, Kirsten E.; Orans, Jillian; Kovach, Alexander R.; Link, Todd M.; Brennan, Richard G.

2014-01-01

Hfq is a posttranscriptional riboregulator and RNA chaperone that binds small RNAs and target mRNAs to effect their annealing and message-specific regulation in response to environmental stressors. Structures of Hfq-RNA complexes indicate that U-rich sequences prefer the proximal face and A-rich sequences the distal face; however, the Hfq-binding sites of most RNAs are unknown. Here, we present an Hfq-RNA mapping approach that uses single tryptophan-substituted Hfq proteins, all of which retain the wild-type Hfq structure, and tryptophan fluorescence quenching (TFQ) by proximal RNA binding. TFQ properly identified the respective distal and proximal binding of A15 and U6 RNA to Gram-negative Escherichia coli (Ec) Hfq and the distal face binding of (AA)3A, (AU)3A and (AC)3A to Gram-positive Staphylococcus aureus (Sa) Hfq. The inability of (GU)3G to bind the distal face of Sa Hfq reveals the (R-L)n binding motif is a more restrictive (A-L)n binding motif. Remarkably Hfq from Gram-positive Listeria monocytogenes (Lm) binds (GU)3G on its proximal face. TFQ experiments also revealed the Ec Hfq (A-R-N)n distal face-binding motif should be redefined as an (A-A-N)n binding motif. TFQ data also demonstrated that the 5′-untranslated region of hfq mRNA binds both the proximal and distal faces of Ec Hfq and the unstructured C-terminus. PMID:24288369

Bioinformatic Analysis Reveals Archaeal tRNATyr and tRNATrp Identities in Bacteria

PubMed Central

Mukai, Takahito; Reynolds, Noah M.; Crnković, Ana; Söll, Dieter

2017-01-01

The tRNA identity elements for some amino acids are distinct between the bacterial and archaeal domains. Searching in recent genomic and metagenomic sequence data, we found some candidate phyla radiation (CPR) bacteria with archaeal tRNA identity for Tyr-tRNA and Trp-tRNA synthesis. These bacteria possess genes for tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase (TrpRS) predicted to be derived from DPANN superphylum archaea, while the cognate tRNATyr and tRNATrp genes reveal bacterial or archaeal origins. We identified a trace of domain fusion and swapping in the archaeal-type TyrRS gene of a bacterial lineage, suggesting that CPR bacteria may have used this mechanism to create diverse proteins. Archaeal-type TrpRS of bacteria and a few TrpRS species of DPANN archaea represent a new phylogenetic clade (named TrpRS-A). The TrpRS-A open reading frames (ORFs) are always associated with another ORF (named ORF1) encoding an unknown protein without global sequence identity to any known protein. However, our protein structure prediction identified a putative HIGH-motif and KMSKS-motif as well as many α-helices that are characteristic of class I aminoacyl-tRNA synthetase (aaRS) homologs. These results provide another example of the diversity of molecular components that implement the genetic code and provide a clue to the early evolution of life and the genetic code. PMID:28230768

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins

PubMed Central

Englert, Markus; Beier, Hildburg

2005-01-01

Pre-tRNA splicing is an essential process in all eukaryotes. It requires the concerted action of an endonuclease to remove the intron and a ligase for joining the resulting tRNA halves as studied best in the yeast Saccharomyces cerevisiae. Here, we report the first characterization of an RNA ligase protein and its gene from a higher eukaryotic organism that is an essential component of the pre-tRNA splicing process. Purification of tRNA ligase from wheat germ by successive column chromatographic steps has identified a protein of 125 kDa by its potentiality to covalently bind AMP, and by its ability to catalyse the ligation of tRNA halves and the circularization of linear introns. Peptide sequences obtained from the purified protein led to the elucidation of the corresponding proteins and their genes in Arabidopsis and Oryza databases. The plant tRNA ligases exhibit no overall sequence homologies to any known RNA ligases, however, they harbour a number of conserved motifs that indicate the presence of three intrinsic enzyme activities: an adenylyltransferase/ligase domain in the N-terminal region, a polynucleotide kinase in the centre and a cyclic phosphodiesterase domain at the C-terminal end. In vitro expression of the recombinant Arabidopsis tRNA ligase and functional analyses revealed all expected individual activities. Plant RNA ligases are active on a variety of substrates in vitro and are capable of inter- and intramolecular RNA joining. Hence, we conclude that their role in vivo might comprise yet unknown essential functions besides their involvement in pre-tRNA splicing. PMID:15653639

Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

PubMed

Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

2018-01-01

Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

miR-328 Functions as an RNA Decoy to Modulate hnRNP E2 Regulation of mRNA Translation in Leukemic Blasts

PubMed Central

Eiring, Anna M.; Harb, Jason G.; Neviani, Paolo; Garton, Christopher; Oaks, Joshua J.; Spizzo, Riccardo; Liu, Shujun; Schwind, Sebastian; Santhanam, Ramasamy; Hickey, Christopher J.; Becker, Heiko; Chandler, Jason C.; Andino, Raul; Cortes, Jorge; Hokland, Peter; Huettner, Claudia S.; Bhatia, Ravi; Roy, Denis C.; Liebhaber, Stephen A.; Caligiuri, Michael A.; Marcucci, Guido; Garzon, Ramiro; Croce, Carlo M.; Calin, George A.; Perrotti, Danilo

2010-01-01

SUMMARY MicroRNAs and heterogeneous ribonucleoproteins (hnRNPs) are posttranscriptional gene regulators that bind mRNA in a sequence-specific manner. Here, we report that loss of miR-328 occurs in blast crisis chronic myelogenous leukemia (CML-BC) in a BCR/ABL dose- and kinase-dependent manner through the MAPK-hnRNP E2 pathway. Restoration of miR-328 expression rescues differentiation and impairs survival of leukemic blasts by simultaneously interacting with the translational regulator poly(rC)-binding protein hnRNP E2 and with the mRNA encoding the survival factor PIM1, respectively. The interaction with hnRNP E2 is independent of the microRNA’s seed sequence and it leads to release of CEBPA mRNA from hnRNP E2-mediated translational inhibition. Altogether, these data reveal the dual ability of a microRNA to control cell fate both through base pairing with mRNA targets and through a decoy activity that interferes with the function of regulatory proteins. PMID:20211135

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

MuSE: accounting for tumor heterogeneity using a sample-specific error model improves sensitivity and specificity in mutation calling from sequencing data.

PubMed

Fan, Yu; Xi, Liu; Hughes, Daniel S T; Zhang, Jianjun; Zhang, Jianhua; Futreal, P Andrew; Wheeler, David A; Wang, Wenyi

2016-08-24

Subclonal mutations reveal important features of the genetic architecture of tumors. However, accurate detection of mutations in genetically heterogeneous tumor cell populations using next-generation sequencing remains challenging. We develop MuSE ( http://bioinformatics.mdanderson.org/main/MuSE ), Mutation calling using a Markov Substitution model for Evolution, a novel approach for modeling the evolution of the allelic composition of the tumor and normal tissue at each reference base. MuSE adopts a sample-specific error model that reflects the underlying tumor heterogeneity to greatly improve the overall accuracy. We demonstrate the accuracy of MuSE in calling subclonal mutations in the context of large-scale tumor sequencing projects using whole exome and whole genome sequencing.

Transcriptome profiling of microRNA by next-gen deep sequencing reveals known and novel miRNA species in the lipid fraction of human breast milk

USDA-ARS?s Scientific Manuscript database

While breast milk has unique health advantages for infants, the mechanisms by which it regulates the physiology of newborns are incompletely understood. miRNAs have been described as functioning transcellularly, and have been previously isolated in cell-free and exosomal form from bodily liquids (se...

Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq

PubMed Central

Shepard, Peter J.; Choi, Eun-A; Lu, Jente; Flanagan, Lisa A.; Hertel, Klemens J.; Shi, Yongsheng

2011-01-01

Alternative polyadenylation (APA) of mRNAs has emerged as an important mechanism for post-transcriptional gene regulation in higher eukaryotes. Although microarrays have recently been used to characterize APA globally, they have a number of serious limitations that prevents comprehensive and highly quantitative analysis. To better characterize APA and its regulation, we have developed a deep sequencing-based method called Poly(A) Site Sequencing (PAS-Seq) for quantitatively profiling RNA polyadenylation at the transcriptome level. PAS-Seq not only accurately and comprehensively identifies poly(A) junctions in mRNAs and noncoding RNAs, but also provides quantitative information on the relative abundance of polyadenylated RNAs. PAS-Seq analyses of human and mouse transcriptomes showed that 40%–50% of all expressed genes produce alternatively polyadenylated mRNAs. Furthermore, our study detected evolutionarily conserved polyadenylation of histone mRNAs and revealed novel features of mitochondrial RNA polyadenylation. Finally, PAS-Seq analyses of mouse embryonic stem (ES) cells, neural stem/progenitor (NSP) cells, and neurons not only identified more poly(A) sites than what was found in the entire mouse EST database, but also detected significant changes in the global APA profile that lead to lengthening of 3′ untranslated regions (UTR) in many mRNAs during stem cell differentiation. Together, our PAS-Seq analyses revealed a complex landscape of RNA polyadenylation in mammalian cells and the dynamic regulation of APA during stem cell differentiation. PMID:21343387

Occurrence and genetic diversity of the Plasmopara halstedii virus in sunflower downy mildew populations of the world.

PubMed

Grasse, Wolfgang; Spring, Otmar

2015-03-01

Plasmopara halstedii virus (PhV) is a ss(+)RNA virus that exclusively occurs in the sunflower downy mildew pathogen Plasmopara halstedii, a biotrophic oomycete of severe economic impact. The virus origin and its genomic variability are unknown. A PCR-based screening of 128 samples of P. halstedii from five continents and up to 40 y old was conducted. PhV RNA was found in over 90 % of the isolates with no correlation to geographic origin or pathotype of its host. Sequence analyses of the two open reading frames (ORFs) revealed only 18 single nucleotide polymorphisms (SNPs) in 3873 nucleotides. The SNPs had no recognizable effect on the two encoded virus proteins. In 398 nucleotides of the untranslated regions (UTRs) of the RNA 2 strand eight additional SNPs and one short deletion was found. Modelling experiments revealed no effects of these variations on the secondary structure of the RNA. The results showed the presence of PhV in P. halstedii isolates of global origin and the existence of the virus since more than 40 y. The virus genome revealed a surprisingly low variation in both coding and noncoding parts. No sequence differences were correlated with host pathotype or geographic populations of the oomycete. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Citrus psorosis virus RNA 1 is of negative polarity and potentially encodes in its complementary strand a 24K protein of unknown function and 280K putative RNA dependent RNA polymerase.

PubMed

Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura

2003-10-01

Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.

The Impact of Normalization Methods on RNA-Seq Data Analysis

PubMed Central

Zyprych-Walczak, J.; Szabelska, A.; Handschuh, L.; Górczak, K.; Klamecka, K.; Figlerowicz, M.; Siatkowski, I.

2015-01-01

High-throughput sequencing technologies, such as the Illumina Hi-seq, are powerful new tools for investigating a wide range of biological and medical problems. Massive and complex data sets produced by the sequencers create a need for development of statistical and computational methods that can tackle the analysis and management of data. The data normalization is one of the most crucial steps of data processing and this process must be carefully considered as it has a profound effect on the results of the analysis. In this work, we focus on a comprehensive comparison of five normalization methods related to sequencing depth, widely used for transcriptome sequencing (RNA-seq) data, and their impact on the results of gene expression analysis. Based on this study, we suggest a universal workflow that can be applied for the selection of the optimal normalization procedure for any particular data set. The described workflow includes calculation of the bias and variance values for the control genes, sensitivity and specificity of the methods, and classification errors as well as generation of the diagnostic plots. Combining the above information facilitates the selection of the most appropriate normalization method for the studied data sets and determines which methods can be used interchangeably. PMID:26176014

Global Maps of ProQ Binding In Vivo Reveal Target Recognition via RNA Structure and Stability Control at mRNA 3' Ends.

PubMed

Holmqvist, Erik; Li, Lei; Bischler, Thorsten; Barquist, Lars; Vogel, Jörg

2018-05-15

The conserved RNA-binding protein ProQ has emerged as the centerpiece of a previously unknown third large network of post-transcriptional control in enterobacteria. Here, we have used in vivo UV crosslinking and RNA sequencing (CLIP-seq) to map hundreds of ProQ binding sites in Salmonella enterica and Escherichia coli. Our analysis of these binding sites, many of which are conserved, suggests that ProQ recognizes its cellular targets through RNA structural motifs found in small RNAs (sRNAs) and at the 3' end of mRNAs. Using the cspE mRNA as a model for 3' end targeting, we reveal a function for ProQ in protecting mRNA against exoribonucleolytic activity. Taken together, our results underpin the notion that ProQ governs a post-transcriptional network distinct from those of the well-characterized sRNA-binding proteins, CsrA and Hfq, and suggest a previously unrecognized, sRNA-independent role of ProQ in stabilizing mRNAs. Copyright © 2018 Elsevier Inc. All rights reserved.

Short intronic repeat sequences facilitate circular RNA production.

PubMed

Liang, Dongming; Wilusz, Jeremy E

2014-10-15

Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery "backsplices" and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼ 30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3' end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. © 2014 Liang and Wilusz; Published by Cold Spring Harbor Laboratory Press.

Sequence features associated with the cleavage efficiency of CRISPR/Cas9 system.

PubMed

Liu, Xiaoxi; Homma, Ayaka; Sayadi, Jamasb; Yang, Shu; Ohashi, Jun; Takumi, Toru

2016-01-27

The CRISPR-Cas9 system has recently emerged as a versatile tool for biological and medical research. In this system, a single guide RNA (sgRNA) directs the endonuclease Cas9 to a targeted DNA sequence for site-specific manipulation. In addition to this targeting function, the sgRNA has also been shown to play a role in activating the endonuclease activity of Cas9. This dual function of the sgRNA likely underlies observations that different sgRNAs have varying on-target activities. Currently, our understanding of the relationship between sequence features of sgRNAs and their on-target cleavage efficiencies remains limited, largely due to difficulties in assessing the cleavage capacity of a large number of sgRNAs. In this study, we evaluated the cleavage activities of 218 sgRNAs using in vitro Surveyor assays. We found that nucleotides at both PAM-distal and PAM-proximal regions of the sgRNA are significantly correlated with on-target efficiency. Furthermore, we also demonstrated that the genomic context of the targeted DNA, the GC percentage, and the secondary structure of sgRNA are critical factors contributing to cleavage efficiency. In summary, our study reveals important parameters for the design of sgRNAs with high on-target efficiencies, especially in the context of high throughput applications.

Enzymatic synthesis of random sequences of RNA and RNA analogues by DNA polymerase theta mutants for the generation of aptamer libraries.

PubMed

Randrianjatovo-Gbalou, Irina; Rosario, Sandrine; Sismeiro, Odile; Varet, Hugo; Legendre, Rachel; Coppée, Jean-Yves; Huteau, Valérie; Pochet, Sylvie; Delarue, Marc

2018-05-21

Nucleic acid aptamers, especially RNA, exhibit valuable advantages compared to protein therapeutics in terms of size, affinity and specificity. However, the synthesis of libraries of large random RNAs is still difficult and expensive. The engineering of polymerases able to directly generate these libraries has the potential to replace the chemical synthesis approach. Here, we start with a DNA polymerase that already displays a significant template-free nucleotidyltransferase activity, human DNA polymerase theta, and we mutate it based on the knowledge of its three-dimensional structure as well as previous mutational studies on members of the same polA family. One mutant exhibited a high tolerance towards ribonucleotides (NTPs) and displayed an efficient ribonucleotidyltransferase activity that resulted in the assembly of long RNA polymers. HPLC analysis and RNA sequencing of the products were used to quantify the incorporation of the four NTPs as a function of initial NTP concentrations and established the randomness of each generated nucleic acid sequence. The same mutant revealed a propensity to accept other modified nucleotides and to extend them in long fragments. Hence, this mutant can deliver random natural and modified RNA polymers libraries ready to use for SELEX, with custom lengths and balanced or unbalanced ratios.

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

PubMed Central

Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

2015-01-01

Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

Comparative Analysis of Fruit Ripening-Related miRNAs and Their Targets in Blueberry Using Small RNA and Degradome Sequencing

PubMed Central

Hou, Yanming; Zhai, Lulu; Li, Xuyan; Xue, Yu; Wang, Jingjing; Yang, Pengjie; Cao, Chunmei; Li, Hongxue; Cui, Yuhai; Bian, Shaomin

2017-01-01

MicroRNAs (miRNAs) play vital roles in the regulation of fruit development and ripening. Blueberry is an important small berry fruit crop with economical and nutritional value. However, nothing is known about the miRNAs and their targets involved in blueberry fruit ripening. In this study, using high-throughput sequencing of small RNAs, 84 known miRNAs belonging to 28 families and 16 novel miRNAs were identified in white fruit (WF) and blue fruit (BF) libraries, which represent fruit ripening onset and in progress, respectively. Among them, 41 miRNAs were shown to be differentially expressed during fruit maturation, and 16 miRNAs representing 16 families were further chosen to validate the sRNA sequencing data by stem-loop qRT-PCR. Meanwhile, 178 targets were identified for 41 known and 7 novel miRNAs in WF and BF libraries using degradome sequencing, and targets of miR160 were validated using RLM-RACE (RNA Ligase-Mediated (RLM)-Rapid Amplification of cDNA Ends) approach. Moreover, the expression patterns of 6 miRNAs and their targets were examined during fruit development and ripening. Finally, integrative analysis of miRNAs and their targets revealed a complex miRNA-mRNA regulatory network involving a wide variety of biological processes. The findings will facilitate future investigations of the miRNA-mediated mechanisms that regulate fruit development and ripening in blueberry. PMID:29257112

Deep sequencing analysis of viral infection and evolution allows rapid and detailed characterization of viral mutant spectrum.

PubMed

Isakov, Ofer; Bordería, Antonio V; Golan, David; Hamenahem, Amir; Celniker, Gershon; Yoffe, Liron; Blanc, Hervé; Vignuzzi, Marco; Shomron, Noam

2015-07-01

The study of RNA virus populations is a challenging task. Each population of RNA virus is composed of a collection of different, yet related genomes often referred to as mutant spectra or quasispecies. Virologists using deep sequencing technologies face major obstacles when studying virus population dynamics, both experimentally and in natural settings due to the relatively high error rates of these technologies and the lack of high performance pipelines. In order to overcome these hurdles we developed a computational pipeline, termed ViVan (Viral Variance Analysis). ViVan is a complete pipeline facilitating the identification, characterization and comparison of sequence variance in deep sequenced virus populations. Applying ViVan on deep sequenced data obtained from samples that were previously characterized by more classical approaches, we uncovered novel and potentially crucial aspects of virus populations. With our experimental work, we illustrate how ViVan can be used for studies ranging from the more practical, detection of resistant mutations and effects of antiviral treatments, to the more theoretical temporal characterization of the population in evolutionary studies. Freely available on the web at http://www.vivanbioinfo.org : nshomron@post.tau.ac.il Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

Three RNA recognition motifs participate in RNA recognition and structural organization by the pro-apoptotic factor TIA-1

PubMed Central

Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.

2012-01-01

T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808

Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand.

PubMed

Yuan, Ji; Cheung, Paul K M; Zhang, Huifang M; Chau, David; Yang, Decheng

2005-02-01

Coxsackievirus B3 (CVB3) is the most common causal agent of viral myocarditis, but existing drug therapies are of limited value. Application of small interfering RNA (siRNA) in knockdown of gene expression is an emerging technology in antiviral gene therapy. To investigate whether RNA interference (RNAi) can protect against CVB3 infection, we evaluated the effects of RNAi on viral replication in HeLa cells and murine cardiomyocytes by using five CVB3-specific siRNAs targeting distinct regions of the viral genome. The most effective one is siRNA-4, targeting the viral protease 2A, achieving a 92% inhibition of CVB3 replication. The specific RNAi effects could last at least 48 h, and cell viability assay revealed that 90% of siRNA-4-pretreated cells were still alive and lacked detectable viral protein expression 48 h postinfection. Moreover, administration of siRNAs after viral infection could also effectively inhibit viral replication, indicating its therapeutic potential. Further evaluation by combination found that no enhanced inhibitory effects were observed when siRNA-4 was cotransfected with each of the other four candidates. In mutational analysis of the mechanisms of siRNA action, we found that siRNA functions by targeting the positive strand of virus and requires a perfect sequence match in the central region of the target, but mismatches were more tolerated near the 3' end than the 5' end of the antisense strand. These findings reveal an effective target for CVB3 silencing and provide a new possibility for antiviral intervention.

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

PubMed

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

PubMed Central

Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

2011-01-01

microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

De novo generation of helper virus-satellite chimera RNAs results in disease attenuation and satellite sequence acquisition in a host-dependent manner.

PubMed

Pyle, J D; Scholthof, Karen-Beth G

2018-01-15

Panicum mosaic virus (PMV) is a helper RNA virus for satellite RNAs (satRNAs) and a satellite virus (SPMV). Here, we describe modifications that occur at the 3'-end of a satRNA of PMV, satS. Co-infections of PMV+satS result in attenuation of the disease symptoms induced by PMV alone in Brachypodium distachyon and proso millet. The 375 nt satS acquires ~100-200 nts from the 3'-end of PMV during infection and is associated with decreased abundance of the PMV RNA and capsid protein in millet. PMV-satS chimera RNAs were isolated from native infections of St. Augustinegrass and switchgrass. Phylogenetic analyses revealed that the chimeric RNAs clustered according to the host species from which they were isolated. Additionally, the chimera satRNAs acquired non-viral "linker" sequences in a host-specific manner. These results highlight the dynamic regulation of viral pathogenicity by satellites, and the selective host-dependent, sequence-based pressures for driving satRNA generation and genome compositions. Copyright © 2017 Elsevier Inc. All rights reserved.

Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

PubMed

Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

2005-10-01

Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Liver Transcriptome and miRNA Analysis of Silver Carp (Hypophthalmichthys molitrix) Intraperitoneally Injected With Microcystin-LR

PubMed Central

Qu, Xiancheng; Hu, Menghong; Shang, Yueyong; Pan, Lisha; Jia, Peixuan; Fu, Chunxue; Liu, Qigen; Wang, Youji

2018-01-01

Next-generation sequencing was used to analyze the effects of toxic microcystin-LR (MC-LR) on silver carp (Hypophthalmichthys molitrix). Silver carps were intraperitoneally injected with MC-LR, and RNA-seq and miRNA-seq in the liver were analyzed at 0.25, 0.5, and 1 h. The expression of glutathione S-transferase (GST), which acts as a marker gene for MC-LR, was tested to determine the earliest time point at which GST transcription was initiated in the liver tissues of the MC-LR-treated silver carps. Hepatic RNA-seq/miRNA-seq analysis and data integration analysis were conducted with reference to the identified time point. Quantitative PCR (qPCR) was performed to detect the expression of the following genes at the three time points: heme oxygenase 1 (HO-1), interleukin-10 receptor 1 (IL-10R1), apolipoprotein A-I (apoA-I), and heme binding protein 2 (HBP2). Results showed that the liver GST expression was remarkably decreased at 0.25 h (P < 0.05). RNA-seq at this time point revealed that the liver tissue contained 97,505 unigenes, including 184 significantly different unigenes and 75 unknown genes. Gene Ontology (GO) term enrichment analysis suggested that 35 of the 145 enriched GO terms were significantly enriched and mainly related to the immune system regulation network. KEGG pathway enrichment analysis showed that 18 of the 189 pathways were significantly enriched, and the most significant was a ribosome pathway containing 77 differentially expressed genes. miRNA-seq analysis indicated that the longest miRNA had 22 nucleotides (nt), followed by 21 and 23 nt. A total of 286 known miRNAs, 332 known miRNA precursor sequences, and 438 new miRNAs were predicted. A total of 1,048,575 mRNA–miRNA interaction sites were obtained, and 21,252 and 21,241 target genes were respectively predicted in known and new miRNAs. qPCR revealed that HO-1, IL-10R1, apoA-I, and HBP2 were significantly differentially expressed and might play important roles in the toxicity and liver detoxification of MC-LR in fish. These results were consistent with those of high-throughput sequencing, thereby verifying the accuracy of our sequencing data. RNA-seq and miRNA-seq analyses of silver carp liver injected with MC-LR provided valuable and new insights into the toxic effects of MC-LR and the antitoxic mechanisms of MC-LR in fish. The RNA/miRNA data are available from the NCBI database Registration No. : SRP075165. PMID:29692738

RNA-Seq profiling of single bovine oocyte transcript abundance and its modulation by cytoplasmic polyadenylation.

PubMed

Reyes, Juan M; Chitwood, James L; Ross, Pablo J

2015-02-01

Molecular changes occurring during mammalian oocyte maturation are partly regulated by cytoplasmic polyadenylation (CP) and affect oocyte quality, yet the extent of CP activity during oocyte maturation remains unknown. Single bovine oocyte RNA sequencing (RNA-Seq) was performed to examine changes in transcript abundance during in vitro oocyte maturation in cattle. Polyadenylated RNA from individual germinal-vesicle and metaphase-II oocytes was amplified and processed for Illumina sequencing, producing approximately 30 million reads per replicate for each sample type. A total of 10,494 genes were found to be expressed, of which 2,455 were differentially expressed (adjusted P < 0.05 and fold change >2) between stages, with 503 and 1,952 genes respectively increasing and decreasing in abundance. Differentially expressed genes with complete 3'-untranslated-region sequence (279 increasing and 918 decreasing in polyadenylated transcript abundance) were examined for the presence, position, and distribution of motifs mediating CP, revealing enrichment (85%) and lack thereof (18%) in up- and down-regulated genes, respectively. Examination of total and polyadenylated RNA abundance by quantitative PCR validated these RNA-Seq findings. The observed increases in polyadenylated transcript abundance within the RNA-Seq data are likely due to CP, providing novel insight into targeted transcripts and resultant differential gene expression profiles that contribute to oocyte maturation. © 2015 Wiley Periodicals, Inc.

Systematic Analysis of Long Noncoding RNAs in the Senescence-accelerated Mouse Prone 8 Brain Using RNA Sequencing.

PubMed

Zhang, Shuai; Qin, Chunxia; Cao, Guoqiong; Xin, Wenfeng; Feng, Chengqiang; Zhang, Wensheng

2016-08-02

Long noncoding RNAs (lncRNAs) may play an important role in Alzheimer's disease (AD) pathogenesis. However, despite considerable research in this area, the comprehensive and systematic understanding of lncRNAs in AD is still limited. The emergence of RNA sequencing provides a predictor and has incomparable advantage compared with other methods, including microarray. In this study, we identified lncRNAs in a 7-month-old mouse brain through deep RNA sequencing using the senescence-accelerated mouse prone 8 (SAMP8) and senescence-accelerated mouse resistant 1 (SAMR1) models. A total of 599,985,802 clean reads and 23,334 lncRNA transcripts were obtained. Then, we identified 97 significantly upregulated and 114 significantly downregulated lncRNA transcripts from all cases in SAMP8 mice relative to SAMR1 mice. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes analyses revealed that these significantly dysregulated lncRNAs were involved in regulating the development of AD from various angles, such as nerve growth factor term (GO: 1990089), mitogen-activated protein kinase signaling pathway, and AD pathway. Furthermore, the most probable AD-associated lncRNAs were predicted and listed in detail. Our study provided the systematic dissection of lncRNA profiling in SAMP8 mouse brain and accelerated the development of lncRNA biomarkers in AD. These attracting biomarkers could provide significant insights into AD therapy in the future.

RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

PubMed

Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

2016-01-01

Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

Transcriptome complexity in cardiac development and diseases--an expanding universe between genome and phenome.

PubMed

Gao, Chen; Wang, Yibin

2014-01-01

With the advancement of transcriptome profiling by micro-arrays and high-throughput RNA-sequencing, transcriptome complexity and its dynamics are revealed at different levels in cardiovascular development and diseases. In this review, we will highlight the recent progress in our knowledge of cardiovascular transcriptome complexity contributed by RNA splicing, RNA editing and noncoding RNAs. The emerging importance of many of these previously under-explored aspects of gene regulation in cardiovascular development and pathology will be discussed.

The heterogeneity of human CD127(+) innate lymphoid cells revealed by single-cell RNA sequencing.

PubMed

Björklund, Åsa K; Forkel, Marianne; Picelli, Simone; Konya, Viktoria; Theorell, Jakob; Friberg, Danielle; Sandberg, Rickard; Mjösberg, Jenny

2016-04-01

Innate lymphoid cells (ILCs) are increasingly appreciated as important participants in homeostasis and inflammation. Substantial plasticity and heterogeneity among ILC populations have been reported. Here we have delineated the heterogeneity of human ILCs through single-cell RNA sequencing of several hundreds of individual tonsil CD127(+) ILCs and natural killer (NK) cells. Unbiased transcriptional clustering revealed four distinct populations, corresponding to ILC1 cells, ILC2 cells, ILC3 cells and NK cells, with their respective transcriptomes recapitulating known as well as unknown transcriptional profiles. The single-cell resolution additionally divulged three transcriptionally and functionally diverse subpopulations of ILC3 cells. Our systematic comparison of single-cell transcriptional variation within and between ILC populations provides new insight into ILC biology during homeostasis, with additional implications for dysregulation of the immune system.

Single-cell RNA sequencing reveals developmental heterogeneity among early lymphoid progenitors.

PubMed

Alberti-Servera, Llucia; von Muenchow, Lilly; Tsapogas, Panagiotis; Capoferri, Giuseppina; Eschbach, Katja; Beisel, Christian; Ceredig, Rhodri; Ivanek, Robert; Rolink, Antonius

2017-12-15

Single-cell RNA sequencing is a powerful technology for assessing heterogeneity within defined cell populations. Here, we describe the heterogeneity of a B220 + CD117 int CD19 - NK1.1 - uncommitted hematopoietic progenitor having combined lymphoid and myeloid potential. Phenotypic and functional assays revealed four subpopulations within the progenitor with distinct lineage developmental potentials. Among them, the Ly6D + SiglecH - CD11c - fraction was lymphoid-restricted exhibiting strong B-cell potential, whereas the Ly6D - SiglecH - CD11c - fraction showed mixed lympho-myeloid potential. Single-cell RNA sequencing of these subsets revealed that the latter population comprised a mixture of cells with distinct lymphoid and myeloid transcriptional signatures and identified a subgroup as the potential precursor of Ly6D + SiglecH - CD11c - Subsequent functional assays confirmed that B220 + CD117 int CD19 - NK1.1 - single cells are, with rare exceptions, not bipotent for lymphoid and myeloid lineages. A B-cell priming gradient was observed within the Ly6D + SiglecH - CD11c - subset and we propose a herein newly identified subgroup as the direct precursor of the first B-cell committed stage. Therefore, the apparent multipotency of B220 + CD117 int CD19 - NK1.1 - progenitors results from underlying heterogeneity at the single-cell level and highlights the validity of single-cell transcriptomics for resolving cellular heterogeneity and developmental relationships among hematopoietic progenitors. © 2017 The Authors.

Chess games: a model for RNA based computation.

PubMed

Cukras, A R; Faulhammer, D; Lipton, R J; Landweber, L F

1999-10-01

Here we develop the theory of RNA computing and a method for solving the 'knight problem' as an instance of a satisfiability (SAT) problem. Using only biological molecules and enzymes as tools, we developed an algorithm for solving the knight problem (3 x 3 chess board) using a 10-bit combinatorial pool and sequential RNase H digestions. The results of preliminary experiments presented here reveal that the protocol recovers far more correct solutions than expected at random, but the persistence of errors still presents the greatest challenge.

Isolation of high quality RNA from pistachio (Pistacia vera L.) and other woody plants high in secondary metabolites.

PubMed

Moazzam Jazi, Maryam; Rajaei, Saideh; Seyedi, Seyed Mahdi

2015-10-01

The quality and quantity of RNA are critical for successful downstream transcriptome-based studies such as microarrays and RNA sequencing (RNA-Seq). RNA isolation from woody plants, such as Pistacia vera, with very high amounts of polyphenols and polysaccharides is an enormous challenge. Here, we describe a highly efficient protocol that overcomes the limitations posed by poor quality and low yield of isolated RNA from pistachio and various recalcitrant woody plants. The key factors that resulted in a yield of 150 μg of high quality RNA per 200 mg of plant tissue include the elimination of phenol from the extraction buffer, raising the concentration of β-mercaptoethanol, long time incubation at 65 °C, and nucleic acid precipitation with optimized volume of NaCl and isopropyl alcohol. Also, the A260/A280 and A260/A230 of extracted RNA were about 1.9-2.1and 2.2-2.3, respectively, revealing the high purity. Since the isolated RNA passed highly stringent quality control standards for sensitive reactions, including RNA sequencing and real-time PCR, it can be considered as a reliable and cost-effective method for RNA extraction from woody plants.

Characterization of genetic elements required for site-specific integration of Lactobacillus delbrueckii subsp. bulgaricus bacteriophage mv4 and construction of an integration-proficient vector for Lactobacillus plantarum.

PubMed Central

Dupont, L; Boizet-Bonhoure, B; Coddeville, M; Auvray, F; Ritzenthaler, P

1995-01-01

Temperate phage mv4 integrates its DNA into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus strains via site-specific recombination. Nucleotide sequencing of a 2.2-kb attP-containing phage fragment revealed the presence of four open reading frames. The larger open reading frame, close to the attP site, encoded a 427-amino-acid polypeptide with similarity in its C-terminal domain to site-specific recombinases of the integrase family. Comparison of the sequences of attP, bacterial attachment site attB, and host-phage junctions attL and attR identified a 17-bp common core sequence, where strand exchange occurs during recombination. Analysis of the attB sequence indicated that the core region overlaps the 3' end of a tRNA(Ser) gene. Phage mv4 DNA integration into the tRNA(Ser) gene preserved an intact tRNA(Ser) gene at the attL site. An integration vector based on the mv4 attP site and int gene was constructed. This vector transforms a heterologous host, L. plantarum, through site-specific integration into the tRNA(Ser) gene of the genome and will be useful for development of an efficient integration system for a number of additional bacterial species in which an identical tRNA gene is present. PMID:7836291

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Identification and Characterization of Two Novel RNA Viruses from Anopheles gambiae Species Complex Mosquitoes

PubMed Central

Carissimo, Guillaume; Eiglmeier, Karin; Reveillaud, Julie; Holm, Inge; Diallo, Mawlouth; Diallo, Diawo; Vantaux, Amélie; Kim, Saorin; Ménard, Didier; Siv, Sovannaroth; Belda, Eugeni; Bischoff, Emmanuel; Antoniewski, Christophe; Vernick, Kenneth D.

2016-01-01

Mosquitoes of the Anopheles gambiae complex display strong preference for human bloodmeals and are major malaria vectors in Africa. However, their interaction with viruses or role in arbovirus transmission during epidemics has been little examined, with the exception of O’nyong-nyong virus, closely related to Chikungunya virus. Deep-sequencing has revealed different RNA viruses in natural insect viromes, but none have been previously described in the Anopheles gambiae species complex. Here, we describe two novel insect RNA viruses, a Dicistrovirus and a Cypovirus, found in laboratory colonies of An. gambiae taxa using small-RNA deep sequencing. Sequence analysis was done with Metavisitor, an open-source bioinformatic pipeline for virus discovery and de novo genome assembly. Wild-collected Anopheles from Senegal and Cambodia were positive for the Dicistrovirus and Cypovirus, displaying high sequence identity to the laboratory-derived virus. Thus, the Dicistrovirus (Anopheles C virus, AnCV) and Cypovirus (Anopheles Cypovirus, AnCPV) are components of the natural virome of at least some anopheline species. Their possible influence on mosquito immunity or transmission of other pathogens is unknown. These natural viruses could be developed as models for the study of Anopheles-RNA virus interactions in low security laboratory settings, in an analogous manner to the use of rodent malaria parasites for studies of mosquito anti-parasite immunity. PMID:27138938

Mistranslation: from adaptations to applications.

PubMed

Hoffman, Kyle S; O'Donoghue, Patrick; Brandl, Christopher J

2017-11-01

The conservation of the genetic code indicates that there was a single origin, but like all genetic material, the cell's interpretation of the code is subject to evolutionary pressure. Single nucleotide variations in tRNA sequences can modulate codon assignments by altering codon-anticodon pairing or tRNA charging. Either can increase translation errors and even change the code. The frozen accident hypothesis argued that changes to the code would destabilize the proteome and reduce fitness. In studies of model organisms, mistranslation often acts as an adaptive response. These studies reveal evolutionary conserved mechanisms to maintain proteostasis even during high rates of mistranslation. This review discusses the evolutionary basis of altered genetic codes, how mistranslation is identified, and how deviations to the genetic code are exploited. We revisit early discoveries of genetic code deviations and provide examples of adaptive mistranslation events in nature. Lastly, we highlight innovations in synthetic biology to expand the genetic code. The genetic code is still evolving. Mistranslation increases proteomic diversity that enables cells to survive stress conditions or suppress a deleterious allele. Genetic code variants have been identified by genome and metagenome sequence analyses, suppressor genetics, and biochemical characterization. Understanding the mechanisms of translation and genetic code deviations enables the design of new codes to produce novel proteins. Engineering the translation machinery and expanding the genetic code to incorporate non-canonical amino acids are valuable tools in synthetic biology that are impacting biomedical research. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

PubMed

Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

2017-02-01

We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

SNP discovery in the bovine milk transcriptome using RNA-Seq technology.

PubMed

Cánovas, Angela; Rincon, Gonzalo; Islas-Trejo, Alma; Wickramasinghe, Saumya; Medrano, Juan F

2010-12-01

High-throughput sequencing of RNA (RNA-Seq) was developed primarily to analyze global gene expression in different tissues. However, it also is an efficient way to discover coding SNPs. The objective of this study was to perform a SNP discovery analysis in the milk transcriptome using RNA-Seq. Seven milk samples from Holstein cows were analyzed by sequencing cDNAs using the Illumina Genome Analyzer system. We detected 19,175 genes expressed in milk samples corresponding to approximately 70% of the total number of genes analyzed. The SNP detection analysis revealed 100,734 SNPs in Holstein samples, and a large number of those corresponded to differences between the Holstein breed and the Hereford bovine genome assembly Btau4.0. The number of polymorphic SNPs within Holstein cows was 33,045. The accuracy of RNA-Seq SNP discovery was tested by comparing SNPs detected in a set of 42 candidate genes expressed in milk that had been resequenced earlier using Sanger sequencing technology. Seventy of 86 SNPs were detected using both RNA-Seq and Sanger sequencing technologies. The KASPar Genotyping System was used to validate unique SNPs found by RNA-Seq but not observed by Sanger technology. Our results confirm that analyzing the transcriptome using RNA-Seq technology is an efficient and cost-effective method to identify SNPs in transcribed regions. This study creates guidelines to maximize the accuracy of SNP discovery and prevention of false-positive SNP detection, and provides more than 33,000 SNPs located in coding regions of genes expressed during lactation that can be used to develop genotyping platforms to perform marker-trait association studies in Holstein cattle.