Application of Bounded Linear Stability Analysis Method for Metrics-Driven Adaptive Control

NASA Technical Reports Server (NTRS)

Bakhtiari-Nejad, Maryam; Nguyen, Nhan T.; Krishnakumar, Kalmanje

2009-01-01

This paper presents the application of Bounded Linear Stability Analysis (BLSA) method for metrics-driven adaptive control. The bounded linear stability analysis method is used for analyzing stability of adaptive control models, without linearizing the adaptive laws. Metrics-driven adaptive control introduces a notion that adaptation should be driven by some stability metrics to achieve robustness. By the application of bounded linear stability analysis method the adaptive gain is adjusted during the adaptation in order to meet certain phase margin requirements. Analysis of metrics-driven adaptive control is evaluated for a second order system that represents a pitch attitude control of a generic transport aircraft. The analysis shows that the system with the metrics-conforming variable adaptive gain becomes more robust to unmodeled dynamics or time delay. The effect of analysis time-window for BLSA is also evaluated in order to meet the stability margin criteria.

BMP, Wnt and FGF signals are integrated through evolutionarily conserved enhancers to achieve robust expression of Pax3 and Zic genes at the zebrafish neural plate border

PubMed Central

Garnett, Aaron T.; Square, Tyler A.; Medeiros, Daniel M.

2012-01-01

Neural crest cells generate a range of cells and tissues in the vertebrate head and trunk, including peripheral neurons, pigment cells, and cartilage. Neural crest cells arise from the edges of the nascent central nervous system, a domain called the neural plate border (NPB). NPB induction is known to involve the BMP, Wnt and FGF signaling pathways. However, little is known about how these signals are integrated to achieve temporally and spatially specific expression of genes in NPB cells. Furthermore, the timing and relative importance of these signals in NPB formation appears to differ between vertebrate species. Here, we use heat-shock overexpression and chemical inhibitors to determine whether, and when, BMP, Wnt and FGF signaling are needed for expression of the NPB specifiers pax3a and zic3 in zebrafish. We then identify four evolutionarily conserved enhancers from the pax3a and zic3 loci and test their response to BMP, Wnt and FGF perturbations. We find that all three signaling pathways are required during gastrulation for the proper expression of pax3a and zic3 in the zebrafish NPB. We also find that, although the expression patterns driven by the pax3a and zic3 enhancers largely overlap, they respond to different combinations of BMP, Wnt and FGF signals. Finally, we show that the combination of the two pax3a enhancers is less susceptible to signaling perturbations than either enhancer alone. Taken together, our results reveal how BMPs, FGFs and Wnts act cooperatively and redundantly through partially redundant enhancers to achieve robust, specific gene expression in the zebrafish NPB. PMID:23034628

m6A-Driver: Identifying Context-Specific mRNA m6A Methylation-Driven Gene Interaction Networks

PubMed Central

Zhang, Song-Yao; Zhang, Shao-Wu; Liu, Lian; Huang, Yufei

2016-01-01

As the most prevalent mammalian mRNA epigenetic modification, N6-methyladenosine (m6A) has been shown to possess important post-transcriptional regulatory functions. However, the regulatory mechanisms and functional circuits of m6A are still largely elusive. To help unveil the regulatory circuitry mediated by mRNA m6A methylation, we develop here m6A-Driver, an algorithm for predicting m6A-driven genes and associated networks, whose functional interactions are likely to be actively modulated by m6A methylation under a specific condition. Specifically, m6A-Driver integrates the PPI network and the predicted differential m6A methylation sites from methylated RNA immunoprecipitation sequencing (MeRIP-Seq) data using a Random Walk with Restart (RWR) algorithm and then builds a consensus m6A-driven network of m6A-driven genes. To evaluate the performance, we applied m6A-Driver to build the context-specific m6A-driven networks for 4 known m6A (de)methylases, i.e., FTO, METTL3, METTL14 and WTAP. Our results suggest that m6A-Driver can robustly and efficiently identify m6A-driven genes that are functionally more enriched and associated with higher degree of differential expression than differential m6A methylated genes. Pathway analysis of the constructed context-specific m6A-driven gene networks further revealed the regulatory circuitry underlying the dynamic interplays between the methyltransferases and demethylase at the epitranscriptomic layer of gene regulation. PMID:28027310

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Kyri; Dall'Anese, Emiliano; Summers, Tyler

This paper outlines a data-driven, distributionally robust approach to solve chance-constrained AC optimal power flow problems in distribution networks. Uncertain forecasts for loads and power generated by photovoltaic (PV) systems are considered, with the goal of minimizing PV curtailment while meeting power flow and voltage regulation constraints. A data- driven approach is utilized to develop a distributionally robust conservative convex approximation of the chance-constraints; particularly, the mean and covariance matrix of the forecast errors are updated online, and leveraged to enforce voltage regulation with predetermined probability via Chebyshev-based bounds. By combining an accurate linear approximation of the AC power flowmore » equations with the distributionally robust chance constraint reformulation, the resulting optimization problem becomes convex and computationally tractable.« less

Highly efficient and robust molecular ruthenium catalysts for water oxidation

PubMed Central

Duan, Lele; Araujo, Carlos Moyses; Ahlquist, Mårten S.G.; Sun, Licheng

2012-01-01

Water oxidation catalysts are essential components of light-driven water splitting systems, which could convert water to H2 driven by solar radiation (H2O + hν → 1/2O2 + H2). The oxidation of water (H2O → 1/2O2 + 2H+ + 2e-) provides protons and electrons for the production of dihydrogen (2H+ + 2e- → H2), a clean-burning and high-capacity energy carrier. One of the obstacles now is the lack of effective and robust water oxidation catalysts. Aiming at developing robust molecular Ru-bda (H2bda = 2,2′-bipyridine-6,6′-dicarboxylic acid) water oxidation catalysts, we carried out density functional theory studies, correlated the robustness of catalysts against hydration with the highest occupied molecular orbital levels of a set of ligands, and successfully directed the synthesis of robust Ru-bda water oxidation catalysts. A series of mononuclear ruthenium complexes [Ru(bda)L2] (L = pyridazine, pyrimidine, and phthalazine) were subsequently synthesized and shown to effectively catalyze CeIV-driven [CeIV = Ce(NH4)2(NO3)6] water oxidation with high oxygen production rates up to 286 s-1 and high turnover numbers up to 55,400. PMID:22753518

The Regulatory Factor ZFHX3 Modifies Circadian Function in SCN via an AT Motif-Driven Axis

PubMed Central

Parsons, Michael J.; Brancaccio, Marco; Sethi, Siddharth; Maywood, Elizabeth S.; Satija, Rahul; Edwards, Jessica K.; Jagannath, Aarti; Couch, Yvonne; Finelli, Mattéa J.; Smyllie, Nicola J.; Esapa, Christopher; Butler, Rachel; Barnard, Alun R.; Chesham, Johanna E.; Saito, Shoko; Joynson, Greg; Wells, Sara; Foster, Russell G.; Oliver, Peter L.; Simon, Michelle M.; Mallon, Ann-Marie; Hastings, Michael H.; Nolan, Patrick M.

2015-01-01

Summary We identified a dominant missense mutation in the SCN transcription factor Zfhx3, termed short circuit (Zfhx3Sci), which accelerates circadian locomotor rhythms in mice. ZFHX3 regulates transcription via direct interaction with predicted AT motifs in target genes. The mutant protein has a decreased ability to activate consensus AT motifs in vitro. Using RNA sequencing, we found minimal effects on core clock genes in Zfhx3Sci/+ SCN, whereas the expression of neuropeptides critical for SCN intercellular signaling was significantly disturbed. Moreover, mutant ZFHX3 had a decreased ability to activate AT motifs in the promoters of these neuropeptide genes. Lentiviral transduction of SCN slices showed that the ZFHX3-mediated activation of AT motifs is circadian, with decreased amplitude and robustness of these oscillations in Zfhx3Sci/+ SCN slices. In conclusion, by cloning Zfhx3Sci, we have uncovered a circadian transcriptional axis that determines the period and robustness of behavioral and SCN molecular rhythms. PMID:26232227

Carbon membranes for efficient water-ethanol separation.

PubMed

Gravelle, Simon; Yoshida, Hiroaki; Joly, Laurent; Ybert, Christophe; Bocquet, Lydéric

2016-09-28

We demonstrate, on the basis of molecular dynamics simulations, the possibility of an efficient water-ethanol separation using nanoporous carbon membranes, namely, carbon nanotube membranes, nanoporous graphene sheets, and multilayer graphene membranes. While these carbon membranes are in general permeable to both pure liquids, they exhibit a counter-intuitive "self-semi-permeability" to water in the presence of water-ethanol mixtures. This originates in a preferred ethanol adsorption in nanoconfinement that prevents water molecules from entering the carbon nanopores. An osmotic pressure is accordingly expressed across the carbon membranes for the water-ethanol mixture, which agrees with the classic van't Hoff type expression. This suggests a robust and versatile membrane-based separation, built on a pressure-driven reverse-osmosis process across these carbon-based membranes. In particular, the recent development of large-scale "graphene-oxide" like membranes then opens an avenue for a versatile and efficient ethanol dehydration using this separation process, with possible application for bio-ethanol fabrication.

Carbon membranes for efficient water-ethanol separation

NASA Astrophysics Data System (ADS)

Gravelle, Simon; Yoshida, Hiroaki; Joly, Laurent; Ybert, Christophe; Bocquet, Lydéric

2016-09-01

We demonstrate, on the basis of molecular dynamics simulations, the possibility of an efficient water-ethanol separation using nanoporous carbon membranes, namely, carbon nanotube membranes, nanoporous graphene sheets, and multilayer graphene membranes. While these carbon membranes are in general permeable to both pure liquids, they exhibit a counter-intuitive "self-semi-permeability" to water in the presence of water-ethanol mixtures. This originates in a preferred ethanol adsorption in nanoconfinement that prevents water molecules from entering the carbon nanopores. An osmotic pressure is accordingly expressed across the carbon membranes for the water-ethanol mixture, which agrees with the classic van't Hoff type expression. This suggests a robust and versatile membrane-based separation, built on a pressure-driven reverse-osmosis process across these carbon-based membranes. In particular, the recent development of large-scale "graphene-oxide" like membranes then opens an avenue for a versatile and efficient ethanol dehydration using this separation process, with possible application for bio-ethanol fabrication.

Sparse coding for flexible, robust 3D facial-expression synthesis.

PubMed

Lin, Yuxu; Song, Mingli; Quynh, Dao Thi Phuong; He, Ying; Chen, Chun

2012-01-01

Computer animation researchers have been extensively investigating 3D facial-expression synthesis for decades. However, flexible, robust production of realistic 3D facial expressions is still technically challenging. A proposed modeling framework applies sparse coding to synthesize 3D expressive faces, using specified coefficients or expression examples. It also robustly recovers facial expressions from noisy and incomplete data. This approach can synthesize higher-quality expressions in less time than the state-of-the-art techniques.

RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay.

PubMed

Dean, Kimberly M; Grayhack, Elizabeth J

2012-12-01

We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

Data Driven Model Development for the Supersonic Semispan Transport (S(sup 4)T)

NASA Technical Reports Server (NTRS)

Kukreja, Sunil L.

2011-01-01

We investigate two common approaches to model development for robust control synthesis in the aerospace community; namely, reduced order aeroservoelastic modelling based on structural finite-element and computational fluid dynamics based aerodynamic models and a data-driven system identification procedure. It is shown via analysis of experimental Super- Sonic SemiSpan Transport (S4T) wind-tunnel data using a system identification approach it is possible to estimate a model at a fixed Mach, which is parsimonious and robust across varying dynamic pressures.

Distribution-Agnostic Stochastic Optimal Power Flow for Distribution Grids: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baker, Kyri; Dall'Anese, Emiliano; Summers, Tyler

2016-09-01

This paper outlines a data-driven, distributionally robust approach to solve chance-constrained AC optimal power flow problems in distribution networks. Uncertain forecasts for loads and power generated by photovoltaic (PV) systems are considered, with the goal of minimizing PV curtailment while meeting power flow and voltage regulation constraints. A data- driven approach is utilized to develop a distributionally robust conservative convex approximation of the chance-constraints; particularly, the mean and covariance matrix of the forecast errors are updated online, and leveraged to enforce voltage regulation with predetermined probability via Chebyshev-based bounds. By combining an accurate linear approximation of the AC power flowmore » equations with the distributionally robust chance constraint reformulation, the resulting optimization problem becomes convex and computationally tractable.« less

Noise Robust Speech Recognition Applied to Voice-Driven Wheelchair

NASA Astrophysics Data System (ADS)

Sasou, Akira; Kojima, Hiroaki

2009-12-01

Conventional voice-driven wheelchairs usually employ headset microphones that are capable of achieving sufficient recognition accuracy, even in the presence of surrounding noise. However, such interfaces require users to wear sensors such as a headset microphone, which can be an impediment, especially for the hand disabled. Conversely, it is also well known that the speech recognition accuracy drastically degrades when the microphone is placed far from the user. In this paper, we develop a noise robust speech recognition system for a voice-driven wheelchair. This system can achieve almost the same recognition accuracy as the headset microphone without wearing sensors. We verified the effectiveness of our system in experiments in different environments, and confirmed that our system can achieve almost the same recognition accuracy as the headset microphone without wearing sensors.

Synthetic dual-input mammalian genetic circuits enable tunable and stringent transcription control by chemical and light.

PubMed

Chen, Xianjun; Li, Ting; Wang, Xue; Du, Zengmin; Liu, Renmei; Yang, Yi

2016-04-07

Programmable transcription factors can enable precise control of gene expression triggered by a chemical inducer or light. To obtain versatile transgene system with combined benefits of a chemical inducer and light inducer, we created various chimeric promoters through the assembly of different copies of the tet operator and Gal4 operator module, which simultaneously responded to a tetracycline-responsive transcription factor and a light-switchable transactivator. The activities of these chimeric promoters can be regulated by tetracycline and blue light synergistically or antagonistically. Further studies of the antagonistic genetic circuit exhibited high spatiotemporal resolution and extremely low leaky expression, which therefore could be used to spatially and stringently control the expression of highly toxic protein Diphtheria toxin A for light regulated gene therapy. When transferring plasmids engineered for the gene switch-driven expression of a firefly luciferase (Fluc) into mice, the Fluc expression levels of the treated animals directly correlated with the tetracycline and light input program. We suggest that dual-input genetic circuits using TET and light that serve as triggers to achieve expression profiles may enable the design of robust therapeutic gene circuits for gene- and cell-based therapies. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparisons of Robustness and Sensitivity between Cancer and Normal Cells by Microarray Data

PubMed Central

Chu, Liang-Hui; Chen, Bor-Sen

2008-01-01

Robustness is defined as the ability to uphold performance in face of perturbations and uncertainties, and sensitivity is a measure of the system deviations generated by perturbations to the system. While cancer appears as a robust but fragile system, few computational and quantitative evidences demonstrate robustness tradeoffs in cancer. Microarrays have been widely applied to decipher gene expression signatures in human cancer research, and quantification of global gene expression profiles facilitates precise prediction and modeling of cancer in systems biology. We provide several efficient computational methods based on system and control theory to compare robustness and sensitivity between cancer and normal cells by microarray data. Measurement of robustness and sensitivity by linear stochastic model is introduced in this study, which shows oscillations in feedback loops of p53 and demonstrates robustness tradeoffs that cancer is a robust system with some extreme fragilities. In addition, we measure sensitivity of gene expression to perturbations in other gene expression and kinetic parameters, discuss nonlinear effects in feedback loops of p53 and extend our method to robustness-based cancer drug design. PMID:19259409

Id expression in amphioxus and lamprey highlights the role of gene cooption during neural crest evolution

NASA Technical Reports Server (NTRS)

Meulemans, Daniel; McCauley, David; Bronner-Fraser, Marianne

2003-01-01

Neural crest cells are unique to vertebrates and generate many of the adult structures that differentiate them from their closest invertebrate relatives, the cephalochordates. Id genes are robust markers of neural crest cells at all stages of development. We compared Id gene expression in amphioxus and lamprey to ask if cephalochordates deploy Id genes at the neural plate border and dorsal neural tube in a manner similar to vertebrates. Furthermore, we examined whether Id expression in these cells is a basal vertebrate trait or a derived feature of gnathostomes. We found that while expression of Id genes in the mesoderm and endoderm is conserved between amphioxus and vertebrates, expression in the lateral neural plate border and dorsal neural tube is a vertebrate novelty. Furthermore, expression of lamprey Id implies that recruitment of Id genes to these cells occurred very early in the vertebrate lineage. Based on expression in amphioxus we postulate that Id cooption conferred sensory cell progenitor-like properties upon the lateral neurectoderm, and pharyngeal mesoderm-like properties upon cranial neural crest. Amphioxus Id expression is also consistent with homology between the anterior neurectoderm of amphioxus and the presumptive placodal ectoderm of vertebrates. These observations support the idea that neural crest evolution was driven in large part by cooption of multipurpose transcriptional regulators from other tissues and cell types.

Data Driven Model Development for the SuperSonic SemiSpan Transport (S(sup 4)T)

NASA Technical Reports Server (NTRS)

Kukreja, Sunil L.

2011-01-01

In this report, we will investigate two common approaches to model development for robust control synthesis in the aerospace community; namely, reduced order aeroservoelastic modelling based on structural finite-element and computational fluid dynamics based aerodynamic models, and a data-driven system identification procedure. It is shown via analysis of experimental SuperSonic SemiSpan Transport (S4T) wind-tunnel data that by using a system identification approach it is possible to estimate a model at a fixed Mach, which is parsimonious and robust across varying dynamic pressures.

Characterization of stem cells and cancer cells on the basis of gene expression profile stability, plasticity, and robustness: dynamical systems theory of gene expressions under cell-cell interaction explains mutational robustness of differentiated cells and suggests how cancer cells emerge.

PubMed

Kaneko, Kunihiko

2011-06-01

Here I present and discuss a model that, among other things, appears able to describe the dynamics of cancer cell origin from the perspective of stable and unstable gene expression profiles. In identifying such aberrant gene expression profiles as lying outside the normal stable states attracted through development and normal cell differentiation, the hypothesis explains why cancer cells accumulate mutations, to which they are not robust, and why these mutations create a new stable state far from the normal gene expression profile space. Such cells are in strong contrast with normal cell types that appeared as an attractor state in the gene expression dynamical system under cell-cell interaction and achieved robustness to noise through evolution, which in turn also conferred robustness to mutation. In complex gene regulation networks, other aberrant cellular states lacking such high robustness are expected to remain, which would correspond to cancer cells. Copyright © 2011 WILEY Periodicals, Inc.

NR4A3 Suppresses Lymphomagenesis through Induction of Proapoptotic Genes.

PubMed

Deutsch, Alexander J A; Rinner, Beate; Pichler, Martin; Prochazka, Katharina; Pansy, Katrin; Bischof, Marco; Fechter, Karoline; Hatzl, Stefan; Feichtinger, Julia; Wenzl, Kerstin; Frisch, Marie-Therese; Stiegelbauer, Verena; Prokesch, Andreas; Krogsdam, Anne; Sill, Heinz; Thallinger, Gerhard G; Greinix, Hildegard T; Wang, Chenguang; Beham-Schmid, Christine; Neumeister, Peter

2017-05-01

Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated with poor survival. Ectopic expression or pharmacological activation of NR4A3 in lymphoma cell lines led to a significantly higher proportion of apoptotic cells. In a mouse NSG xenograft model of lymphoma (stably transduced SuDHL4 cells), NR4A3 expression abrogated tumor growth, compared with vector control and uninduced cells that formed massive tumors. Transcript analysis of four different aggressive lymphoma cell lines overexpressing either NR4A3 or NR4A1 revealed that apoptosis was driven similarly by induction of BAK, Puma, BIK, BIM, BID, and Trail. Overall, our results showed that NR4A3 possesses robust tumor suppressor functions of similar impact to NR4A1 in aggressive lymphomas. Cancer Res; 77(9); 2375-86. ©2017 AACR . ©2017 American Association for Cancer Research.

Chronic activation of wild-type epidermal growth factor receptor and loss of Cdkn2a cause mouse glioblastoma formation.

PubMed

Acquaviva, Jaime; Jun, Hyun Jung; Lessard, Julie; Ruiz, Rolando; Zhu, Haihao; Donovan, Melissa; Woolfenden, Steve; Boskovitz, Abraham; Raval, Ami; Bronson, Roderick T; Pfannl, Rolf; Whittaker, Charles A; Housman, David E; Charest, Al

2011-12-01

Glioblastoma multiforme (GBM) is characterized by overexpression of epidermal growth factor receptor (EGFR) and loss of the tumor suppressors Ink4a/Arf. Efforts at modeling GBM using wild-type EGFR in mice have proven unsuccessful. Here, we present a unique mouse model of wild-type EGFR-driven gliomagenesis. We used a combination of somatic conditional overexpression and ligand-mediated chronic activation of EGFR in cooperation with Ink4a/Arf loss in the central nervous system of adult mice to generate tumors with the histopathologic and molecular characteristics of human GBMs. Sustained, ligand-mediated activation of EGFR was necessary for gliomagenesis, functionally substantiating the clinical observation that EGFR-positive GBMs from patients express EGFR ligands. To gain a better understanding of the clinically disappointing EGFR-targeted therapies for GBM, we investigated the molecular responses to EGFR tyrosine kinase inhibitor (TKI) treatment in this model. Gefitinib treatment of primary GBM cells resulted in a robust apoptotic response, partially conveyed by mitogen-activated protein kinase (MAPK) signaling attenuation and accompanied by BIM(EL) expression. In human GBMs, loss-of-function mutations in the tumor suppressor PTEN are a common occurrence. Elimination of PTEN expression in GBM cells posttumor formation did not confer resistance to TKI treatment, showing that PTEN status in our model is not predictive. Together, these findings offer important mechanistic insights into the genetic determinants of EGFR gliomagenesis and sensitivity to TKIs and provide a robust discovery platform to better understand the molecular events that are associated with predictive markers of TKI therapy.

Direct visualization of membrane architecture of myelinating cells in transgenic mice expressing membrane-anchored EGFP.

PubMed

Deng, Yaqi; Kim, BongWoo; He, Xuelian; Kim, Sunja; Lu, Changqing; Wang, Haibo; Cho, Ssang-Goo; Hou, Yiping; Li, Jianrong; Zhao, Xianghui; Lu, Q Richard

2014-04-01

Myelinogenesis is a complex process that involves substantial and dynamic changes in plasma membrane architecture and myelin interaction with axons. Highly ramified processes of oligodendrocytes in the central nervous system (CNS) make axonal contact and then extrapolate to wrap around axons and form multilayer compact myelin sheathes. Currently, the mechanisms governing myelin sheath assembly and axon selection by myelinating cells are not fully understood. Here, we generated a transgenic mouse line expressing the membrane-anchored green fluorescent protein (mEGFP) in myelinating cells, which allow live imaging of details of myelinogenesis and cellular behaviors in the nervous systems. mEGFP expression is driven by the promoter of 2'-3'-cyclic nucleotide 3'-phosphodiesterase (CNP) that is expressed in the myelinating cell lineage. Robust mEGFP signals appear in the membrane processes of oligodendrocytes in the CNS and Schwann cells in the peripheral nervous system (PNS), wherein mEGFP expression defines the inner layers of myelin sheaths and Schmidt-Lanterman incisures in adult sciatic nerves. In addition, mEGFP expression can be used to track the extent of remyelination after demyelinating injury in a toxin-induced demyelination animal model. Taken together, the membrane-anchored mEGFP expression in the new transgenic line would facilitate direct visualization of dynamic myelin membrane formation and assembly during development and process remodeling during remyelination after various demyelinating injuries.

Disrupting Hypoxia-Induced Bicarbonate Transport Acidifies Tumor Cells and Suppresses Tumor Growth.

PubMed

McIntyre, Alan; Hulikova, Alzbeta; Ledaki, Ioanna; Snell, Cameron; Singleton, Dean; Steers, Graham; Seden, Peter; Jones, Dylan; Bridges, Esther; Wigfield, Simon; Li, Ji-Liang; Russell, Angela; Swietach, Pawel; Harris, Adrian L

2016-07-01

Tumor hypoxia is associated clinically with therapeutic resistance and poor patient outcomes. One feature of tumor hypoxia is activated expression of carbonic anhydrase IX (CA9), a regulator of pH and tumor growth. In this study, we investigated the hypothesis that impeding the reuptake of bicarbonate produced extracellularly by CA9 could exacerbate the intracellular acidity produced by hypoxic conditions, perhaps compromising cell growth and viability as a result. In 8 of 10 cancer cell lines, we found that hypoxia induced the expression of at least one bicarbonate transporter. The most robust and frequent inductions were of the sodium-driven bicarbonate transporters SLC4A4 and SLC4A9, which rely upon both HIF1α and HIF2α activity for their expression. In cancer cell spheroids, SLC4A4 or SLC4A9 disruption by either genetic or pharmaceutical approaches acidified intracellular pH and reduced cell growth. Furthermore, treatment of spheroids with S0859, a small-molecule inhibitor of sodium-driven bicarbonate transporters, increased apoptosis in the cell lines tested. Finally, RNAi-mediated attenuation of SLC4A9 increased apoptosis in MDA-MB-231 breast cancer spheroids and dramatically reduced growth of MDA-MB-231 breast tumors or U87 gliomas in murine xenografts. Our findings suggest that disrupting pH homeostasis by blocking bicarbonate import might broadly relieve the common resistance of hypoxic tumors to anticancer therapy. Cancer Res; 76(13); 3744-55. ©2016 AACR. ©2016 American Association for Cancer Research.

Multiplex engineering of industrial yeast genomes using CRISPRm.

PubMed

Ryan, Owen W; Cate, Jamie H D

2014-01-01

Global demand has driven the use of industrial strains of the yeast Saccharomyces cerevisiae for large-scale production of biofuels and renewable chemicals. However, the genetic basis of desired domestication traits is poorly understood because robust genetic tools do not exist for industrial hosts. We present an efficient, marker-free, high-throughput, and multiplexed genome editing platform for industrial strains of S. cerevisiae that uses plasmid-based expression of the CRISPR/Cas9 endonuclease and multiple ribozyme-protected single guide RNAs. With this multiplex CRISPR (CRISPRm) system, it is possible to integrate DNA libraries into the chromosome for evolution experiments, and to engineer multiple loci simultaneously. The CRISPRm tools should therefore find use in many higher-order synthetic biology applications to accelerate improvements in industrial microorganisms.

Augmentor α and β (FAM150) are ligands of the receptor tyrosine kinases ALK and LTK: Hierarchy and specificity of ligand-receptor interactions.

PubMed

Reshetnyak, Andrey V; Murray, Phillip B; Shi, Xiarong; Mo, Elizabeth S; Mohanty, Jyotidarsini; Tome, Francisco; Bai, Hanwen; Gunel, Murat; Lax, Irit; Schlessinger, Joseph

2015-12-29

Receptor tyrosine kinases (RTKs) are a class of cell surface receptors that, upon ligand binding, stimulate a variety of critical cellular functions. The orphan receptor anaplastic lymphoma kinase (ALK) is one of very few RTKs that remain without a firmly established protein ligand. Here we present a novel cytokine, FAM150B, which we propose naming augmentor-α (AUG-α), as a ligand for ALK. AUG-α binds ALK with high affinity and activates ALK in cells with subnanomolar potency. Detailed binding experiments using cells expressing ALK or the related receptor leukocyte tyrosine kinase (LTK) demonstrate that AUG-α binds and robustly activates both ALK and LTK. We show that the previously established LTK ligand FAM150A (AUG-β) is specific for LTK and only weakly binds to ALK. Furthermore, expression of AUG-α stimulates transformation of NIH/3T3 cells expressing ALK, induces IL-3 independent growth of Ba/F3 cells expressing ALK, and is expressed in neuroblastoma, a cancer partly driven by ALK. These experiments reveal the hierarchy and specificity of two cytokines as ligands for ALK and LTK and set the stage for elucidating their roles in development and disease states.

Knowledge discovery by accuracy maximization

PubMed Central

Cacciatore, Stefano; Luchinat, Claudio; Tenori, Leonardo

2014-01-01

Here we describe KODAMA (knowledge discovery by accuracy maximization), an unsupervised and semisupervised learning algorithm that performs feature extraction from noisy and high-dimensional data. Unlike other data mining methods, the peculiarity of KODAMA is that it is driven by an integrated procedure of cross-validation of the results. The discovery of a local manifold’s topology is led by a classifier through a Monte Carlo procedure of maximization of cross-validated predictive accuracy. Briefly, our approach differs from previous methods in that it has an integrated procedure of validation of the results. In this way, the method ensures the highest robustness of the obtained solution. This robustness is demonstrated on experimental datasets of gene expression and metabolomics, where KODAMA compares favorably with other existing feature extraction methods. KODAMA is then applied to an astronomical dataset, revealing unexpected features. Interesting and not easily predictable features are also found in the analysis of the State of the Union speeches by American presidents: KODAMA reveals an abrupt linguistic transition sharply separating all post-Reagan from all pre-Reagan speeches. The transition occurs during Reagan’s presidency and not from its beginning. PMID:24706821

Transition state theory for activated systems with driven anharmonic barriers.

PubMed

Revuelta, F; Craven, Galen T; Bartsch, Thomas; Borondo, F; Benito, R M; Hernandez, Rigoberto

2017-08-21

Classical transition state theory has been extended to address chemical reactions across barriers that are driven and anharmonic. This resolves a challenge to the naive theory that necessarily leads to recrossings and approximate rates because it relies on a fixed dividing surface. We develop both perturbative and numerical methods for the computation of a time-dependent recrossing-free dividing surface for a model anharmonic system in a solvated environment that interacts strongly with an oscillatory external field. We extend our previous work, which relied either on a harmonic approximation or on periodic force driving. We demonstrate that the reaction rate, expressed as the long-time flux of reactive trajectories, can be extracted directly from the stability exponents, namely, Lyapunov exponents, of the moving dividing surface. Comparison to numerical results demonstrates the accuracy and robustness of this approach for the computation of optimal (recrossing-free) dividing surfaces and reaction rates in systems with Markovian solvation forces. The resulting reaction rates are in strong agreement with those determined from the long-time flux of reactive trajectories.

Set-membership fault detection under noisy environment with application to the detection of abnormal aircraft control surface positions

NASA Astrophysics Data System (ADS)

El Houda Thabet, Rihab; Combastel, Christophe; Raïssi, Tarek; Zolghadri, Ali

2015-09-01

The paper develops a set membership detection methodology which is applied to the detection of abnormal positions of aircraft control surfaces. Robust and early detection of such abnormal positions is an important issue for early system reconfiguration and overall optimisation of aircraft design. In order to improve fault sensitivity while ensuring a high level of robustness, the method combines a data-driven characterisation of noise and a model-driven approach based on interval prediction. The efficiency of the proposed methodology is illustrated through simulation results obtained based on data recorded in several flight scenarios of a highly representative aircraft benchmark.

Robust Smoothing: Smoothing Parameter Selection and Applications to Fluorescence Spectroscopy∂

PubMed Central

Lee, Jong Soo; Cox, Dennis D.

2009-01-01

Fluorescence spectroscopy has emerged in recent years as an effective way to detect cervical cancer. Investigation of the data preprocessing stage uncovered a need for a robust smoothing to extract the signal from the noise. Various robust smoothing methods for estimating fluorescence emission spectra are compared and data driven methods for the selection of smoothing parameter are suggested. The methods currently implemented in R for smoothing parameter selection proved to be unsatisfactory, and a computationally efficient procedure that approximates robust leave-one-out cross validation is presented. PMID:20729976

FLT3-ITD confers resistance to the PI3K/Akt pathway inhibitors by protecting the mTOR/4EBP1/Mcl-1 pathway through STAT5 activation in acute myeloid leukemia

PubMed Central

Nogami, Ayako; Oshikawa, Gaku; Okada, Keigo; Fukutake, Shusaku; Umezawa, Yoshihiro; Nagao, Toshikage; Kurosu, Tetsuya; Miura, Osamu

2015-01-01

FLT3-ITD and FLT3-TKD are the most frequent tyrosine kinase mutations in acute myeloid leukemia (AML), with the former associated with poor prognosis. Here, we show that the PI3K inhibitor GDC-0941 or the Akt inhibitor MK-2206 induced apoptosis through the mitochondria-mediated intrinsic pathway more efficiently in hematopoietic 32D cells driven by FLT3-TKD (32D/TKD) than FLT3-ITD (32D/ITD), which robustly activated STAT5. The resistance to GDC-0941 and MK-2206 was gained by expression of the constitutively activated STAT5 mutant STAT5A1*6 in 32D/TKD cells, while it was abrogated by the STAT5 inhibitor pimozide in 32D/ITD cells or FLT3-ITD-expressing human leukemic MV4–11 cells. GDC-0941 or MK-2206 induced dephosphorylation of 4EBP1 more conspicuously in 32D/TKD than in 32D/ITD, which was prevented or augmented by STAT5A1*6 or pimozide, respectively, and correlated with downregulation of the eIF4E/eIF4G complex formation and Mcl-1 expression. Furthermore, exogenous expression of Mcl-1 endowed resistance to GDC-0941 and MK-2206 on 32D/TKD cells. Finally, it was confirmed in primary AML cells with FLT3-ITD that pimozide enhanced 4EBP1 dephosphorylation and Mcl-1 downregulation to augment cytotoxicity of GDC-0941. These data suggest that the robust STAT5 activation by FLT3-ITD protects cells treated with the PI3K/Akt pathway inhibitors from apoptosis by maintaining Mcl-1 expression through the mTORC1/4EBP1/eIF4E pathway. PMID:25826077

FLT3-ITD confers resistance to the PI3K/Akt pathway inhibitors by protecting the mTOR/4EBP1/Mcl-1 pathway through STAT5 activation in acute myeloid leukemia.

PubMed

Nogami, Ayako; Oshikawa, Gaku; Okada, Keigo; Fukutake, Shusaku; Umezawa, Yoshihiro; Nagao, Toshikage; Kurosu, Tetsuya; Miura, Osamu

2015-04-20

FLT3-ITD and FLT3-TKD are the most frequent tyrosine kinase mutations in acute myeloid leukemia (AML), with the former associated with poor prognosis. Here, we show that the PI3K inhibitor GDC-0941 or the Akt inhibitor MK-2206 induced apoptosis through the mitochondria-mediated intrinsic pathway more efficiently in hematopoietic 32D cells driven by FLT3-TKD (32D/TKD) than FLT3-ITD (32D/ITD), which robustly activated STAT5. The resistance to GDC-0941 and MK-2206 was gained by expression of the constitutively activated STAT5 mutant STAT5A1*6 in 32D/TKD cells, while it was abrogated by the STAT5 inhibitor pimozide in 32D/ITD cells or FLT3-ITD-expressing human leukemic MV4-11 cells. GDC-0941 or MK-2206 induced dephosphorylation of 4EBP1 more conspicuously in 32D/TKD than in 32D/ITD, which was prevented or augmented by STAT5A1*6 or pimozide, respectively, and correlated with downregulation of the eIF4E/eIF4G complex formation and Mcl-1 expression. Furthermore, exogenous expression of Mcl-1 endowed resistance to GDC-0941 and MK-2206 on 32D/TKD cells. Finally, it was confirmed in primary AML cells with FLT3-ITD that pimozide enhanced 4EBP1 dephosphorylation and Mcl-1 downregulation to augment cytotoxicity of GDC-0941. These data suggest that the robust STAT5 activation by FLT3-ITD protects cells treated with the PI3K/Akt pathway inhibitors from apoptosis by maintaining Mcl-1 expression through the mTORC1/4EBP1/eIF4E pathway.

Generalized extracellular molecule sensor platform for programming cellular behavior.

PubMed

Scheller, Leo; Strittmatter, Tobias; Fuchs, David; Bojar, Daniel; Fussenegger, Martin

2018-04-23

Strategies for expanding the sensor space of designer receptors are urgently needed to tailor cell-based therapies to respond to any type of medically relevant molecules. Here, we describe a universal approach to designing receptor scaffolds that enables antibody-specific molecular input to activate JAK/STAT, MAPK, PLCG or PI3K/Akt signaling rewired to transgene expression driven by synthetic promoters. To demonstrate its scope, we equipped the GEMS (generalized extracellular molecule sensor) platform with antibody fragments targeting a synthetic azo dye, nicotine, a peptide tag and the PSA (prostate-specific antigen) biomarker, thereby covering inputs ranging from small molecules to proteins. These four GEMS devices provided robust signaling and transgene expression with high signal-to-noise ratios in response to their specific ligands. The sensitivity of the nicotine- and PSA-specific GEMS devices matched the clinically relevant concentration ranges, and PSA-specific GEMS were able to detect pathological PSA levels in the serum of patients diagnosed with prostate cancer.

A sensory-driven controller for quadruped locomotion.

PubMed

Ferreira, César; Santos, Cristina P

2017-02-01

Locomotion of quadruped robots has not yet achieved the harmony, flexibility, efficiency and robustness of its biological counterparts. Biological research showed that spinal reflexes are crucial for a successful locomotion in the most varied terrains. In this context, the development of bio-inspired controllers seems to be a good way to move toward an efficient and robust robotic locomotion, by mimicking their biological counterparts. This contribution presents a sensory-driven controller designed for the simulated Oncilla quadruped robot. In the proposed reflex controller, movement is generated through the robot's interactions with the environment, and therefore, the controller is solely dependent on sensory information. The results show that the reflex controller is capable of producing stable quadruped locomotion with a regular stepping pattern. Furthermore, it is capable of dealing with slopes without changing the parameters and with small obstacles, overcoming them successfully. Finally, system robustness was verified by adding noise to sensors and actuators and also delays.

What are the most effective strategies for improving quality and safety of health care?

PubMed

Scott, I

2009-06-01

There is now a plethora of different quality improvement strategies (QIS) for optimizing health care, some clinician/patient driven, others manager/policy-maker driven. Which of these are most effective remains unclear despite expressed concerns about potential for QIS-related patient harm and wasting of resources. The objective of this study was to review published literature assessing the relative effectiveness of different QIS. Data sources comprising PubMed Clinical Queries, Cochrane Library and its Effective Practice and Organization of Care database, and HealthStar were searched for studies of QIS between January 1985 and February 2008 using search terms based on an a priori QIS classification suggested by experts. Systematic reviews of controlled trials were selected in determining effect sizes for specific QIS, which were compared as a narrative meta-review. Clinician/patient driven QIS were associated with stronger evidence of efficacy and larger effect sizes than manager/policy-maker driven QIS. The most effective strategies (>10% absolute increase in appropriate care or equivalent measure) included clinician-directed audit and feedback cycles, clinical decision support systems, specialty outreach programmes, chronic disease management programmes, continuing professional education based on interactive small-group case discussions, and patient-mediated clinician reminders. Pay-for-performance schemes directed to clinician groups and organizational process redesign were modestly effective. Other manager/policy-maker driven QIS including continuous quality improvement programmes, risk and safety management systems, public scorecards and performance reports, external accreditation, and clinical governance arrangements have not been adequately evaluated with regard to effectiveness. QIS are heterogeneous and methodological flaws in much of the evaluative literature limit validity and generalizability of results. Based on current best available evidence, clinician/patient driven QIS appear to be more effective than manager/policy-maker driven QIS although the latter have, in many instances, attracted insufficient robust evaluations to accurately determine their comparative effectiveness.

Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

PubMed

Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

2016-01-01

Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for the ubiquity of nonlinear dynamics in gene expression networks, and generate useful guidelines for the design of synthetic gene circuits.

Data-Driven Robust M-LS-SVR-Based NARX Modeling for Estimation and Control of Molten Iron Quality Indices in Blast Furnace Ironmaking.

PubMed

Zhou, Ping; Guo, Dongwei; Wang, Hong; Chai, Tianyou

2017-09-29

Optimal operation of an industrial blast furnace (BF) ironmaking process largely depends on a reliable measurement of molten iron quality (MIQ) indices, which are not feasible using the conventional sensors. This paper proposes a novel data-driven robust modeling method for the online estimation and control of MIQ indices. First, a nonlinear autoregressive exogenous (NARX) model is constructed for the MIQ indices to completely capture the nonlinear dynamics of the BF process. Then, considering that the standard least-squares support vector regression (LS-SVR) cannot directly cope with the multioutput problem, a multitask transfer learning is proposed to design a novel multioutput LS-SVR (M-LS-SVR) for the learning of the NARX model. Furthermore, a novel M-estimator is proposed to reduce the interference of outliers and improve the robustness of the M-LS-SVR model. Since the weights of different outlier data are properly given by the weight function, their corresponding contributions on modeling can properly be distinguished, thus a robust modeling result can be achieved. Finally, a novel multiobjective evaluation index on the modeling performance is developed by comprehensively considering the root-mean-square error of modeling and the correlation coefficient on trend fitting, based on which the nondominated sorting genetic algorithm II is used to globally optimize the model parameters. Both experiments using industrial data and industrial applications illustrate that the proposed method can eliminate the adverse effect caused by the fluctuation of data in BF process efficiently. This indicates its stronger robustness and higher accuracy. Moreover, control testing shows that the developed model can be well applied to realize data-driven control of the BF process.

Data-Driven Robust M-LS-SVR-Based NARX Modeling for Estimation and Control of Molten Iron Quality Indices in Blast Furnace Ironmaking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Ping; Guo, Dongwei; Wang, Hong

Optimal operation of an industrial blast furnace (BF) ironmaking process largely depends on a reliable measurement of molten iron quality (MIQ) indices, which are not feasible using the conventional sensors. This paper proposes a novel data-driven robust modeling method for the online estimation and control of MIQ indices. First, a nonlinear autoregressive exogenous (NARX) model is constructed for the MIQ indices to completely capture the nonlinear dynamics of the BF process. Then, considering that the standard least-squares support vector regression (LS-SVR) cannot directly cope with the multioutput problem, a multitask transfer learning is proposed to design a novel multioutput LS-SVRmore » (M-LS-SVR) for the learning of the NARX model. Furthermore, a novel M-estimator is proposed to reduce the interference of outliers and improve the robustness of the M-LS-SVR model. Since the weights of different outlier data are properly given by the weight function, their corresponding contributions on modeling can properly be distinguished, thus a robust modeling result can be achieved. Finally, a novel multiobjective evaluation index on the modeling performance is developed by comprehensively considering the root-mean-square error of modeling and the correlation coefficient on trend fitting, based on which the nondominated sorting genetic algorithm II is used to globally optimize the model parameters. Both experiments using industrial data and industrial applications illustrate that the proposed method can eliminate the adverse effect caused by the fluctuation of data in BF process efficiently. In conclusion, this indicates its stronger robustness and higher accuracy. Moreover, control testing shows that the developed model can be well applied to realize data-driven control of the BF process.« less

Data-Driven Robust M-LS-SVR-Based NARX Modeling for Estimation and Control of Molten Iron Quality Indices in Blast Furnace Ironmaking

DOE PAGES

Zhou, Ping; Guo, Dongwei; Wang, Hong; ...

2017-09-29

Optimal operation of an industrial blast furnace (BF) ironmaking process largely depends on a reliable measurement of molten iron quality (MIQ) indices, which are not feasible using the conventional sensors. This paper proposes a novel data-driven robust modeling method for the online estimation and control of MIQ indices. First, a nonlinear autoregressive exogenous (NARX) model is constructed for the MIQ indices to completely capture the nonlinear dynamics of the BF process. Then, considering that the standard least-squares support vector regression (LS-SVR) cannot directly cope with the multioutput problem, a multitask transfer learning is proposed to design a novel multioutput LS-SVRmore » (M-LS-SVR) for the learning of the NARX model. Furthermore, a novel M-estimator is proposed to reduce the interference of outliers and improve the robustness of the M-LS-SVR model. Since the weights of different outlier data are properly given by the weight function, their corresponding contributions on modeling can properly be distinguished, thus a robust modeling result can be achieved. Finally, a novel multiobjective evaluation index on the modeling performance is developed by comprehensively considering the root-mean-square error of modeling and the correlation coefficient on trend fitting, based on which the nondominated sorting genetic algorithm II is used to globally optimize the model parameters. Both experiments using industrial data and industrial applications illustrate that the proposed method can eliminate the adverse effect caused by the fluctuation of data in BF process efficiently. In conclusion, this indicates its stronger robustness and higher accuracy. Moreover, control testing shows that the developed model can be well applied to realize data-driven control of the BF process.« less

Exploring the Role of Spatial Frequency Information during Neural Emotion Processing in Human Infants.

PubMed

Jessen, Sarah; Grossmann, Tobias

2017-01-01

Enhanced attention to fear expressions in adults is primarily driven by information from low as opposed to high spatial frequencies contained in faces. However, little is known about the role of spatial frequency information in emotion processing during infancy. In the present study, we examined the role of low compared to high spatial frequencies in the processing of happy and fearful facial expressions by using filtered face stimuli and measuring event-related brain potentials (ERPs) in 7-month-old infants ( N = 26). Our results revealed that infants' brains discriminated between emotional facial expressions containing high but not between expressions containing low spatial frequencies. Specifically, happy faces containing high spatial frequencies elicited a smaller Nc amplitude than fearful faces containing high spatial frequencies and happy and fearful faces containing low spatial frequencies. Our results demonstrate that already in infancy spatial frequency content influences the processing of facial emotions. Furthermore, we observed that fearful facial expressions elicited a comparable Nc response for high and low spatial frequencies, suggesting a robust detection of fearful faces irrespective of spatial frequency content, whereas the detection of happy facial expressions was contingent upon frequency content. In summary, these data provide new insights into the neural processing of facial emotions in early development by highlighting the differential role played by spatial frequencies in the detection of fear and happiness.

Virally delivered Channelrhodopsin-2 Safely and Effectively Restores Visual Function in Multiple Mouse Models of Blindness

PubMed Central

Doroudchi, M Mehdi; Greenberg, Kenneth P; Liu, Jianwen; Silka, Kimberly A; Boyden, Edward S; Lockridge, Jennifer A; Arman, A Cyrus; Janani, Ramesh; Boye, Shannon E; Boye, Sanford L; Gordon, Gabriel M; Matteo, Benjamin C; Sampath, Alapakkam P; Hauswirth, William W; Horsager, Alan

2011-01-01

Previous work established retinal expression of channelrhodopsin-2 (ChR2), an algal cation channel gated by light, restored physiological and behavioral visual responses in otherwise blind rd1 mice. However, a viable ChR2-based human therapy must meet several key criteria: (i) ChR2 expression must be targeted, robust, and long-term, (ii) ChR2 must provide long-term and continuous therapeutic efficacy, and (iii) both viral vector delivery and ChR2 expression must be safe. Here, we demonstrate the development of a clinically relevant therapy for late stage retinal degeneration using ChR2. We achieved specific and stable expression of ChR2 in ON bipolar cells using a recombinant adeno-associated viral vector (rAAV) packaged in a tyrosine-mutated capsid. Targeted expression led to ChR2-driven electrophysiological ON responses in postsynaptic retinal ganglion cells and significant improvement in visually guided behavior for multiple models of blindness up to 10 months postinjection. Light levels to elicit visually guided behavioral responses were within the physiological range of cone photoreceptors. Finally, chronic ChR2 expression was nontoxic, with transgene biodistribution limited to the eye. No measurable immune or inflammatory response was observed following intraocular vector administration. Together, these data indicate that virally delivered ChR2 can provide a viable and efficacious clinical therapy for photoreceptor disease-related blindness. PMID:21505421

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Specialized Motor-Driven dusp1 Expression in the Song Systems of Multiple Lineages of Vocal Learning Birds

PubMed Central

Horita, Haruhito; Kobayashi, Masahiko; Liu, Wan-chun; Oka, Kotaro; Jarvis, Erich D.; Wada, Kazuhiro

2012-01-01

Mechanisms for the evolution of convergent behavioral traits are largely unknown. Vocal learning is one such trait that evolved multiple times and is necessary in humans for the acquisition of spoken language. Among birds, vocal learning is evolved in songbirds, parrots, and hummingbirds. Each time similar forebrain song nuclei specialized for vocal learning and production have evolved. This finding led to the hypothesis that the behavioral and neuroanatomical convergences for vocal learning could be associated with molecular convergence. We previously found that the neural activity-induced gene dual specificity phosphatase 1 (dusp1) was up-regulated in non-vocal circuits, specifically in sensory-input neurons of the thalamus and telencephalon; however, dusp1 was not up-regulated in higher order sensory neurons or motor circuits. Here we show that song motor nuclei are an exception to this pattern. The song nuclei of species from all known vocal learning avian lineages showed motor-driven up-regulation of dusp1 expression induced by singing. There was no detectable motor-driven dusp1 expression throughout the rest of the forebrain after non-vocal motor performance. This pattern contrasts with expression of the commonly studied activity-induced gene egr1, which shows motor-driven expression in song nuclei induced by singing, but also motor-driven expression in adjacent brain regions after non-vocal motor behaviors. In the vocal non-learning avian species, we found no detectable vocalizing-driven dusp1 expression in the forebrain. These findings suggest that independent evolutions of neural systems for vocal learning were accompanied by selection for specialized motor-driven expression of the dusp1 gene in those circuits. This specialized expression of dusp1 could potentially lead to differential regulation of dusp1-modulated molecular cascades in vocal learning circuits. PMID:22876306

[Comparison of TTR and CMV promoters in vivo and in vitro via a secreted luciferase reporter system].

PubMed

Luo, Shun-Tao; Tian, Wen-Hong; Wang, Gang; Dong, Xiao-Yan; Yang, Li; Wu, Xiao-Bing

2009-11-01

GLuc (Gaussia luciferase) is a secreted luciferase with high sensitivity. In this study, we primarily compared expression character of PTTR with that of PCMV, relied on easy secretion, high sensitivity and simple and fast detection of GLuc. We firstly constructed two plasmids pAAV2-neo-TTR-GLuc and pAAV2-neo-CMV-GLuc. Then, 4 cell lines were transfected with the two plasmids in aid of Lipofectamine 2000, including Huh7 and HepG2, which are derived from liver cells, as well as HEK293 and HeLaS3 cells, which are non-liver cell lines. We monitored the expression of GLuc in the supernatant of these cell cultures at different time points post-transfection. Furthermore, we injected the two plasmids with different doses into BALB/c mice by the means of hydrodynamic delivery and monitored the GLuc expression in vivo with 2.5 microl tail tip blood since 2 h post-injection. The cell assay results suggested that the expression of GLuc driven by CMV promoter was significantly higher than that of GLuc driven by TTR promoter. And, the luciferase activity of GLuc driven by CMV promoter was 50-300 times higher than that of GLuc driven by TTR promoter in HEK293 and HeLaS3 cell lines, but less than 10 times higher than that of GLuc driven by TTR promoter in the HepG2 and Huh7 cell lines, indicating the relative liver-specificity of TTR promoter. In the animal assay, the higher luciferase activity was determined in CMV promoter group than in TTR promoter group at different doses of the two plasmids. But the expression patterns for the two promoters differed obviously. The expression of GLuc driven by CMV promoter reached the maximum 10 hours post-injection and declined rapidly; while the expression of GLuc driven by TTR promoter reached the maximum 48 hours after delivery, and declined very slowly. These results implied that PTTR could keep expression of driven gene in a long time although its expression intensity is lower than PCMV's. Thus, it is more suitable for maintaining longer expression of target genes in liver.

Enhancement of matrix production and cell proliferation in human annulus cells under bioreactor culture.

PubMed

Yang, Xinlin; Wang, Daidong; Hao, Jianrong; Gong, Meiqing; Arlet, Vincent; Balian, Gary; Shen, Francis H; Li, Xudong Joshua

2011-06-01

Tissue engineering is a promising approach for treatment of disc degeneration. Herein, we evaluated effects of rotating bioreactor culture on the extracellular matrix production and proliferation of human annulus fibrosus (AF) cells. AF cells were embedded into alginate beads, and then cultured up to 3 weeks in a rotating wall vessel bioreactor or a static vessel. By real-time reverse transcription-polymerase chain reaction, expression of aggrecan, collagen type I and type II, and collagen prolyl 4-hydroxylase II was remarkably elevated, whereas expression of matrix metalloproteinase 3 and a disintegrin and metalloproteinase with thrombospondin motifs 5 was significantly decreased under bioreactor. Biochemical analysis revealed that the levels of the whole cell-associated proteoglycan and collagen were approximately five- and twofolds in rotating bioreactor, respectively, compared to those in static culture. Moreover, AF cell proliferation was augmented in rotating bioreactor. DNA contents were threefolds higher in rotating bioreactor than that in static culture. Expression of the proliferating cell nuclear antigen was robustly enhanced in rotating bioreactor as early as 1 week. Our findings suggested that rotating bioreactor culture would be an effective technique for expansion of human annulus cells for tissue engineering driven treatment of disc degeneration.

Cloning, characterization, and chromosomal mapping of a human electroneutral Na(+)-driven Cl-HCO3 exchanger.

PubMed

Grichtchenko, I I; Choi, I; Zhong, X; Bray-Ward, P; Russell, J M; Boron, W F

2001-03-16

The electroneutral Na(+)-driven Cl-HCO3 exchanger is a key mechanism for regulating intracellular pH (pH(i)) in neurons, glia, and other cells. Here we report the cloning, tissue distribution, chromosomal location, and functional characterization of the cDNA of such a transporter (NDCBE1) from human brain (GenBank accession number AF069512). NDCBE1, which encodes 1044 amino acids, is 34% identical to the mammalian anion exchanger (AE2); approximately 50% to the electrogenic Na/HCO3 cotransporter (NBCe1) from salamander, rat, and humans; approximately 73% to mammalian electroneutral Na/HCO3 cotransporters (NBCn1); 71% to mouse NCBE; and 47% to a Na(+)-driven anion exchanger (NDAE1) from Drosophila. Northern blot analysis of NDCBE1 shows a robust approximately 12-kilobase signal in all major regions of human brain and in testis, and weaker signals in kidney and ovary. This human gene (SLC4A8) maps to chromosome 12q13. When expressed in Xenopus oocytes and running in the forward direction, NDCBE1 is electroneutral and mediates increases in both pH(i) and [Na(+)](i) (monitored with microelectrodes) that require HCO3(-) and are blocked by 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). The pH(i) increase also requires extracellular Na(+). The Na(+):HCO3(-) stoichiometry is 1:2. Forward-running NDCBE1 mediates a 36Cl efflux that requires extracellular Na(+) and HCO3(-) and is blocked by DIDS. Running in reverse, NDCBE1 requires extracellular Cl(-). Thus, NDCBE1 encodes a human, electroneutral Na(+)-driven Cl-HCO3 exchanger.

Robust generation and expansion of skeletal muscle progenitors and myocytes from human pluripotent stem cells.

PubMed

Shelton, Michael; Kocharyan, Avetik; Liu, Jun; Skerjanc, Ilona S; Stanford, William L

2016-05-15

Human pluripotent stem cells provide a developmental model to study early embryonic and tissue development, tease apart human disease processes, perform drug screens to identify potential molecular effectors of in situ regeneration, and provide a source for cell and tissue based transplantation. Highly efficient differentiation protocols have been established for many cell types and tissues; however, until very recently robust differentiation into skeletal muscle cells had not been possible unless driven by transgenic expression of master regulators of myogenesis. Nevertheless, several breakthrough protocols have been published in the past two years that efficiently generate cells of the skeletal muscle lineage from pluripotent stem cells. Here, we present an updated version of our recently described 50-day protocol in detail, whereby chemically defined media are used to drive and support muscle lineage development from initial CHIR99021-induced mesoderm through to PAX7-expressing skeletal muscle progenitors and mature skeletal myocytes. Furthermore, we report an optional method to passage and expand differentiating skeletal muscle progenitors approximately 3-fold every 2weeks using Collagenase IV and continued FGF2 supplementation. Both protocols have been optimized using a variety of human pluripotent stem cell lines including patient-derived induced pluripotent stem cells. Taken together, our differentiation and expansion protocols provide sufficient quantities of skeletal muscle progenitors and myocytes that could be used for a variety of studies. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Subject independent facial expression recognition with robust face detection using a convolutional neural network.

PubMed

Matsugu, Masakazu; Mori, Katsuhiko; Mitari, Yusuke; Kaneda, Yuji

2003-01-01

Reliable detection of ordinary facial expressions (e.g. smile) despite the variability among individuals as well as face appearance is an important step toward the realization of perceptual user interface with autonomous perception of persons. We describe a rule-based algorithm for robust facial expression recognition combined with robust face detection using a convolutional neural network. In this study, we address the problem of subject independence as well as translation, rotation, and scale invariance in the recognition of facial expression. The result shows reliable detection of smiles with recognition rate of 97.6% for 5600 still images of more than 10 subjects. The proposed algorithm demonstrated the ability to discriminate smiling from talking based on the saliency score obtained from voting visual cues. To the best of our knowledge, it is the first facial expression recognition model with the property of subject independence combined with robustness to variability in facial appearance.

Rod- and cone-driven responses in mice expressing human L-cone pigment

PubMed Central

Atorf, Jenny; Neitz, Maureen; Neitz, Jay

2015-01-01

The mouse is commonly used for studying retinal processing, primarily because it is amenable to genetic manipulation. To accurately study photoreceptor driven signals in the healthy and diseased retina, it is of great importance to isolate the responses of single photoreceptor types. This is not easily achieved in mice because of the strong overlap of rod and M-cone absorption spectra (i.e., maxima at 498 and 508 nm, respectively). With a newly developed mouse model (Opn1lwLIAIS) expressing a variant of the human L-cone pigment (561 nm) instead of the mouse M-opsin, the absorption spectra are substantially separated, allowing retinal physiology to be studied using silent substitution stimuli. Unlike conventional chromatic isolation methods, this spectral compensation approach can isolate single photoreceptor subtypes without changing the retinal adaptation. We measured flicker electroretinograms in these mutants under ketamine-xylazine sedation with double silent substitution (silent S-cone and either rod or M/L-cones) and obtained robust responses for both rods and (L-)cones. Small signals were yielded in wild-type mice, whereas heterozygotes exhibited responses that were generally intermediate to both. Fundamental response amplitudes and phase behaviors (as a function of temporal frequency) in all genotypes were largely similar. Surprisingly, isolated (L-)cone and rod response properties in the mutant strain were alike. Thus the LIAIS mouse warrants a more comprehensive in vivo assessment of photoreceptor subtype-specific physiology, because it overcomes the hindrance of overlapping spectral sensitivities present in the normal mouse. PMID:26245314

Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

PubMed

Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

2009-06-04

Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

Use of Attribute Driven Incremental Discretization and Logic Learning Machine to build a prognostic classifier for neuroblastoma patients.

PubMed

Cangelosi, Davide; Muselli, Marco; Parodi, Stefano; Blengio, Fabiola; Becherini, Pamela; Versteeg, Rogier; Conte, Massimo; Varesio, Luigi

2014-01-01

Cancer patient's outcome is written, in part, in the gene expression profile of the tumor. We previously identified a 62-probe sets signature (NB-hypo) to identify tissue hypoxia in neuroblastoma tumors and showed that NB-hypo stratified neuroblastoma patients in good and poor outcome 1. It was important to develop a prognostic classifier to cluster patients into risk groups benefiting of defined therapeutic approaches. Novel classification and data discretization approaches can be instrumental for the generation of accurate predictors and robust tools for clinical decision support. We explored the application to gene expression data of Rulex, a novel software suite including the Attribute Driven Incremental Discretization technique for transforming continuous variables into simplified discrete ones and the Logic Learning Machine model for intelligible rule generation. We applied Rulex components to the problem of predicting the outcome of neuroblastoma patients on the bases of 62 probe sets NB-hypo gene expression signature. The resulting classifier consisted in 9 rules utilizing mainly two conditions of the relative expression of 11 probe sets. These rules were very effective predictors, as shown in an independent validation set, demonstrating the validity of the LLM algorithm applied to microarray data and patients' classification. The LLM performed as efficiently as Prediction Analysis of Microarray and Support Vector Machine, and outperformed other learning algorithms such as C4.5. Rulex carried out a feature selection by selecting a new signature (NB-hypo-II) of 11 probe sets that turned out to be the most relevant in predicting outcome among the 62 of the NB-hypo signature. Rules are easily interpretable as they involve only few conditions. Our findings provided evidence that the application of Rulex to the expression values of NB-hypo signature created a set of accurate, high quality, consistent and interpretable rules for the prediction of neuroblastoma patients' outcome. We identified the Rulex weighted classification as a flexible tool that can support clinical decisions. For these reasons, we consider Rulex to be a useful tool for cancer classification from microarray gene expression data.

Robust ion current oscillations under a steady electric field: An ion channel analog.

PubMed

Yan, Yu; Wang, Yunshan; Senapati, Satyajyoti; Schiffbauer, Jarrod; Yossifon, Gilad; Chang, Hsueh-Chia

2016-08-01

We demonstrate a nonlinear, nonequilibrium field-driven ion flux phenomenon, which unlike Teorell's nonlinear multiple field theory, requires only the application of one field: robust autonomous current-mass flux oscillations across a porous monolith coupled to a capillary with a long air bubble, which mimics a hydrophobic protein in an ion channel. The oscillations are driven by the hysteretic wetting dynamics of the meniscus when electro-osmotic flow and pressure driven backflow, due to bubble expansion, compete to approach zero mass flux within the monolith. Delayed rupture of the film around the advancing bubble cuts off the electric field and switches the monolith mass flow from the former to the latter. The meniscus then recedes and repairs the rupture to sustain an oscillation for a range of applied fields. This generic mechanism shares many analogs with current oscillations in cell membrane ion channel. At sufficiently high voltage, the system undergoes a state transition characterized by appearance of the ubiquitous 1/f power spectrum.

Design and implementation of robust controllers for a gait trainer.

PubMed

Wang, F C; Yu, C H; Chou, T Y

2009-08-01

This paper applies robust algorithms to control an active gait trainer for children with walking disabilities. Compared with traditional rehabilitation procedures, in which two or three trainers are required to assist the patient, a motor-driven mechanism was constructed to improve the efficiency of the procedures. First, a six-bar mechanism was designed and constructed to mimic the trajectory of children's ankles in walking. Second, system identification techniques were applied to obtain system transfer functions at different operating points by experiments. Third, robust control algorithms were used to design Hinfinity robust controllers for the system. Finally, the designed controllers were implemented to verify experimentally the system performance. From the results, the proposed robust control strategies are shown to be effective.

A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

PubMed Central

Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

2015-01-01

In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes.

PubMed

Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

2015-01-01

In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data.

Conditional deletion of p53 and Rb in the renin-expressing compartment of the pancreas leads to a highly penetrant metastatic pancreatic neuroendocrine carcinoma

PubMed Central

Glenn, Sean T.; Jones, Craig A.; Sexton, Sandra; LeVea, Charles M.; Caraker, Susan M.; Hajduczok, George; Gross, Kenneth W.

2014-01-01

Efforts to model human pancreatic neuroendocrine tumors (PanNET) in animals have been moderately successful, with minimal evidence for glucagonomas or metastatic spread. The renin gene while classically associated with expression in the kidney is also expressed in many other extra-renal tissues including the pancreas. To induce tumorigenesis within renin specific tissues, floxed alleles of p53 and Rb were selectively abrogated using Cre-recombinase driven by the renin promoter. The primary neoplasm generated is a highly metastatic islet cell carcinoma of the pancreas. Lineage tracing identifies descendants of renin-expressing cells as pancreatic alpha cells despite a lack of active renin expression in the mature pancreas. Both primary and metastatic tumors express high levels of glucagon, furthermore an increased level of glucagon is found in the serum identifying the pancreatic cancer as a functional glucagonoma. This new model is highly penetrant and exhibits robust frequency of metastases to lymph nodes and liver, mimicking human disease and provides a useful platform for better understanding pancreatic endocrine differentiation and development, as well as islet cell carcinogenesis. The use of fluorescent reporters for lineage tracing of the cells contributing to disease initiation and progression provides a unique opportunity to dissect the timeline of disease, examining mechanisms of the metastatic process, as well as recovering primary and metastatic cells for identifying co-operating mutations that are necessary for progression of disease. PMID:24292676

Conditional deletion of p53 and Rb in the renin-expressing compartment of the pancreas leads to a highly penetrant metastatic pancreatic neuroendocrine carcinoma.

PubMed

Glenn, S T; Jones, C A; Sexton, S; LeVea, C M; Caraker, S M; Hajduczok, G; Gross, K W

2014-12-11

Efforts to model human pancreatic neuroendocrine tumors (PanNETs) in animals have been moderately successful, with minimal evidence for glucagonomas or metastatic spread. The renin gene, although classically associated with expression in the kidney, is also expressed in many other extrarenal tissues including the pancreas. To induce tumorigenesis within rennin-specific tissues, floxed alleles of p53 and Rb were selectively abrogated using Cre-recombinase driven by the renin promoter. The primary neoplasm generated is a highly metastatic islet cell carcinoma of the pancreas. Lineage tracing identifies descendants of renin-expressing cells as pancreatic alpha cells despite a lack of active renin expression in the mature pancreas. Both primary and metastatic tumors express high levels of glucagon; furthermore, an increased level of glucagon is found in the serum, identifying the pancreatic cancer as a functional glucagonoma. This new model is highly penetrant and exhibits robust frequency of metastases to the lymph nodes and the liver, mimicking human disease, and provides a useful platform for better understanding pancreatic endocrine differentiation and development, as well as islet cell carcinogenesis. The use of fluorescent reporters for lineage tracing of the cells contributing to disease initiation and progression provides an unique opportunity to dissect the timeline of disease, examining mechanisms of the metastatic process, as well as recovering primary and metastatic cells for identifying cooperating mutations that are necessary for progression of disease.

Massive-scale gene co-expression network construction and robustness testing using random matrix theory.

PubMed

Gibson, Scott M; Ficklin, Stephen P; Isaacson, Sven; Luo, Feng; Feltus, Frank A; Smith, Melissa C

2013-01-01

The study of gene relationships and their effect on biological function and phenotype is a focal point in systems biology. Gene co-expression networks built using microarray expression profiles are one technique for discovering and interpreting gene relationships. A knowledge-independent thresholding technique, such as Random Matrix Theory (RMT), is useful for identifying meaningful relationships. Highly connected genes in the thresholded network are then grouped into modules that provide insight into their collective functionality. While it has been shown that co-expression networks are biologically relevant, it has not been determined to what extent any given network is functionally robust given perturbations in the input sample set. For such a test, hundreds of networks are needed and hence a tool to rapidly construct these networks. To examine functional robustness of networks with varying input, we enhanced an existing RMT implementation for improved scalability and tested functional robustness of human (Homo sapiens), rice (Oryza sativa) and budding yeast (Saccharomyces cerevisiae). We demonstrate dramatic decrease in network construction time and computational requirements and show that despite some variation in global properties between networks, functional similarity remains high. Moreover, the biological function captured by co-expression networks thresholded by RMT is highly robust.

Carrier-envelope phase-dependent effect of high-order sideband generation in ultrafast driven optomechanical system.

PubMed

Xiong, Hao; Si, Liu-Gang; Lü, Xin-You; Yang, Xiaoxue; Wu, Ying

2013-02-01

We analyze the features of the output field of a generic optomechanical system that is driven by a control field and a nanosecond driven pulse, and find a robust high-order sideband generation in optomechanical systems. The typical spectral structure, plateau and cutoff, confirms the nonperturbative nature of the effect, which is similar to high-order harmonic generation in atoms or molecules. Based on the phenomenon, we show that the carrier-envelope phase of laser pulses that contain huge numbers of cycles can cause profound effects.

Integrated direct/indirect adaptive robust motion trajectory tracking control of pneumatic cylinders

NASA Astrophysics Data System (ADS)

Meng, Deyuan; Tao, Guoliang; Zhu, Xiaocong

2013-09-01

This paper studies the precision motion trajectory tracking control of a pneumatic cylinder driven by a proportional-directional control valve. An integrated direct/indirect adaptive robust controller is proposed. The controller employs a physical model based indirect-type parameter estimation to obtain reliable estimates of unknown model parameters, and utilises a robust control method with dynamic compensation type fast adaptation to attenuate the effects of parameter estimation errors, unmodelled dynamics and disturbances. Due to the use of projection mapping, the robust control law and the parameter adaption algorithm can be designed separately. Since the system model uncertainties are unmatched, the recursive backstepping technology is adopted to design the robust control law. Extensive comparative experimental results are presented to illustrate the effectiveness of the proposed controller and its performance robustness to parameter variations and sudden disturbances.

In vivo labeling of cortical astrocytes with sulforhodamine 101 (SR101).

PubMed

Nimmerjahn, Axel; Helmchen, Fritjof

2012-03-01

Fluorescent markers that stain particular cell types in the intact brain are essential tools for fluorescence microscopy because they enable studies of structure and function of cells identified in this way. Although cell type-specific fluorescence staining can be achieved through promoter-driven expression of fluorescent proteins, this genetic approach is generally labor- and cost-intensive. Alternative viral approaches for targeted fluorophore expression are relatively invasive. For astrocytes, there is a simple alternative. This protocol describes an easy and robust method for rapid (within minutes) and high-contrast staining of astrocytes in defined regions of the intact rodent cortex using the synthetic, water-soluble but non-fixable red fluorescent dye sulforhodamine 101 (SR101). Selective staining is achieved through local uptake and gap junction-mediated spread of SR101 following its topical application or injection into tissue. Applications, technical pitfalls, and limitations of the SR101-staining technique are discussed. Given its simplicity and reliability, SR101 staining is a valuable tool for the study of astrocyte function in the intact brain and for in vivo fluorescence microscopy in general.

Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.

PubMed

Chen, Limo; Gibbons, Don L; Goswami, Sangeeta; Cortez, Maria Angelica; Ahn, Young-Ho; Byers, Lauren A; Zhang, Xuejun; Yi, Xiaohui; Dwyer, David; Lin, Wei; Diao, Lixia; Wang, Jing; Roybal, Jonathon; Patel, Mayuri; Ungewiss, Christin; Peng, David; Antonia, Scott; Mediavilla-Varela, Melanie; Robertson, Gordon; Suraokar, Milind; Welsh, James W; Erez, Baruch; Wistuba, Ignacio I; Chen, Lieping; Peng, Di; Wang, Shanshan; Ullrich, Stephen E; Heymach, John V; Kurie, Jonathan M; Qin, F Xiao-Feng

2014-10-28

Immunosuppression of tumour-infiltrating lymphocytes (TIL) is a common feature of advanced cancer, but its biological basis has remained obscure. We demonstrate here a molecular link between epithelial-to-mesenchymal transition (EMT) and CD8(+) TIL immunosuppression, two key drivers of cancer progression. We show that microRNA-200 (miR-200), a cell-autonomous suppressor of EMT and metastasis, targets PD-L1. Moreover, ZEB1, an EMT activator and transcriptional repressor of miR-200, relieves miR-200 repression of PD-L1 on tumour cells, leading to CD8(+) T-cell immunosuppression and metastasis. These findings are supported by robust correlations between the EMT score, miR-200 levels and PD-L1 expression in multiple human lung cancer datasets. In addition to revealing a link between EMT and T-cell dysfunction, these findings also show that ZEB1 promotes metastasis through a heretofore unappreciated cell non-autonomous mechanism, and suggest that subgroups of patients in whom malignant progression is driven by EMT activators may respond to treatment with PD-L1 antagonists.

Robustness effect of gap junctions between Golgi cells on cerebellar cortex oscillations

PubMed Central

2011-01-01

Background Previous one-dimensional network modeling of the cerebellar granular layer has been successfully linked with a range of cerebellar cortex oscillations observed in vivo. However, the recent discovery of gap junctions between Golgi cells (GoCs), which may cause oscillations by themselves, has raised the question of how gap-junction coupling affects GoC and granular-layer oscillations. To investigate this question, we developed a novel two-dimensional computational model of the GoC-granule cell (GC) circuit with and without gap junctions between GoCs. Results Isolated GoCs coupled by gap junctions had a strong tendency to generate spontaneous oscillations without affecting their mean firing frequencies in response to distributed mossy fiber input. Conversely, when GoCs were synaptically connected in the granular layer, gap junctions increased the power of the oscillations, but the oscillations were primarily driven by the synaptic feedback loop between GoCs and GCs, and the gap junctions did not change oscillation frequency or the mean firing rate of either GoCs or GCs. Conclusion Our modeling results suggest that gap junctions between GoCs increase the robustness of cerebellar cortex oscillations that are primarily driven by the feedback loop between GoCs and GCs. The robustness effect of gap junctions on synaptically driven oscillations observed in our model may be a general mechanism, also present in other regions of the brain. PMID:22330240

Novel molecular insights into RhoA GTPase-induced resistance to aqueous humor outflow through the trabecular meshwork

PubMed Central

Zhang, Min; Maddala, Rupalatha; Rao, Ponugoti Vasantha

2008-01-01

Impaired drainage of aqueous humor through the trabecular meshwork (TM) culminating in increased intraocular pressure is a major risk factor for glaucoma, a leading cause of blindness worldwide. Regulation of aqueous humor drainage through the TM, however, is poorly understood. The role of RhoA GTPase-mediated actomyosin organization, cell adhesive interactions, and gene expression in regulation of aqueous humor outflow was investigated using adenoviral vector-driven expression of constitutively active mutant of RhoA (RhoAV14). Organ-cultured anterior segments from porcine eyes expressing RhoAV14 exhibited significant reduction of aqueous humor outflow. Cultured TM cells expressing RhoAV14 exhibited a pronounced contractile morphology, increased actin stress fibers, and focal adhesions and increased levels of phosphorylated myosin light chain (MLC), collagen IV, fibronectin, and laminin. cDNA microarray analysis of RNA extracted from RhoAV14-expressing human TM cells revealed a significant increase in the expression of genes encoding extracellular matrix (ECM) proteins, cytokines, integrins, cytoskeletal proteins, and signaling proteins. Conversely, various ECM proteins stimulated robust increases in phosphorylation of MLC, paxillin, and focal adhesion kinase and activated Rho GTPase and actin stress fiber formation in TM cells, indicating a potential regulatory feedback interaction between ECM-induced mechanical strain and Rho GTPase-induced isometric tension in TM cells. Collectively, these data demonstrate that sustained activation of Rho GTPase signaling in the aqueous humor outflow pathway increases resistance to aqueous humor outflow through the trabecular pathway by influencing the actomyosin assembly, cell adhesive interactions, and the expression of ECM proteins and cytokines in TM cells. PMID:18799648

A circannual clock drives expression of genes central for seasonal reproduction.

PubMed

Sáenz de Miera, Cristina; Monecke, Stefanie; Bartzen-Sprauer, Julien; Laran-Chich, Marie-Pierre; Pévet, Paul; Hazlerigg, David G; Simonneaux, Valérie

2014-07-07

Animals living in temperate zones anticipate seasonal environmental changes to adapt their biological functions, especially reproduction and metabolism. Two main physiological mechanisms have evolved for this adaptation: intrinsic long-term timing mechanisms with an oscillating period of approximately 1 year, driven by a circannual clock [1], and synchronization of biological rhythms to the sidereal year using day length (photoperiod) [2]. In mammals, the pineal hormone melatonin relays photoperiodic information to the hypothalamus to control seasonal physiology through well-defined mechanisms [3-6]. In contrast, little is known about how the circannual clock drives endogenous changes in seasonal functions. The aim of this study was to determine whether genes involved in photoperiodic time measurement (TSHβ and Dio2) and central control of reproduction (Rfrp and Kiss1) display circannual rhythms in expression under constant conditions. Male European hamsters, deprived of seasonal time cues by pinealectomy and maintenance in constant photoperiod, were selected when expressing a subjective summer or subjective winter state in their circannual cycle of body weight, temperature, and testicular size. TSHβ expression in the pars tuberalis (PT) displayed a robust circannual variation with highest level in the subjective summer state, which was positively correlated with hypothalamic Dio2 and Rfrp expression. The negative sex steroid feedback was found to act specifically on arcuate Kiss1 expression. Our findings reveal TSH as a circannual output of the PT, which in turn regulates hypothalamic neurons controlling reproductive activity. Therefore, both the circannual and the melatonin signals converge on PT TSHβ expression to synchronize seasonal biological activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Longitudinal Analysis of Whole Blood Transcriptomes to Explore Molecular Signatures Associated With Acute Renal Allograft Rejection

PubMed Central

Shin, Heesun; Günther, Oliver; Hollander, Zsuzsanna; Wilson-McManus, Janet E.; Ng, Raymond T.; Balshaw, Robert; Keown, Paul A.; McMaster, Robert; McManus, Bruce M.; Isbel, Nicole M.; Knoll, Greg; Tebbutt, Scott J.

2014-01-01

In this study, we explored a time course of peripheral whole blood transcriptomes from kidney transplantation patients who either experienced an acute rejection episode or did not in order to better delineate the immunological and biological processes measureable in blood leukocytes that are associated with acute renal allograft rejection. Using microarrays, we generated gene expression data from 24 acute rejectors and 24 nonrejectors. We filtered the data to obtain the most unambiguous and robustly expressing probe sets and selected a subset of patients with the clearest phenotype. We then performed a data-driven exploratory analysis using data reduction and differential gene expression analysis tools in order to reveal gene expression signatures associated with acute allograft rejection. Using a template-matching algorithm, we then expanded our analysis to include time course data, identifying genes whose expression is modulated leading up to acute rejection. We have identified molecular phenotypes associated with acute renal allograft rejection, including a significantly upregulated signature of neutrophil activation and accumulation following transplant surgery that is common to both acute rejectors and nonrejectors. Our analysis shows that this expression signature appears to stabilize over time in nonrejectors but persists in patients who go on to reject the transplanted organ. In addition, we describe an expression signature characteristic of lymphocyte activity and proliferation. This lymphocyte signature is significantly downregulated in both acute rejectors and nonrejectors following surgery; however, patients who go on to reject the organ show a persistent downregulation of this signature relative to the neutrophil signature. PMID:24526836

Hypoxia-targeted 131I therapy of hepatocellular cancer after systemic mesenchymal stem cell-mediated sodium iodide symporter gene delivery

PubMed Central

Müller, Andrea M.; Schmohl, Kathrin A.; Knoop, Kerstin; Schug, Christina; Urnauer, Sarah; Hagenhoff, Anna; Clevert, Dirk-André; Ingrisch, Michael; Niess, Hanno; Carlsen, Janette; Zach, Christian; Wagner, Ernst; Bartenstein, Peter; Nelson, Peter J.; Spitzweg, Christine

2016-01-01

Adoptively transferred mesenchymal stem cells (MSCs) home to solid tumors. Biologic features within the tumor environment can be used to selectively activate transgenes in engineered MSCs after tumor invasion. One of the characteristic features of solid tumors is hypoxia. We evaluated a hypoxia-based imaging and therapy strategy to target expression of the sodium iodide symporter (NIS) gene to experimental hepatocellular carcinoma (HCC) delivered by MSCs. MSCs engineered to express transgenes driven by a hypoxia-responsive promoter showed robust transgene induction under hypoxia as demonstrated by mCherry expression in tumor cell spheroid models, or radioiodide uptake using NIS. Subcutaneous and orthotopic HCC xenograft mouse models revealed significant levels of perchlorate-sensitive NIS-mediated tumoral radioiodide accumulation by tumor-recruited MSCs using 123I-scintigraphy or 124I-positron emission tomography. Functional NIS expression was further confirmed by ex vivo 123I-biodistribution analysis. Administration of a therapeutic dose of 131I in mice treated with NIS-transfected MSCs resulted in delayed tumor growth and reduced tumor perfusion, as shown by contrast-enhanced sonography, and significantly prolonged survival of mice bearing orthotopic HCC tumors. Interestingly, radioiodide uptake into subcutaneous tumors was not sufficient to induce therapeutic effects. Our results demonstrate the potential of using tumor hypoxia-based approaches to drive radioiodide therapy in non-thyroidal tumors. PMID:27458162

Chaos and Hyperchaos in Coupled Antiphase Driven Toda Oscillators

NASA Astrophysics Data System (ADS)

Stankevich, Nataliya V.; Dvorak, Anton; Astakhov, Vladimir; Jaros, Patrycja; Kapitaniak, Marcin; Perlikowski, Przemysław; Kapitaniak, Tomasz

2018-01-01

The dynamics of two coupled antiphase driven Toda oscillators is studied. We demonstrate three different routes of transition to chaotic dynamics associated with different bifurcations of periodic and quasi-periodic regimes. As a result of these, two types of chaotic dynamics with one and two positive Lyapunov exponents are observed. We argue that the results obtained are robust as they can exist in a wide range of the system parameters.

Data-driven robust approximate optimal tracking control for unknown general nonlinear systems using adaptive dynamic programming method.

PubMed

Zhang, Huaguang; Cui, Lili; Zhang, Xin; Luo, Yanhong

2011-12-01

In this paper, a novel data-driven robust approximate optimal tracking control scheme is proposed for unknown general nonlinear systems by using the adaptive dynamic programming (ADP) method. In the design of the controller, only available input-output data is required instead of known system dynamics. A data-driven model is established by a recurrent neural network (NN) to reconstruct the unknown system dynamics using available input-output data. By adding a novel adjustable term related to the modeling error, the resultant modeling error is first guaranteed to converge to zero. Then, based on the obtained data-driven model, the ADP method is utilized to design the approximate optimal tracking controller, which consists of the steady-state controller and the optimal feedback controller. Further, a robustifying term is developed to compensate for the NN approximation errors introduced by implementing the ADP method. Based on Lyapunov approach, stability analysis of the closed-loop system is performed to show that the proposed controller guarantees the system state asymptotically tracking the desired trajectory. Additionally, the obtained control input is proven to be close to the optimal control input within a small bound. Finally, two numerical examples are used to demonstrate the effectiveness of the proposed control scheme.

Robust H(∞) positional control of 2-DOF robotic arm driven by electro-hydraulic servo system.

PubMed

Guo, Qing; Yu, Tian; Jiang, Dan

2015-11-01

In this paper an H∞ positional feedback controller is developed to improve the robust performance under structural and parametric uncertainty disturbance in electro-hydraulic servo system (EHSS). The robust control model is described as the linear state-space equation by upper linear fractional transformation. According to the solution of H∞ sub-optimal control problem, the robust controller is designed and simplified to lower order linear model which is easily realized in EHSS. The simulation and experimental results can validate the robustness of this proposed method. The comparison result with PI control shows that the robust controller is suitable for this EHSS under the critical condition where the desired system bandwidth is higher and the external load of the hydraulic actuator is closed to its limited capability. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Exercise-driven metabolic pathways in healthy cartilage.

PubMed

Blazek, A D; Nam, J; Gupta, R; Pradhan, M; Perera, P; Weisleder, N L; Hewett, T E; Chaudhari, A M; Lee, B S; Leblebicioglu, B; Butterfield, T A; Agarwal, S

2016-07-01

Exercise is vital for maintaining cartilage integrity in healthy joints. Here we examined the exercise-driven transcriptional regulation of genes in healthy rat articular cartilage to dissect the metabolic pathways responsible for the potential benefits of exercise. Transcriptome-wide gene expression in the articular cartilage of healthy Sprague-Dawley female rats exercised daily (low intensity treadmill walking) for 2, 5, or 15 days was compared to that of non-exercised rats, using Affymetrix GeneChip arrays. Database for Annotation, Visualization and Integrated Discovery (DAVID) was used for Gene Ontology (GO)-term enrichment and Functional Annotation analysis of differentially expressed genes (DEGs). Kyoto Encyclopedia of Genes and Genome (KEGG) pathway mapper was used to identify the metabolic pathways regulated by exercise. Microarray analysis revealed that exercise-induced 644 DEGs in healthy articular cartilage. The DAVID bioinformatics tool demonstrated high prevalence of functional annotation clusters with greater enrichment scores and GO-terms associated with extracellular matrix (ECM) biosynthesis/remodeling and inflammation/immune response. The KEGG database revealed that exercise regulates 147 metabolic pathways representing molecular interaction networks for Metabolism, Genetic Information Processing, Environmental Information Processing, Cellular Processes, Organismal Systems, and Diseases. These pathways collectively supported the complex regulation of the beneficial effects of exercise on the cartilage. Overall, the findings highlight that exercise is a robust transcriptional regulator of a wide array of metabolic pathways in healthy cartilage. The major actions of exercise involve ECM biosynthesis/cartilage strengthening and attenuation of inflammatory pathways to provide prophylaxis against onset of arthritic diseases in healthy cartilage. Copyright © 2016 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Massive-Scale Gene Co-Expression Network Construction and Robustness Testing Using Random Matrix Theory

PubMed Central

Isaacson, Sven; Luo, Feng; Feltus, Frank A.; Smith, Melissa C.

2013-01-01

The study of gene relationships and their effect on biological function and phenotype is a focal point in systems biology. Gene co-expression networks built using microarray expression profiles are one technique for discovering and interpreting gene relationships. A knowledge-independent thresholding technique, such as Random Matrix Theory (RMT), is useful for identifying meaningful relationships. Highly connected genes in the thresholded network are then grouped into modules that provide insight into their collective functionality. While it has been shown that co-expression networks are biologically relevant, it has not been determined to what extent any given network is functionally robust given perturbations in the input sample set. For such a test, hundreds of networks are needed and hence a tool to rapidly construct these networks. To examine functional robustness of networks with varying input, we enhanced an existing RMT implementation for improved scalability and tested functional robustness of human (Homo sapiens), rice (Oryza sativa) and budding yeast (Saccharomyces cerevisiae). We demonstrate dramatic decrease in network construction time and computational requirements and show that despite some variation in global properties between networks, functional similarity remains high. Moreover, the biological function captured by co-expression networks thresholded by RMT is highly robust. PMID:23409071

Robust rotation of rotor in a thermally driven nanomotor

PubMed Central

Cai, Kun; Yu, Jingzhou; Shi, Jiao; Qin, Qing-Hua

2017-01-01

In the fabrication of a thermally driven rotary nanomotor with the dimension of a few nanometers, fabrication and control precision may have great influence on rotor’s stability of rotational frequency (SRF). To investigate effects of uncertainty of some major factors including temperature, tube length, axial distance between tubes, diameter of tubes and the inward radial deviation (IRD) of atoms in stators on the frequency’s stability, theoretical analysis integrating with numerical experiments are carried out. From the results obtained via molecular dynamics simulation, some key points are illustrated for future fabrication of the thermal driven rotary nanomotor. PMID:28393898

MDM2 is an important prognostic and predictive factor for platin-pemetrexed therapy in malignant pleural mesotheliomas and deregulation of P14/ARF (encoded by CDKN2A) seems to contribute to an MDM2-driven inactivation of P53.

PubMed

Walter, R F H; Mairinger, F D; Ting, S; Vollbrecht, C; Mairinger, T; Theegarten, D; Christoph, D C; Schmid, K W; Wohlschlaeger, J

2015-03-03

Malignant pleural mesothelioma (MPM) is a highly aggressive tumour that is first-line treated with a combination of cisplatin and pemetrexed. Until now, predictive and prognostic biomarkers are lacking, making it a non-tailored therapy regimen with unknown outcome. P53 is frequently inactivated in MPM, but mutations are extremely rare. MDM2 and P14/ARF are upstream regulators of P53 that may contribute to P53 inactivation. A total of 72 MPM patients were investigated. MDM2 immunoexpression was assessed in 65 patients. MDM2 and P14/ARF mRNA expression was analysed in 48 patients of the overall collective. The expression results were correlated to overall survival (OS) and progression-free survival (PFS). OS and PFS correlated highly significantly with MDM2 mRNA and protein expression, showing a dismal prognosis for patients with elevated MDM2 expression (for OS: Score (logrank) test: P⩽0.002, and for PFS: Score (logrank) test; P<0.007). MDM2 was identified as robust prognostic and predictive biomarker for MPM on the mRNA and protein level. P14/ARF mRNA expression reached no statistical significance, but Kaplan-Meier curves distinguished patients with low P14/ARF expression and hence shorter survival from patients with higher expression and prolonged survival. MDM2 is a prognostic and predictive marker for a platin-pemetrexed therapy of patients with MPMs. Downregulation of P14/ARF expression seems to contribute to MDM2-overexpression-mediated P53 inactivation in MPM patients.

Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

PubMed

Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

2003-11-01

Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

Entrainment to feeding but not to light: circadian phenotype of VPAC2 receptor-null mice.

PubMed

Sheward, W John; Maywood, Elizabeth S; French, Karen L; Horn, Jacqueline M; Hastings, Michael H; Seckl, Jonathan R; Holmes, Megan C; Harmar, Anthony J

2007-04-18

The master clock driving mammalian circadian rhythms is located in the suprachiasmatic nuclei (SCN) of the hypothalamus and entrained by daily light/dark cycles. SCN lesions abolish circadian rhythms of behavior and result in a loss of synchronized circadian rhythms of clock gene expression in peripheral organs (e.g., the liver) and of hormone secretion (e.g., corticosterone). We examined rhythms of behavior, hepatic clock gene expression, and corticosterone secretion in VPAC2 receptor-null (Vipr2-/-) mice, which lack a functional SCN clock. Unexpectedly, although Vipr2-/- mice lacked robust circadian rhythms of wheel-running activity and corticosterone secretion, hepatic clock gene expression was strongly rhythmic, but advanced in phase compared with that in wild-type mice. The timing of food availability is thought to be an important entrainment signal for circadian clocks outside the SCN. Vipr2-/- mice consumed food significantly earlier in the 24 h cycle than wild-type mice, consistent with the observed timing of peripheral rhythms of circadian gene expression. When restricted to feeding only during the daytime (RF), mice develop rhythms of activity and of corticosterone secretion in anticipation of feeding time, thought to be driven by a food-entrainable circadian oscillator, located outside the SCN. Under RF, mice of both genotypes developed food-anticipatory rhythms of activity and corticosterone secretion, and hepatic gene expression rhythms also became synchronized to the RF stimulus. Thus, food intake is an effective zeitgeber capable of coordinating circadian rhythms of behavior, peripheral clock gene expression, and hormone secretion, even in the absence of a functional SCN clock.

Detection-enhanced steady state entanglement with ions.

PubMed

Bentley, C D B; Carvalho, A R R; Kielpinski, D; Hope, J J

2014-07-25

Driven dissipative steady state entanglement schemes take advantage of coupling to the environment to robustly prepare highly entangled states. We present a scheme for two trapped ions to generate a maximally entangled steady state with fidelity above 0.99, appropriate for use in quantum protocols. Furthermore, we extend the scheme by introducing detection of our dissipation process, significantly enhancing the fidelity. Our scheme is robust to anomalous heating and requires no sympathetic cooling.

New robust statistical procedures for the polytomous logistic regression models.

PubMed

Castilla, Elena; Ghosh, Abhik; Martin, Nirian; Pardo, Leandro

2018-05-17

This article derives a new family of estimators, namely the minimum density power divergence estimators, as a robust generalization of the maximum likelihood estimator for the polytomous logistic regression model. Based on these estimators, a family of Wald-type test statistics for linear hypotheses is introduced. Robustness properties of both the proposed estimators and the test statistics are theoretically studied through the classical influence function analysis. Appropriate real life examples are presented to justify the requirement of suitable robust statistical procedures in place of the likelihood based inference for the polytomous logistic regression model. The validity of the theoretical results established in the article are further confirmed empirically through suitable simulation studies. Finally, an approach for the data-driven selection of the robustness tuning parameter is proposed with empirical justifications. © 2018, The International Biometric Society.

Data-Driven Neural Network Model for Robust Reconstruction of Automobile Casting

NASA Astrophysics Data System (ADS)

Lin, Jinhua; Wang, Yanjie; Li, Xin; Wang, Lu

2017-09-01

In computer vision system, it is a challenging task to robustly reconstruct complex 3D geometries of automobile castings. However, 3D scanning data is usually interfered by noises, the scanning resolution is low, these effects normally lead to incomplete matching and drift phenomenon. In order to solve these problems, a data-driven local geometric learning model is proposed to achieve robust reconstruction of automobile casting. In order to relieve the interference of sensor noise and to be compatible with incomplete scanning data, a 3D convolution neural network is established to match the local geometric features of automobile casting. The proposed neural network combines the geometric feature representation with the correlation metric function to robustly match the local correspondence. We use the truncated distance field(TDF) around the key point to represent the 3D surface of casting geometry, so that the model can be directly embedded into the 3D space to learn the geometric feature representation; Finally, the training labels is automatically generated for depth learning based on the existing RGB-D reconstruction algorithm, which accesses to the same global key matching descriptor. The experimental results show that the matching accuracy of our network is 92.2% for automobile castings, the closed loop rate is about 74.0% when the matching tolerance threshold τ is 0.2. The matching descriptors performed well and retained 81.6% matching accuracy at 95% closed loop. For the sparse geometric castings with initial matching failure, the 3D matching object can be reconstructed robustly by training the key descriptors. Our method performs 3D reconstruction robustly for complex automobile castings.

Data-driven asthma endotypes defined from blood biomarker and gene expression data

EPA Science Inventory

The diagnosis and treatment of childhood asthma is complicated by its mechanistically distinct subtypes (endotypes) driven by genetic susceptibility and modulating environmental factors. Clinical biomarkers and blood gene expression were collected from a stratified, cross-section...

Non-hematopoietic PAR-2 is essential for matriptase-driven pre-malignant progression and potentiation of ras-mediated squamous cell carcinogenesis

PubMed Central

Sales, Katiuchia Uzzun; Friis, Stine; Konkel, Joanne E.; Godiksen, Sine; Hatakeyama, Marcia; Hansen, Karina K.; Rogatto, Silvia Regina; Szabo, Roman; Vogel, Lotte K.; Chen, Wanjun; Gutkind, J. Silvio; Bugge, Thomas H.

2014-01-01

The membrane-anchored serine protease, matriptase, is consistently dysregulated in a range of human carcinomas, and high matriptase activity correlates with poor prognosis. Furthermore, matriptase is unique among tumor-associated proteases in that epithelial stem cell expression of the protease suffices to induce malignant transformation. Here, we use genetic epistasis analysis to identify proteinase-activated receptor (PAR)-2-dependent inflammatory signaling as an essential component of matriptase-mediated oncogenesis. In cell-based assays, matriptase was a potent activator of PAR-2, and PAR-2 activation by matriptase caused robust induction of NFκB through Gαi. Importantly, genetic elimination of PAR-2 from mice completely prevented matriptase-induced pre-malignant progression, including inflammatory cytokine production, inflammatory cell recruitment, epidermal hyperplasia, and dermal fibrosis. Selective ablation of PAR-2 from bone marrow-derived cells did not prevent matriptase-driven pre-malignant progression, indicating that matriptase activates keratinocyte stem cell PAR-2 to elicit its pro-inflammatory and pro-tumorigenic effects. When combined with previous studies, our data suggest that dual induction of PAR-2-NFκB inflammatory signaling and PI3K-Akt-mTor survival/proliferative signaling underlies the transforming potential of matriptase and may contribute to pro-tumorigenic signaling in human epithelial carcinogenesis. PMID:24469043

Non-hematopoietic PAR-2 is essential for matriptase-driven pre-malignant progression and potentiation of ras-mediated squamous cell carcinogenesis.

PubMed

Sales, K U; Friis, S; Konkel, J E; Godiksen, S; Hatakeyama, M; Hansen, K K; Rogatto, S R; Szabo, R; Vogel, L K; Chen, W; Gutkind, J S; Bugge, T H

2015-01-15

The membrane-anchored serine protease, matriptase, is consistently dysregulated in a range of human carcinomas, and high matriptase activity correlates with poor prognosis. Furthermore, matriptase is unique among tumor-associated proteases in that epithelial stem cell expression of the protease suffices to induce malignant transformation. Here, we use genetic epistasis analysis to identify proteinase-activated receptor (PAR)-2-dependent inflammatory signaling as an essential component of matriptase-mediated oncogenesis. In cell-based assays, matriptase was a potent activator of PAR-2, and PAR-2 activation by matriptase caused robust induction of nuclear factor (NF)κB through Gαi. Importantly, genetic elimination of PAR-2 from mice completely prevented matriptase-induced pre-malignant progression, including inflammatory cytokine production, inflammatory cell recruitment, epidermal hyperplasia and dermal fibrosis. Selective ablation of PAR-2 from bone marrow-derived cells did not prevent matriptase-driven pre-malignant progression, indicating that matriptase activates keratinocyte stem cell PAR-2 to elicit its pro-inflammatory and pro-tumorigenic effects. When combined with previous studies, our data suggest that dual induction of PAR-2-NFκB inflammatory signaling and PI3K-Akt-mTor survival/proliferative signaling underlies the transforming potential of matriptase and may contribute to pro-tumorigenic signaling in human epithelial carcinogenesis.

H∞ robust fault-tolerant controller design for an autonomous underwater vehicle's navigation control system

NASA Astrophysics Data System (ADS)

Cheng, Xiang-Qin; Qu, Jing-Yuan; Yan, Zhe-Ping; Bian, Xin-Qian

2010-03-01

In order to improve the security and reliability for autonomous underwater vehicle (AUV) navigation, an H∞ robust fault-tolerant controller was designed after analyzing variations in state-feedback gain. Operating conditions and the design method were then analyzed so that the control problem could be expressed as a mathematical optimization problem. This permitted the use of linear matrix inequalities (LMI) to solve for the H∞ controller for the system. When considering different actuator failures, these conditions were then also mathematically expressed, allowing the H∞ robust controller to solve for these events and thus be fault-tolerant. Finally, simulation results showed that the H∞ robust fault-tolerant controller could provide precise AUV navigation control with strong robustness.

A Hybrid One-Way ANOVA Approach for the Robust and Efficient Estimation of Differential Gene Expression with Multiple Patterns

PubMed Central

Mollah, Mohammad Manir Hossain; Jamal, Rahman; Mokhtar, Norfilza Mohd; Harun, Roslan; Mollah, Md. Nurul Haque

2015-01-01

Background Identifying genes that are differentially expressed (DE) between two or more conditions with multiple patterns of expression is one of the primary objectives of gene expression data analysis. Several statistical approaches, including one-way analysis of variance (ANOVA), are used to identify DE genes. However, most of these methods provide misleading results for two or more conditions with multiple patterns of expression in the presence of outlying genes. In this paper, an attempt is made to develop a hybrid one-way ANOVA approach that unifies the robustness and efficiency of estimation using the minimum β-divergence method to overcome some problems that arise in the existing robust methods for both small- and large-sample cases with multiple patterns of expression. Results The proposed method relies on a β-weight function, which produces values between 0 and 1. The β-weight function with β = 0.2 is used as a measure of outlier detection. It assigns smaller weights (≥ 0) to outlying expressions and larger weights (≤ 1) to typical expressions. The distribution of the β-weights is used to calculate the cut-off point, which is compared to the observed β-weight of an expression to determine whether that gene expression is an outlier. This weight function plays a key role in unifying the robustness and efficiency of estimation in one-way ANOVA. Conclusion Analyses of simulated gene expression profiles revealed that all eight methods (ANOVA, SAM, LIMMA, EBarrays, eLNN, KW, robust BetaEB and proposed) perform almost identically for m = 2 conditions in the absence of outliers. However, the robust BetaEB method and the proposed method exhibited considerably better performance than the other six methods in the presence of outliers. In this case, the BetaEB method exhibited slightly better performance than the proposed method for the small-sample cases, but the the proposed method exhibited much better performance than the BetaEB method for both the small- and large-sample cases in the presence of more than 50% outlying genes. The proposed method also exhibited better performance than the other methods for m > 2 conditions with multiple patterns of expression, where the BetaEB was not extended for this condition. Therefore, the proposed approach would be more suitable and reliable on average for the identification of DE genes between two or more conditions with multiple patterns of expression. PMID:26413858

Partially Redundant Enhancers Cooperatively Maintain Mammalian Pomc Expression Above a Critical Functional Threshold

PubMed Central

Lam, Daniel D.; de Souza, Flavio S. J.; Nasif, Sofia; Yamashita, Miho; López-Leal, Rodrigo; Meece, Kana; Sampath, Harini; Mercer, Aaron J.; Wardlaw, Sharon L.

2015-01-01

Cell-specific expression of many genes is conveyed by multiple enhancers, with each individual enhancer controlling a particular expression domain. In contrast, multiple enhancers drive similar expression patterns of some genes involved in embryonic development, suggesting regulatory redundancy. Work in Drosophila has indicated that functionally overlapping enhancers canalize development by buffering gene expression against environmental and genetic disturbances. However, little is known about regulatory redundancy in vertebrates and in genes mainly expressed during adulthood. Here we study nPE1 and nPE2, two phylogenetically conserved mammalian enhancers that drive expression of the proopiomelanocortin gene (Pomc) to the same set of hypothalamic neurons. The simultaneous deletion of both enhancers abolished Pomc expression at all ages and induced a profound metabolic dysfunction including early-onset extreme obesity. Targeted inactivation of either nPE1 or nPE2 led to very low levels of Pomc expression during early embryonic development indicating that both enhancers function synergistically. In adult mice, however, Pomc expression is controlled additively by both enhancers, with nPE1 being responsible for ∼80% and nPE2 for ∼20% of Pomc transcription. Consequently, nPE1 knockout mice exhibit mild obesity whereas nPE2-deficient mice maintain a normal body weight. These results suggest that nPE2-driven Pomc expression is compensated by nPE1 at later stages of development, essentially rescuing the earlier phenotype of nPE2 deficiency. Together, these results reveal that cooperative interactions between the enhancers confer robustness of Pomc expression against gene regulatory disturbances and preclude deleterious metabolic phenotypes caused by Pomc deficiency in adulthood. Thus, our study demonstrates that enhancer redundancy can be used by genes that control adult physiology in mammals and underlines the potential significance of regulatory sequence mutations in common diseases. PMID:25671638

Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain

PubMed Central

Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

2016-01-01

Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies. PMID:27853240

Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain.

PubMed

Shimada, Naoto; Inami, Show; Sato, Shoma; Kitamoto, Toshihiro; Sakai, Takaomi

2016-11-17

Apterous (Ap), the best studied LIM-homeodomain transcription factor in Drosophila, cooperates with the cofactor Chip (Chi) to regulate transcription of specific target genes. Although Ap regulates various developmental processes, its function in the adult brain remains unclear. Here, we report that Ap and Chi in the neurons expressing PDF, a neuropeptide, play important roles in proper sleep/wake regulation in adult flies. PDF-expressing neurons consist of two neuronal clusters: small ventral-lateral neurons (s-LNvs) acting as the circadian pacemaker and large ventral-lateral neurons (l-LNvs) regulating light-driven arousal. We identified that Ap localizes to the nuclei of s-LNvs and l-LNvs. In light-dark (LD) cycles, RNAi knockdown or the targeted expression of dominant-negative forms of Ap or Chi in PDF-expressing neurons or l-LNvs promoted arousal. In contrast, in constant darkness, knockdown of Ap in PDF-expressing neurons did not promote arousal, indicating that a reduced Ap function in PDF-expressing neurons promotes light-driven arousal. Furthermore, Ap expression in l-LNvs showed daily rhythms (peaking at midnight), which are generated by a direct light-dependent mechanism rather than by the endogenous clock. These results raise the possibility that the daily oscillation of Ap expression in l-LNvs may contribute to the buffering of light-driven arousal in wild-type flies.

Synaptically Driven Phosphorylation of Ribosomal Protein S6 Is Differentially Regulated at Active Synapses versus Dendrites and Cell Bodies by MAPK and PI3K/mTOR Signaling Pathways

ERIC Educational Resources Information Center

Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald

2017-01-01

High-frequency stimulation of the medial perforant path triggers robust phosphorylation of ribosomal protein S6 (rpS6) in activated dendritic domains and granule cell bodies. Here we dissect the signaling pathways responsible for synaptically driven rpS6 phosphorylation in the dentate gyrus using pharmacological agents to inhibit PI3-kinase/mTOR…

Robust Control of a Cable-Driven Soft Exoskeleton Joint for Intrinsic Human-Robot Interaction.

PubMed

Jarrett, C; McDaid, A J

2017-07-01

A novel, cable-driven soft joint is presented for use in robotic rehabilitation exoskeletons to provide intrinsic, comfortable human-robot interaction. The torque-displacement characteristics of the soft elastomeric core contained within the joint are modeled. This knowledge is used in conjunction with a dynamic system model to derive a sliding mode controller (SMC) to implement low-level torque control of the joint. The SMC controller is experimentally compared with a baseline feedback-linearised proportional-derivative controller across a range of conditions and shown to be robust to un-modeled disturbances. The torque controller is then tested with six healthy subjects while they perform a selection of activities of daily living, which has validated its range of performance. Finally, a case study with a participant with spastic cerebral palsy is presented to illustrate the potential of both the joint and controller to be used in a physiotherapy setting to assist clinical populations.

Data-Driven Discovery of Extravasation Pathway in Circulating Tumor Cells

PubMed Central

Yadavalli, S.; Jayaram, S.; Manda, S. S.; Madugundu, A. K.; Nayakanti, D. S.; Tan, T. Z.; Bhat, R.; Rangarajan, A.; Chatterjee, A.; Gowda, H.; Thiery, J. P.; Kumar, P.

2017-01-01

Circulating tumor cells (CTCs) play a crucial role in cancer dissemination and provide a promising source of blood-based markers. Understanding the spectrum of transcriptional profiles of CTCs and their corresponding regulatory mechanisms will allow for a more robust analysis of CTC phenotypes. The current challenge in CTC research is the acquisition of useful clinical information from the multitude of high-throughput studies. To gain a deeper understanding of CTC heterogeneity and identify genes, pathways and processes that are consistently affected across tumors, we mined the literature for gene expression profiles in CTCs. Through in silico analysis and the integration of CTC-specific genes, we found highly significant biological mechanisms and regulatory processes acting in CTCs across various cancers, with a particular enrichment of the leukocyte extravasation pathway. This pathway appears to play a pivotal role in the migration of CTCs to distant metastatic sites. We find that CTCs from multiple cancers express both epithelial and mesenchymal markers in varying amounts, which is suggestive of dynamic and hybrid states along the epithelial-mesenchymal transition (EMT) spectrum. Targeting the specific molecular nodes to monitor disease and therapeutic control of CTCs in real time will likely improve the clinical management of cancer progression and metastases. PMID:28262832

A Multidisciplinary Approach to Research in Small-Scale Societies: Studying Emotions and Facial Expressions in the Field

PubMed Central

Crivelli, Carlos; Jarillo, Sergio; Fridlund, Alan J.

2016-01-01

Although cognitive science was multidisciplinary from the start, an under-emphasis on anthropology has left the field with limited research in small scale, indigenous societies. Neglecting the anthropological perspective is risky, given that once-canonical cognitive science findings have often been shown to be artifacts of enculturation rather than cognitive universals. This imbalance has become more problematic as the increased use of Western theory-driven approaches, many of which assume human uniformity (“universality”), confronts the absence of a robust descriptive base that might provide clarifying or even contrary evidence. We highlight the need for remedies to such shortcomings by suggesting a two-fold methodological shift. First, studies conducted in indigenous societies can benefit by relying on multidisciplinary research groups to diminish ethnocentrism and enhance the quality of the data. Second, studies devised for Western societies can readily be adapted to the changing settings encountered in the field. Here, we provide examples, drawn from the areas of emotion and facial expressions, to illustrate potential solutions to recurrent problems in enhancing the quality of data collection, hypothesis testing, and the interpretation of results. PMID:27486420

Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

PubMed

Fuller, Kevin K; Dunlap, Jay C; Loros, Jennifer J

2018-05-01

Regulatable promoters are important genetic tools, particularly for assigning function to essential and redundant genes. They can also be used to control the expression of enzymes that influence metabolic flux or protein secretion, thereby optimizing product yield in bioindustry. This review will focus on regulatable systems for use in filamentous fungi, an important group of organisms whose members include key research models, devastating pathogens of plants and animals, and exploitable cell factories. Though we will begin by cataloging those promoters that are controlled by nutritional or chemical means, our primary focus will rest on those who can be controlled by a literal flip-of-the-switch: promoters of light-regulated genes. The vvd promoter of Neurospora will first serve as a paradigm for how light-driven systems can provide tight, robust, tunable, and temporal control of either autologous or heterologous fungal proteins. We will then discuss a theoretical approach to, and practical considerations for, the development of such promoters in other species. To this end, we have compiled genes from six previously published light-regulated transcriptomic studies to guide the search for suitable photoregulatable promoters in your fungus of interest.

Ab initio relaxation times and time-dependent Hamiltonians within the steepest-entropy-ascent quantum thermodynamic framework

NASA Astrophysics Data System (ADS)

Kim, Ilki; von Spakovsky, Michael R.

2017-08-01

Quantum systems driven by time-dependent Hamiltonians are considered here within the framework of steepest-entropy-ascent quantum thermodynamics (SEAQT) and used to study the thermodynamic characteristics of such systems. In doing so, a generalization of the SEAQT framework valid for all such systems is provided, leading to the development of an ab initio physically relevant expression for the intrarelaxation time, an important element of this framework and one that had as of yet not been uniquely determined as an integral part of the theory. The resulting expression for the relaxation time is valid as well for time-independent Hamiltonians as a special case and makes the description provided by the SEAQT framework more robust at the fundamental level. In addition, the SEAQT framework is used to help resolve a fundamental issue of thermodynamics in the quantum domain, namely, that concerning the unique definition of process-dependent work and heat functions. The developments presented lead to the conclusion that this framework is not just an alternative approach to thermodynamics in the quantum domain but instead one that uniquely sheds new light on various fundamental but as of yet not completely resolved questions of thermodynamics.

DN1(p) circadian neurons coordinate acute light and PDF inputs to produce robust daily behavior in Drosophila.

PubMed

Zhang, Luoying; Chung, Brian Y; Lear, Bridget C; Kilman, Valerie L; Liu, Yixiao; Mahesh, Guruswamy; Meissner, Rose-Anne; Hardin, Paul E; Allada, Ravi

2010-04-13

Daily behaviors in animals are determined by the interplay between internal timing signals from circadian clocks and environmental stimuli such as light. How these signals are integrated to produce timely and adaptive behavior is unclear. The fruit fly Drosophila exhibits clock-driven activity increases that anticipate dawn and dusk and free-running rhythms under constant conditions. Flies also respond to the onset of light and dark with acute increases in activity. Mutants of a novel ion channel, narrow abdomen (na), lack a robust increase in activity in response to light and show reduced anticipatory behavior and free-running rhythms, providing a genetic link between photic responses and circadian clock function. We used tissue-specific rescue of na to demonstrate a role for approximately 16-20 circadian pacemaker neurons, a subset of the posterior dorsal neurons 1 (DN1(p)s), in mediating the acute response to the onset of light as well as morning anticipatory behavior. Circadian pacemaker neurons expressing the neuropeptide PIGMENT-DISPERSING FACTOR (PDF) are especially important for morning anticipation and free-running rhythms and send projections to the DN1(p)s. We also demonstrate that DN1(p)Pdfr expression is sufficient to rescue, at least partially, Pdfr morning anticipation defects as well as defects in free-running rhythms, including those in DN1 molecular clocks. Additionally, these DN1 clocks in wild-type flies are more strongly reset to timing changes in PDF clocks than other pacemaker neurons, suggesting that they are direct targets. Taking these results together, we demonstrate that the DN1(p)s lie at the nexus of PDF and photic signaling to produce appropriate daily behavior.

Data-driven inference of network connectivity for modeling the dynamics of neural codes in the insect antennal lobe

PubMed Central

Shlizerman, Eli; Riffell, Jeffrey A.; Kutz, J. Nathan

2014-01-01

The antennal lobe (AL), olfactory processing center in insects, is able to process stimuli into distinct neural activity patterns, called olfactory neural codes. To model their dynamics we perform multichannel recordings from the projection neurons in the AL driven by different odorants. We then derive a dynamic neuronal network from the electrophysiological data. The network consists of lateral-inhibitory neurons and excitatory neurons (modeled as firing-rate units), and is capable of producing unique olfactory neural codes for the tested odorants. To construct the network, we (1) design a projection, an odor space, for the neural recording from the AL, which discriminates between distinct odorants trajectories (2) characterize scent recognition, i.e., decision-making based on olfactory signals and (3) infer the wiring of the neural circuit, the connectome of the AL. We show that the constructed model is consistent with biological observations, such as contrast enhancement and robustness to noise. The study suggests a data-driven approach to answer a key biological question in identifying how lateral inhibitory neurons can be wired to excitatory neurons to permit robust activity patterns. PMID:25165442

Efficient gene targeting by homology-directed repair in rat zygotes using TALE nucleases.

PubMed

Remy, Séverine; Tesson, Laurent; Menoret, Séverine; Usal, Claire; De Cian, Anne; Thepenier, Virginie; Thinard, Reynald; Baron, Daniel; Charpentier, Marine; Renaud, Jean-Baptiste; Buelow, Roland; Cost, Gregory J; Giovannangeli, Carine; Fraichard, Alexandre; Concordet, Jean-Paul; Anegon, Ignacio

2014-08-01

The generation of genetically modified animals is important for both research and commercial purposes. The rat is an important model organism that until recently lacked efficient genetic engineering tools. Sequence-specific nucleases, such as ZFNs, TALE nucleases, and CRISPR/Cas9 have allowed the creation of rat knockout models. Genetic engineering by homology-directed repair (HDR) is utilized to create animals expressing transgenes in a controlled way and to introduce precise genetic modifications. We applied TALE nucleases and donor DNA microinjection into zygotes to generate HDR-modified rats with large new sequences introduced into three different loci with high efficiency (0.62%-5.13% of microinjected zygotes). Two of these loci (Rosa26 and Hprt1) are known to allow robust and reproducible transgene expression and were targeted for integration of a GFP expression cassette driven by the CAG promoter. GFP-expressing embryos and four Rosa26 GFP rat lines analyzed showed strong and widespread GFP expression in most cells of all analyzed tissues. The third targeted locus was Ighm, where we performed successful exon exchange of rat exon 2 for the human one. At all three loci we observed HDR only when using linear and not circular donor DNA. Mild hypothermic (30°C) culture of zygotes after microinjection increased HDR efficiency for some loci. Our study demonstrates that TALE nuclease and donor DNA microinjection into rat zygotes results in efficient and reproducible targeted donor integration by HDR. This allowed creation of genetically modified rats in a work-, cost-, and time-effective manner. © 2014 Remy et al.; Published by Cold Spring Harbor Laboratory Press.

Efficient gene targeting by homology-directed repair in rat zygotes using TALE nucleases

PubMed Central

Remy, Séverine; Tesson, Laurent; Menoret, Séverine; Usal, Claire; De Cian, Anne; Thepenier, Virginie; Thinard, Reynald; Baron, Daniel; Charpentier, Marine; Renaud, Jean-Baptiste; Buelow, Roland; Cost, Gregory J.; Giovannangeli, Carine; Fraichard, Alexandre; Concordet, Jean-Paul; Anegon, Ignacio

2014-01-01

The generation of genetically modified animals is important for both research and commercial purposes. The rat is an important model organism that until recently lacked efficient genetic engineering tools. Sequence-specific nucleases, such as ZFNs, TALE nucleases, and CRISPR/Cas9 have allowed the creation of rat knockout models. Genetic engineering by homology-directed repair (HDR) is utilized to create animals expressing transgenes in a controlled way and to introduce precise genetic modifications. We applied TALE nucleases and donor DNA microinjection into zygotes to generate HDR-modified rats with large new sequences introduced into three different loci with high efficiency (0.62%–5.13% of microinjected zygotes). Two of these loci (Rosa26 and Hprt1) are known to allow robust and reproducible transgene expression and were targeted for integration of a GFP expression cassette driven by the CAG promoter. GFP-expressing embryos and four Rosa26 GFP rat lines analyzed showed strong and widespread GFP expression in most cells of all analyzed tissues. The third targeted locus was Ighm, where we performed successful exon exchange of rat exon 2 for the human one. At all three loci we observed HDR only when using linear and not circular donor DNA. Mild hypothermic (30°C) culture of zygotes after microinjection increased HDR efficiency for some loci. Our study demonstrates that TALE nuclease and donor DNA microinjection into rat zygotes results in efficient and reproducible targeted donor integration by HDR. This allowed creation of genetically modified rats in a work-, cost-, and time-effective manner. PMID:24989021

Optimization of Direct Fibroblast Reprogramming to Cardiomyocytes Using Calcium Activity as a Functional Measure of Success

PubMed Central

Addis, Russell C.; Ifkovits, Jamie L.; Pinto, Filipa; Kellam, Lori D.; Esteso, Paul; Rentschler, Stacey; Christoforou, Nicolas; Epstein, Jonathan A.; Gearhart, John D.

2013-01-01

Direct conversion of fibroblasts to induced cardiomyocytes (iCMs) has great potential for regenerative medicine. Recent publications have reported significant progress, but the evaluation of reprogramming has relied upon non-functional measures such as flow cytometry for cardiomyocyte markers or GFP expression driven by a cardiomyocyte-specific promoter. The issue is one of practicality: the most stringent measures - electrophysiology to detect cell excitation and the presence of spontaneously contracting myocytes - are not readily quantifiable in the large numbers of cells screened in reprogramming experiments. However, excitation and contraction are linked by a third functional characteristic of cardiomyocytes: the rhythmic oscillation of intracellular calcium levels. We set out to optimize direct conversion of fibroblasts to iCMs with a quantifiable calcium reporter to rapidly assess functional transdifferentiation. We constructed a reporter system in which the calcium indicator GCaMP is driven by the cardiomyocyte-specific Troponin T promoter. Using calcium activity as our primary outcome measure, we compared several published combinations of transcription factors along with novel combinations in mouse embryonic fibroblasts. The most effective combination consisted of Hand2, Nkx2.5, Gata4, Mef2c, and Tbx5 (HNGMT). This combination is >50-fold more efficient than GMT alone and produces iCMs with cardiomyocyte marker expression, robust calcium oscillation, and spontaneous beating that persists for weeks following inactivation of reprogramming factors. HNGMT is also significantly more effective than previously published factor combinations for the transdifferentiation of adult mouse cardiac fibroblasts to iCMs. Quantification of calcium function is a convenient and effective means for the identification and evaluation of cardiomyocytes generated by direct reprogramming. Using this stringent outcome measure, we conclude that HNGMT produces iCMs more efficiently than previously published methods. PMID:23591016

Resonance-assisted decay of nondispersive wave packets.

PubMed

Wimberger, Sandro; Schlagheck, Peter; Eltschka, Christopher; Buchleitner, Andreas

2006-07-28

We present a quantitative semiclassical theory for the decay of nondispersive electronic wave packets in driven, ionizing Rydberg systems. Statistically robust quantities are extracted combining resonance-assisted tunneling with subsequent transport across chaotic phase space and a final ionization step.

Phenotypic Robustness and the Assortativity Signature of Human Transcription Factor Networks

PubMed Central

Pechenick, Dov A.; Payne, Joshua L.; Moore, Jason H.

2014-01-01

Many developmental, physiological, and behavioral processes depend on the precise expression of genes in space and time. Such spatiotemporal gene expression phenotypes arise from the binding of sequence-specific transcription factors (TFs) to DNA, and from the regulation of nearby genes that such binding causes. These nearby genes may themselves encode TFs, giving rise to a transcription factor network (TFN), wherein nodes represent TFs and directed edges denote regulatory interactions between TFs. Computational studies have linked several topological properties of TFNs — such as their degree distribution — with the robustness of a TFN's gene expression phenotype to genetic and environmental perturbation. Another important topological property is assortativity, which measures the tendency of nodes with similar numbers of edges to connect. In directed networks, assortativity comprises four distinct components that collectively form an assortativity signature. We know very little about how a TFN's assortativity signature affects the robustness of its gene expression phenotype to perturbation. While recent theoretical results suggest that increasing one specific component of a TFN's assortativity signature leads to increased phenotypic robustness, the biological context of this finding is currently limited because the assortativity signatures of real-world TFNs have not been characterized. It is therefore unclear whether these earlier theoretical findings are biologically relevant. Moreover, it is not known how the other three components of the assortativity signature contribute to the phenotypic robustness of TFNs. Here, we use publicly available DNaseI-seq data to measure the assortativity signatures of genome-wide TFNs in 41 distinct human cell and tissue types. We find that all TFNs share a common assortativity signature and that this signature confers phenotypic robustness to model TFNs. Lastly, we determine the extent to which each of the four components of the assortativity signature contributes to this robustness. PMID:25121490

Genome-wide computational analysis reveals cardiomyocyte-specific transcriptional Cis-regulatory motifs that enable efficient cardiac gene therapy.

PubMed

Rincon, Melvin Y; Sarcar, Shilpita; Danso-Abeam, Dina; Keyaerts, Marleen; Matrai, Janka; Samara-Kuko, Ermira; Acosta-Sanchez, Abel; Athanasopoulos, Takis; Dickson, George; Lahoutte, Tony; De Bleser, Pieter; VandenDriessche, Thierry; Chuah, Marinee K

2015-01-01

Gene therapy is a promising emerging therapeutic modality for the treatment of cardiovascular diseases and hereditary diseases that afflict the heart. Hence, there is a need to develop robust cardiac-specific expression modules that allow for stable expression of the gene of interest in cardiomyocytes. We therefore explored a new approach based on a genome-wide bioinformatics strategy that revealed novel cardiac-specific cis-acting regulatory modules (CS-CRMs). These transcriptional modules contained evolutionary-conserved clusters of putative transcription factor binding sites that correspond to a "molecular signature" associated with robust gene expression in the heart. We then validated these CS-CRMs in vivo using an adeno-associated viral vector serotype 9 that drives a reporter gene from a quintessential cardiac-specific α-myosin heavy chain promoter. Most de novo designed CS-CRMs resulted in a >10-fold increase in cardiac gene expression. The most robust CRMs enhanced cardiac-specific transcription 70- to 100-fold. Expression was sustained and restricted to cardiomyocytes. We then combined the most potent CS-CRM4 with a synthetic heart and muscle-specific promoter (SPc5-12) and obtained a significant 20-fold increase in cardiac gene expression compared to the cytomegalovirus promoter. This study underscores the potential of rational vector design to improve the robustness of cardiac gene therapy.

Singing-driven gene expression in the developing songbird brain

PubMed Central

Johnson, Frank; Whitney, Osceola

2014-01-01

Neural and behavioral development arises from an integration of genetic and environmental influences, yet specifying the nature of this interaction remains a primary problem in neuroscience. Here, we review molecular and behavioral studies that focus on the role of singing-driven gene expression during neural and vocal development in the male zebra finch (Taeniopygia guttata), a songbird that learns a species-typical vocal pattern during juvenile development by imitating an adult male tutor. A primary aim of our lab has been to identify naturally-occurring environmental influences that shape the propensity to sing. This ethological approach underlies our theoretical perspective, which is to integrate the significance of singing-driven gene expression into a broader ecological context. PMID:16129463

mQTL-seq delineates functionally relevant candidate gene harbouring a major QTL regulating pod number in chickpea

PubMed Central

Das, Shouvik; Singh, Mohar; Srivastava, Rishi; Bajaj, Deepak; Saxena, Maneesha S.; Rana, Jai C.; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.

2016-01-01

The present study used a whole-genome, NGS resequencing-based mQTL-seq (multiple QTL-seq) strategy in two inter-specific mapping populations (Pusa 1103 × ILWC 46 and Pusa 256 × ILWC 46) to scan the major genomic region(s) underlying QTL(s) governing pod number trait in chickpea. Essentially, the whole-genome resequencing of low and high pod number-containing parental accessions and homozygous individuals (constituting bulks) from each of these two mapping populations discovered >8 million high-quality homozygous SNPs with respect to the reference kabuli chickpea. The functional significance of the physically mapped SNPs was apparent from the identified 2,264 non-synonymous and 23,550 regulatory SNPs, with 8–10% of these SNPs-carrying genes corresponding to transcription factors and disease resistance-related proteins. The utilization of these mined SNPs in Δ (SNP index)-led QTL-seq analysis and their correlation between two mapping populations based on mQTL-seq, narrowed down two (CaqaPN4.1: 867.8 kb and CaqaPN4.2: 1.8 Mb) major genomic regions harbouring robust pod number QTLs into the high-resolution short QTL intervals (CaqbPN4.1: 637.5 kb and CaqbPN4.2: 1.28 Mb) on chickpea chromosome 4. The integration of mQTL-seq-derived one novel robust QTL with QTL region-specific association analysis delineated the regulatory (C/T) and coding (C/A) SNPs-containing one pentatricopeptide repeat (PPR) gene at a major QTL region regulating pod number in chickpea. This target gene exhibited anther, mature pollen and pod-specific expression, including pronounced higher up-regulated (∼3.5-folds) transcript expression in high pod number-containing parental accessions and homozygous individuals of two mapping populations especially during pollen and pod development. The proposed mQTL-seq-driven combinatorial strategy has profound efficacy in rapid genome-wide scanning of potential candidate gene(s) underlying trait-associated high-resolution robust QTL(s), thereby expediting genomics-assisted breeding and genetic enhancement of crop plants, including chickpea. PMID:26685680

NATbox: a network analysis toolbox in R.

PubMed

Chavan, Shweta S; Bauer, Michael A; Scutari, Marco; Nagarajan, Radhakrishnan

2009-10-08

There has been recent interest in capturing the functional relationships (FRs) from high-throughput assays using suitable computational techniques. FRs elucidate the working of genes in concert as a system as opposed to independent entities hence may provide preliminary insights into biological pathways and signalling mechanisms. Bayesian structure learning (BSL) techniques and its extensions have been used successfully for modelling FRs from expression profiles. Such techniques are especially useful in discovering undocumented FRs, investigating non-canonical signalling mechanisms and cross-talk between pathways. The objective of the present study is to develop a graphical user interface (GUI), NATbox: Network Analysis Toolbox in the language R that houses a battery of BSL algorithms in conjunction with suitable statistical tools for modelling FRs in the form of acyclic networks from gene expression profiles and their subsequent analysis. NATbox is a menu-driven open-source GUI implemented in the R statistical language for modelling and analysis of FRs from gene expression profiles. It provides options to (i) impute missing observations in the given data (ii) model FRs and network structure from gene expression profiles using a battery of BSL algorithms and identify robust dependencies using a bootstrap procedure, (iii) present the FRs in the form of acyclic graphs for visualization and investigate its topological properties using network analysis metrics, (iv) retrieve FRs of interest from published literature. Subsequently, use these FRs as structural priors in BSL (v) enhance scalability of BSL across high-dimensional data by parallelizing the bootstrap routines. NATbox provides a menu-driven GUI for modelling and analysis of FRs from gene expression profiles. By incorporating readily available functions from existing R-packages, it minimizes redundancy and improves reproducibility, transparency and sustainability, characteristic of open-source environments. NATbox is especially suited for interdisciplinary researchers and biologists with minimal programming experience and would like to use systems biology approaches without delving into the algorithmic aspects. The GUI provides appropriate parameter recommendations for the various menu options including default parameter choices for the user. NATbox can also prove to be a useful demonstration and teaching tool in graduate and undergraduate course in systems biology. It has been tested successfully under Windows and Linux operating systems. The source code along with installation instructions and accompanying tutorial can be found at http://bioinformatics.ualr.edu/natboxWiki/index.php/Main_Page.

Histone acetylation is associated with differential gene expression in the rapid and robust memory CD8+ T-cell response

PubMed Central

Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping

2006-01-01

To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257

On the robustness of complex heterogeneous gene expression networks.

PubMed

Gómez-Gardeñes, Jesús; Moreno, Yamir; Floría, Luis M

2005-04-01

We analyze a continuous gene expression model on the underlying topology of a complex heterogeneous network. Numerical simulations aimed at studying the chaotic and periodic dynamics of the model are performed. The results clearly indicate that there is a region in which the dynamical and structural complexity of the system avoid chaotic attractors. However, contrary to what has been reported for Random Boolean Networks, the chaotic phase cannot be completely suppressed, which has important bearings on network robustness and gene expression modeling.

Mechanisms and time course of vocal learning and consolidation in the adult songbird.

PubMed

Warren, Timothy L; Tumer, Evren C; Charlesworth, Jonathan D; Brainard, Michael S

2011-10-01

In songbirds, the basal ganglia outflow nucleus LMAN is a cortical analog that is required for several forms of song plasticity and learning. Moreover, in adults, inactivating LMAN can reverse the initial expression of learning driven via aversive reinforcement. In the present study, we investigated how LMAN contributes to both reinforcement-driven learning and a self-driven recovery process in adult Bengalese finches. We first drove changes in the fundamental frequency of targeted song syllables and compared the effects of inactivating LMAN with the effects of interfering with N-methyl-d-aspartate (NMDA) receptor-dependent transmission from LMAN to one of its principal targets, the song premotor nucleus RA. Inactivating LMAN and blocking NMDA receptors in RA caused indistinguishable reversions in the expression of learning, indicating that LMAN contributes to learning through NMDA receptor-mediated glutamatergic transmission to RA. We next assessed how LMAN's role evolves over time by maintaining learned changes to song while periodically inactivating LMAN. The expression of learning consolidated to become LMAN independent over multiple days, indicating that this form of consolidation is not completed over one night, as previously suggested, and instead may occur gradually during singing. Subsequent cessation of reinforcement was followed by a gradual self-driven recovery of original song structure, indicating that consolidation does not correspond with the lasting retention of changes to song. Finally, for self-driven recovery, as for reinforcement-driven learning, LMAN was required for the expression of initial, but not later, changes to song. Our results indicate that NMDA receptor-dependent transmission from LMAN to RA plays an essential role in the initial expression of two distinct forms of vocal learning and that this role gradually wanes over a multiday process of consolidation. The results support an emerging view that cortical-basal ganglia circuits can direct the initial expression of learning via top-down influences on primary motor circuitry.

Mechanisms and time course of vocal learning and consolidation in the adult songbird

PubMed Central

Tumer, Evren C.; Charlesworth, Jonathan D.; Brainard, Michael S.

2011-01-01

In songbirds, the basal ganglia outflow nucleus LMAN is a cortical analog that is required for several forms of song plasticity and learning. Moreover, in adults, inactivating LMAN can reverse the initial expression of learning driven via aversive reinforcement. In the present study, we investigated how LMAN contributes to both reinforcement-driven learning and a self-driven recovery process in adult Bengalese finches. We first drove changes in the fundamental frequency of targeted song syllables and compared the effects of inactivating LMAN with the effects of interfering with N-methyl-d-aspartate (NMDA) receptor-dependent transmission from LMAN to one of its principal targets, the song premotor nucleus RA. Inactivating LMAN and blocking NMDA receptors in RA caused indistinguishable reversions in the expression of learning, indicating that LMAN contributes to learning through NMDA receptor-mediated glutamatergic transmission to RA. We next assessed how LMAN's role evolves over time by maintaining learned changes to song while periodically inactivating LMAN. The expression of learning consolidated to become LMAN independent over multiple days, indicating that this form of consolidation is not completed over one night, as previously suggested, and instead may occur gradually during singing. Subsequent cessation of reinforcement was followed by a gradual self-driven recovery of original song structure, indicating that consolidation does not correspond with the lasting retention of changes to song. Finally, for self-driven recovery, as for reinforcement-driven learning, LMAN was required for the expression of initial, but not later, changes to song. Our results indicate that NMDA receptor-dependent transmission from LMAN to RA plays an essential role in the initial expression of two distinct forms of vocal learning and that this role gradually wanes over a multiday process of consolidation. The results support an emerging view that cortical-basal ganglia circuits can direct the initial expression of learning via top-down influences on primary motor circuitry. PMID:21734110

Robust Selection Algorithm (RSA) for Multi-Omic Biomarker Discovery; Integration with Functional Network Analysis to Identify miRNA Regulated Pathways in Multiple Cancers.

PubMed

Sehgal, Vasudha; Seviour, Elena G; Moss, Tyler J; Mills, Gordon B; Azencott, Robert; Ram, Prahlad T

2015-01-01

MicroRNAs (miRNAs) play a crucial role in the maintenance of cellular homeostasis by regulating the expression of their target genes. As such, the dysregulation of miRNA expression has been frequently linked to cancer. With rapidly accumulating molecular data linked to patient outcome, the need for identification of robust multi-omic molecular markers is critical in order to provide clinical impact. While previous bioinformatic tools have been developed to identify potential biomarkers in cancer, these methods do not allow for rapid classification of oncogenes versus tumor suppressors taking into account robust differential expression, cutoffs, p-values and non-normality of the data. Here, we propose a methodology, Robust Selection Algorithm (RSA) that addresses these important problems in big data omics analysis. The robustness of the survival analysis is ensured by identification of optimal cutoff values of omics expression, strengthened by p-value computed through intensive random resampling taking into account any non-normality in the data and integration into multi-omic functional networks. Here we have analyzed pan-cancer miRNA patient data to identify functional pathways involved in cancer progression that are associated with selected miRNA identified by RSA. Our approach demonstrates the way in which existing survival analysis techniques can be integrated with a functional network analysis framework to efficiently identify promising biomarkers and novel therapeutic candidates across diseases.

Control of CA3 output by feedforward inhibition despite developmental changes in the excitation-inhibition balance.

PubMed

Torborg, Christine L; Nakashiba, Toshiaki; Tonegawa, Susumu; McBain, Chris J

2010-11-17

In somatosensory cortex, the relative balance of excitation and inhibition determines how effectively feedforward inhibition enforces the temporal fidelity of action potentials. Within the CA3 region of the hippocampus, glutamatergic mossy fiber (MF) synapses onto CA3 pyramidal cells (PCs) provide strong monosynaptic excitation that exhibit prominent facilitation during repetitive activity. We demonstrate in the juvenile CA3 that MF-driven polysynaptic IPSCs facilitate to maintain a fixed EPSC-IPSC ratio during short-term plasticity. In contrast, in young adult mice this MF-driven polysynaptic inhibitory input can facilitate or depress in response to short trains of activity. Transgenic mice lacking the feedback inhibitory loop continue to exhibit both facilitating and depressing polysynaptic IPSCs, indicating that this robust inhibition is not caused by the secondary engagement of feedback inhibition. Surprisingly, eliminating MF-driven inhibition onto CA3 pyramidal cells by blockade of GABA(A) receptors did not lead to a loss of temporal precision of the first action potential observed after a stimulus but triggered in many cases a long excitatory plateau potential capable of triggering repetitive action potential firing. These observations indicate that, unlike other regions of the brain, the temporal precision of single MF-driven action potentials is dictated primarily by the kinetics of MF EPSPs, not feedforward inhibition. Instead, feedforward inhibition provides a robust regulation of CA3 PC excitability across development to prevent excessive depolarization by the monosynaptic EPSP and multiple action potential firings.

High Performance Automatic Character Skinning Based on Projection Distance

NASA Astrophysics Data System (ADS)

Li, Jun; Lin, Feng; Liu, Xiuling; Wang, Hongrui

2018-03-01

Skeleton-driven-deformation methods have been commonly used in the character deformations. The process of painting skin weights for character deformation is a long-winded task requiring manual tweaking. We present a novel method to calculate skinning weights automatically from 3D human geometric model and corresponding skeleton. The method first, groups each mesh vertex of 3D human model to a skeleton bone by the minimum distance from a mesh vertex to each bone. Secondly, calculates each vertex's weights to the adjacent bones by the vertex's projection point distance to the bone joints. Our method's output can not only be applied to any kind of skeleton-driven deformation, but also to motion capture driven (mocap-driven) deformation. Experiments results show that our method not only has strong generality and robustness, but also has high performance.

Relevance of phenotypic noise to adaptation and evolution.

PubMed

Kaneko, K; Furusawa, C

2008-09-01

Biological processes are inherently noisy, as highlighted in recent measurements of stochasticity in gene expression. Here, the authors show that such phenotypic noise is essential to the adaptation of organisms to a variety of environments and also to the evolution of robustness against mutations. First, the authors show that for any growing cell showing stochastic gene expression, the adaptive cellular state is inevitably selected by noise, without the use of a specific signal transduction network. In general, changes in any protein concentration in a cell are products of its synthesis minus dilution and degradation, both of which are proportional to the rate of cell growth. In an adaptive state, both the synthesis and dilution terms of proteins are large, and so the adaptive state is less affected by stochasticity in gene expression, whereas for a non-adaptive state, both terms are smaller, and so cells are easily knocked out of their original state by noise. This leads to a novel, generic mechanism for the selection of adaptive states. The authors have confirmed this selection by model simulations. Secondly, the authors consider the evolution of gene networks to acquire robustness of the phenotype against noise and mutation. Through simulations using a simple stochastic gene expression network that undergoes mutation and selection, the authors show that a threshold level of noise in gene expression is required for the network to acquire both types of robustness. The results reveal how the noise that cells encounter during growth and development shapes any network's robustness, not only to noise but also to mutations. The authors also establish a relationship between developmental and mutational robustness.

Data-Driven Asthma Endotypes Defined from Blood Biomarker and Gene Expression Data

PubMed Central

George, Barbara Jane; Reif, David M.; Gallagher, Jane E.; Williams-DeVane, ClarLynda R.; Heidenfelder, Brooke L.; Hudgens, Edward E.; Jones, Wendell; Neas, Lucas; Hubal, Elaine A. Cohen; Edwards, Stephen W.

2015-01-01

The diagnosis and treatment of childhood asthma is complicated by its mechanistically distinct subtypes (endotypes) driven by genetic susceptibility and modulating environmental factors. Clinical biomarkers and blood gene expression were collected from a stratified, cross-sectional study of asthmatic and non-asthmatic children from Detroit, MI. This study describes four distinct asthma endotypes identified via a purely data-driven method. Our method was specifically designed to integrate blood gene expression and clinical biomarkers in a way that provides new mechanistic insights regarding the different asthma endotypes. For example, we describe metabolic syndrome-induced systemic inflammation as an associated factor in three of the four asthma endotypes. Context provided by the clinical biomarker data was essential in interpreting gene expression patterns and identifying putative endotypes, which emphasizes the importance of integrated approaches when studying complex disease etiologies. These synthesized patterns of gene expression and clinical markers from our research may lead to development of novel serum-based biomarker panels. PMID:25643280

Lymphocytes influence intracranial aneurysm formation and rupture: role of extracellular matrix remodeling and phenotypic modulation of vascular smooth muscle cells.

PubMed

Sawyer, David M; Pace, Lauren A; Pascale, Crissey L; Kutchin, Alexander C; O'Neill, Brannan E; Starke, Robert M; Dumont, Aaron S

2016-07-14

Intracranial aneurysms (IA) are increasingly recognized as a disease driven by chronic inflammation. Recent research has identified key mediators and processes underlying IA pathogenesis, but mechanistic understanding remains incomplete. Lymphocytic infiltrates have been demonstrated in patient IA tissue specimens and have also been shown to play an important role in abdominal aortic aneurysms (AAA) and related diseases such as atherosclerosis. However, no study has systematically examined the contribution of lymphocytes in a model of IA. Lymphocyte-deficient (Rag1) and wild-type (WT; C57BL/6 strain) mice were subjected to a robust IA induction protocol. Rates of IA formation and rupture were measured, and cerebral artery tissue was collected and utilized for histology and gene expression analysis. At 2 weeks, the Rag1 group had significantly fewer IA formations and ruptures than the WT group. Histological analysis of unruptured IA tissue showed robust B and T lymphocyte infiltration in the WT group, while there were no differences in macrophage infiltration, IA diameter, and wall thickness. Significant differences in interleukin-6 (IL-6), matrix metalloproteinases 2 (MMP2) and 9 (MMP9), and smooth muscle myosin heavy chain (MHC) were observed between the groups. Lymphocytes are key contributors to IA pathogenesis and provide a novel target for the prevention of IA progression and rupture in patients.

Coamplification of miR-4728 protects HER2-amplified breast cancers from targeted therapy

PubMed Central

Floros, Konstantinos V.; Hu, Bin; Monterrubio, Carles; Hughes, Mark T.; Wells, Jason D.; Morales, Cristina Bernadó; Ghotra, Maninderjit S.; Costa, Carlotta; Souers, Andrew J.; Boikos, Sosipatros A.; Leverson, Joel D.; Tan, Ming; Serra, Violeta; Koblinski, Jennifer E.; Arribas, Joaquin; Prat, Aleix; Paré, Laia; Miller, Todd W.; Harada, Hisashi; Windle, Brad E.; Scaltriti, Maurizio; Faber, Anthony C.

2018-01-01

HER2 (ERBB2) amplification is a driving oncogenic event in breast cancer. Clinical trials have consistently shown the benefit of HER2 inhibitors (HER2i) in treating patients with both local and advanced HER2+ breast cancer. Despite this benefit, their efficacy as single agents is limited, unlike the robust responses to other receptor tyrosine kinase inhibitors like EGFR inhibitors in EGFR-mutant lung cancer. Interestingly, the lack of HER2i efficacy occurs despite sufficient intracellular signaling shutdown following HER2i treatment. Exploring possible intrinsic causes for this lack of response, we uncovered remarkably depressed levels of NOXA, an endogenous inhibitor of the antiapoptotic MCL-1, in HER2-amplified breast cancer. Upon investigation of the mechanism leading to low NOXA, we identified a micro-RNA encoded in an intron of HER2, termed miR-4728, that targets the mRNA of the Estrogen Receptor α (ESR1). Reduced ESR1 expression in turn prevents ERα-mediated transcription of NOXA, mitigating apoptosis following treatment with the HER2i lapatinib. Importantly, resistance can be overcome with pharmacological inhibition of MCL-1. More generally, while many cancers like EGFR-mutant lung cancer are driven by activated kinases that when drugged lead to robust monotherapeutic responses, we demonstrate that the efficacy of targeted therapies directed against oncogenes active through focal amplification may be mitigated by coamplified genes. PMID:29476008

PD-L1–Driven Tolerance Protects Neurogenin3-Induced Islet Neogenesis to Reverse Established Type 1 Diabetes in NOD Mice

PubMed Central

Li, Rongying; Lee, Jeongkyung; Kim, Mi-sun; Liu, Victoria; Moulik, Mousumi; Li, Haiyan; Yi, Qing; Xie, Aini; Chen, Wenhao; Yang, Lina; Li, Yimin; Tsai, Tsung Huang; Oka, Kazuhiro

2015-01-01

A breakdown in self-tolerance underlies autoimmune destruction of β-cells and type 1 diabetes. A cure by restoring β-cell mass is limited by the availability of transplantable β-cells and the need for chronic immunosuppression. Evidence indicates that inhibiting costimulation through the PD-1/PD-L1 pathway is central to immune tolerance. We therefore tested whether induction of islet neogenesis in the liver, protected by PD-L1–driven tolerance, reverses diabetes in NOD mice. We demonstrated a robust induction of neo-islets in the liver of diabetic NOD mice by gene transfer of Neurogenin3, the islet-defining factor, along with betacellulin, an islet growth factor. These neo-islets expressed all the major pancreatic hormones and transcription factors. However, an enduring restoration of glucose-stimulated insulin secretion and euglycemia occurs only when tolerance is also induced by the targeted overexpression of PD-L1 in the neo-islets, which results in inhibition of proliferation and increased apoptosis of infiltrating CD4+ T cells. Further analysis revealed an inhibition of cytokine production from lymphocytes isolated from the liver but not from the spleen of treated mice, indicating that treatment did not result in generalized immunosuppression. This treatment strategy leads to persistence of functional neo-islets that resist autoimmune destruction and consequently an enduring reversal of diabetes in NOD mice. PMID:25332429

A data-driven, knowledge-based approach to biomarker discovery: application to circulating microRNA markers of colorectal cancer prognosis.

PubMed

Vafaee, Fatemeh; Diakos, Connie; Kirschner, Michaela B; Reid, Glen; Michael, Michael Z; Horvath, Lisa G; Alinejad-Rokny, Hamid; Cheng, Zhangkai Jason; Kuncic, Zdenka; Clarke, Stephen

2018-01-01

Recent advances in high-throughput technologies have provided an unprecedented opportunity to identify molecular markers of disease processes. This plethora of complex-omics data has simultaneously complicated the problem of extracting meaningful molecular signatures and opened up new opportunities for more sophisticated integrative and holistic approaches. In this era, effective integration of data-driven and knowledge-based approaches for biomarker identification has been recognised as key to improving the identification of high-performance biomarkers, and necessary for translational applications. Here, we have evaluated the role of circulating microRNA as a means of predicting the prognosis of patients with colorectal cancer, which is the second leading cause of cancer-related death worldwide. We have developed a multi-objective optimisation method that effectively integrates a data-driven approach with the knowledge obtained from the microRNA-mediated regulatory network to identify robust plasma microRNA signatures which are reliable in terms of predictive power as well as functional relevance. The proposed multi-objective framework has the capacity to adjust for conflicting biomarker objectives and to incorporate heterogeneous information facilitating systems approaches to biomarker discovery. We have found a prognostic signature of colorectal cancer comprising 11 circulating microRNAs. The identified signature predicts the patients' survival outcome and targets pathways underlying colorectal cancer progression. The altered expression of the identified microRNAs was confirmed in an independent public data set of plasma samples of patients in early stage vs advanced colorectal cancer. Furthermore, the generality of the proposed method was demonstrated across three publicly available miRNA data sets associated with biomarker studies in other diseases.

Testing genuine tripartite quantum nonlocality with three two-level atoms in a driven cavity

NASA Astrophysics Data System (ADS)

Yuan, H.; Wei, L. F.

2013-10-01

It is known that the violation of Svetlichny's inequality (SI), rather than the usual Mermin's inequality (MI), is a robust criterion to confirm the existence of genuine multipartite quantum nonlocality. In this paper, we propose a feasible approach to test SI with three two-level atoms (TLAs) dispersively coupled to a driven cavity. The proposal is based on the joint measurements of the states of three TLAs by probing the steady-state transmission spectra of the driven cavity: each peak marks one of the computational basis states and its relative height corresponds to the probability superposed in the detected three-TLA state. With these kinds of joint measurements, the correlation functions in SI can be directly calculated, and thus the SI can be efficiently tested for typical tripartite entanglement, i.e., genuine tripartite entanglement [e.g., Greenberger-Horne-Zeilinger (GHZ) and W states] and biseparable three-qubit entangled states (e.g., |χ>12|ξ>3). Our numerical experiments show that the SI is violated only by three-qubit GHZ and W states, not by biseparable three-qubit entangled state |χ>12|ξ>3, while the MI can still be violated by biseparable three-qubit entangled states. Thus the violation of SI can be regarded as a robust criterion for the existence of genuine tripartite entanglement.

A defect-driven diagnostic method for machine tool spindles

PubMed Central

Vogl, Gregory W.; Donmez, M. Alkan

2016-01-01

Simple vibration-based metrics are, in many cases, insufficient to diagnose machine tool spindle condition. These metrics couple defect-based motion with spindle dynamics; diagnostics should be defect-driven. A new method and spindle condition estimation device (SCED) were developed to acquire data and to separate system dynamics from defect geometry. Based on this method, a spindle condition metric relying only on defect geometry is proposed. Application of the SCED on various milling and turning spindles shows that the new approach is robust for diagnosing the machine tool spindle condition. PMID:28065985

Spin Mode Switching at the Edge of a Quantum Hall System.

PubMed

Khanna, Udit; Murthy, Ganpathy; Rao, Sumathi; Gefen, Yuval

2017-11-03

Quantum Hall states can be characterized by their chiral edge modes. Upon softening the edge potential, the edge has long been known to undergo spontaneous reconstruction driven by charging effects. In this Letter we demonstrate a qualitatively distinct phenomenon driven by exchange effects, in which the ordering of the edge modes at ν=3 switches abruptly as the edge potential is made softer, while the ordering in the bulk remains intact. We demonstrate that this phenomenon is robust, and has many verifiable experimental signatures in transport.

Pulsed dynamical decoupling for fast and robust two-qubit gates on trapped ions

NASA Astrophysics Data System (ADS)

Arrazola, I.; Casanova, J.; Pedernales, J. S.; Wang, Z.-Y.; Solano, E.; Plenio, M. B.

2018-05-01

We propose a pulsed dynamical decoupling protocol as the generator of tunable, fast, and robust quantum phase gates between two microwave-driven trapped-ion hyperfine qubits. The protocol consists of sequences of π pulses acting on ions that are oriented along an externally applied magnetic-field gradient. In contrast to existing approaches, in our design the two vibrational modes of the ion chain cooperate under the influence of the external microwave driving to achieve significantly increased gate speeds. Our scheme is robust against the dominant noise sources, which are errors on the magnetic-field and microwave pulse intensities, as well as motional heating, predicting two-qubit gates with fidelities above 99.9% in tens of microseconds.

78 FR 38848 - Re-establishing the Sanctuary Nomination Process

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-28

... process for local communities and other interested parties to provide NOAA with robust, criteria-driven... coastal communities around the country have requested NOAA, the Department of Commerce, and the President... benefits that coastal communities realize from an adjacent national marine sanctuary, including, but not...

Robust Synchronization Models for Presentation System Using SMIL-Driven Approach

ERIC Educational Resources Information Center

Asnawi, Rustam; Ahmad, Wan Fatimah Wan; Rambli, Dayang Rohaya Awang

2013-01-01

Current common Presentation System (PS) models are slide based oriented and lack synchronization analysis either with temporal or spatial constraints. Such models, in fact, tend to lead to synchronization problems, particularly on parallel synchronization with spatial constraints between multimedia element presentations. However, parallel…

Aging has the opposite effect on cAMP and cGMP circadian variations in rat Leydig cells.

PubMed

Baburski, Aleksandar Z; Sokanovic, Srdjan J; Andric, Silvana A; Kostic, Tatjana S

2017-05-01

The Leydig cell physiology displays a circadian rhythm driven by a complex interaction of the reproductive axis hormones and circadian system. The final output of this regulatory process is circadian pattern of steroidogenic genes expression and testosterone production. Aging gradually decreases robustness of rhythmic testosterone secretion without change in pattern of LH secretion. Here, we analyzed effect of aging on circadian variation of cAMP and cGMP signaling in Leydig cells. Results showed opposite effect of aging on cAMP and cGMP daily variation. Reduced amplitude of cAMP circadian oscillation was probably associated with changed expression of genes involved in cAMP production (increased circadian pattern of Adcy7, Adcy9, Adcy10 and decreased Adcy3); cAMP degradation (increased Pde4a, decreased Pde8b, canceled rhythm of Pde4d, completely reversed circadian pattern of Pde7b and Pde8a); and circadian expression of protein kinase A subunits (Prkac/PRKAC and Prkar2a). Aging stimulates expression of genes responsible for cGMP production (Nos2, Gucy1a3 and Gucy1b3/GUCYB3) and degradation (Pde5a, Pde6a and Pde6h) but the overall net effect is elevation of cGMP circadian oscillations in Leydig cells. In addition, the expression of cGMP-dependent kinase, Prkg1/PRKG1 is up-regulated. It seems that aging potentiate cGMP- and reduce cAMP-signaling in Leydig cells. Since both signaling pathways affect testosterone production and clockwork in the cells, further insights into these signaling pathways will help to unravel disorders linked to the circadian timing system, aging and reproduction.

Selective reconstitution of liver cholesterol biosynthesis promotes lung maturation but does not prevent neonatal lethality in Dhcr7 null mice.

PubMed

Yu, Hongwei; Li, Man; Tint, G Stephen; Chen, Jianliang; Xu, Guorong; Patel, Shailendra B

2007-04-04

Targeted disruption of the murine 3beta-hydroxysterol-Delta7-reductase gene (Dhcr7), an animal model of Smith-Lemli-Opitz syndrome, leads to loss of cholesterol synthesis and neonatal death that can be partially rescued by transgenic replacement of DHCR7 expression in brain during embryogenesis. To gain further insight into the role of non-brain tissue cholesterol deficiency in the pathophysiology, we tested whether the lethal phenotype could be abrogated by selective transgenic complementation with DHCR7 expression in the liver. We generated mice that carried a liver-specific human DHCR7 transgene whose expression was driven by the human apolipoprotein E (ApoE) promoter and its associated liver-specific enhancer. These mice were then crossed with Dhcr7+/- mutants to generate Dhcr7-/- mice bearing a human DHCR7 transgene. Robust hepatic transgene expression resulted in significant improvement of cholesterol homeostasis with cholesterol concentrations increasing to 80~90 % of normal levels in liver and lung. Significantly, cholesterol deficiency in brain was not altered. Although late gestational lung sacculation defect reported previously was significantly improved, there was no parallel increase in postnatal survival in the transgenic mutant mice. The reconstitution of DHCR7 function selectively in liver induced a significant improvement of cholesterol homeostasis in non-brain tissues, but failed to rescue the neonatal lethality of Dhcr7 null mice. These results provided further evidence that CNS defects caused by Dhcr7 null likely play a major role in the lethal pathogenesis of Dhcr7-/- mice, with the peripheral organs contributing the morbidity.

Robust diagnosis of Ewing sarcoma by immunohistochemical detection of super-enhancer-driven EWSR1-ETS targets

PubMed Central

Marchetto, Aruna; Gerke, Julia S.; Rubio, Rebeca Alba; Kiran, Merve M.; Musa, Julian; Knott, Maximilian M. L.; Ohmura, Shunya; Li, Jing; Akpolat, Nusret; Akatli, Ayse N.; Özen, Özlem; Dirksen, Uta; Hartmann, Wolfgang; de Alava, Enrique; Baumhoer, Daniel; Sannino, Giuseppina; Kirchner, Thomas; Grünewald, Thomas G. P.

2018-01-01

Ewing sarcoma is an undifferentiated small-round-cell sarcoma. Although molecular detection of pathognomonic EWSR1-ETS fusions such as EWSR1-FLI1 enables definitive diagnosis, substantial confusion can arise if molecular diagnostics are unavailable. Diagnosis based on the conventional immunohistochemical marker CD99 is unreliable due to its abundant expression in morphological mimics. To identify novel diagnostic immunohistochemical markers for Ewing sarcoma, we performed comparative expression analyses in 768 tumors representing 21 entities including Ewing-like sarcomas, which confirmed that CIC-DUX4-, BCOR-CCNB3-, EWSR1-NFATc2-, and EWSR1-ETS-translocated sarcomas are distinct entities, and revealed that ATP1A1, BCL11B, and GLG1 constitute specific markers for Ewing sarcoma. Their high expression was validated by immunohistochemistry and proved to depend on EWSR1-FLI1-binding to highly active proximal super-enhancers. Automated cut-off-finding and combination-testing in a tissue-microarray comprising 174 samples demonstrated that detection of high BCL11B and/or GLG1 expression is sufficient to reach 96% specificity for Ewing sarcoma. While 88% of tested Ewing-like sarcomas displayed strong CD99-immunoreactivity, none displayed combined strong BCL11B- and GLG1-immunoreactivity. Collectively, we show that ATP1A1, BCL11B, and GLG1 are EWSR1-FLI1 targets, of which BCL11B and GLG1 offer a fast, simple, and cost-efficient way to diagnose Ewing sarcoma by immunohistochemistry. These markers may significantly reduce the number of misdiagnosed patients, and thus improve patient care. PMID:29416716

The effects of acute salinity challenges on osmoregulation in Mozambique tilapia reared in a tidally changing salinity.

PubMed

Moorman, Benjamin P; Lerner, Darren T; Grau, E Gordon; Seale, Andre P

2015-03-01

This study characterizes the differences in osmoregulatory capacity among Mozambique tilapia, Oreochromis mossambicus, reared in freshwater (FW), in seawater (SW) or under tidally driven changes in salinity. This was addressed through the use of an abrupt exposure to a change in salinity. We measured changes in: (1) plasma osmolality and prolactin (PRL) levels; (2) pituitary expression of prolactin (PRL) and its receptors, PRLR1 and PRLR2; (3) branchial expression of PRLR1, PRLR2, Na(+)/Cl(-) co-transporter (NCC), Na(+)/K(+)/2Cl(-) co-transporter (NKCC), α1a and α1b isoforms of Na(+)/K(+)-ATPase (NKA), cystic fibrosis transmembrane conductance regulator (CFTR), aquaporin 3 (AQP3) and Na(+)/H(+) exchanger 3 (NHE3). Mozambique tilapia reared in a tidal environment successfully adapted to SW while fish reared in FW did not survive a transfer to SW beyond the 6 h sampling. With the exception of CFTR, the change in the expression of ion pumps, transporters and channels was more gradual in fish transferred from tidally changing salinities to SW than in fish transferred from FW to SW. Upon transfer to SW, the increase in CFTR expression was more robust in tidal fish than in FW fish. Tidal and SW fish successfully adapted when transferred to FW. These results suggest that Mozambique tilapia reared in a tidally changing salinity, a condition that more closely represents their natural history, gain an adaptive advantage compared with fish reared in FW when facing a hyperosmotic challenge. © 2015. Published by The Company of Biologists Ltd.

miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3

PubMed Central

Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.

2016-01-01

Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189

Robustness, evolvability, and the logic of genetic regulation.

PubMed

Payne, Joshua L; Moore, Jason H; Wagner, Andreas

2014-01-01

In gene regulatory circuits, the expression of individual genes is commonly modulated by a set of regulating gene products, which bind to a gene's cis-regulatory region. This region encodes an input-output function, referred to as signal-integration logic, that maps a specific combination of regulatory signals (inputs) to a particular expression state (output) of a gene. The space of all possible signal-integration functions is vast and the mapping from input to output is many-to-one: For the same set of inputs, many functions (genotypes) yield the same expression output (phenotype). Here, we exhaustively enumerate the set of signal-integration functions that yield identical gene expression patterns within a computational model of gene regulatory circuits. Our goal is to characterize the relationship between robustness and evolvability in the signal-integration space of regulatory circuits, and to understand how these properties vary between the genotypic and phenotypic scales. Among other results, we find that the distributions of genotypic robustness are skewed, so that the majority of signal-integration functions are robust to perturbation. We show that the connected set of genotypes that make up a given phenotype are constrained to specific regions of the space of all possible signal-integration functions, but that as the distance between genotypes increases, so does their capacity for unique innovations. In addition, we find that robust phenotypes are (i) evolvable, (ii) easily identified by random mutation, and (iii) mutationally biased toward other robust phenotypes. We explore the implications of these latter observations for mutation-based evolution by conducting random walks between randomly chosen source and target phenotypes. We demonstrate that the time required to identify the target phenotype is independent of the properties of the source phenotype.

Robustness, Evolvability, and the Logic of Genetic Regulation

PubMed Central

Moore, Jason H.; Wagner, Andreas

2014-01-01

In gene regulatory circuits, the expression of individual genes is commonly modulated by a set of regulating gene products, which bind to a gene’s cis-regulatory region. This region encodes an input-output function, referred to as signal-integration logic, that maps a specific combination of regulatory signals (inputs) to a particular expression state (output) of a gene. The space of all possible signal-integration functions is vast and the mapping from input to output is many-to-one: for the same set of inputs, many functions (genotypes) yield the same expression output (phenotype). Here, we exhaustively enumerate the set of signal-integration functions that yield idential gene expression patterns within a computational model of gene regulatory circuits. Our goal is to characterize the relationship between robustness and evolvability in the signal-integration space of regulatory circuits, and to understand how these properties vary between the genotypic and phenotypic scales. Among other results, we find that the distributions of genotypic robustness are skewed, such that the majority of signal-integration functions are robust to perturbation. We show that the connected set of genotypes that make up a given phenotype are constrained to specific regions of the space of all possible signal-integration functions, but that as the distance between genotypes increases, so does their capacity for unique innovations. In addition, we find that robust phenotypes are (i) evolvable, (ii) easily identified by random mutation, and (iii) mutationally biased toward other robust phenotypes. We explore the implications of these latter observations for mutation-based evolution by conducting random walks between randomly chosen source and target phenotypes. We demonstrate that the time required to identify the target phenotype is independent of the properties of the source phenotype. PMID:23373974

Single-cell entropy for accurate estimation of differentiation potency from a cell's transcriptome

NASA Astrophysics Data System (ADS)

Teschendorff, Andrew E.; Enver, Tariq

2017-06-01

The ability to quantify differentiation potential of single cells is a task of critical importance. Here we demonstrate, using over 7,000 single-cell RNA-Seq profiles, that differentiation potency of a single cell can be approximated by computing the signalling promiscuity, or entropy, of a cell's transcriptome in the context of an interaction network, without the need for feature selection. We show that signalling entropy provides a more accurate and robust potency estimate than other entropy-based measures, driven in part by a subtle positive correlation between the transcriptome and connectome. Signalling entropy identifies known cell subpopulations of varying potency and drug resistant cancer stem-cell phenotypes, including those derived from circulating tumour cells. It further reveals that expression heterogeneity within single-cell populations is regulated. In summary, signalling entropy allows in silico estimation of the differentiation potency and plasticity of single cells and bulk samples, providing a means to identify normal and cancer stem-cell phenotypes.

Phasic dopamine release drives rapid activation of striatal D2-receptors

PubMed Central

Marcott, Pamela F; Mamaligas, Aphroditi A; Ford, Christopher P

2014-01-01

Summary Striatal dopamine transmission underlies numerous goal-directed behaviors. Medium spiny neurons (MSNs) are a major target of dopamine in the striatum. However, as dopamine does not directly evoke a synaptic event in MSNs, the time course of dopamine signaling in these cells remains unclear. To examine how dopamine release activates D2-receptors on MSNs, G-protein activated inwardly rectifying potassium (GIRK2; Kir 3.2) channels were virally overexpressed in the striatum and the resulting outward currents were used as a sensor of D2-receptor activation. Electrical and optogenetic stimulation of dopamine terminals evoked robust D2-receptor inhibitory post-synaptic currents (IPSCs) in GIRK2-expressing MSNs that occurred in under a second. Evoked D2-IPSCs could be driven by repetitive stimulation and were not occluded by background dopamine tone. Together, the results indicate that D2-receptors on MSNs exhibit functional low affinity and suggest that striatal D2-receptors can encode both tonic and phasic dopamine signals. PMID:25242218

Lateral adhesion drives reintegration of misplaced cells into epithelial monolayers.

PubMed

Bergstralh, Dan T; Lovegrove, Holly E; St Johnston, Daniel

2015-11-01

Cells in simple epithelia orient their mitotic spindles in the plane of the epithelium so that both daughter cells are born within the epithelial sheet. This is assumed to be important to maintain epithelial integrity and prevent hyperplasia, because misaligned divisions give rise to cells outside the epithelium. Here we test this assumption in three types of Drosophila epithelium; the cuboidal follicle epithelium, the columnar early embryonic ectoderm, and the pseudostratified neuroepithelium. Ectopic expression of Inscuteable in these tissues reorients mitotic spindles, resulting in one daughter cell being born outside the epithelial layer. Live imaging reveals that these misplaced cells reintegrate into the tissue. Reducing the levels of the lateral homophilic adhesion molecules Neuroglian or Fasciclin 2 disrupts reintegration, giving rise to extra-epithelial cells, whereas disruption of adherens junctions has no effect. Thus, the reinsertion of misplaced cells seems to be driven by lateral adhesion, which pulls cells born outside the epithelial layer back into it. Our findings reveal a robust mechanism that protects epithelia against the consequences of misoriented divisions.

Protein-mRNA interactome capture: cartography of the mRNP landscape

PubMed Central

Ryder, Sean P.

2016-01-01

RNA-binding proteins play a variety of roles in cellular physiology. Some regulate mRNA processing, mRNA abundance, and translation efficiency. Some fight off invader RNA through small RNA-driven silencing pathways. Others sense foreign sequences in the form of double-stranded RNA and activate the innate immune response. Yet others, for example cytoplasmic aconitase, act as bi-functional proteins, processing metabolites in one conformation and regulating metabolic gene expression in another. Not all are involved in gene regulation. Some play structural roles, for example, connecting the translational machinery to the endoplasmic reticulum outer membrane. Despite their pervasive role and relative importance, it has remained difficult to identify new RNA-binding proteins in a systematic, unbiased way. A recent body of literature from several independent labs has defined robust, easily adaptable protocols for mRNA interactome discovery. In this review, I summarize the methods and review some of the intriguing findings from their application to a wide variety of biological systems. PMID:29098073

Behavioural fever is a synergic signal amplifying the innate immune response.

PubMed

Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S

2013-09-07

Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.

Single-cell entropy for accurate estimation of differentiation potency from a cell's transcriptome

PubMed Central

Teschendorff, Andrew E.; Enver, Tariq

2017-01-01

The ability to quantify differentiation potential of single cells is a task of critical importance. Here we demonstrate, using over 7,000 single-cell RNA-Seq profiles, that differentiation potency of a single cell can be approximated by computing the signalling promiscuity, or entropy, of a cell's transcriptome in the context of an interaction network, without the need for feature selection. We show that signalling entropy provides a more accurate and robust potency estimate than other entropy-based measures, driven in part by a subtle positive correlation between the transcriptome and connectome. Signalling entropy identifies known cell subpopulations of varying potency and drug resistant cancer stem-cell phenotypes, including those derived from circulating tumour cells. It further reveals that expression heterogeneity within single-cell populations is regulated. In summary, signalling entropy allows in silico estimation of the differentiation potency and plasticity of single cells and bulk samples, providing a means to identify normal and cancer stem-cell phenotypes. PMID:28569836

Antibiotic policies and the role of strategic hospital leadership.

PubMed

Masterson, R G

1999-12-01

Operational aspects, programme construction and implementation are all essential components of antimicrobial control but are not the direct remit of management and must rest with the professional provider. Hospital leaders can influence antibiotic control through the priority they give it. This must not be purely financially driven and must incorporate an awareness of issues surrounding patient care. Such attitudes should encompass the consequences of poor prescribing practices in both human and corporate terms. A leader's recognition of these elements can be expressed through securing resources in terms of both the human and hardware components. The best signalling of the status of this activity is through ensuring its inclusion in clinical governance and organisational Board reports. The goals for hospital leaders should be evidence of effective working practices and the execution of their own responsibilities by championing robust structures and procedures are in place. Potent hospital leadership delivered to the focus of antimicrobial control programmes is a major tool for their success.

In Vivo Observation of Structural Changes in Neocortical Catecholaminergic Projections in Response to Drugs of Abuse.

PubMed

Morimoto, Mai M; Tanaka, Shinji; Mizutani, Shunsuke; Urata, Shinji; Kobayashi, Kazuto; Okabe, Shigeo

2018-01-01

Catecholaminergic (dopamine and norepinephrine) projections to the cortex play an important role in cognitive functions and dysfunctions including learning, addiction, and mental disorders. While dynamics of glutamatergic synapses have been well studied in such contexts, little is known regarding catecholaminergic projections, owing to lack of robust methods. Here we report a system to monitor catecholaminergic projections in vivo over the timeframes that such events occur. Green fluorescent protein (GFP) expression driven by tyrosine hydroxylase promoter in a transgenic mouse line enabled us to perform two-photon imaging of cortical catecholaminergic projections through a cranial window. Repetitive imaging of the same axons over 24 h revealed the highly dynamic nature of catecholaminergic boutons. Surprisingly, administration of single high dose methamphetamine (MAP) induced a transient increase in bouton volumes. This new method opens avenues for longitudinal in vivo evaluation of structural changes at single release sites of catecholamines in association with physiology and pathology of cortical functions.

In Vivo Observation of Structural Changes in Neocortical Catecholaminergic Projections in Response to Drugs of Abuse

PubMed Central

Morimoto, Mai M.; Tanaka, Shinji; Mizutani, Shunsuke; Urata, Shinji; Kobayashi, Kazuto

2018-01-01

Catecholaminergic (dopamine and norepinephrine) projections to the cortex play an important role in cognitive functions and dysfunctions including learning, addiction, and mental disorders. While dynamics of glutamatergic synapses have been well studied in such contexts, little is known regarding catecholaminergic projections, owing to lack of robust methods. Here we report a system to monitor catecholaminergic projections in vivo over the timeframes that such events occur. Green fluorescent protein (GFP) expression driven by tyrosine hydroxylase promoter in a transgenic mouse line enabled us to perform two-photon imaging of cortical catecholaminergic projections through a cranial window. Repetitive imaging of the same axons over 24 h revealed the highly dynamic nature of catecholaminergic boutons. Surprisingly, administration of single high dose methamphetamine (MAP) induced a transient increase in bouton volumes. This new method opens avenues for longitudinal in vivo evaluation of structural changes at single release sites of catecholamines in association with physiology and pathology of cortical functions. PMID:29445765

Comparing the new generation accelerator driven subcritical reactor system (ADS) to traditional critical reactors

NASA Astrophysics Data System (ADS)

Kemah, Elif; Akkaya, Recep; Tokgöz, Seyit Rıza

2017-02-01

In recent years, the accelerator driven subcritical reactors have taken great interest worldwide. The Accelerator Driven System (ADS) has been used to produce neutron in subcritical state by the external proton beam source. These reactors, which are hybrid systems, are important in production of clean and safe energy and conversion of radioactive waste. The ADS with the selection of reliability and robust target materials have been the new generation of fission reactors. In addition, in the ADS Reactors the problems of long-lived radioactive fission products and waste actinides encountered in the fission process of the reactor during incineration can be solved, and ADS has come to the forefront of thorium as fuel for the reactors.

Semiconductor lasers driven by self-sustained chaotic electronic oscillators and applications to optical chaos cryptography.

PubMed

Kingni, Sifeu Takougang; Mbé, Jimmi Hervé Talla; Woafo, Paul

2012-09-01

In this work, we numerically study the dynamics of vertical cavity surface emitting laser (VCSEL) firstly when it is driven by Chua's oscillator, secondly in case where it is driven by a broad frequency spectral bandwidth chaotic oscillator developed by Nana et al. [Commun. Nonlinear Sci. Numer. Simul. 14, 2266 (2009)]. We demonstrated that the VCSEL generated robust chaotic dynamics compared to the ones found in VCSEL subject to a sinusoidally modulated current and therefore it is more suitable for chaos encryption techniques. The synchronization characteristics and the communication performances of unidirectional coupled VCSEL driven by the broad frequency spectral bandwidth chaotic oscillators are investigated numerically. The results show that high-quality synchronization and transmission of messages can be realized for suitable system parameters. Chaos shift keying method is successfully applied to encrypt a message at a high bitrate.

Uniform heating of materials into the warm dense matter regime with laser-driven quasimonoenergetic ion beams

DOE PAGES

Bang, W.; Albright, B. J.; Bradley, P. A.; ...

2015-12-01

In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE/E~20%, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. As a result, the robustness of the expected heatingmore » uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.« less

Uniform heating of materials into the warm dense matter regime with laser-driven quasimonoenergetic ion beams

NASA Astrophysics Data System (ADS)

Bang, W.; Albright, B. J.; Bradley, P. A.; Vold, E. L.; Boettger, J. C.; Fernández, J. C.

2015-12-01

In a recent experiment at the Trident laser facility, a laser-driven beam of quasimonoenergetic aluminum ions was used to heat solid gold and diamond foils isochorically to 5.5 and 1.7 eV, respectively. Here theoretical calculations are presented that suggest the gold and diamond were heated uniformly by these laser-driven ion beams. According to calculations and SESAME equation-of-state tables, laser-driven aluminum ion beams achievable at Trident, with a finite energy spread of ΔE /E ˜20 %, are expected to heat the targets more uniformly than a beam of 140-MeV aluminum ions with zero energy spread. The robustness of the expected heating uniformity relative to the changes in the incident ion energy spectra is evaluated, and expected plasma temperatures of various target materials achievable with the current experimental platform are presented.

AKI after Conditional and Kidney-Specific Knockdown of Stanniocalcin-1

PubMed Central

Huang, Luping; Belousova, Tatiana; Pan, Jenny Szu-Chin; Du, Jie; Ju, Huiming; Lu, Lianghao; Zhang, Pumin; Truong, Luan D.; Nuotio-Antar, Alli

2014-01-01

Stanniocalcin-1 is an intracrine protein; it binds to the cell surface, is internalized to the mitochondria, and diminishes superoxide generation through induction of uncoupling proteins. In vitro, stanniocalcin-1 inhibits macrophages and preserves endothelial barrier function, and transgenic overexpression of stanniocalcin-1 in mice protects against ischemia-reperfusion kidney injury. We sought to determine the kidney phenotype after kidney endothelium-specific expression of stanniocalcin-1 small hairpin RNA (shRNA). We generated transgenic mice that express stanniocalcin-1 shRNA or scrambled shRNA upon removal of a floxed reporter (phosphoglycerate kinase-driven enhanced green fluorescent protein) and used ultrasound microbubbles to deliver tyrosine kinase receptor-2 promoter-driven Cre to the kidney to permit kidney endothelium-specific shRNA expression. Stanniocalcin-1 mRNA and protein were expressed throughout the kidney in wild-type mice. Delivery of tyrosine kinase receptor-2 promoter-driven Cre to stanniocalcin-1 shRNA transgenic kidneys diminished the expression of stanniocalcin-1 mRNA and protein throughout the kidneys. Stanniocalcin-1 mRNA and protein expression did not change in similarly treated scrambled shRNA transgenic kidneys, and we observed no Cre protein expression in cultured and tyrosine kinase receptor-2 promoter-driven Cre–transfected proximal tubule cells, suggesting that knockdown of stanniocalcin-1 in epithelial cells in vivo may result from stanniocalcin-1 shRNA transfer from endothelial cells to epithelial cells. Kidney-specific knockdown of stanniocalcin-1 led to severe proximal tubule injury characterized by vacuolization, decreased uncoupling of protein-2 expression, greater generation of superoxide, activation of the unfolded protein response, initiation of autophagy, cell apoptosis, and kidney failure. Our observations suggest that stanniocalcin-1 is critical for tubular epithelial survival under physiologic conditions. PMID:24700878

Increased TET1 Expression in Inflammatory Microenvironment of Hyperinsulinemia Enhances the Response of Endometrial Cancer to Estrogen by Epigenetic Modulation of GPER

PubMed Central

Lv, Qiao-Ying; Xie, Bing-Ying; Yang, Bing-Yi; Ning, Cheng-Cheng; Shan, Wei-Wei; Gu, Chao; Luo, Xue-Zhen; Chen, Xiao-Jun; Zhang, Zhen-Bo; Feng, You-Ji

2017-01-01

Background: Insulin resistance (IR) has been well studied in the initiation and development of endometrial endometrioid carcinoma (EEC). As yet, it has been largely neglected for estrogen sensitivity in local endometrium in hyperinsulinemia-induced systemic microenvironment. The aim of this study was to investigate the role of insulin in regulating estrogen sensitivity and explore the potential mechanisms in insulin-driven inflammatory microenvironment. Methods: We first investigated the effect of insulin on estradiol-driven endometrial cancer cells proliferation in vitro to address the roles of insulin in modulating estrogen sensitivity. Then GPER, ERα and TET1 in EEC samples with or without insulin resistance were screened by immunohistochemistry to confirm whether insulin resistance regulates estrogen receptors. Further mechanism analysis was carried out to address whether TET1 was mediated epigenetic modulation of GPER in insulin-induced microenvironment. Results: Insulin enhanced estradiol-driven endometrial cancer cells proliferation by up-regulating G-protein-coupled estrogen receptor (GPER) expression, but not ERα or ERβ. Immunohistochemistry of EEC tissues showed that GPER expression was greatly increased in endometrial tissues from EEC subjects with insulin resistance and was positively correlated with Ten-eleven-translocation 1 (TET1) expression. Mechanistically, insulin up-regulates TET1 expression, and the latter, an important DNA hydroxymethylase, could up-regulate GPER expression through epigenetic modulation. Conclusion: This study identified TET1 as the upstream regulator of GPER expression and provides a possible mechanism that insulin-induced positive regulation of estrogen sensitivity in endometrial cancer cells. Increasing expression of GPER through TET1-mediated epigenetic modulation may emerge as the main regulator to enhance the response of endometrial cancer to estrogen in insulin-driven inflammatory microenvironment. PMID:28382153

Increased TET1 Expression in Inflammatory Microenvironment of Hyperinsulinemia Enhances the Response of Endometrial Cancer to Estrogen by Epigenetic Modulation of GPER.

PubMed

Lv, Qiao-Ying; Xie, Bing-Ying; Yang, Bing-Yi; Ning, Cheng-Cheng; Shan, Wei-Wei; Gu, Chao; Luo, Xue-Zhen; Chen, Xiao-Jun; Zhang, Zhen-Bo; Feng, You-Ji

2017-01-01

Background: Insulin resistance (IR) has been well studied in the initiation and development of endometrial endometrioid carcinoma (EEC). As yet, it has been largely neglected for estrogen sensitivity in local endometrium in hyperinsulinemia-induced systemic microenvironment. The aim of this study was to investigate the role of insulin in regulating estrogen sensitivity and explore the potential mechanisms in insulin-driven inflammatory microenvironment. Methods: We first investigated the effect of insulin on estradiol-driven endometrial cancer cells proliferation in vitro to address the roles of insulin in modulating estrogen sensitivity. Then GPER, ERα and TET1 in EEC samples with or without insulin resistance were screened by immunohistochemistry to confirm whether insulin resistance regulates estrogen receptors. Further mechanism analysis was carried out to address whether TET1 was mediated epigenetic modulation of GPER in insulin-induced microenvironment. Results: Insulin enhanced estradiol-driven endometrial cancer cells proliferation by up-regulating G-protein-coupled estrogen receptor (GPER) expression, but not ERα or ERβ. Immunohistochemistry of EEC tissues showed that GPER expression was greatly increased in endometrial tissues from EEC subjects with insulin resistance and was positively correlated with Ten-eleven-translocation 1 (TET1) expression. Mechanistically, insulin up-regulates TET1 expression, and the latter, an important DNA hydroxymethylase, could up-regulate GPER expression through epigenetic modulation. Conclusion: This study identified TET1 as the upstream regulator of GPER expression and provides a possible mechanism that insulin-induced positive regulation of estrogen sensitivity in endometrial cancer cells. Increasing expression of GPER through TET1-mediated epigenetic modulation may emerge as the main regulator to enhance the response of endometrial cancer to estrogen in insulin-driven inflammatory microenvironment.

Large Field Visualization with Demand-Driven Calculation

NASA Technical Reports Server (NTRS)

Moran, Patrick J.; Henze, Chris

1999-01-01

We present a system designed for the interactive definition and visualization of fields derived from large data sets: the Demand-Driven Visualizer (DDV). The system allows the user to write arbitrary expressions to define new fields, and then apply a variety of visualization techniques to the result. Expressions can include differential operators and numerous other built-in functions, ail of which are evaluated at specific field locations completely on demand. The payoff of following a demand-driven design philosophy throughout becomes particularly evident when working with large time-series data, where the costs of eager evaluation alternatives can be prohibitive.

Dendrimer-driven neurotrophin expression differs in temporal patterns between rodent and human stem cells.

PubMed

Shakhbazau, Antos; Shcharbin, Dzmitry; Seviaryn, Ihar; Goncharova, Natalya; Kosmacheva, Svetlana; Potapnev, Mihail; Bryszewska, Maria; Kumar, Ranjan; Biernaskie, Jeffrey; Midha, Rajiv

2012-05-07

This study reports the use of a nonviral expression system based on polyamidoamine dendrimers for time-restricted neurotrophin overproduction in mesenchymal stem cells and skin precursor-derived Schwann cells. The dendrimers were used to deliver plasmids for brain-derived neurotrophic factor (BDNF) or neurotrophin-3 (NT-3) expression in both rodent and human stem cells, and the timelines of expression were studied. We have found that, despite the fact that transfection efficiencies and protein expression levels were comparable, dendrimer-driven expression in human mesenchymal stem cells was characterized by a more rapid decline compared to rodent cells. Transient expression systems can be beneficial for some neurotrophins, which were earlier reported to cause unwanted side effects in virus-based long-term expression models. Nonviral neurotrophin expression is a biologically safe and accessible alternative to increase the therapeutic potential of autologous adult stem cells and stem cell-derived functional differentiated cells.

Simultaneous Inhibition of PI3Kδ and PI3Kα Induces ABC-DLBCL Regression by Blocking BCR-Dependent and -Independent Activation of NF-κB and AKT.

PubMed

Paul, Juliane; Soujon, Maurice; Wengner, Antje M; Zitzmann-Kolbe, Sabine; Sturz, Andrea; Haike, Katja; Keng Magdalene, Koh Hui; Tan, Sze Huey; Lange, Martin; Tan, Soo Yong; Mumberg, Dominik; Lim, Soon Thye; Ziegelbauer, Karl; Liu, Ningshu

2017-01-09

Compared with follicular lymphoma, high PI3Kα expression was more prevalent in diffuse large B cell lymphoma (DLBCL), although both tumor types expressed substantial PI3Kδ. Simultaneous inhibition of PI3Kα and PI3Kδ dramatically enhanced the anti-tumor profile in ABC-DLBCL models compared with selective inhibition of PI3Kδ, PI3Kα, or BTK. The anti-tumor activity was associated with suppression of p-AKT and a mechanism of blocking nuclear factor-κB activation driven by CD79 mut , CARD11 mut , TNFAIP3 mut , or MYD88 mut . Inhibition of PI3Kα/δ resulted in tumor regression in an ibrutinib-resistant CD79B WT /MYD88 mut patient-derived ABC-DLBCL model. Furthermore, rebound activation of BTK and AKT was identified as a mechanism limiting CD79B mut -ABC-DLBCL to show a robust response to PI3K and BTK inhibitor monotherapies. A combination of ibrutinib with the PI3Kα/δ inhibitor copanlisib produced a sustained complete response in vivo in CD79B mut /MYD88 mut ABC-DLBCL models. Copyright © 2017 Elsevier Inc. All rights reserved.

Complex Constructivism: A Theoretical Model of Complexity and Cognition

ERIC Educational Resources Information Center

Doolittle, Peter E.

2014-01-01

Education has long been driven by its metaphors for teaching and learning. These metaphors have influenced both educational research and educational practice. Complexity and constructivism are two theories that provide functional and robust metaphors. Complexity provides a metaphor for the structure of myriad phenomena, while constructivism…

Synaptic vesicle distribution by conveyor belt.

PubMed

Moughamian, Armen J; Holzbaur, Erika L F

2012-03-02

The equal distribution of synaptic vesicles among synapses along the axon is critical for robust neurotransmission. Wong et al. show that the continuous circulation of synaptic vesicles throughout the axon driven by molecular motors ultimately yields this even distribution. Copyright © 2012 Elsevier Inc. All rights reserved.

Robust kernel representation with statistical local features for face recognition.

PubMed

Yang, Meng; Zhang, Lei; Shiu, Simon Chi-Keung; Zhang, David

2013-06-01

Factors such as misalignment, pose variation, and occlusion make robust face recognition a difficult problem. It is known that statistical features such as local binary pattern are effective for local feature extraction, whereas the recently proposed sparse or collaborative representation-based classification has shown interesting results in robust face recognition. In this paper, we propose a novel robust kernel representation model with statistical local features (SLF) for robust face recognition. Initially, multipartition max pooling is used to enhance the invariance of SLF to image registration error. Then, a kernel-based representation model is proposed to fully exploit the discrimination information embedded in the SLF, and robust regression is adopted to effectively handle the occlusion in face images. Extensive experiments are conducted on benchmark face databases, including extended Yale B, AR (A. Martinez and R. Benavente), multiple pose, illumination, and expression (multi-PIE), facial recognition technology (FERET), face recognition grand challenge (FRGC), and labeled faces in the wild (LFW), which have different variations of lighting, expression, pose, and occlusions, demonstrating the promising performance of the proposed method.

Chronic gonadotropin-releasing hormone inhibits activin induction of the ovine follicle-stimulating hormone beta-subunit: involvement of 3',5'-cyclic adenosine monophosphate response element binding protein and nitric oxide synthase type I.

PubMed

Shafiee-Kermani, Farideh; Han, Sang-oh; Miller, William L

2007-07-01

FSH is induced by activin, and this expression is modulated by GnRH through FSHB expression. This report focuses on the inhibitory effect of GnRH on activin-induced FSHB expression. Activin-treated primary murine pituitary cultures robustly express mutant ovine FSHBLuc-DeltaAP1, a luciferase transgene driven by 4.7 kb of ovine FSHB promoter. This promoter lacks two GnRH-inducible activator protein-1 sites, making it easier to observe GnRH-mediated inhibition. Luciferase expression from this transgene was decreased 94% by 100 nM GnRH with a half-time of approximately 4 h in pituitary cultures, and this inhibition was independent of follistatin. Activators of cAMP and protein kinase C like forskolin and phorbol 12-myristate 3-acetate (PMA), respectively, mimicked GnRH action. Kinetic studies of wild-type ovine FSHBLuc in LbetaT2 cells showed continuous induction by activin (4-fold) over 20 h. Most of this induction (78%) was blocked, beginning at 6 h. cAMP response element binding protein (CREB) was implicated in this inhibition because overexpression of its constitutively active mutant mimicked GnRH, and its inhibitor (inducible cAMP early repressor isoform II) reversed the inhibition caused by GnRH, forskolin, or PMA. In addition, GnRH, forskolin, or PMA increased the expression of a CREB-responsive reporter gene, 6xCRE-37PRL-Luc. Inhibition of nitric oxide type I (NOSI) by 7-nitroindazole also reversed GnRH-mediated inhibition by 60%. It is known that GnRH and CREB induce production of NOSI in gonadotropes and neuronal cells, respectively. These data support the concept that chronic GnRH inhibits activin-induced ovine FSHB expression by sequential activation of CREB and NOSI through the cAMP and/or protein kinase C pathways.

Identification and temporal expression of putative circadian clock transcripts in the amphipod crustacean Talitrus saltator

PubMed Central

O’Grady, Joseph F.; Hoelters, Laura S.; Swain, Martin T.

2016-01-01

Background Talitrus saltator is an amphipod crustacean that inhabits the supralittoral zone on sandy beaches in the Northeast Atlantic and Mediterranean. T. saltator exhibits endogenous locomotor activity rhythms and time-compensated sun and moon orientation, both of which necessitate at least one chronometric mechanism. Whilst their behaviour is well studied, currently there are no descriptions of the underlying molecular components of a biological clock in this animal, and very few in other crustacean species. Methods We harvested brain tissue from animals expressing robust circadian activity rhythms and used homology cloning and Illumina RNAseq approaches to sequence and identify the core circadian clock and clock-related genes in these samples. We assessed the temporal expression of these genes in time-course samples from rhythmic animals using RNAseq. Results We identified a comprehensive suite of circadian clock gene homologues in T. saltator including the ‘core’ clock genes period (Talper), cryptochrome 2 (Talcry2), timeless (Taltim), clock (Talclk), and bmal1 (Talbmal1). In addition we describe the sequence and putative structures of 23 clock-associated genes including two unusual, extended isoforms of pigment dispersing hormone (Talpdh). We examined time-course RNAseq expression data, derived from tissues harvested from behaviourally rhythmic animals, to reveal rhythmic expression of these genes with approximately circadian period in Talper and Talbmal1. Of the clock-related genes, casein kinase IIβ (TalckIIβ), ebony (Talebony), jetlag (Taljetlag), pigment dispensing hormone (Talpdh), protein phosphatase 1 (Talpp1), shaggy (Talshaggy), sirt1 (Talsirt1), sirt7 (Talsirt7) and supernumerary limbs (Talslimb) show temporal changes in expression. Discussion We report the sequences of principle genes that comprise the circadian clock of T. saltator and highlight the conserved structural and functional domains of their deduced cognate proteins. Our sequencing data contribute to the growing inventory of described comparative clocks. Expression profiling of the identified clock genes illuminates tantalising targets for experimental manipulation to elucidate the molecular and cellular control of clock-driven phenotypes in this crustacean. PMID:27761341

A sensitive synthetic reporter for visualizing cytokinin signaling output in rice.

PubMed

Tao, Jinyuan; Sun, Huwei; Gu, Pengyuan; Liang, Zhihao; Chen, Xinni; Lou, Jiajing; Xu, Guohua; Zhang, Yali

2017-01-01

Cytokinins play many essential roles in plant growth and development, mainly through signal transduction pathways. Although the cytokinin signaling pathway in rice has been clarified, no synthetic reporter for cytokinin signaling output has been reported for rice. The sensitive synthetic reporter two-component signaling sensor ( TCSn ) is used in the model plant Arabidopsis; however, whether the reporter reflects the cytokinin signaling output pattern in rice remains unclear. Early-cytokinin-responsive type-A OsRR-binding element (A/G)GAT(C/T) was more clustered in the 15 type-A OsRRs than in the 13 control genes. Quantitative polymerase chain reaction analysis showed that the relative expression of seven type-A OsRRs in roots and shoots was significantly induced by exogenous cytokinin application, and that of seven OsRRs , mainly in roots, was inhibited by exogenous auxin application. We constructed a transgenic rice plant harboring a beta-glucuronidase (GUS) driven by the synthetic promoter TCSn . TCSn::GUS was expressed in the meristem of germinated rice seed and rice seedlings. Furthermore, TCSn::GUS expression in rice seedlings was induced specifically by exogenous cytokinin application and decreased by exogenous auxin application. Moreover, no obvious reduction in GUS levels was observed after three generations of selfing of transgenic plants, indicating that TCSn::GUS is not subject to transgene silencing. We report here a robust and sensitive synthetic sensor for monitoring the transcriptional output of the cytokinin signaling network in rice.

Knowledge Driven Variable Selection (KDVS) – a new approach to enrichment analysis of gene signatures obtained from high–throughput data

PubMed Central

2013-01-01

Background High–throughput (HT) technologies provide huge amount of gene expression data that can be used to identify biomarkers useful in the clinical practice. The most frequently used approaches first select a set of genes (i.e. gene signature) able to characterize differences between two or more phenotypical conditions, and then provide a functional assessment of the selected genes with an a posteriori enrichment analysis, based on biological knowledge. However, this approach comes with some drawbacks. First, gene selection procedure often requires tunable parameters that affect the outcome, typically producing many false hits. Second, a posteriori enrichment analysis is based on mapping between biological concepts and gene expression measurements, which is hard to compute because of constant changes in biological knowledge and genome analysis. Third, such mapping is typically used in the assessment of the coverage of gene signature by biological concepts, that is either score–based or requires tunable parameters as well, limiting its power. Results We present Knowledge Driven Variable Selection (KDVS), a framework that uses a priori biological knowledge in HT data analysis. The expression data matrix is transformed, according to prior knowledge, into smaller matrices, easier to analyze and to interpret from both computational and biological viewpoints. Therefore KDVS, unlike most approaches, does not exclude a priori any function or process potentially relevant for the biological question under investigation. Differently from the standard approach where gene selection and functional assessment are applied independently, KDVS embeds these two steps into a unified statistical framework, decreasing the variability derived from the threshold–dependent selection, the mapping to the biological concepts, and the signature coverage. We present three case studies to assess the usefulness of the method. Conclusions We showed that KDVS not only enables the selection of known biological functionalities with accuracy, but also identification of new ones. An efficient implementation of KDVS was devised to obtain results in a fast and robust way. Computing time is drastically reduced by the effective use of distributed resources. Finally, integrated visualization techniques immediately increase the interpretability of results. Overall, KDVS approach can be considered as a viable alternative to enrichment–based approaches. PMID:23302187

Targeting MYCN-Driven Transcription By BET-Bromodomain Inhibition.

PubMed

Henssen, Anton; Althoff, Kristina; Odersky, Andrea; Beckers, Anneleen; Koche, Richard; Speleman, Frank; Schäfers, Simon; Bell, Emma; Nortmeyer, Maike; Westermann, Frank; De Preter, Katleen; Florin, Alexandra; Heukamp, Lukas; Spruessel, Annika; Astrahanseff, Kathy; Lindner, Sven; Sadowski, Natalie; Schramm, Alexander; Astorgues-Xerri, Lucile; Riveiro, Maria E; Eggert, Angelika; Cvitkovic, Esteban; Schulte, Johannes H

2016-05-15

Targeting BET proteins was previously shown to have specific antitumoral efficacy against MYCN-amplified neuroblastoma. We here assess the therapeutic efficacy of the BET inhibitor, OTX015, in preclinical neuroblastoma models and extend the knowledge on the role of BRD4 in MYCN-driven neuroblastoma. The efficacy of OTX015 was assessed in in vitro and in vivo models of human and murine MYCN-driven neuroblastoma. To study the effects of BET inhibition in the context of high MYCN levels, MYCN was ectopically expressed in human and murine cells. The effect of OTX015 on BRD4-regulated transcriptional pause release was analyzed using BRD4 and H3K27Ac chromatin immunoprecipitation coupled with DNA sequencing (ChIP-Seq) and gene expression analysis in neuroblastoma cells treated with OTX015 compared with vehicle control. OTX015 showed therapeutic efficacy against preclinical MYCN-driven neuroblastoma models. Similar to previously described BET inhibitors, concurrent MYCN repression was observed in OTX015-treated samples. Ectopic MYCN expression, however, did not abrogate effects of OTX015, indicating that MYCN repression is not the only target of BET proteins in neuroblastoma. When MYCN was ectopically expressed, BET inhibition still disrupted MYCN target gene transcription without affecting MYCN expression. We found that BRD4 binds to super-enhancers and MYCN target genes, and that OTX015 specifically disrupts BRD4 binding and transcription of these genes. We show that OTX015 is effective against mouse and human MYCN-driven tumor models and that BRD4 not only targets MYCN, but specifically occupies MYCN target gene enhancers as well as other genes associated with super-enhancers. Clin Cancer Res; 22(10); 2470-81. ©2015 AACR. ©2015 American Association for Cancer Research.

RNA-Sequencing studies identify genes differentially regulated during inflammation-driven lung tumorigenesis and targeted by chemopreventive agents

PubMed Central

Qian, Xuemin; Khammanivong, Ali; Song, Jung Min; Teferi, Fitsum; Upadhyaya, Pramod; Dickerson, Erin; Kassie, Fekadu

2016-01-01

Chronic pulmonary inflammation has been consistently shown to increase the risk of lung cancer. Therefore, assessing the molecular links between the two diseases and identification of chemopreventive agents that inhibit inflammation-driven lung tumorigenesis is indispensable. Recently, we found that 4-(methylnitro-samino)-1-(3-pyridyl)-1-butanone (NNK)-induced mouse lung tumorigenesis was significantly enhanced by chronic treatment with the inflammatory agents lipopolysaccharide (LPS) and combinatory treatment with the chemoprevenitve agents silibinin (Sil) and indole-3-carbinol (I3C) significantly inhibited the burden of inflammation-driven lung tumors. In this report, we described gene expression profiling of lung tissues derived from these studies to determine the gene expression signature in inflammation-driven lung tumors and modulation of this signature by the chemopreventive agents Sil and I3C. We found that 330, 2,957, and 1,143 genes were differentially regulated in mice treated with NNK, LPS, and NNK + LPS, respectively. The inflammatory response of lung tumors to LPS, as determined by the number of proinflammatory genes with altered gene expression or the level of alteration, was markedly less than that of normal lungs. Among 1,143 genes differentially regulated in the NNK + LPS group, the expression of 162 genes and associated signaling pathways were significantly modulated by I3C and/or Sil + I3C. These genes include cytokines, chemokines, putative oncogenes and tumor suppressor genes and Ros1, AREG, EREG, Cyp1a1, Arntl, and Npas2. To our knowledge, this is the first report that provides insight into genes that are differentially expressed during inflammation-driven lung tumorigenesis and the modulation of these genes by chemopreventive agents. PMID:25795230

Characterizing wood-plastic composites via data-driven methodologies

Treesearch

John G. Michopoulos; John C. Hermanson; Robert Badaliance

2007-01-01

The recent increase of wood-plastic composite materials in various application areas has underlined the need for an efficient and robust methodology to characterize their nonlinear anisotropic constitutive behavior. In addition, the multiplicity of various loading conditions in structures utilizing these materials further increases the need for a characterization...

On Teacher Quality in Independent Schools

ERIC Educational Resources Information Center

Balossi, Matt; Hernandez, Natalia R.

2016-01-01

Independent schools pride themselves on providing a unique educational experience for students, one that is robust and mission-driven and capitalizes on lower student-to-teacher ratios that allow for more personalized learning and high-quality teachers. Numerous studies measure teacher effectiveness in public schools, yet there is little research…

Zonal flow generation in inertial confinement fusion implosions

DOE PAGES

Peterson, J. L.; Humbird, K. D.; Field, J. E.; ...

2017-03-06

A supervised machine learning algorithm trained on a multi-petabyte dataset of inertial confinement fusion simulations has identified a class of implosions that robustly achieve high yield, even in the presence of drive variations and hydrodynamic perturbations. These implosions are purposefully driven with a time-varying asymmetry, such that coherent flow generation during hotspot stagnation forces the capsule to self-organize into an ovoid, a shape that appears to be more resilient to shell perturbations than spherical designs. Here this new class of implosions, whose configurations are reminiscent of zonal flows in magnetic fusion devices, may offer a path to robust inertial fusion.

Nonparametric methods for doubly robust estimation of continuous treatment effects.

PubMed

Kennedy, Edward H; Ma, Zongming; McHugh, Matthew D; Small, Dylan S

2017-09-01

Continuous treatments (e.g., doses) arise often in practice, but many available causal effect estimators are limited by either requiring parametric models for the effect curve, or by not allowing doubly robust covariate adjustment. We develop a novel kernel smoothing approach that requires only mild smoothness assumptions on the effect curve, and still allows for misspecification of either the treatment density or outcome regression. We derive asymptotic properties and give a procedure for data-driven bandwidth selection. The methods are illustrated via simulation and in a study of the effect of nurse staffing on hospital readmissions penalties.

Zonal flow generation in inertial confinement fusion implosions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, J. L.; Humbird, K. D.; Field, J. E.

A supervised machine learning algorithm trained on a multi-petabyte dataset of inertial confinement fusion simulations has identified a class of implosions that robustly achieve high yield, even in the presence of drive variations and hydrodynamic perturbations. These implosions are purposefully driven with a time-varying asymmetry, such that coherent flow generation during hotspot stagnation forces the capsule to self-organize into an ovoid, a shape that appears to be more resilient to shell perturbations than spherical designs. Here this new class of implosions, whose configurations are reminiscent of zonal flows in magnetic fusion devices, may offer a path to robust inertial fusion.

Robust, synergistic regulation of human gene expression using TALE activators.

PubMed

Maeder, Morgan L; Linder, Samantha J; Reyon, Deepak; Angstman, James F; Fu, Yanfang; Sander, Jeffry D; Joung, J Keith

2013-03-01

Artificial activators designed using transcription activator-like effector (TALE) technology have broad utility, but previous studies suggest that these monomeric proteins often exhibit low activities. Here we demonstrate that TALE activators can robustly function individually or in synergistic combinations to increase expression of endogenous human genes over wide dynamic ranges. These findings will encourage applications of TALE activators for research and therapy, and guide design of monomeric TALE-based fusion proteins.

Robust Principal Component Analysis Regularized by Truncated Nuclear Norm for Identifying Differentially Expressed Genes.

PubMed

Wang, Ya-Xuan; Gao, Ying-Lian; Liu, Jin-Xing; Kong, Xiang-Zhen; Li, Hai-Jun

2017-09-01

Identifying differentially expressed genes from the thousands of genes is a challenging task. Robust principal component analysis (RPCA) is an efficient method in the identification of differentially expressed genes. RPCA method uses nuclear norm to approximate the rank function. However, theoretical studies showed that the nuclear norm minimizes all singular values, so it may not be the best solution to approximate the rank function. The truncated nuclear norm is defined as the sum of some smaller singular values, which may achieve a better approximation of the rank function than nuclear norm. In this paper, a novel method is proposed by replacing nuclear norm of RPCA with the truncated nuclear norm, which is named robust principal component analysis regularized by truncated nuclear norm (TRPCA). The method decomposes the observation matrix of genomic data into a low-rank matrix and a sparse matrix. Because the significant genes can be considered as sparse signals, the differentially expressed genes are viewed as the sparse perturbation signals. Thus, the differentially expressed genes can be identified according to the sparse matrix. The experimental results on The Cancer Genome Atlas data illustrate that the TRPCA method outperforms other state-of-the-art methods in the identification of differentially expressed genes.

Observation of Discrete-Time-Crystal Signatures in an Ordered Dipolar Many-Body System

NASA Astrophysics Data System (ADS)

Rovny, Jared; Blum, Robert L.; Barrett, Sean E.

2018-05-01

A discrete time crystal (DTC) is a robust phase of driven systems that breaks the discrete time translation symmetry of the driving Hamiltonian. Recent experiments have observed DTC signatures in two distinct systems. Here we show nuclear magnetic resonance observations of DTC signatures in a third, strikingly different system: an ordered spatial crystal. We use a novel DTC echo experiment to probe the coherence of the driven system. Finally, we show that interactions during the pulse of the DTC sequence contribute to the decay of the signal, complicating attempts to measure the intrinsic lifetime of the DTC.

Observation of Discrete-Time-Crystal Signatures in an Ordered Dipolar Many-Body System.

PubMed

Rovny, Jared; Blum, Robert L; Barrett, Sean E

2018-05-04

A discrete time crystal (DTC) is a robust phase of driven systems that breaks the discrete time translation symmetry of the driving Hamiltonian. Recent experiments have observed DTC signatures in two distinct systems. Here we show nuclear magnetic resonance observations of DTC signatures in a third, strikingly different system: an ordered spatial crystal. We use a novel DTC echo experiment to probe the coherence of the driven system. Finally, we show that interactions during the pulse of the DTC sequence contribute to the decay of the signal, complicating attempts to measure the intrinsic lifetime of the DTC.

Delay-induced cluster patterns in coupled Cayley tree networks

NASA Astrophysics Data System (ADS)

Singh, A.; Jalan, S.

2013-07-01

We study effects of delay in diffusively coupled logistic maps on the Cayley tree networks. We find that smaller coupling values exhibit sensitiveness to value of delay, and lead to different cluster patterns of self-organized and driven types. Whereas larger coupling strengths exhibit robustness against change in delay values, and lead to stable driven clusters comprising nodes from last generation of the Cayley tree. Furthermore, introduction of delay exhibits suppression as well as enhancement of synchronization depending upon coupling strength values. To the end we discuss the importance of results to understand conflicts and cooperations observed in family business.

Environmental Noise, Genetic Diversity and the Evolution of Evolvability and Robustness in Model Gene Networks

PubMed Central

Steiner, Christopher F.

2012-01-01

The ability of organisms to adapt and persist in the face of environmental change is accepted as a fundamental feature of natural systems. More contentious is whether the capacity of organisms to adapt (or “evolvability”) can itself evolve and the mechanisms underlying such responses. Using model gene networks, I provide evidence that evolvability emerges more readily when populations experience positively autocorrelated environmental noise (red noise) compared to populations in stable or randomly varying (white noise) environments. Evolvability was correlated with increasing genetic robustness to effects on network viability and decreasing robustness to effects on phenotypic expression; populations whose networks displayed greater viability robustness and lower phenotypic robustness produced more additive genetic variation and adapted more rapidly in novel environments. Patterns of selection for robustness varied antagonistically with epistatic effects of mutations on viability and phenotypic expression, suggesting that trade-offs between these properties may constrain their evolutionary responses. Evolution of evolvability and robustness was stronger in sexual populations compared to asexual populations indicating that enhanced genetic variation under fluctuating selection combined with recombination load is a primary driver of the emergence of evolvability. These results provide insight into the mechanisms potentially underlying rapid adaptation as well as the environmental conditions that drive the evolution of genetic interactions. PMID:23284934

A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori

PubMed Central

Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

2012-01-01

Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

Nonlatching positive feedback enables robust bimodality by decoupling expression noise from the mean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Razooky, Brandon S.; Cao, Youfang; Hansen, Maike M. K.

Fundamental to biological decision-making is the ability to generate bimodal expression patterns where two alternate expression states simultaneously exist. Here in this study, we use a combination of single-cell analysis and mathematical modeling to examine the sources of bimodality in the transcriptional program controlling HIV’s fate decision between active replication and viral latency. We find that the HIV Tat protein manipulates the intrinsic toggling of HIV’s promoter, the LTR, to generate bimodal ON-OFF expression, and that transcriptional positive feedback from Tat shifts and expands the regime of LTR bimodality. This result holds for both minimal synthetic viral circuits and full-lengthmore » virus. Strikingly, computational analysis indicates that the Tat circuit’s non-cooperative ‘non-latching’ feedback architecture is optimized to slow the promoter’s toggling and generate bimodality by stochastic extinction of Tat. In contrast to the standard Poisson model, theory and experiment show that non-latching positive feedback substantially dampens the inverse noise-mean relationship to maintain stochastic bimodality despite increasing mean-expression levels. Given the rapid evolution of HIV, the presence of a circuit optimized to robustly generate bimodal expression appears consistent with the hypothesis that HIV’s decision between active replication and latency provides a viral fitness advantage. More broadly, the results suggest that positive-feedback circuits may have evolved not only for signal amplification but also for robustly generating bimodality by decoupling expression fluctuations (noise) from mean expression levels.« less

Posed versus spontaneous facial expressions are modulated by opposite cerebral hemispheres.

PubMed

Ross, Elliott D; Pulusu, Vinay K

2013-05-01

Clinical research has indicated that the left face is more expressive than the right face, suggesting that modulation of facial expressions is lateralized to the right hemisphere. The findings, however, are controversial because the results explain, on average, approximately 4% of the data variance. Using high-speed videography, we sought to determine if movement-onset asymmetry was a more powerful research paradigm than terminal movement asymmetry. The results were very robust, explaining up to 70% of the data variance. Posed expressions began overwhelmingly on the right face whereas spontaneous expressions began overwhelmingly on the left face. This dichotomy was most robust for upper facial expressions. In addition, movement-onset asymmetries did not predict terminal movement asymmetries, which were not significantly lateralized. The results support recent neuroanatomic observations that upper versus lower facial movements have different forebrain motor representations and recent behavioral constructs that posed versus spontaneous facial expressions are modulated preferentially by opposite cerebral hemispheres and that spontaneous facial expressions are graded rather than non-graded movements. Published by Elsevier Ltd.

Sonic hedgehog-Dependent Induction of MicroRNA 31 and MicroRNA 150 Regulates Mycobacterium bovis BCG-Driven Toll-Like Receptor 2 Signaling

PubMed Central

Ghorpade, Devram Sampat; Holla, Sahana; Kaveri, Srini V.; Bayry, Jagadeesh; Patil, Shripad A.

2013-01-01

Hedgehog (HH) signaling is a significant regulator of cell fate decisions during embryogenesis, development, and perpetuation of various disease conditions. Testing whether pathogen-specific HH signaling promotes unique innate recognition of intracellular bacteria, we demonstrate that among diverse Gram-positive or Gram-negative microbes, Mycobacterium bovis BCG, a vaccine strain, elicits a robust activation of Sonic HH (SHH) signaling in macrophages. Interestingly, sustained tumor necrosis factor alpha (TNF-α) secretion by macrophages was essential for robust SHH activation, as TNF-α−/− macrophages exhibited compromised ability to activate SHH signaling. Neutralization of TNF-α or blockade of TNF-α receptor signaling significantly reduced the infection-induced SHH signaling activation both in vitro and in vivo. Intriguingly, activated SHH signaling downregulated M. bovis BCG-mediated Toll-like receptor 2 (TLR2) signaling events to regulate a battery of genes associated with divergent functions of M1/M2 macrophages. Genome-wide expression profiling as well as conventional gain-of-function or loss-of-function analysis showed that SHH signaling-responsive microRNA 31 (miR-31) and miR-150 target MyD88, an adaptor protein of TLR2 signaling, thus leading to suppression of TLR2 responses. SHH signaling signatures could be detected in vivo in tuberculosis patients and M. bovis BCG-challenged mice. Collectively, these investigations identify SHH signaling to be what we believe is one of the significant regulators of host-pathogen interactions. PMID:23166298

Scaling of Optogenetically Evoked Signaling in a Higher-Order Corticocortical Pathway in the Anesthetized Mouse.

PubMed

Li, Xiaojian; Yamawaki, Naoki; Barrett, John M; Körding, Konrad P; Shepherd, Gordon M G

2018-01-01

Quantitative analysis of corticocortical signaling is needed to understand and model information processing in cerebral networks. However, higher-order pathways, hodologically remote from sensory input, are not amenable to spatiotemporally precise activation by sensory stimuli. Here, we combined parametric channelrhodopsin-2 (ChR2) photostimulation with multi-unit electrophysiology to study corticocortical driving in a parietofrontal pathway from retrosplenial cortex (RSC) to posterior secondary motor cortex (M2) in mice in vivo . Ketamine anesthesia was used both to eliminate complex activity associated with the awake state and to enable stable recordings of responses over a wide range of stimulus parameters. Photostimulation of ChR2-expressing neurons in RSC, the upstream area, produced local activity that decayed quickly. This activity in turn drove downstream activity in M2 that arrived rapidly (5-10 ms latencies), and scaled in amplitude across a wide range of stimulus parameters as an approximately constant fraction (~0.1) of the upstream activity. A model-based analysis could explain the corticocortically driven activity with exponentially decaying kernels (~20 ms time constant) and small delay. Reverse (antidromic) driving was similarly robust. The results show that corticocortical signaling in this pathway drives downstream activity rapidly and scalably, in a mostly linear manner. These properties, identified in anesthetized mice and represented in a simple model, suggest a robust basis for supporting complex non-linear dynamic activity in corticocortical circuits in the awake state.

Detecting phenotype-driven transitions in regulatory network structure.

PubMed

Padi, Megha; Quackenbush, John

2018-01-01

Complex traits and diseases like human height or cancer are often not caused by a single mutation or genetic variant, but instead arise from functional changes in the underlying molecular network. Biological networks are known to be highly modular and contain dense "communities" of genes that carry out cellular processes, but these structures change between tissues, during development, and in disease. While many methods exist for inferring networks and analyzing their topologies separately, there is a lack of robust methods for quantifying differences in network structure. Here, we describe ALPACA (ALtered Partitions Across Community Architectures), a method for comparing two genome-scale networks derived from different phenotypic states to identify condition-specific modules. In simulations, ALPACA leads to more nuanced, sensitive, and robust module discovery than currently available network comparison methods. As an application, we use ALPACA to compare transcriptional networks in three contexts: angiogenic and non-angiogenic subtypes of ovarian cancer, human fibroblasts expressing transforming viral oncogenes, and sexual dimorphism in human breast tissue. In each case, ALPACA identifies modules enriched for processes relevant to the phenotype. For example, modules specific to angiogenic ovarian tumors are enriched for genes associated with blood vessel development, and modules found in female breast tissue are enriched for genes involved in estrogen receptor and ERK signaling. The functional relevance of these new modules suggests that not only can ALPACA identify structural changes in complex networks, but also that these changes may be relevant for characterizing biological phenotypes.

Using Public Data for Comparative Proteome Analysis in Precision Medicine Programs.

PubMed

Hughes, Christopher S; Morin, Gregg B

2018-03-01

Maximizing the clinical utility of information obtained in longitudinal precision medicine programs would benefit from robust comparative analyses to known information to assess biological features of patient material toward identifying the underlying features driving their disease phenotype. Herein, the potential for utilizing publically deposited mass-spectrometry-based proteomics data to perform inter-study comparisons of cell-line or tumor-tissue materials is investigated. To investigate the robustness of comparison between MS-based proteomics studies carried out with different methodologies, deposited data representative of label-free (MS1) and isobaric tagging (MS2 and MS3 quantification) are utilized. In-depth quantitative proteomics data acquired from analysis of ovarian cancer cell lines revealed the robust recapitulation of observable gene expression dynamics between individual studies carried out using significantly different methodologies. The observed signatures enable robust inter-study clustering of cell line samples. In addition, the ability to classify and cluster tumor samples based on observed gene expression trends when using a single patient sample is established. With this analysis, relevant gene expression dynamics are obtained from a single patient tumor, in the context of a precision medicine analysis, by leveraging a large cohort of repository data as a comparator. Together, these data establish the potential for state-of-the-art MS-based proteomics data to serve as resources for robust comparative analyses in precision medicine applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adaptive integral robust control and application to electromechanical servo systems.

PubMed

Deng, Wenxiang; Yao, Jianyong

2017-03-01

This paper proposes a continuous adaptive integral robust control with robust integral of the sign of the error (RISE) feedback for a class of uncertain nonlinear systems, in which the RISE feedback gain is adapted online to ensure the robustness against disturbances without the prior bound knowledge of the additive disturbances. In addition, an adaptive compensation integrated with the proposed adaptive RISE feedback term is also constructed to further reduce design conservatism when the system also exists parametric uncertainties. Lyapunov analysis reveals the proposed controllers could guarantee the tracking errors are asymptotically converging to zero with continuous control efforts. To illustrate the high performance nature of the developed controllers, numerical simulations are provided. At the end, an application case of an actual electromechanical servo system driven by motor is also studied, with some specific design consideration, and comparative experimental results are obtained to verify the effectiveness of the proposed controllers. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

A Robust Control of Two-Wheeled Mobile Manipulator with Underactuated Joint by Nonlinear Backstepping Method

NASA Astrophysics Data System (ADS)

Acar, Cihan; Murakami, Toshiyuki

In this paper, a robust control of two-wheeled mobile manipulator with underactuated joint is considered. Two-wheeled mobile manipulators are dynamically balanced two-wheeled driven systems that do not have any caster or extra wheels to stabilize their body. Two-wheeled mobile manipulators mainly have an important feature that makes them more flexible and agile than the statically stable mobile manipulators. However, two-wheeled mobile manipulator is an underactuated system due to its two-wheeled structure. Therefore, it is required to stabilize the underactuated passive body and, at the same time, control the position of the center of gravity (CoG) of the manipulator in this system. To realize this, nonlinear backstepping based control method with virtual double inverted pendulum model is proposed in this paper. Backstepping is used with sliding mode to increase the robustness of the system against modeling errors and other perturbations. Then robust acceleration control is also achieved by utilizing disturbance observer. Performance of the proposed method is evaluated by several experiments.

Association between PD-L1 expression and driven gene status in NSCLC: A meta-analysis.

PubMed

Li, D; Zhu, X; Wang, H; Li, N

2017-07-01

We explored the potential clinical association between programmed death-ligand 1 (PD-L1) expression and driven gene status in non-small cell lung cancer (NSCLC). We systemically searched through October 2015. Odd ratios (ORs) with 95% CIs were calculated to examine the association of PD-L1 expression with driven gene status. A random- or fixed-effects model was used. Nine studies were identified. KRAS-mutant tumors were more likely to be PD-L1 positive than KRAS-wild type tumors (51% vs 36%; OR 1.69; 95% CI 1.01-2.84; p = 0.045). In contrast, PD-L1 expression did not differ by EGFR (OR 0.86; 95% CI 0.43-1.73; p = 0.675) or ALK (OR 1.02; 95% CI 0.44-2.37; p = 0.954) status. In subgroup analysis, there was also no significant association between PD-L1 expression and EGFR status in term of the cut-offs or ethnicity. In conclusion, NSCLC with KRAS mutations showed a trend for higher frequency of positive PD-L1 expression. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights reserved.

Robust patterning of gene expression based on internal coordinate system of cells.

PubMed

Ogawa, Ken-ichiro; Miyake, Yoshihiro

2015-06-01

Cell-to-cell communication in multicellular organisms is established through the transmission of various kinds of chemical substances such as proteins. It is well known that gene expression triggered by a chemical substance in individuals has stable spatial patterns despite the individual differences in concentration patterns of the chemical substance. This fact reveals an important property of multicellular organisms called "robustness", which allows the organisms to generate their forms while maintaining proportion. Robustness has been conventionally accounted for by the stability of solutions of dynamical equations that represent a specific interaction network of chemical substances. However, any biological system is composed of autonomous elements. In general, an autonomous element does not merely accept information on the chemical substance from the environment; instead, it accepts the information based on its own criteria for reaction. Therefore, this phenomenon needs to be considered from the viewpoint of cells. Such a viewpoint is expected to allow the consideration of the autonomy of cells in multicellular organisms. This study aims to explain theoretically the robust patterning of gene expression from the viewpoint of cells. For this purpose, we introduced a new operator for transforming a state variable of a chemical substance from an external coordinate system to an internal coordinate system of each cell, which describes the observation of the chemical substance by cells. We then applied this operator to the simplest reaction-diffusion model of the chemical substance to investigate observation effects by cells. Our mathematical analysis of this extended model indicates that the robust patterning of gene expression against individual differences in concentration pattern of the chemical substance can be explained from the viewpoint of cells if there is a regulation field that compensates for the difference between cells seen in the observation results. This result provides a new insight into the investigation of the mechanism of robust patterning in biological systems composed of individual elements. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Aryl Hydrocarbon Receptor-Dependent Retention of Nuclear HuR Suppresses Cigarette Smoke-Induced Cyclooxygenase-2 Expression Independent of DNA-Binding

PubMed Central

Zago, Michela; Sheridan, Jared A.; Nair, Parameswaran; Rico de Souza, Angela; Gallouzi, Imed-Eddine; Rousseau, Simon; Di Marco, Sergio; Hamid, Qutayba; Eidelman, David H.; Baglole, Carolyn J.

2013-01-01

The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to man-made environmental toxicants, has emerged as an endogenous regulator of cyclooxygenase-2 (Cox-2) by a mechanism that is poorly understood. In this study, we first used AhR-deficient (AhR−/−) primary pulmonary cells, together with pharmacological tools to inhibit new RNA synthesis, to show that the AhR is a prominent factor in the destabilization of Cox-2 mRNA. The destabilization of Cox-2 mRNA and subsequent suppression of cigarette smoke-induced COX-2 protein expression by the AhR was independent of its ability to bind the dioxin response element (DRE), thereby differentiating the DRE-driven toxicological AhR pathway from its anti-inflammatory abilities. We further describe that the AhR destabilizes Cox-2 mRNA by sequestering HuR within the nucleus. The role of HuR in AhR stabilization of Cox-2 mRNA was confirmed by knockdown of HuR, which resulted in rapid Cox-2 mRNA degradation. Finally, in the lungs of AhR−/− mice exposed to cigarette smoke, there was little Cox-2 mRNA despite robust COX-2 protein expression, a finding that correlates with almost exclusive cytoplasmic HuR within the lungs of AhR−/− mice. Therefore, we propose that the AhR plays an important role in suppressing the expression of inflammatory proteins, a function that extends beyond the ability of the AhR to respond to man-made toxicants. These findings open the possibility that a DRE-independent AhR pathway may be exploited therapeutically as an anti-inflammatory target. PMID:24086407

Aryl hydrocarbon receptor-dependent retention of nuclear HuR suppresses cigarette smoke-induced cyclooxygenase-2 expression independent of DNA-binding.

PubMed

Zago, Michela; Sheridan, Jared A; Nair, Parameswaran; Rico de Souza, Angela; Gallouzi, Imed-Eddine; Rousseau, Simon; Di Marco, Sergio; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J

2013-01-01

The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to man-made environmental toxicants, has emerged as an endogenous regulator of cyclooxygenase-2 (Cox-2) by a mechanism that is poorly understood. In this study, we first used AhR-deficient (AhR(-/-) ) primary pulmonary cells, together with pharmacological tools to inhibit new RNA synthesis, to show that the AhR is a prominent factor in the destabilization of Cox-2 mRNA. The destabilization of Cox-2 mRNA and subsequent suppression of cigarette smoke-induced COX-2 protein expression by the AhR was independent of its ability to bind the dioxin response element (DRE), thereby differentiating the DRE-driven toxicological AhR pathway from its anti-inflammatory abilities. We further describe that the AhR destabilizes Cox-2 mRNA by sequestering HuR within the nucleus. The role of HuR in AhR stabilization of Cox-2 mRNA was confirmed by knockdown of HuR, which resulted in rapid Cox-2 mRNA degradation. Finally, in the lungs of AhR(-/-) mice exposed to cigarette smoke, there was little Cox-2 mRNA despite robust COX-2 protein expression, a finding that correlates with almost exclusive cytoplasmic HuR within the lungs of AhR(-/-) mice. Therefore, we propose that the AhR plays an important role in suppressing the expression of inflammatory proteins, a function that extends beyond the ability of the AhR to respond to man-made toxicants. These findings open the possibility that a DRE-independent AhR pathway may be exploited therapeutically as an anti-inflammatory target.

Data-Driven Robust Control Design: Unfalsified Control

DTIC Science & Technology

2006-12-01

only be determined by fresh information which we shall no doubt find waiting for us.” Sherlock Holmes Arthur Conan Doyle 1.0 INTRODUCTION Though the...begins to twist facts to suit theories instead of theories to suit facts.” Sherlock Holmes Arthur Conan Doyle 6.0 ACKNOWLEDGMENT I thank my current and

Optimization of direct fibroblast reprogramming to cardiomyocytes using calcium activity as a functional measure of success.

PubMed

Addis, Russell C; Ifkovits, Jamie L; Pinto, Filipa; Kellam, Lori D; Esteso, Paul; Rentschler, Stacey; Christoforou, Nicolas; Epstein, Jonathan A; Gearhart, John D

2013-07-01

Direct conversion of fibroblasts to induced cardiomyocytes (iCMs) has great potential for regenerative medicine. Recent publications have reported significant progress, but the evaluation of reprogramming has relied upon non-functional measures such as flow cytometry for cardiomyocyte markers or GFP expression driven by a cardiomyocyte-specific promoter. The issue is one of practicality: the most stringent measures - electrophysiology to detect cell excitation and the presence of spontaneously contracting myocytes - are not readily quantifiable in the large numbers of cells screened in reprogramming experiments. However, excitation and contraction are linked by a third functional characteristic of cardiomyocytes: the rhythmic oscillation of intracellular calcium levels. We set out to optimize direct conversion of fibroblasts to iCMs with a quantifiable calcium reporter to rapidly assess functional transdifferentiation. We constructed a reporter system in which the calcium indicator GCaMP is driven by the cardiomyocyte-specific Troponin T promoter. Using calcium activity as our primary outcome measure, we compared several published combinations of transcription factors along with novel combinations in mouse embryonic fibroblasts. The most effective combination consisted of Hand2, Nkx2.5, Gata4, Mef2c, and Tbx5 (HNGMT). This combination is >50-fold more efficient than GMT alone and produces iCMs with cardiomyocyte marker expression, robust calcium oscillation, and spontaneous beating that persist for weeks following inactivation of reprogramming factors. HNGMT is also significantly more effective than previously published factor combinations for the transdifferentiation of adult mouse cardiac fibroblasts to iCMs. Quantification of calcium function is a convenient and effective means for the identification and evaluation of cardiomyocytes generated by direct reprogramming. Using this stringent outcome measure, we conclude that HNGMT produces iCMs more efficiently than previously published methods. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

Robust PLS approach for KPI-related prediction and diagnosis against outliers and missing data

NASA Astrophysics Data System (ADS)

Yin, Shen; Wang, Guang; Yang, Xu

2014-07-01

In practical industrial applications, the key performance indicator (KPI)-related prediction and diagnosis are quite important for the product quality and economic benefits. To meet these requirements, many advanced prediction and monitoring approaches have been developed which can be classified into model-based or data-driven techniques. Among these approaches, partial least squares (PLS) is one of the most popular data-driven methods due to its simplicity and easy implementation in large-scale industrial process. As PLS is totally based on the measured process data, the characteristics of the process data are critical for the success of PLS. Outliers and missing values are two common characteristics of the measured data which can severely affect the effectiveness of PLS. To ensure the applicability of PLS in practical industrial applications, this paper introduces a robust version of PLS to deal with outliers and missing values, simultaneously. The effectiveness of the proposed method is finally demonstrated by the application results of the KPI-related prediction and diagnosis on an industrial benchmark of Tennessee Eastman process.

A fast and robust computational method for the ionization cross sections of the driven Schrödinger equation using an O (N) multigrid-based scheme

NASA Astrophysics Data System (ADS)

Cools, S.; Vanroose, W.

2016-03-01

This paper improves the convergence and robustness of a multigrid-based solver for the cross sections of the driven Schrödinger equation. Adding a Coupled Channel Correction Step (CCCS) after each multigrid (MG) V-cycle efficiently removes the errors that remain after the V-cycle sweep. The combined iterative solution scheme (MG-CCCS) is shown to feature significantly improved convergence rates over the classical MG method at energies where bound states dominate the solution, resulting in a fast and scalable solution method for the complex-valued Schrödinger break-up problem for any energy regime. The proposed solver displays optimal scaling; a solution is found in a time that is linear in the number of unknowns. The method is validated on a 2D Temkin-Poet model problem, and convergence results both as a solver and preconditioner are provided to support the O (N) scalability of the method. This paper extends the applicability of the complex contour approach for far field map computation (Cools et al. (2014) [10]).

Emergent phases and critical behavior in a non-Markovian open quantum system

NASA Astrophysics Data System (ADS)

Cheung, H. F. H.; Patil, Y. S.; Vengalattore, M.

2018-05-01

Open quantum systems exhibit a range of novel out-of-equilibrium behavior due to the interplay between coherent quantum dynamics and dissipation. Of particular interest in these systems are driven, dissipative transitions, the emergence of dynamical phases with novel broken symmetries, and critical behavior that lies beyond the conventional paradigm of Landau-Ginzburg phenomenology. Here, we consider a parametrically driven two-mode system in the presence of non-Markovian system-reservoir interactions. We show that the non-Markovian dynamics modifies the phase diagram of this system, resulting in the emergence of a broken symmetry phase in a universality class that has no counterpart in the corresponding Markovian system. This emergent phase is accompanied by enhanced two-mode entanglement that remains robust at finite temperatures. Such reservoir-engineered dynamical phases can potentially shed light on universal aspects of dynamical phase transitions in a wide range of nonequilibrium systems, and aid in the development of techniques for the robust generation of entanglement and quantum correlations at finite temperatures with potential applications to quantum control, state preparation, and metrology.

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks

PubMed Central

Gerstein, Mark

2016-01-01

Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem’s gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally–e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the “state” and “control” in the model refer to its own (internal) and another subsystem’s (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model’s parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with evolutionarily ancient functions (e.g. the ribosomal proteins), in contrast to those with more recently evolved functions (e.g., cell-cell communication). This suggests that despite striking morphological differences, some fundamental embryonic-developmental processes are still controlled by ancient regulatory systems. PMID:27760135

DREISS: Using State-Space Models to Infer the Dynamics of Gene Expression Driven by External and Internal Regulatory Networks.

PubMed

Wang, Daifeng; He, Fei; Maslov, Sergei; Gerstein, Mark

2016-10-01

Gene expression is controlled by the combinatorial effects of regulatory factors from different biological subsystems such as general transcription factors (TFs), cellular growth factors and microRNAs. A subsystem's gene expression may be controlled by its internal regulatory factors, exclusively, or by external subsystems, or by both. It is thus useful to distinguish the degree to which a subsystem is regulated internally or externally-e.g., how non-conserved, species-specific TFs affect the expression of conserved, cross-species genes during evolution. We developed a computational method (DREISS, dreiss.gerteinlab.org) for analyzing the Dynamics of gene expression driven by Regulatory networks, both External and Internal based on State Space models. Given a subsystem, the "state" and "control" in the model refer to its own (internal) and another subsystem's (external) gene expression levels. The state at a given time is determined by the state and control at a previous time. Because typical time-series data do not have enough samples to fully estimate the model's parameters, DREISS uses dimensionality reduction, and identifies canonical temporal expression trajectories (e.g., degradation, growth and oscillation) representing the regulatory effects emanating from various subsystems. To demonstrate capabilities of DREISS, we study the regulatory effects of evolutionarily conserved vs. divergent TFs across distant species. In particular, we applied DREISS to the time-series gene expression datasets of C. elegans and D. melanogaster during their embryonic development. We analyzed the expression dynamics of the conserved, orthologous genes (orthologs), seeing the degree to which these can be accounted for by orthologous (internal) versus species-specific (external) TFs. We found that between two species, the orthologs have matched, internally driven expression patterns but very different externally driven ones. This is particularly true for genes with evolutionarily ancient functions (e.g. the ribosomal proteins), in contrast to those with more recently evolved functions (e.g., cell-cell communication). This suggests that despite striking morphological differences, some fundamental embryonic-developmental processes are still controlled by ancient regulatory systems.

(Im)Perfect robustness and adaptation of metabolic networks subject to metabolic and gene-expression regulation: marrying control engineering with metabolic control analysis.

PubMed

He, Fei; Fromion, Vincent; Westerhoff, Hans V

2013-11-21

Metabolic control analysis (MCA) and supply-demand theory have led to appreciable understanding of the systems properties of metabolic networks that are subject exclusively to metabolic regulation. Supply-demand theory has not yet considered gene-expression regulation explicitly whilst a variant of MCA, i.e. Hierarchical Control Analysis (HCA), has done so. Existing analyses based on control engineering approaches have not been very explicit about whether metabolic or gene-expression regulation would be involved, but designed different ways in which regulation could be organized, with the potential of causing adaptation to be perfect. This study integrates control engineering and classical MCA augmented with supply-demand theory and HCA. Because gene-expression regulation involves time integration, it is identified as a natural instantiation of the 'integral control' (or near integral control) known in control engineering. This study then focuses on robustness against and adaptation to perturbations of process activities in the network, which could result from environmental perturbations, mutations or slow noise. It is shown however that this type of 'integral control' should rarely be expected to lead to the 'perfect adaptation': although the gene-expression regulation increases the robustness of important metabolite concentrations, it rarely makes them infinitely robust. For perfect adaptation to occur, the protein degradation reactions should be zero order in the concentration of the protein, which may be rare biologically for cells growing steadily. A proposed new framework integrating the methodologies of control engineering and metabolic and hierarchical control analysis, improves the understanding of biological systems that are regulated both metabolically and by gene expression. In particular, the new approach enables one to address the issue whether the intracellular biochemical networks that have been and are being identified by genomics and systems biology, correspond to the 'perfect' regulatory structures designed by control engineering vis-à-vis optimal functions such as robustness. To the extent that they are not, the analyses suggest how they may become so and this in turn should facilitate synthetic biology and metabolic engineering.

(Im)Perfect robustness and adaptation of metabolic networks subject to metabolic and gene-expression regulation: marrying control engineering with metabolic control analysis

PubMed Central

2013-01-01

Background Metabolic control analysis (MCA) and supply–demand theory have led to appreciable understanding of the systems properties of metabolic networks that are subject exclusively to metabolic regulation. Supply–demand theory has not yet considered gene-expression regulation explicitly whilst a variant of MCA, i.e. Hierarchical Control Analysis (HCA), has done so. Existing analyses based on control engineering approaches have not been very explicit about whether metabolic or gene-expression regulation would be involved, but designed different ways in which regulation could be organized, with the potential of causing adaptation to be perfect. Results This study integrates control engineering and classical MCA augmented with supply–demand theory and HCA. Because gene-expression regulation involves time integration, it is identified as a natural instantiation of the ‘integral control’ (or near integral control) known in control engineering. This study then focuses on robustness against and adaptation to perturbations of process activities in the network, which could result from environmental perturbations, mutations or slow noise. It is shown however that this type of ‘integral control’ should rarely be expected to lead to the ‘perfect adaptation’: although the gene-expression regulation increases the robustness of important metabolite concentrations, it rarely makes them infinitely robust. For perfect adaptation to occur, the protein degradation reactions should be zero order in the concentration of the protein, which may be rare biologically for cells growing steadily. Conclusions A proposed new framework integrating the methodologies of control engineering and metabolic and hierarchical control analysis, improves the understanding of biological systems that are regulated both metabolically and by gene expression. In particular, the new approach enables one to address the issue whether the intracellular biochemical networks that have been and are being identified by genomics and systems biology, correspond to the ‘perfect’ regulatory structures designed by control engineering vis-à-vis optimal functions such as robustness. To the extent that they are not, the analyses suggest how they may become so and this in turn should facilitate synthetic biology and metabolic engineering. PMID:24261908

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Understanding emotional expression using prosodic analysis of natural speech: refining the methodology.

PubMed

Cohen, Alex S; Hong, S Lee; Guevara, Alvaro

2010-06-01

Emotional expression is an essential function for daily life that can be severely affected in some psychological disorders. Laboratory-based procedures designed to measure prosodic expression from natural speech have shown early promise for measuring individual differences in emotional expression but have yet to produce robust within-group prosodic changes across various evocative conditions. This report presents data from three separate studies (total N = 464) that digitally recorded subjects as they verbalized their reactions to various stimuli. Format and stimuli were modified to maximize prosodic expression. Our results suggest that use of evocative slides organized according to either a dimensional (e.g., high and low arousal - pleasant, unpleasant and neutral valence) or categorical (e.g., fear, surprise, happiness) models produced robust changes in subjective state but only negligible change in prosodic expression. Alternatively, speech from the recall of autobiographical memories resulted in meaningful changes in both subjective state and prosodic expression. Implications for the study of psychological disorders are discussed.

Generation of a neurodegenerative disease mouse model using lentiviral vectors carrying an enhanced synapsin I promoter.

PubMed

Matsuzaki, Yasunori; Oue, Miho; Hirai, Hirokazu

2014-02-15

Certain inherited progressive neurodegenerative disorders, such as spinocerebellar ataxia (SCA), affect neurons in large areas of the central nervous system (CNS). The selective expression of disease-causing and therapeutic genes in susceptible regions and cell types is critical for the generation of animal models and development of gene therapies for these diseases. Previous studies have demonstrated the advantages of the short synapsin I (SynI) promoter (0.5 kb) as a neuron-specific promoter for robust transgene expression. However, the short SynI promoter has also shown some promoter activity in glia and a lack of transgene expression in significant areas of the CNS. New methods: To improve the SynI promoter, we used a SynI promoter that is twice as long (1.0 kb) as the short SynI promoter and incorporated a minimal CMV (minCMV) sequence. We observed that the 1.0 kb rat SynI promoter with minCMV [rSynI(1.0)-minCMV] exhibited robust promoter strength, excellent neuronal specificity and wide-ranging transgene expression throughout the CNS. Comparison with existing methods: Compared with the two previously reported short (0.5 kb) promoters, the new promoter was superior with respect to neuronal specificity and more efficiently transduced neurons. Moreover, transgenic mice expressing the mutant protein ATXN1[Q98], which causes SCA type 1 (SCA1), under the control of the rSynI(1.0)-minCMV promoter showed robust transgene expression specifically in neurons throughout the CNS and exhibited progressive ataxia. rSynI(1.0)-minCMV drives robust and neuron-specific transgene expression throughout the CNS and is therefore useful for viral vector-mediated neuron-specific gene delivery and generation of neuron-specific transgenic animals. Copyright © 2013 Elsevier B.V. All rights reserved.

Identifying Androgen Receptor-Independent Mechanisms of Prostate Cancer Resistance to Second-Generation Antiandrogen Therapy

DTIC Science & Technology

2016-08-01

expanded upon the relationship between GR and SGK1 in the context of enzalutamide-driven prostate cancer. We have generated CRISPR /Cas9 cell lines...Complete Generate SGK1 overexpressing cell models 50% Ongoing Clone SGK1 CRISPR 100% Complete Generate SGK1-deficient cell models 75% Ongoing Test...driven enzalutamide resistance, GR-expressing enzalutamide-resistant prostate cancer cells expressing CRISPR /Cas9 and a guide targeting SGK1 (sgSGK1

Global transcriptional regulatory network for Escherichia coli robustly connects gene expression to transcription factor activities

PubMed Central

Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.

2017-01-01

Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552

Biologically inspired robots elicit a robust fear response in zebrafish

NASA Astrophysics Data System (ADS)

Ladu, Fabrizio; Bartolini, Tiziana; Panitz, Sarah G.; Butail, Sachit; Macrı, Simone; Porfiri, Maurizio

2015-03-01

We investigate the behavioral response of zebrafish to three fear-evoking stimuli. In a binary choice test, zebrafish are exposed to a live allopatric predator, a biologically-inspired robot, and a computer-animated image of the live predator. A target tracking algorithm is developed to score zebrafish behavior. Unlike computer-animated images, the robotic and live predator elicit a robust avoidance response. Importantly, the robotic stimulus elicits more consistent inter-individual responses than the live predator. Results from this effort are expected to aid in hypothesis-driven studies on zebrafish fear response, by offering a valuable approach to maximize data-throughput and minimize animal subjects.

A dynamically adaptive multigrid algorithm for the incompressible Navier-Stokes equations: Validation and model problems

NASA Technical Reports Server (NTRS)

Thompson, C. P.; Leaf, G. K.; Vanrosendale, J.

1991-01-01

An algorithm is described for the solution of the laminar, incompressible Navier-Stokes equations. The basic algorithm is a multigrid based on a robust, box-based smoothing step. Its most important feature is the incorporation of automatic, dynamic mesh refinement. This algorithm supports generalized simple domains. The program is based on a standard staggered-grid formulation of the Navier-Stokes equations for robustness and efficiency. Special grid transfer operators were introduced at grid interfaces in the multigrid algorithm to ensure discrete mass conservation. Results are presented for three models: the driven-cavity, a backward-facing step, and a sudden expansion/contraction.

The Influence of Assortativity on the Robustness of Signal-Integration Logic in Gene Regulatory Networks

PubMed Central

Pechenick, Dov A.; Payne, Joshua L.; Moore, Jason H.

2011-01-01

Gene regulatory networks (GRNs) drive the cellular processes that sustain life. To do so reliably, GRNs must be robust to perturbations, such as gene deletion and the addition or removal of regulatory interactions. GRNs must also be robust to genetic changes in regulatory regions that define the logic of signal-integration, as these changes can affect how specific combinations of regulatory signals are mapped to particular gene expression states. Previous theoretical analyses have demonstrated that the robustness of a GRN is influenced by its underlying topological properties, such as degree distribution and modularity. Another important topological property is assortativity, which measures the propensity with which nodes of similar connectivity are connected to one another. How assortativity influences the robustness of the signal-integration logic of GRNs remains an open question. Here, we use computational models of GRNs to investigate this relationship. We separately consider each of the three dynamical regimes of this model for a variety of degree distributions. We find that in the chaotic regime, robustness exhibits a pronounced increase as assortativity becomes more positive, while in the critical and ordered regimes, robustness is generally less sensitive to changes in assortativity. We attribute the increased robustness to a decrease in the duration of the gene expression pattern, which is caused by a reduction in the average size of a GRN’s in-components. This study provides the first direct evidence that assortativity influences the robustness of the signal-integration logic of computational models of GRNs, illuminates a mechanistic explanation for this influence, and furthers our understanding of the relationship between topology and robustness in complex biological systems. PMID:22155134

A 310-bp minimal promoter mediates smooth muscle cell-specific expression of telokin.

PubMed

Smith, A F; Bigsby, R M; Word, R A; Herring, B P

1998-05-01

A cell-specific promoter located in an intron of the smooth muscle myosin light chain kinase gene directs transcription of telokin exclusively in smooth muscle cells. Transgenic mice were generated in which a 310-bp rabbit telokin promoter fragment, extending from -163 to +147, was used to drive expression of simian virus 40 large T antigen. Smooth muscle-specific expression of the T-antigen transgene paralleled that of the endogenous telokin gene in all smooth muscle tissues except uterus. The 310-bp promoter fragment resulted in very low levels of transgene expression in uterus; in contrast, a transgene driven by a 2.4-kb fragment (-2250 to +147) resulted in high levels of transgene expression in uterine smooth muscle. Telokin expression levels correlate with the estrogen status of human myometrial tissues, suggesting that deletion of an estrogen response element (ERE) may account for the low levels of transgene expression driven by the 310-bp rabbit telokin promoter in uterine smooth muscle. Experiments in A10 smooth muscle cells directly showed that reporter gene expression driven by the 2.4-kb, but not 310-bp, promoter fragment could be stimulated two- to threefold by estrogen. This stimulation was mediated through an ERE located between -1447 and -1474. Addition of the ERE to the 310-bp fragment restored estrogen responsiveness in A10 cells. These data demonstrate that in addition to a minimal 310-bp proximal promoter at least one distal cis-acting regulatory element is required for telokin expression in uterine smooth muscle. The distal element may include an ERE between -1447 and -1474.

Identification of copy number variation-driven genes for liver cancer via bioinformatics analysis.

PubMed

Lu, Xiaojie; Ye, Kun; Zou, Kailin; Chen, Jinlian

2014-11-01

To screen out copy number variation (CNV)-driven differentially expressed genes (DEGs) in liver cancer and advance our understanding of the pathogenesis, an integrated analysis of liver cancer-related CNV data from The Cancer Genome Atlas (TCGA) and gene expression data from EBI Array Express database were performed. The DEGs were identified by package limma based on the cut-off of |log2 (fold-change)|>0.585 and adjusted p-value<0.05. Using hg19 annotation information provided by UCSC, liver cancer-related CNVs were then screened out. TF-target gene interactions were also predicted with information from UCSC using DAVID online tools. As a result, 25 CNV-driven genes were obtained, including tripartite motif containing 28 (TRIM28) and RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1). In the transcriptional regulatory network, 8 known cancer-related transcription factors (TFs) interacted with 21 CNV-driven genes, suggesting that the other 8 TFs may be involved in liver cancer. These genes may be potential biomarkers for early detection and prevention of liver cancer. These findings may improve our knowledge of the pathogenesis of liver cancer. Nevertheless, further experiments are still needed to confirm our findings.

Exponential integrators in time-dependent density-functional calculations

NASA Astrophysics Data System (ADS)

Kidd, Daniel; Covington, Cody; Varga, Kálmán

2017-12-01

The integrating factor and exponential time differencing methods are implemented and tested for solving the time-dependent Kohn-Sham equations. Popular time propagation methods used in physics, as well as other robust numerical approaches, are compared to these exponential integrator methods in order to judge the relative merit of the computational schemes. We determine an improvement in accuracy of multiple orders of magnitude when describing dynamics driven primarily by a nonlinear potential. For cases of dynamics driven by a time-dependent external potential, the accuracy of the exponential integrator methods are less enhanced but still match or outperform the best of the conventional methods tested.

Period doubling in period-one steady states

NASA Astrophysics Data System (ADS)

Wang, Reuben R. W.; Xing, Bo; Carlo, Gabriel G.; Poletti, Dario

2018-02-01

Nonlinear classical dissipative systems present a rich phenomenology in their "route to chaos," including period doubling, i.e., the system evolves with a period which is twice that of the driving. However, typically the attractor of a periodically driven quantum open system evolves with a period which exactly matches that of the driving. Here, we analyze a periodically driven many-body open quantum system whose classical correspondent presents period doubling. We show that by studying the dynamical correlations, it is possible to show the occurrence of period doubling in the quantum (period-one) steady state. We also discuss that such systems are natural candidates for clean and intrinsically robust Floquet time crystals.

An miRNA-mediated therapy for SCA6 blocks IRES-driven translation of the CACNA1A second cistron.

PubMed

Miyazaki, Yu; Du, Xiaofei; Muramatsu, Shin-Ichi; Gomez, Christopher M

2016-07-13

Spinocerebellar ataxia type 6 (SCA6) is a dominantly inherited neurodegenerative disease characterized by slowly progressive ataxia and Purkinje cell degeneration. SCA6 is caused by a polyglutamine repeat expansion within a second CACNA1A gene product, α1ACT. α1ACT expression is under the control of an internal ribosomal entry site (IRES) present within the CACNA1A coding region. Whereas SCA6 allele knock-in mice show indistinguishable phenotypes from wild-type littermates, expression of SCA6-associated α1ACT (α1ACTSCA6) driven by a Purkinje cell-specific promoter in mice produces slowly progressive ataxia and cerebellar atrophy. We developed an early-onset SCA6 mouse model using an adeno-associated virus (AAV)-based gene delivery system to ectopically express CACNA1A IRES-driven α1ACTSCA6 to test the potential of CACNA1A IRES-targeting therapies. Mice expressing AAV9-mediated CACNA1A IRES-driven α1ACTSCA6 exhibited early-onset ataxia, motor deficits, and Purkinje cell degeneration. We identified miR-3191-5p as a microRNA (miRNA) that targeted CACNA1A IRES and preferentially inhibited the CACNA1A IRES-driven translation of α1ACT in an Argonaute 4 (Ago4)-dependent manner. We found that eukaryotic initiation factors (eIFs), eIF4AII and eIF4GII, interacted with the CACNA1A IRES to enhance α1ACT translation. Ago4-bound miR-3191-5p blocked the interaction of eIF4AII and eIF4GII with the CACNA1A IRES, attenuating IRES-driven α1ACT translation. Furthermore, AAV9-mediated delivery of miR-3191-5p protected mice from the ataxia, motor deficits, and Purkinje cell degeneration caused by CACNA1A IRES-driven α1ACTSCA6 We have established proof of principle that viral delivery of an miRNA can rescue a disease phenotype through modulation of cellular IRES activity in a mouse model. Copyright © 2016, American Association for the Advancement of Science.

An miRNA-mediated therapy for SCA6 blocks IRES-driven translation of the CACNA1A second cistron

PubMed Central

Miyazaki, Yu; Du, Xiaofei; Muramatsu, Shin-ichi; Gomez, Christopher M.

2017-01-01

Spinocerebellar ataxia type 6 (SCA6) is a dominantly inherited neurodegenerative disease characterized by slowly progressive ataxia and Purkinje cell degeneration. SCA6 is caused by a polyglutamine repeat expansion within a second CACNA1A gene product, α1ACT. α1ACT expression is under the control of an internal ribosomal entry site (IRES) present within the CACNA1A coding region. Whereas SCA6 allele knock-in mice show indistinguishable phenotypes from wild-type littermates, expression of SCA6-associated α1ACT (α1ACTSCA6) driven by a Purkinje cell–specific promoter in mice produces slowly progressive ataxia and cerebellar atrophy. We developed an early-onset SCA6 mouse model using an adeno-associated virus (AAV)–based gene delivery system to ectopically express CACNA1A IRES–driven α1ACTSCA6 to test the potential of CACNA1A IRES–targeting therapies. Mice expressing AAV9-mediated CACNA1A IRES–driven α1ACTSCA6 exhibited early-onset ataxia, motor deficits, and Purkinje cell degeneration. We identified miR-3191-5p as a microRNA (miRNA) that targeted CACNA1A IRES and preferentially inhibited the CACNA1A IRES–driven translation of α1ACT in an Argonaute 4 (Ago4)–dependent manner. We found that eukaryotic initiation factors (eIFs), eIF4AII and eIF4GII, interacted with the CACNA1A IRES to enhance α1ACT translation. Ago4-bound miR-3191-5p blocked the interaction of eIF4AII and eIF4GII with the CACNA1A IRES, attenuating IRES-driven α1ACT translation. Furthermore, AAV9-mediated delivery of miR-3191-5p protected mice from the ataxia, motor deficits, and Purkinje cell degeneration caused by CACNA1A IRES–driven α1ACTSCA6. We have established proof of principle that viral delivery of an miRNA can rescue a disease phenotype through modulation of cellular IRES activity in a mouse model. PMID:27412786

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.

PubMed

Dale, Rodney M; Topczewski, Jacek

2011-09-15

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene

PubMed Central

Dale, Rodney M.; Topczewski, Jacek

2011-01-01

Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274

Toll-Like Receptor 2 and Mincle Cooperatively Sense Corynebacterial Cell Wall Glycolipids.

PubMed

Schick, Judith; Etschel, Philipp; Bailo, Rebeca; Ott, Lisa; Bhatt, Apoorva; Lepenies, Bernd; Kirschning, Carsten; Burkovski, Andreas; Lang, Roland

2017-07-01

Nontoxigenic Corynebacterium diphtheriae and Corynebacterium ulcerans cause invasive disease in humans and animals. Host sensing of corynebacteria is largely uncharacterized, albeit the recognition of lipoglycans by Toll-like receptor 2 (TLR2) appears to be important for macrophage activation by corynebacteria. The members of the order Corynebacterineae (e.g., mycobacteria, nocardia, and rhodococci) share a glycolipid-rich cell wall dominated by mycolic acids (termed corynomycolic acids in corynebacteria). The mycolic acid-containing cord factor of mycobacteria, trehalose dimycolate, activates the C-type lectin receptor (CLR) Mincle. Here, we show that glycolipid extracts from the cell walls of several pathogenic and nonpathogenic Corynebacterium strains directly bound to recombinant Mincle in vitro Macrophages deficient in Mincle or its adapter protein Fc receptor gamma chain (FcRγ) produced severely reduced amounts of granulocyte colony-stimulating factor (G-CSF) and of nitric oxide (NO) upon challenge with corynebacterial glycolipids. Consistently, cell wall extracts of a particular C. diphtheriae strain (DSM43989) lacking mycolic acid esters neither bound Mincle nor activated macrophages. Furthermore, TLR2 but not TLR4 was critical for sensing of cell wall extracts and whole corynebacteria. The upregulation of Mincle expression upon encountering corynebacteria required TLR2. Thus, macrophage activation by the corynebacterial cell wall relies on TLR2-driven robust Mincle expression and the cooperative action of both receptors. Copyright © 2017 American Society for Microbiology.

Toll-Like Receptor 2 and Mincle Cooperatively Sense Corynebacterial Cell Wall Glycolipids

PubMed Central

Schick, Judith; Etschel, Philipp; Bailo, Rebeca; Ott, Lisa; Bhatt, Apoorva; Lepenies, Bernd; Kirschning, Carsten

2017-01-01

ABSTRACT Nontoxigenic Corynebacterium diphtheriae and Corynebacterium ulcerans cause invasive disease in humans and animals. Host sensing of corynebacteria is largely uncharacterized, albeit the recognition of lipoglycans by Toll-like receptor 2 (TLR2) appears to be important for macrophage activation by corynebacteria. The members of the order Corynebacterineae (e.g., mycobacteria, nocardia, and rhodococci) share a glycolipid-rich cell wall dominated by mycolic acids (termed corynomycolic acids in corynebacteria). The mycolic acid-containing cord factor of mycobacteria, trehalose dimycolate, activates the C-type lectin receptor (CLR) Mincle. Here, we show that glycolipid extracts from the cell walls of several pathogenic and nonpathogenic Corynebacterium strains directly bound to recombinant Mincle in vitro. Macrophages deficient in Mincle or its adapter protein Fc receptor gamma chain (FcRγ) produced severely reduced amounts of granulocyte colony-stimulating factor (G-CSF) and of nitric oxide (NO) upon challenge with corynebacterial glycolipids. Consistently, cell wall extracts of a particular C. diphtheriae strain (DSM43989) lacking mycolic acid esters neither bound Mincle nor activated macrophages. Furthermore, TLR2 but not TLR4 was critical for sensing of cell wall extracts and whole corynebacteria. The upregulation of Mincle expression upon encountering corynebacteria required TLR2. Thus, macrophage activation by the corynebacterial cell wall relies on TLR2-driven robust Mincle expression and the cooperative action of both receptors. PMID:28483856

Dynamic knowledge representation using agent-based modeling: ontology instantiation and verification of conceptual models.

PubMed

An, Gary

2009-01-01

The sheer volume of biomedical research threatens to overwhelm the capacity of individuals to effectively process this information. Adding to this challenge is the multiscale nature of both biological systems and the research community as a whole. Given this volume and rate of generation of biomedical information, the research community must develop methods for robust representation of knowledge in order for individuals, and the community as a whole, to "know what they know." Despite increasing emphasis on "data-driven" research, the fact remains that researchers guide their research using intuitively constructed conceptual models derived from knowledge extracted from publications, knowledge that is generally qualitatively expressed using natural language. Agent-based modeling (ABM) is a computational modeling method that is suited to translating the knowledge expressed in biomedical texts into dynamic representations of the conceptual models generated by researchers. The hierarchical object-class orientation of ABM maps well to biomedical ontological structures, facilitating the translation of ontologies into instantiated models. Furthermore, ABM is suited to producing the nonintuitive behaviors that often "break" conceptual models. Verification in this context is focused at determining the plausibility of a particular conceptual model, and qualitative knowledge representation is often sufficient for this goal. Thus, utilized in this fashion, ABM can provide a powerful adjunct to other computational methods within the research process, as well as providing a metamodeling framework to enhance the evolution of biomedical ontologies.

Turbulence-enhanced bottom melting of a horizontal glacier--lake interface

NASA Astrophysics Data System (ADS)

Keitzl, T.; Mellado, J. P.; Notz, D.

2014-12-01

We use laboratory tank experiments and direct numerical simulations to investigate the meltrates of a horizontal bottom glacier--lake interface as a function of lake temperature. Existing parameterisations of such meltrates are usually based on empirical fits to field observations. To understand the meltrates of an ice--water interface more systematically we study an idealised system in terms of its temperature-driven buoyancy forcing. In such systems, the meltrate can be expressed analytically for a stable stratification. Here we investigate the unstable case and present how the meltrate depends on the lake temperature when the water beneath the ice is overturning and turbulent. We use laboratory tank experiments and direct numerical simulations to study an idealised ice--water boundary. The laboratory tank experiments provide robust observation-based mean-temperature profiles. The numerical simulations provide the full three-dimensional structure of the turbulent flow down to scales not accessible in the laboratory, with a minimum 0.2mm gridspacing. Our laboratory mean-temperature profiles agree well with the numerical simulations and lend credibility to our numerical setup. The structure of the turbulent flow in our simulations is well described by two self-similar subregions, a diffusion-dominated inner layer close to the ice and a turbulence-dominated outer layer far from the ice. We provide an explicit expression for the parameterisation of the meltrate of a horizontal glacier--lake interface as a function of lake temperature.

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

Affordable non-traditional source data mining for context assessment to improve distributed fusion system robustness

NASA Astrophysics Data System (ADS)

Bowman, Christopher; Haith, Gary; Steinberg, Alan; Morefield, Charles; Morefield, Michael

2013-05-01

This paper describes methods to affordably improve the robustness of distributed fusion systems by opportunistically leveraging non-traditional data sources. Adaptive methods help find relevant data, create models, and characterize the model quality. These methods also can measure the conformity of this non-traditional data with fusion system products including situation modeling and mission impact prediction. Non-traditional data can improve the quantity, quality, availability, timeliness, and diversity of the baseline fusion system sources and therefore can improve prediction and estimation accuracy and robustness at all levels of fusion. Techniques are described that automatically learn to characterize and search non-traditional contextual data to enable operators integrate the data with the high-level fusion systems and ontologies. These techniques apply the extension of the Data Fusion & Resource Management Dual Node Network (DNN) technical architecture at Level 4. The DNN architecture supports effectively assessment and management of the expanded portfolio of data sources, entities of interest, models, and algorithms including data pattern discovery and context conformity. Affordable model-driven and data-driven data mining methods to discover unknown models from non-traditional and `big data' sources are used to automatically learn entity behaviors and correlations with fusion products, [14 and 15]. This paper describes our context assessment software development, and the demonstration of context assessment of non-traditional data to compare to an intelligence surveillance and reconnaissance fusion product based upon an IED POIs workflow.

Rats Display a Robust Bimodal Preference Profile for Sucralose

PubMed Central

Loney, Gregory C.; Torregrossa, Ann-Marie; Smith, James C.; Sclafani, Anthony

2011-01-01

Female Sprague–Dawley rats display considerable variability in their preference for the artificial sweetener sucralose over water. While some rats can be classified as sucralose preferrers (SP), as they prefer sucralose across a broad range of concentrations, others can be classified as sucralose avoiders (SA), as they avoid sucralose at concentrations above 0.1 g/L. Here, we expand on a previous report of this phenomenon by demonstrating, in a series of 2-bottle 24-h preference tests involving water and an ascending series of sucralose concentrations, that this variability in sucralose preference is robust across sex, stage of the estrous cycle, and 2 rat strains (Long–Evans and Sprague–Dawley). In a second experiment involving a large sample of rats (n = 50), we established that the ratio of SP to SA is approximately 35–65%. This bimodal behavioral response to sucralose appears to be driven by taste because rats display a similar bimodal licking response to a range of sucralose solutions presented during brief-access tests. Finally, we have shown that sucralose avoidance is extremely robust as 23-h water-deprived SA continue to avoid sucralose in 1-h single-bottle intake tests. Based on their reduced licking responses to sucralose during brief-access (taste driven) tests, and the fact that their distaste for sucralose cannot be overcome by the motivation to rehydrate, we conclude that SA detect a negative taste quality of sucralose that SP are relatively insensitive to. PMID:21653913

Intelligent Model Management in a Forest Ecosystem Management Decision Support System

Treesearch

Donald Nute; Walter D. Potter; Frederick Maier; Jin Wang; Mark Twery; H. Michael Rauscher; Peter Knopp; Scott Thomasma; Mayukh Dass; Hajime Uchiyama

2002-01-01

Decision making for forest ecosystem management can include the use of a wide variety of modeling tools. These tools include vegetation growth models, wildlife models, silvicultural models, GIS, and visualization tools. NED-2 is a robust, intelligent, goal-driven decision support system that integrates tools in each of these categories. NED-2 uses a blackboard...

Scientific rigor through videogames.

PubMed

Treuille, Adrien; Das, Rhiju

2014-11-01

Hypothesis-driven experimentation - the scientific method - can be subverted by fraud, irreproducibility, and lack of rigorous predictive tests. A robust solution to these problems may be the 'massive open laboratory' model, recently embodied in the internet-scale videogame EteRNA. Deploying similar platforms throughout biology could enforce the scientific method more broadly. Copyright © 2014 Elsevier Ltd. All rights reserved.

Allen Brain Atlas-Driven Visualizations: A Web-Based Gene Expression Energy Visualization Tool

DTIC Science & Technology

2014-05-21

purposes notwithstanding any copyright anno - tation thereon. The views and conclusions contained herein are those of the authors and should not be...Brain Res. Brain Res. Rev. 28, 309–369. doi: 10.1016/S0165-0173(98)00019-8 Bostock, M., Ogievetsky, V., and Heer, J . (2011). D³ data-driven documents...omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 30, 207–210. doi: 10.1093/nar/30.1.207 Eppig, J . T., Blake

Myocardial gene delivery using molecular cardiac surgery with recombinant adeno-associated virus vectors in vivo

PubMed Central

White, JD; Thesier, DM; Swain, JBD; Katz, MG; Tomasulo, C; Henderson, A; Wang, L; Yarnall, C; Fargnoli, A; Sumaroka, M; Isidro, A; Petrov, M; Holt, D; Nolen-Walston, R; Koch, WJ; Stedman, HH; Rabinowitz, J; Bridges, CR

2013-01-01

We use a novel technique that allows for closed recirculation of vector genomes in the cardiac circulation using cardiopulmonary bypass, referred to here as molecular cardiac surgery with recirculating delivery (MCARD). We demonstrate that this platform technology is highly efficient in isolating the heart from the systemic circulation in vivo. Using MCARD, we compare the relative efficacy of single-stranded (ss) adeno-associated virus (AAV)6, ssAAV9 and self-complimentary (sc)AAV6-encoding enhanced green fluorescent protein, driven by the constitutive cytomegalovirus promoter to transduce the ovine myocardium in situ. MCARD allows for the unprecedented delivery of up to 48 green fluorescent protein genome copies per cell globally in the sheep left ventricular (LV) myocardium. We demonstrate that scAAV6-mediated MCARD delivery results in global, cardiac-specific LV gene expression in the ovine heart and provides for considerably more robust and cardiac-specific gene delivery than other available delivery techniques such as intramuscular injection or intracoronary injection; thus, representing a potential, clinically translatable platform for heart failure gene therapy. PMID:21228882

Lateral adhesion drives reintegration of misplaced cells into epithelial monolayers

PubMed Central

St Johnston, Daniel

2016-01-01

Cells in simple epithelia orient their mitotic spindles in the plane of the epithelium so that both daughter cells are born within the epithelial sheet. This is assumed to be important to maintain epithelial integrity and prevent hyperplasia, because misaligned divisions give rise to cells outside the epithelium1,2. Here we test this assumption in three types of Drosophila epithelia; the cuboidal follicle epithelium, the columnar early embryonic ectoderm, and the pseudostratified neuroepithelium. Ectopic expression of Inscuteable in these tissues reorients mitotic spindles, resulting in one daughter cell being born outside of the epithelial layer. Live imaging reveals that these misplaced cells reintegrate into the tissue. Reducing the levels of the lateral homophilic adhesion molecules Neuroglian or Fasciclin 2 disrupts reintegration, giving rise to extra-epithelial cells, whereas disruption of adherens junctions has no effect. Thus, the reinsertion of misplaced cells appears to be driven by lateral adhesion, which pulls cells born outside the epithelia layer back into it. Our findings reveal a robust mechanism that protects epithelia against the consequences of misoriented divisions. PMID:26414404

Hypoxic and Ras-transformed cells support growth by scavenging unsaturated fatty acids from lysophospholipids

PubMed Central

Kamphorst, Jurre J.; Cross, Justin R.; Fan, Jing; de Stanchina, Elisa; Mathew, Robin; White, Eileen P.; Thompson, Craig B.; Rabinowitz, Joshua D.

2013-01-01

Cancer cell growth requires fatty acids to replicate cellular membranes. The kinase Akt is known to up-regulate fatty acid synthesis and desaturation, which is carried out by the oxygen-consuming enzyme stearoyl-CoA desaturase (SCD)1. We used 13C tracers and lipidomics to probe fatty acid metabolism, including desaturation, as a function of oncogene expression and oxygen availability. During hypoxia, flux from glucose to acetyl-CoA decreases, and the fractional contribution of glutamine to fatty acid synthesis increases. In addition, we find that hypoxic cells bypass de novo lipogenesis, and thus, both the need for acetyl-CoA and the oxygen-dependent SCD1-reaction, by scavenging serum fatty acids. The preferred substrates for scavenging are phospholipids with one fatty acid tail (lysophospholipids). Hypoxic reprogramming of de novo lipogenesis can be reproduced in normoxic cells by Ras activation. This renders Ras-driven cells, both in culture and in allografts, resistant to SCD1 inhibition. Thus, a mechanism by which oncogenic Ras confers metabolic robustness is through lipid scavenging. PMID:23671091

EBW H&CD Potential for Spherical Tokamaks

NASA Astrophysics Data System (ADS)

Urban, J.; Decker, J.; Peysson, Y.; Preinhaelter, J.; Shevchenko, V.; Taylor, G.; Vahala, L.; Vahala, G.

2011-12-01

Spherical tokamaks (STs), which feature relatively high neutron flux and good economy, operate generally in high-ß regimes, in which the usual EC O- and X- modes are cut-off. In this case, electron Bernstein waves (EBWs) seem to be the only option that can provide features similar to the EC waves—controllable localized heating and current drive (H&) that can be utilized for core plasma heating as well as for accurate plasma stabilization. We first derive an analytical expression for Gaussian beam OXB conversion efficiency. Then, an extensive numerical study of EBW H&CD performance in four typical ST plasmas (NSTX L- and H-mode, MAST Upgrade, NHTX) is performed. Coupled ray-tracing (AMR) and Fokker-Planck (LUKE) codes are employed to simulate EBWs of varying frequencies and launch conditions. Our results indicate that an efficient and universal EBW H&CD system is indeed viable. In particular, power can be deposited and current reasonably efficiently driven across the whole plasma radius. Such a system could be controlled by a suitably chosen launching antenna vertical position and would also be sufficiently robust.

LDRD project final report : hybrid AI/cognitive tactical behavior framework for LVC.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Djordjevich, Donna D.; Xavier, Patrick Gordon; Brannon, Nathan Gregory

This Lab-Directed Research and Development (LDRD) sought to develop technology that enhances scenario construction speed, entity behavior robustness, and scalability in Live-Virtual-Constructive (LVC) simulation. We investigated issues in both simulation architecture and behavior modeling. We developed path-planning technology that improves the ability to express intent in the planning task while still permitting an efficient search algorithm. An LVC simulation demonstrated how this enables 'one-click' layout of squad tactical paths, as well as dynamic re-planning for simulated squads and for real and simulated mobile robots. We identified human response latencies that can be exploited in parallel/distributed architectures. We did an experimentalmore » study to determine where parallelization would be productive in Umbra-based force-on-force (FOF) simulations. We developed and implemented a data-driven simulation composition approach that solves entity class hierarchy issues and supports assurance of simulation fairness. Finally, we proposed a flexible framework to enable integration of multiple behavior modeling components that model working memory phenomena with different degrees of sophistication.« less

A study on facial expressions recognition

NASA Astrophysics Data System (ADS)

Xu, Jingjing

2017-09-01

In terms of communication, postures and facial expressions of such feelings like happiness, anger and sadness play important roles in conveying information. With the development of the technology, recently a number of algorithms dealing with face alignment, face landmark detection, classification, facial landmark localization and pose estimation have been put forward. However, there are a lot of challenges and problems need to be fixed. In this paper, a few technologies have been concluded and analyzed, and they all relate to handling facial expressions recognition and poses like pose-indexed based multi-view method for face alignment, robust facial landmark detection under significant head pose and occlusion, partitioning the input domain for classification, robust statistics face formalization.

Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.

PubMed

Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

2016-07-21

Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.

Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma

PubMed Central

Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

2016-01-01

Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene’s expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment. PMID:27468205

Masking responses to light in period mutant mice.

PubMed

Pendergast, Julie S; Yamazaki, Shin

2011-10-01

Masking is an acute effect of an external signal on an overt rhythm and is distinct from the process of entrainment. In the current study, we investigated the phase dependence and molecular mechanisms regulating masking effects of light pulses on spontaneous locomotor activity in mice. The circadian genes, Period1 (Per1) and Per2, are necessary components of the timekeeping machinery and entrainment by light appears to involve the induction of the expression of Per1 and Per2 mRNAs in the suprachiasmatic nuclei (SCN). We assessed the roles of the Per genes in regulating masking by assessing the effects of light pulses on nocturnal locomotor activity in C57BL/6J Per mutant mice. We found that Per1(-/-) and Per2(-/-) mice had robust negative masking responses to light. In addition, the locomotor activity of Per1(-/-)/Per2(-/-) mice appeared to be rhythmic in the light-dark (LD) cycle, and the phase of activity onset was advanced (but varied among individual mice) relative to lights off. This rhythm persisted for 1 to 2 days in constant darkness in some Per1(-/-)/Per2(-/-) mice. Furthermore, Per1(-/-)/Per2(-/-) mice exhibited robust negative masking responses to light. Negative masking was phase dependent in wild-type mice such that maximal suppression was induced by light pulses at zeitgeber time 14 (ZT14) and gradually weaker suppression occurred during light pulses at ZT16 and ZT18. By measuring the phase shifts induced by the masking protocol (light pulses were administered to mice maintained in the LD cycle), we found that the phase responsiveness of Per mutant mice was altered compared to wild-types. Together, our data suggest that negative masking responses to light are robust in Per mutant mice and that the Per1(-/-)/Per2(-/-) SCN may be a light-driven, weak/damping oscillator.

Evolution and inheritance of early embryonic patterning in D. simulans and D. sechellia

PubMed Central

Lott, Susan E.; Ludwig, Michael Z.; Kreitman, Martin

2010-01-01

Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation which selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth ‘stripe allometry’) in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species D. simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the “margin of error” for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness PMID:21121913

iGC-an integrated analysis package of gene expression and copy number alteration.

PubMed

Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y

2017-01-14

With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .

Observation of topologically protected bound states in photonic quantum walks.

PubMed

Kitagawa, Takuya; Broome, Matthew A; Fedrizzi, Alessandro; Rudner, Mark S; Berg, Erez; Kassal, Ivan; Aspuru-Guzik, Alán; Demler, Eugene; White, Andrew G

2012-06-06

Topological phases exhibit some of the most striking phenomena in modern physics. Much of the rich behaviour of quantum Hall systems, topological insulators, and topological superconductors can be traced to the existence of robust bound states at interfaces between different topological phases. This robustness has applications in metrology and holds promise for future uses in quantum computing. Engineered quantum systems--notably in photonics, where wavefunctions can be observed directly--provide versatile platforms for creating and probing a variety of topological phases. Here we use photonic quantum walks to observe bound states between systems with different bulk topological properties and demonstrate their robustness to perturbations--a signature of topological protection. Although such bound states are usually discussed for static (time-independent) systems, here we demonstrate their existence in an explicitly time-dependent situation. Moreover, we discover a new phenomenon: a topologically protected pair of bound states unique to periodically driven systems.

Robust tissue classification for reproducible wound assessment in telemedicine environments

NASA Astrophysics Data System (ADS)

Wannous, Hazem; Treuillet, Sylvie; Lucas, Yves

2010-04-01

In telemedicine environments, a standardized and reproducible assessment of wounds, using a simple free-handled digital camera, is an essential requirement. However, to ensure robust tissue classification, particular attention must be paid to the complete design of the color processing chain. We introduce the key steps including color correction, merging of expert labeling, and segmentation-driven classification based on support vector machines. The tool thus developed ensures stability under lighting condition, viewpoint, and camera changes, to achieve accurate and robust classification of skin tissues. Clinical tests demonstrate that such an advanced tool, which forms part of a complete 3-D and color wound assessment system, significantly improves the monitoring of the healing process. It achieves an overlap score of 79.3 against 69.1% for a single expert, after mapping on the medical reference developed from the image labeling by a college of experts.

Validation of Reference Genes for Robust qRT-PCR Gene Expression Analysis in the Rice Blast Fungus Magnaporthe oryzae.

PubMed

Che Omar, Sarena; Bentley, Michael A; Morieri, Giulia; Preston, Gail M; Gurr, Sarah J

2016-01-01

The rice blast fungus causes significant annual harvest losses. It also serves as a genetically-tractable model to study fungal ingress. Whilst pathogenicity determinants have been unmasked and changes in global gene expression described, we know little about Magnaporthe oryzae cell wall remodelling. Our interests, in wall remodelling genes expressed during infection, vegetative growth and under exogenous wall stress, demand robust choice of reference genes for quantitative Real Time-PCR (qRT-PCR) data normalisation. We describe the expression stability of nine candidate reference genes profiled by qRT-PCR with cDNAs derived during asexual germling development, from sexual stage perithecia and from vegetative mycelium grown under various exogenous stressors. Our Minimum Information for Publication of qRT-PCR Experiments (MIQE) compliant analysis reveals a set of robust reference genes used to track changes in the expression of the cell wall remodelling gene MGG_Crh2 (MGG_00592). We ranked nine candidate reference genes by their expression stability (M) and report the best gene combination needed for reliable gene expression normalisation, when assayed in three tissue groups (Infective, Vegetative, and Global) frequently used in M. oryzae expression studies. We found that MGG_Actin (MGG_03982) and the 40S 27a ribosomal subunit MGG_40s (MGG_02872) proved to be robust reference genes for the Infection group and MGG_40s and MGG_Ef1 (Elongation Factor1-α) for both Vegetative and Global groups. Using the above validated reference genes, M. oryzae MGG_Crh2 expression was found to be significantly (p<0.05) elevated three-fold during vegetative growth as compared with dormant spores and two fold higher under cell wall stress (Congo Red) compared to growth under optimal conditions. We recommend the combinatorial use of two reference genes, belonging to the cytoskeleton and ribosomal synthesis functional groups, MGG_Actin, MGG_40s, MGG_S8 (Ribosomal subunit 40S S8) or MGG_Ef1, which demonstrated low M values across heterogeneous tissues. By contrast, metabolic pathway genes MGG_Fad (FAD binding domain-containing protein) and MGG_Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) performed poorly, due to their lack of expression stability across samples.

A model of strength

USGS Publications Warehouse

Johnson, Douglas H.; Cook, R.D.

2013-01-01

In her AAAS News & Notes piece "Can the Southwest manage its thirst?" (26 July, p. 362), K. Wren quotes Ajay Kalra, who advocates a particular method for predicting Colorado River streamflow "because it eschews complex physical climate models for a statistical data-driven modeling approach." A preference for data-driven models may be appropriate in this individual situation, but it is not so generally, Data-driven models often come with a warning against extrapolating beyond the range of the data used to develop the models. When the future is like the past, data-driven models can work well for prediction, but it is easy to over-model local or transient phenomena, often leading to predictive inaccuracy (1). Mechanistic models are built on established knowledge of the process that connects the response variables with the predictors, using information obtained outside of an extant data set. One may shy away from a mechanistic approach when the underlying process is judged to be too complicated, but good predictive models can be constructed with statistical components that account for ingredients missing in the mechanistic analysis. Models with sound mechanistic components are more generally applicable and robust than data-driven models.

A functional mammalian target of rapamycin complex 1 signaling is indispensable for c-Myc-driven hepatocarcinogenesis.

PubMed

Liu, Pin; Ge, Mengmeng; Hu, Junjie; Li, Xiaolei; Che, Li; Sun, Kun; Cheng, Lili; Huang, Yuedong; Pilo, Maria G; Cigliano, Antonio; Pes, Giovanni M; Pascale, Rosa M; Brozzetti, Stefania; Vidili, Gianpaolo; Porcu, Alberto; Cossu, Antonio; Palmieri, Giuseppe; Sini, Maria C; Ribback, Silvia; Dombrowski, Frank; Tao, Junyan; Calvisi, Diego F; Chen, Ligong; Chen, Xin

2017-07-01

Amplification and/or activation of the c-Myc proto-oncogene is one of the leading genetic events along hepatocarcinogenesis. The oncogenic potential of c-Myc has been proven experimentally by the finding that its overexpression in the mouse liver triggers tumor formation. However, the molecular mechanism whereby c-Myc exerts its oncogenic activity in the liver remains poorly understood. Here, we demonstrate that the mammalian target of rapamycin complex 1 (mTORC1) cascade is activated and necessary for c-Myc-dependent hepatocarcinogenesis. Specifically, we found that ablation of Raptor, the unique member of mTORC1, strongly inhibits c-Myc liver tumor formation. Also, the p70 ribosomal S6 kinase/ribosomal protein S6 and eukaryotic translation initiation factor 4E-binding protein 1/eukaryotic translation initiation factor 4E signaling cascades downstream of mTORC1 are required for c-Myc-driven tumorigenesis. Intriguingly, microarray expression analysis revealed up-regulation of multiple amino acid transporters, including solute carrier family 1 member A5 (SLC1A5) and SLC7A6, leading to robust uptake of amino acids, including glutamine, into c-Myc tumor cells. Subsequent functional studies showed that amino acids are critical for activation of mTORC1 as their inhibition suppressed mTORC1 in c-Myc tumor cells. In human hepatocellular carcinoma specimens, levels of c-Myc directly correlate with those of mTORC1 activation as well as of SLC1A5 and SLC7A6. Our current study indicates that an intact mTORC1 axis is required for c-Myc-driven hepatocarcinogenesis; thus, targeting the mTOR pathway or amino acid transporters may be an effective and novel therapeutic option for the treatment of hepatocellular carcinoma with activated c-Myc signaling. (Hepatology 2017;66:167-181). © 2017 by the American Association for the Study of Liver Diseases.

Preliminary Results from a Model-Driven Architecture Methodology for Development of an Event-Driven Space Communications Service Concept

NASA Technical Reports Server (NTRS)

Roberts, Christopher J.; Morgenstern, Robert M.; Israel, David J.; Borky, John M.; Bradley, Thomas H.

2017-01-01

NASA's next generation space communications network will involve dynamic and autonomous services analogous to services provided by current terrestrial wireless networks. This architecture concept, known as the Space Mobile Network (SMN), is enabled by several technologies now in development. A pillar of the SMN architecture is the establishment and utilization of a continuous bidirectional control plane space link channel and a new User Initiated Service (UIS) protocol to enable more dynamic and autonomous mission operations concepts, reduced user space communications planning burden, and more efficient and effective provider network resource utilization. This paper provides preliminary results from the application of model driven architecture methodology to develop UIS. Such an approach is necessary to ensure systematic investigation of several open questions concerning the efficiency, robustness, interoperability, scalability and security of the control plane space link and UIS protocol.

A Highly Selective and Robust Co(II)-Based Homogeneous Catalyst for Reduction of CO2 to CO in CH3CN/H2O Solution Driven by Visible Light.

PubMed

Ouyang, Ting; Hou, Cheng; Wang, Jia-Wei; Liu, Wen-Ju; Zhong, Di-Chang; Ke, Zhuo-Feng; Lu, Tong-Bu

2017-07-03

Visible-light driven reduction of CO 2 into chemical fuels has attracted enormous interest in the production of sustainable energy and reversal of the global warming trend. The main challenge in this field is the development of efficient, selective, and economic photocatalysts. Herein, we report a Co(II)-based homogeneous catalyst, [Co(NTB)CH 3 CN](ClO 4 ) 2 (1, NTB = tris(benzimidazolyl-2-methyl)amine), which shows high selectivity and stability for the catalytic reduction of CO 2 to CO in a water-containing system driven by visible light, with turnover number (TON) and turnover frequency (TOF) values of 1179 and 0.032 s -1 , respectively, and selectivity to CO of 97%. The high catalytic activity of 1 for photochemical CO 2 -to-CO conversion is supported by the results of electrochemical investigations and DFT calculations.

Abstract knowledge versus direct experience in processing of binomial expressions

PubMed Central

Morgan, Emily; Levy, Roger

2016-01-01

We ask whether word order preferences for binomial expressions of the form A and B (e.g. bread and butter) are driven by abstract linguistic knowledge of ordering constraints referencing the semantic, phonological, and lexical properties of the constituent words, or by prior direct experience with the specific items in questions. Using forced-choice and self-paced reading tasks, we demonstrate that online processing of never-before-seen binomials is influenced by abstract knowledge of ordering constraints, which we estimate with a probabilistic model. In contrast, online processing of highly frequent binomials is primarily driven by direct experience, which we estimate from corpus frequency counts. We propose a trade-off wherein processing of novel expressions relies upon abstract knowledge, while reliance upon direct experience increases with increased exposure to an expression. Our findings support theories of language processing in which both compositional generation and direct, holistic reuse of multi-word expressions play crucial roles. PMID:27776281

FAK Regulates Intestinal Epithelial Cell Survival and Proliferation during Mucosal Wound Healing

PubMed Central

Tilghman, Robert W.; Casanova, James E.; Bouton, Amy H.

2011-01-01

Background Following damage to the intestinal epithelium, restoration of epithelial barrier integrity is triggered by a robust proliferative response. In other tissues, focal adhesion kinase (FAK) regulates many of the cellular processes that are critical for epithelial homeostasis and restitution, including cell migration, proliferation and survival. However, few studies to date have determined how FAK contributes to mucosal wound healing in vivo. Methodology and Principal Findings To examine the role of FAK in intestinal epithelial homeostasis and during injury, we generated intestinal epithelium (IE)-specific conditional FAK knockout mice. Colitis was induced with dextran-sulfate-sodium (DSS) and intestinal tissues were analyzed by immunohistochemistry and immunoblotting. While intestinal development occurred normally in mice lacking FAK, FAK-deficient animals were profoundly susceptible to colitis. The loss of epithelial FAK resulted in elevated p53 expression and an increased sensitivity to apoptosis, coincident with a failure to upregulate epithelial cell proliferation. FAK has been reported to function as a mechanosensor, inducing cyclin D1 expression and promoting cell cycle progression under conditions in which tissue/matrix stiffness is increased. Collagen deposition, a hallmark of inflammatory injury resulting in increased tissue rigidity, was observed in control and FAK knockout mice during colitis. Despite this fibrotic response, the colonic epithelium in FAK-deficient mice exhibited significantly reduced cyclin D1 expression, suggesting that proliferation is uncoupled from fibrosis in the absence of FAK. In support of this hypothesis, proliferation of Caco-2 cells increased proportionally with matrix stiffness in vitro only under conditions of normal FAK expression; FAK depleted cells exhibited reduced proliferation concomitant with attenuated cyclin D1 expression. Conclusions In the colon, FAK functions as a regulator of epithelial cell survival and proliferation under conditions of mucosal injury and a mechanosensor of tissue compliance, inducing repair-driven proliferation in the colonic epithelium through upregulation of cyclin D1. PMID:21887232

ROBUSTNESS OF SIGNALING GRADIENT IN DROSOPHILA WING IMAGINAL DISC

PubMed Central

Lei, Jinzhi; Wan, Frederic Y. M.; Lander, Arthur D.; Nie, Qing

2012-01-01

Quasi-stable gradients of signaling protein molecules (known as morphogens or ligands) bound to cell receptors are known to be responsible for differential cell signaling and gene expressions. From these follow different stable cell fates and visually patterned tissues in biological development. Recent studies have shown that the relevant basic biological processes yield gradients that are sensitive to small changes in system characteristics (such as expression level of morphogens or receptors) or environmental conditions (such as temperature changes). Additional biological activities must play an important role in the high level of robustness observed in embryonic patterning for example. It is natural to attribute observed robustness to various type of feedback control mechanisms. However, our own simulation studies have shown that feedback control is neither necessary nor sufficient for robustness of the morphogen decapentaplegic (Dpp) gradient in wing imaginal disc of Drosophilas. Furthermore, robustness can be achieved by substantial binding of the signaling morphogen Dpp with nonsignaling cell surface bound molecules (such as heparan sulfate proteoglygans) and degrading the resulting complexes at a sufficiently rapid rate. The present work provides a theoretical basis for the results of our numerical simulation studies. PMID:24098092

The Receptive-Expressive Gap in the Vocabulary of Young Second-Language Learners: Robustness and Possible Mechanisms

ERIC Educational Resources Information Center

Gibson, Todd A.; Oller, D. Kimbrough; Jarmulowicz, Linda; Ethington, Corinna A.

2012-01-01

Adults and children learning a second language show difficulty accessing expressive vocabulary that appears accessible receptively in their first language (L1). We call this discrepancy the receptive-expressive gap. Kindergarten Spanish (L1)-English (L2) sequential bilinguals were given standardized tests of receptive and expressive vocabulary in…

Tail mean and related robust solution concepts

NASA Astrophysics Data System (ADS)

Ogryczak, Włodzimierz

2014-01-01

Robust optimisation might be viewed as a multicriteria optimisation problem where objectives correspond to the scenarios although their probabilities are unknown or imprecise. The simplest robust solution concept represents a conservative approach focused on the worst-case scenario results optimisation. A softer concept allows one to optimise the tail mean thus combining performances under multiple worst scenarios. We show that while considering robust models allowing the probabilities to vary only within given intervals, the tail mean represents the robust solution for only upper bounded probabilities. For any arbitrary intervals of probabilities the corresponding robust solution may be expressed by the optimisation of appropriately combined mean and tail mean criteria thus remaining easily implementable with auxiliary linear inequalities. Moreover, we use the tail mean concept to develope linear programming implementable robust solution concepts related to risk averse optimisation criteria.

Enhancement of Survival and Electricity Production in an Engineered Bacterium by Light-Driven Proton Pumping▿ †

PubMed Central

Johnson, Ethan T.; Baron, Daniel B.; Naranjo, Belén; Bond, Daniel R.; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A.

2010-01-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments. PMID:20453141

Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumping.

PubMed

Johnson, Ethan T; Baron, Daniel B; Naranjo, Belén; Bond, Daniel R; Schmidt-Dannert, Claudia; Gralnick, Jeffrey A

2010-07-01

Microorganisms can use complex photosystems or light-dependent proton pumps to generate membrane potential and/or reduce electron carriers to support growth. The discovery that proteorhodopsin is a light-dependent proton pump that can be expressed readily in recombinant bacteria enables development of new strategies to probe microbial physiology and to engineer microbes with new light-driven properties. Here, we describe functional expression of proteorhodopsin and light-induced changes in membrane potential in the bacterium Shewanella oneidensis strain MR-1. We report that there were significant increases in electrical current generation during illumination of electrochemical chambers containing S. oneidensis expressing proteorhodopsin. We present evidence that an engineered strain is able to consume lactate at an increased rate when it is illuminated, which is consistent with the hypothesis that proteorhodopsin activity enhances lactate uptake by increasing the proton motive force. Our results demonstrate that there is coupling of a light-driven process to electricity generation in a nonphotosynthetic engineered bacterium. Expression of proteorhodopsin also preserved the viability of the bacterium under nutrient-limited conditions, providing evidence that fulfillment of basic energy needs of organisms may explain the widespread distribution of proteorhodopsin in marine environments.

Missing data and technical variability in single-cell RNA-sequencing experiments.

PubMed

Hicks, Stephanie C; Townes, F William; Teng, Mingxiang; Irizarry, Rafael A

2017-11-06

Until recently, high-throughput gene expression technology, such as RNA-Sequencing (RNA-seq) required hundreds of thousands of cells to produce reliable measurements. Recent technical advances permit genome-wide gene expression measurement at the single-cell level. Single-cell RNA-Seq (scRNA-seq) is the most widely used and numerous publications are based on data produced with this technology. However, RNA-seq and scRNA-seq data are markedly different. In particular, unlike RNA-seq, the majority of reported expression levels in scRNA-seq are zeros, which could be either biologically-driven, genes not expressing RNA at the time of measurement, or technically-driven, genes expressing RNA, but not at a sufficient level to be detected by sequencing technology. Another difference is that the proportion of genes reporting the expression level to be zero varies substantially across single cells compared to RNA-seq samples. However, it remains unclear to what extent this cell-to-cell variation is being driven by technical rather than biological variation. Furthermore, while systematic errors, including batch effects, have been widely reported as a major challenge in high-throughput technologies, these issues have received minimal attention in published studies based on scRNA-seq technology. Here, we use an assessment experiment to examine data from published studies and demonstrate that systematic errors can explain a substantial percentage of observed cell-to-cell expression variability. Specifically, we present evidence that some of these reported zeros are driven by technical variation by demonstrating that scRNA-seq produces more zeros than expected and that this bias is greater for lower expressed genes. In addition, this missing data problem is exacerbated by the fact that this technical variation varies cell-to-cell. Then, we show how this technical cell-to-cell variability can be confused with novel biological results. Finally, we demonstrate and discuss how batch-effects and confounded experiments can intensify the problem. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Reversible Redox Activity by Ion-pH Dually Modulated Duplex Formation of i-Motif DNA with Complementary G-DNA.

PubMed

Chang, Soyoung; Kilic, Tugba; Lee, Chang Kee; Avci, Huseyin; Bae, Hojae; Oskui, Shirin Mesbah; Jung, Sung Mi; Shin, Su Ryon; Kim, Seon Jeong

2018-04-08

The unique biological features of supramolecular DNA have led to an increasing interest in biomedical applications such as biosensors. We have developed an i-motif and G-rich DNA conjugated single-walled carbon nanotube hybrid materials, which shows reversible conformational switching upon external stimuli such as pH (5 and 8) and presence of ions (Li⁺ and K⁺). We observed reversible electrochemical redox activity upon external stimuli in a quick and robust manner. Given the ease and the robustness of this method, we believe that pH- and ion-driven reversible DNA structure transformations will be utilized for future applications for developing novel biosensors.

Probing the prostate tumour microenvironment II: Impact of hypoxia on a cell model of prostate cancer progression

PubMed Central

Tonry, Claire; Armstrong, John; Pennington, Stephen

2017-01-01

Approximately one in six men are diagnosed with Prostate Cancer every year in the Western world. Although it can be well managed and non-life threatening in the early stages, over time many patients cease to respond to treatment and develop castrate resistant prostate cancer (CRPC). CRPC represents a clinically challenging and lethal form of prostate cancer. Progression of CRPC is, in part, driven by the ability of cancer cells to alter their metabolic profile during the course of tumourgenesis and metastasis so that they can survive in oxygen and nutrient-poor environments and even withstand treatment. This work was carried out as a continuation of a study aimed towards gaining greater mechanistic understanding of how conditions within the tumour microenvironment impact on both androgen sensitive (LNCaP) and androgen independent (LNCaP-abl and LNCaP-abl-Hof) prostate cancer cell lines. Here we have applied technically robust and reproducible label-free liquid chromatography mass spectrometry analysis for comprehensive proteomic profiling of prostate cancer cell lines under hypoxic conditions. This led to the identification of over 4,000 proteins – one of the largest protein datasets for prostate cancer cell lines established to date. The biological and clinical significance of proteins showing a significant change in expression as result of hypoxic conditions was established. Novel, intuitive workflows were subsequently implemented to enable robust, reproducible and high throughput verification of selected proteins of interest. Overall, these data suggest that this strategy supports identification of protein biomarkers of prostate cancer progression and potential therapeutic targets for CRPC. PMID:28410543

Robust and sparse correlation matrix estimation for the analysis of high-dimensional genomics data.

PubMed

Serra, Angela; Coretto, Pietro; Fratello, Michele; Tagliaferri, Roberto; Stegle, Oliver

2018-02-15

Microarray technology can be used to study the expression of thousands of genes across a number of different experimental conditions, usually hundreds. The underlying principle is that genes sharing similar expression patterns, across different samples, can be part of the same co-expression system, or they may share the same biological functions. Groups of genes are usually identified based on cluster analysis. Clustering methods rely on the similarity matrix between genes. A common choice to measure similarity is to compute the sample correlation matrix. Dimensionality reduction is another popular data analysis task which is also based on covariance/correlation matrix estimates. Unfortunately, covariance/correlation matrix estimation suffers from the intrinsic noise present in high-dimensional data. Sources of noise are: sampling variations, presents of outlying sample units, and the fact that in most cases the number of units is much larger than the number of genes. In this paper, we propose a robust correlation matrix estimator that is regularized based on adaptive thresholding. The resulting method jointly tames the effects of the high-dimensionality, and data contamination. Computations are easy to implement and do not require hand tunings. Both simulated and real data are analyzed. A Monte Carlo experiment shows that the proposed method is capable of remarkable performances. Our correlation metric is more robust to outliers compared with the existing alternatives in two gene expression datasets. It is also shown how the regularization allows to automatically detect and filter spurious correlations. The same regularization is also extended to other less robust correlation measures. Finally, we apply the ARACNE algorithm on the SyNTreN gene expression data. Sensitivity and specificity of the reconstructed network is compared with the gold standard. We show that ARACNE performs better when it takes the proposed correlation matrix estimator as input. The R software is available at https://github.com/angy89/RobustSparseCorrelation. aserra@unisa.it or robtag@unisa.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Cultural Geography Model Validation

DTIC Science & Technology

2010-03-01

the Cultural Geography Model (CGM), a government owned, open source multi - agent system utilizing Bayesian networks, queuing systems, the Theory of...referent determined either from theory or SME opinion. 4. CGM Overview The CGM is a government-owned, open source, data driven multi - agent social...HSCB, validation, social network analysis ABSTRACT: In the current warfighting environment , the military needs robust modeling and simulation (M&S

Safety features of subcritical fluid fueled systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bell, C.R.

1995-10-01

Accelerator-driven transmutation technology has been under study at Los Alamos for several years for application to nuclear waste treatment, tritium production, energy generation, and recently, to the disposition of excess weapons plutonium. Studies and evaluations performed to date at Los Alamos have led to a current focus on a fluid-fuel, fission system operating in a neutron source-supported subcritical mode, using molten salt reactor technology and accelerator-driven proton-neutron spallation. In this paper, the safety features and characteristics of such systems are explored from the perspective of the fundamental nuclear safety objectives that any reactor-type system should address. This exploration is qualitativemore » in nature and uses current vintage solid-fueled reactors as a baseline for comparison. Based on the safety perspectives presented, such systems should be capable of meeting the fundamental nuclear safety objectives. In addition, they should be able to provide the safety robustness desired for advanced reactors. However, the manner in which safety objectives and robustness are achieved is very different from that associated with conventional reactors. Also, there are a number of safety design and operational challenges that will have to be addressed for the safety potential of such systems to be credible.« less

Data-Driven Anomaly Detection Performance for the Ares I-X Ground Diagnostic Prototype

NASA Technical Reports Server (NTRS)

Martin, Rodney A.; Schwabacher, Mark A.; Matthews, Bryan L.

2010-01-01

In this paper, we will assess the performance of a data-driven anomaly detection algorithm, the Inductive Monitoring System (IMS), which can be used to detect simulated Thrust Vector Control (TVC) system failures. However, the ability of IMS to detect these failures in a true operational setting may be related to the realistic nature of how they are simulated. As such, we will investigate both a low fidelity and high fidelity approach to simulating such failures, with the latter based upon the underlying physics. Furthermore, the ability of IMS to detect anomalies that were previously unknown and not previously simulated will be studied in earnest, as well as apparent deficiencies or misapplications that result from using the data-driven paradigm. Our conclusions indicate that robust detection performance of simulated failures using IMS is not appreciably affected by the use of a high fidelity simulation. However, we have found that the inclusion of a data-driven algorithm such as IMS into a suite of deployable health management technologies does add significant value.

Machine Learning

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chikkagoudar, Satish; Chatterjee, Samrat; Thomas, Dennis G.

The absence of a robust and unified theory of cyber dynamics presents challenges and opportunities for using machine learning based data-driven approaches to further the understanding of the behavior of such complex systems. Analysts can also use machine learning approaches to gain operational insights. In order to be operationally beneficial, cybersecurity machine learning based models need to have the ability to: (1) represent a real-world system, (2) infer system properties, and (3) learn and adapt based on expert knowledge and observations. Probabilistic models and Probabilistic graphical models provide these necessary properties and are further explored in this chapter. Bayesian Networksmore » and Hidden Markov Models are introduced as an example of a widely used data driven classification/modeling strategy.« less

Stochastic dynamics of uncoupled neural oscillators: Fokker-Planck studies with the finite element method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galan, Roberto F.; Urban, Nathaniel N.; Center for the Neural Basis of Cognition, Mellon Institute, Pittsburgh, Pennsylvania 15213

We have investigated the effect of the phase response curve on the dynamics of oscillators driven by noise in two limit cases that are especially relevant for neuroscience. Using the finite element method to solve the Fokker-Planck equation we have studied (i) the impact of noise on the regularity of the oscillations quantified as the coefficient of variation, (ii) stochastic synchronization of two uncoupled phase oscillators driven by correlated noise, and (iii) their cross-correlation function. We show that, in general, the limit of type II oscillators is more robust to noise and more efficient at synchronizing by correlated noise thanmore » type I.« less

A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

PubMed

Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

2016-02-29

Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

microRNA as a Potential Vector for the Propagation of Robustness in Protein Expression and Oscillatory Dynamics within a ceRNA Network

PubMed Central

Gérard, Claude; Novák, Béla

2013-01-01

microRNAs (miRNAs) are small noncoding RNAs that are important post-transcriptional regulators of gene expression. miRNAs can induce thresholds in protein synthesis. Such thresholds in protein output can be also achieved by oligomerization of transcription factors (TF) for the control of gene expression. First, we propose a minimal model for protein expression regulated by miRNA and by oligomerization of TF. We show that miRNA and oligomerization of TF generate a buffer, which increases the robustness of protein output towards molecular noise as well as towards random variation of kinetics parameters. Next, we extend the model by considering that the same miRNA can bind to multiple messenger RNAs, which accounts for the dynamics of a minimal competing endogenous RNAs (ceRNAs) network. The model shows that, through common miRNA regulation, TF can control the expression of all proteins formed by the ceRNA network, even if it drives the expression of only one gene in the network. The model further suggests that the threshold in protein synthesis mediated by the oligomerization of TF can be propagated to the other genes, which can increase the robustness of the expression of all genes in such ceRNA network. Furthermore, we show that a miRNA could increase the time delay of a “Goodwin-like” oscillator model, which may favor the occurrence of oscillations of large amplitude. This result predicts important roles of miRNAs in the control of the molecular mechanisms leading to the emergence of biological rhythms. Moreover, a model for the latter oscillator embedded in a ceRNA network indicates that the oscillatory behavior can be propagated, via the shared miRNA, to all proteins formed by such ceRNA network. Thus, by means of computational models, we show that miRNAs could act as vectors allowing the propagation of robustness in protein synthesis as well as oscillatory behaviors within ceRNA networks. PMID:24376695

Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

PubMed Central

Kaneko, Kunihiko

2011-01-01

The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus

PubMed Central

Khan, Zainul A.; Abdin, Malik Z.; Khan, Jawaid A.

2015-01-01

Cotton leaf curl Burewala virus (CLCuBuV), belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP) genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV) were fused with β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi) leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum) plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells. PMID:25799504

Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

PubMed

Khan, Zainul A; Abdin, Malik Z; Khan, Jawaid A

2015-01-01

Cotton leaf curl Burewala virus (CLCuBuV), belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP) genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV) were fused with β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi) leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum) plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

Transfer functions of double- and multiple-cavity Fabry-Perot filters driven by Lorentzian sources.

PubMed

Marti, J; Capmany, J

1996-12-20

We derive expressions for the transfer functions of double- and multiple-cavity Fabry-Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Transfer functions of double- and multiple-cavity Fabry Perot filters driven by Lorentzian sources

NASA Astrophysics Data System (ADS)

Marti, Javier; Capmany, Jose

1996-12-01

We derive expressions for the transfer functions of double- and multiple-cavity Fabry Perot filters driven by laser sources with Lorentzian spectrum. These are of interest because of their applications in sensing and channel filtering in optical frequency-division multiplexing networks.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Economic modeling of new stent platforms to evaluate cost effectiveness: analysis of the TAXUS Liberté versus TAXUS express stents.

PubMed

Turco, Mark A; Kansal, Anuraag R; Stern, Sean; Amorosi, Stacey L; Underwood, Paul L; Lissovoy, Greg D E; Dawkins, Keith D

2012-08-01

With the changing health care environment, cost effectiveness is an important adjunct to clinical investigation when assessing new medical devices. This study presents an economic model to evaluate cost effectiveness of coronary stents. Markov modeling was developed comparing total costs (Medicare payer perspective) between TAXUS Liberté and TAXUS Express based on 3-year clinical outcomes from the TAXUS ATLAS Small Vessel and Long Lesion trials. The TAXUS Liberté 2.25-mm stent provided cost savings relative to TAXUS Express from a payer perspective ($17,605 vs. $20,281), driven by reduced target vessel revascularization (0.16 events/patient vs. 0.33 events/patient). In probabilistic sensitivity analyses, TAXUS Liberté was less costly with fewer major adverse cardiac events in over 99% of parameter sets. The TAXUS Liberté Long (38 mm) stent was cost neutral relative to TAXUS Express from a payer perspective ($18,545 vs. $18,551) with fewer myocardial infarctions and cardiac deaths. Accounting for angiography-driven revascularizations, TAXUS Liberté 2.25 mm still provided cost savings relative to TAXUS Express ($16,822 vs. $19,139), although TAXUS Liberté Long was more expensive than TAXUS Express ($17,886 vs. $17,652). From a hospital perspective, TAXUS Liberté Long provided cost savings up to a price premium of $671/stent, driven by fewer stents employed per patient. This analysis confirms the utility of economic modeling in assessing new stent platforms. TAXUS Liberté 2.25 mm is economically dominant relative to TAXUS Express when treating small vessels. TAXUS Liberté Long is cost neutral to modestly more costly than TAXUS Express 2.25 mm from a payer perspective. ©2012, Wiley Periodicals, Inc.

Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

PubMed

Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

2016-08-08

Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

PubMed Central

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

Use of planar array electrophysiology for the development of robust ion channel cell lines.

PubMed

Clare, Jeffrey J; Chen, Mao Xiang; Downie, David L; Trezise, Derek J; Powell, Andrew J

2009-01-01

The tractability of ion channels as drug targets has been significantly improved by the advent of planar array electrophysiology platforms which have dramatically increased the capacity for electrophysiological profiling of lead series compounds. However, the data quality and through-put obtained with these platforms is critically dependent on the robustness of the expression reagent being used. The generation of high quality, recombinant cell lines is therefore a key step in the early phase of ion channel drug discovery and this can present significant challenges due to the diversity and organisational complexity of many channel types. This article focuses on several complex and difficult to express ion channels and illustrates how improved stable cell lines can be obtained by integration of planar array electrophysiology systems into the cell line generation process per se. By embedding this approach at multiple stages (e.g., during development of the expression strategy, during screening and validation of clonal lines, and during characterisation of the final cell line), the cycle time and success rate in obtaining robust expression of complex multi-subunit channels can be significantly improved. We also review how recent advances in this technology (e.g., population patch clamp) have further widened the versatility and applicability of this approach.

Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.

PubMed

Kowarz, Eric; Löscher, Denise; Marschalek, Rolf

2015-04-01

Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Facial expression recognition based on weber local descriptor and sparse representation

NASA Astrophysics Data System (ADS)

Ouyang, Yan

2018-03-01

Automatic facial expression recognition has been one of the research hotspots in the area of computer vision for nearly ten years. During the decade, many state-of-the-art methods have been proposed which perform very high accurate rate based on the face images without any interference. Nowadays, many researchers begin to challenge the task of classifying the facial expression images with corruptions and occlusions and the Sparse Representation based Classification framework has been wildly used because it can robust to the corruptions and occlusions. Therefore, this paper proposed a novel facial expression recognition method based on Weber local descriptor (WLD) and Sparse representation. The method includes three parts: firstly the face images are divided into many local patches, and then the WLD histograms of each patch are extracted, finally all the WLD histograms features are composed into a vector and combined with SRC to classify the facial expressions. The experiment results on the Cohn-Kanade database show that the proposed method is robust to occlusions and corruptions.

Geographical Genomics of Human Leukocyte Gene Expression Variation in Southern Morocco

PubMed Central

Idaghdour, Youssef; Czika, Wendy; Shianna, Kevin V.; Lee, S. Hong; Visscher, Peter M.; Martin, Hilary C.; Miclaus, Kelci; Jadallah, Sami J.; Goldstein, David B.; Wolfinger, Russell D.; Gibson, Greg

2009-01-01

Studies of the genetics of gene expression reveal expression SNPs that explain variation in transcript abundance. Here we address the robustness of eSNP associations to environmental geography and population structure in a comparison of 194 Arab and Amazigh individuals from a city and two villages in southern Morocco. Gene expression differed between pairs of locations for up to a third of all transcripts, with notable enrichment for ribosomal biosynthesis and oxidative phosphorylation. Robust associations were observed in the leukocyte samples with cis-eSNPs (P < 10−08) for 346 genes, and trans-eSNPs (P < 10−11) with 10 genes. All of these were consistent across the three sample locations and after controlling for ethnicity and relatedness. No evidence for large-effect trans-acting mediators of the pervasive environmental influence was found and instead genetic and environmental factors acted in a largely additive manner. PMID:19966804

Order Under Uncertainty: Robust Differential Expression Analysis Using Probabilistic Models for Pseudotime Inference

PubMed Central

Campbell, Kieran R.

2016-01-01

Single cell gene expression profiling can be used to quantify transcriptional dynamics in temporal processes, such as cell differentiation, using computational methods to label each cell with a ‘pseudotime’ where true time series experimentation is too difficult to perform. However, owing to the high variability in gene expression between individual cells, there is an inherent uncertainty in the precise temporal ordering of the cells. Pre-existing methods for pseudotime estimation have predominantly given point estimates precluding a rigorous analysis of the implications of uncertainty. We use probabilistic modelling techniques to quantify pseudotime uncertainty and propagate this into downstream differential expression analysis. We demonstrate that reliance on a point estimate of pseudotime can lead to inflated false discovery rates and that probabilistic approaches provide greater robustness and measures of the temporal resolution that can be obtained from pseudotime inference. PMID:27870852

Evolution and inheritance of early embryonic patterning in Drosophila simulans and D. sechellia.

PubMed

Lott, Susan E; Ludwig, Michael Z; Kreitman, Martin

2011-05-01

Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation that selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth "stripe allometry") in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species Drosophila simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the "margin of error" for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

Dual regulation of gene expression mediated by extended MAPK activation and salicylic acid contributes to robust innate immunity in Arabidopsis thaliana.

PubMed

Tsuda, Kenichi; Mine, Akira; Bethke, Gerit; Igarashi, Daisuke; Botanga, Christopher J; Tsuda, Yayoi; Glazebrook, Jane; Sato, Masanao; Katagiri, Fumiaki

2013-01-01

Network robustness is a crucial property of the plant immune signaling network because pathogens are under a strong selection pressure to perturb plant network components to dampen plant immune responses. Nevertheless, modulation of network robustness is an area of network biology that has rarely been explored. While two modes of plant immunity, Effector-Triggered Immunity (ETI) and Pattern-Triggered Immunity (PTI), extensively share signaling machinery, the network output is much more robust against perturbations during ETI than PTI, suggesting modulation of network robustness. Here, we report a molecular mechanism underlying the modulation of the network robustness in Arabidopsis thaliana. The salicylic acid (SA) signaling sector regulates a major portion of the plant immune response and is important in immunity against biotrophic and hemibiotrophic pathogens. In Arabidopsis, SA signaling was required for the proper regulation of the vast majority of SA-responsive genes during PTI. However, during ETI, regulation of most SA-responsive genes, including the canonical SA marker gene PR1, could be controlled by SA-independent mechanisms as well as by SA. The activation of the two immune-related MAPKs, MPK3 and MPK6, persisted for several hours during ETI but less than one hour during PTI. Sustained MAPK activation was sufficient to confer SA-independent regulation of most SA-responsive genes. Furthermore, the MPK3 and SA signaling sectors were compensatory to each other for inhibition of bacterial growth as well as for PR1 expression during ETI. These results indicate that the duration of the MAPK activation is a critical determinant for modulation of robustness of the immune signaling network. Our findings with the plant immune signaling network imply that the robustness level of a biological network can be modulated by the activities of network components.

Parental Expressiveness as a Moderator of Coparenting and Marital Relationship Quality

ERIC Educational Resources Information Center

Kolak, Amy M.; Volling, Brenda L.

2007-01-01

Driven by theory and extant research on the communication of emotions within the family, the current investigation examined marital quality and parents' emotional expressiveness as determinants of coparenting in a sample of 57 couples with young children. Specifically, mothers' and fathers' expressiveness was examined as moderators of the…

Assessment of long-term transgene expression in barley: Ds-mediated delivery of bar results in robust, stable, and heritable expression

USDA-ARS?s Scientific Manuscript database

The utility of transgenic plants for both experimental and practical agronomic purposes is highly dependent on stable, predictable, and heritable expression of the introduced genes. This requirement is frequently unfulfilled, and transgenes are frequently subject to silencing. Studies of the charact...

Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

PubMed Central

Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.

2016-01-01

Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed that the consistency of AR gene membership correlates with phylogenetic distance, but there is clear variability in the regulatory networks of closely related organisms. As large scale expression data sets become increasingly common for model and non-model organisms, comparative analyses of atomic regulons will provide valuable insights into fundamental regulatory modules used across the bacterial domain. PMID:27933038

Coordination of self-renewal in glioblastoma by integration of adhesion and microRNA signaling.

PubMed

Alvarado, Alvaro G; Turaga, Soumya M; Sathyan, Pratheesh; Mulkearns-Hubert, Erin E; Otvos, Balint; Silver, Daniel J; Hale, James S; Flavahan, William A; Zinn, Pascal O; Sinyuk, Maksim; Li, Meizhang; Guda, Maheedhara R; Velpula, Kiran K; Tsung, Andrew J; Nakano, Ichiro; Vogelbaum, Michael A; Majumder, Sadhan; Rich, Jeremy N; Lathia, Justin D

2016-05-01

Cancer stem cells (CSCs) provide an additional layer of complexity for tumor models and targets for therapeutic development. The balance between CSC self-renewal and differentiation is driven by niche components including adhesion, which is a hallmark of stemness. While studies have demonstrated that the reduction of adhesion molecules, such as integrins and junctional adhesion molecule-A (JAM-A), decreases CSC maintenance. The molecular circuitry underlying these interactions has yet to be resolved. MicroRNA screening predicted that microRNA-145 (miR-145) would bind to JAM-A. JAM-A overexpression in CSCs was evaluated both in vitro (proliferation and self-renewal) and in vivo (intracranial tumor initiation). miR-145 introduction into CSCs was similarly assessed in vitro. Additionally, The Cancer Genome Atlas dataset was evaluated for expression levels of miR-145 and overall survival of the different molecular groups. Using patient-derived glioblastoma CSCs, we confirmed that JAM-A is suppressed by miR-145. CSCs expressed low levels of miR-145, and its introduction decreased self-renewal through reductions in AKT signaling and stem cell marker (SOX2, OCT4, and NANOG) expression; JAM-A overexpression rescued these effects. These findings were predictive of patient survival, with a JAM-A/miR-145 signature robustly predicting poor patient prognosis. Our results link CSC-specific niche signaling to a microRNA regulatory network that is altered in glioblastoma and can be targeted to attenuate CSC self-renewal. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Transcriptional Regulation of Seprase in Invasive Melanoma Cells by Transforming Growth Factor-β Signaling*

PubMed Central

Tulley, Shaun; Chen, Wen-Tien

2014-01-01

The tumor invasive phenotype driven by seprase expression/activity has been widely examined in an array of malignant tumor cell types; however, very little is known about the transcriptional regulation of this critical protease. Seprase (also named fibroblast activation protein-α, antiplasmin-cleaving enzyme, and dipeptidyl prolyl peptidase 5) is expressed at high levels by stromal fibroblast, endothelial, and tumor cells in a variety of invasive tumors but is undetectable in the majority of normal adult tissues. To examine the transcriptional regulation of the gene, we cloned the human seprase promoter and demonstrated that endogenous seprase expression and exogenous seprase promoter activity are high in invasive melanoma cells but not in non-invasive melanoma cells/primary melanocytes. In addition, we identified a crucial TGF-β-responsive cis-regulatory element in the proximal seprase promoter region that enabled robust transcriptional activation of the gene. Treatment of metastatic but not normal/non-invasive cells with TGF-β1 caused a rapid and profound up-regulation of endogenous seprase mRNA, which coincided with an abolishment of the negative regulator c-Ski, and an increase in binding of Smad3/4 to the seprase promoter in vivo. Blocking TGF-β signaling in invasive melanoma cells through overexpression of c-Ski, chemically using SB-431542, or with a neutralizing antibody against TGF-β significantly reduced seprase mRNA levels. Strikingly, RNAi of seprase in invasive cells greatly diminished their invasive potential in vitro as did blocking TGF-β signaling using SB-431542. Altogether, we found that seprase is transcriptionally up-regulated in invasive melanoma cells via the canonical TGF-β signaling pathway, supporting the roles of both TGF-β and seprase in tumor invasion and metastasis. PMID:24727589

Analysis of gene network robustness based on saturated fixed point attractors

PubMed Central

2014-01-01

The analysis of gene network robustness to noise and mutation is important for fundamental and practical reasons. Robustness refers to the stability of the equilibrium expression state of a gene network to variations of the initial expression state and network topology. Numerical simulation of these variations is commonly used for the assessment of robustness. Since there exists a great number of possible gene network topologies and initial states, even millions of simulations may be still too small to give reliable results. When the initial and equilibrium expression states are restricted to being saturated (i.e., their elements can only take values 1 or −1 corresponding to maximum activation and maximum repression of genes), an analytical gene network robustness assessment is possible. We present this analytical treatment based on determination of the saturated fixed point attractors for sigmoidal function models. The analysis can determine (a) for a given network, which and how many saturated equilibrium states exist and which and how many saturated initial states converge to each of these saturated equilibrium states and (b) for a given saturated equilibrium state or a given pair of saturated equilibrium and initial states, which and how many gene networks, referred to as viable, share this saturated equilibrium state or the pair of saturated equilibrium and initial states. We also show that the viable networks sharing a given saturated equilibrium state must follow certain patterns. These capabilities of the analytical treatment make it possible to properly define and accurately determine robustness to noise and mutation for gene networks. Previous network research conclusions drawn from performing millions of simulations follow directly from the results of our analytical treatment. Furthermore, the analytical results provide criteria for the identification of model validity and suggest modified models of gene network dynamics. The yeast cell-cycle network is used as an illustration of the practical application of this analytical treatment. PMID:24650364

Exploration of the Hypothalamic-Pituitary-Adrenal Axis to Improve Animal Welfare by Means of Genetic Selection: Lessons from the South African Merino

PubMed Central

Hough, Denise; Swart, Pieter; Cloete, Schalk

2013-01-01

Simple Summary Breeding sheep that are robust and easily managed may be beneficial for both animal welfare and production. Sheep that are more readily able to adapt to stressful situations and a wide variety of environmental conditions are likely to have more resources available for a higher expression of their production potential. This review explores the utilization of one of the stress response pathways, namely the hypothalamic-pituitary-adrenal axis, to locate potential sites where genetic markers might be identified that contribute to sheep robustness. A South African Merino breeding programme is used to demonstrate the potential benefits of this approach. Abstract It is a difficult task to improve animal production by means of genetic selection, if the environment does not allow full expression of the animal’s genetic potential. This concept may well be the future for animal welfare, because it highlights the need to incorporate traits related to production and robustness, simultaneously, to reach sustainable breeding goals. This review explores the identification of potential genetic markers for robustness within the hypothalamic-pituitary-adrenal axis (HPAA), since this axis plays a vital role in the stress response. If genetic selection for superior HPAA responses to stress is possible, then it ought to be possible to breed robust and easily managed genotypes that might be able to adapt to a wide range of environmental conditions whilst expressing a high production potential. This approach is explored in this review by means of lessons learnt from research on Merino sheep, which were divergently selected for their multiple rearing ability. These two selection lines have shown marked differences in reproduction, production and welfare, which makes this breeding programme ideal to investigate potential genetic markers of robustness. The HPAA function is explored in detail to elucidate where such genetic markers are likely to be found. PMID:26487412

Robust transcriptional tumor signatures applicable to both formalin-fixed paraffin-embedded and fresh-frozen samples

PubMed Central

Cheng, Jun; He, Jun; Liu, Huaping; Cai, Hao; Hong, Guini; Zhang, Jiahui; Li, Na; Ao, Lu; Guo, Zheng

2017-01-01

Formalin-fixed paraffin-embedded (FFPE) samples represent a valuable resource for clinical researches. However, FFPE samples are usually considered an unreliable source for gene expression analysis due to the partial RNA degradation. In this study, through comparing gene expression profiles between FFPE samples and paired fresh-frozen (FF) samples for three cancer types, we firstly showed that expression measurements of thousands of genes had at least two-fold change in FFPE samples compared with paired FF samples. Therefore, for a transcriptional signature based on risk scores summarized from the expression levels of the signature genes, the risk score thresholds trained from FFPE (or FF) samples could not be applied to FF (or FFPE) samples. On the other hand, we found that more than 90% of the relative expression orderings (REOs) of gene pairs in the FF samples were maintained in their paired FFPE samples and largely unaffected by the storage time. The result suggested that the REOs of gene pairs were highly robust against partial RNA degradation in FFPE samples. Finally, as a case study, we developed a REOs-based signature to distinguish liver cirrhosis from hepatocellular carcinoma (HCC) using FFPE samples. The signature was validated in four datasets of FFPE samples and eight datasets of FF samples. In conclusion, the valuable FFPE samples can be fully exploited to identify REOs-based diagnostic and prognostic signatures which could be robustly applicable to both FF samples and FFPE samples with degraded RNA. PMID:28036264

Robust Learning of High-dimensional Biological Networks with Bayesian Networks

NASA Astrophysics Data System (ADS)

Nägele, Andreas; Dejori, Mathäus; Stetter, Martin

Structure learning of Bayesian networks applied to gene expression data has become a potentially useful method to estimate interactions between genes. However, the NP-hardness of Bayesian network structure learning renders the reconstruction of the full genetic network with thousands of genes unfeasible. Consequently, the maximal network size is usually restricted dramatically to a small set of genes (corresponding with variables in the Bayesian network). Although this feature reduction step makes structure learning computationally tractable, on the downside, the learned structure might be adversely affected due to the introduction of missing genes. Additionally, gene expression data are usually very sparse with respect to the number of samples, i.e., the number of genes is much greater than the number of different observations. Given these problems, learning robust network features from microarray data is a challenging task. This chapter presents several approaches tackling the robustness issue in order to obtain a more reliable estimation of learned network features.

Neutrality and Robustness in Evo-Devo: Emergence of Lateral Inhibition

PubMed Central

Munteanu, Andreea; Solé, Ricard V.

2008-01-01

Embryonic development is defined by the hierarchical dynamical process that translates genetic information (genotype) into a spatial gene expression pattern (phenotype) providing the positional information for the correct unfolding of the organism. The nature and evolutionary implications of genotype–phenotype mapping still remain key topics in evolutionary developmental biology (evo-devo). We have explored here issues of neutrality, robustness, and diversity in evo-devo by means of a simple model of gene regulatory networks. The small size of the system allowed an exhaustive analysis of the entire fitness landscape and the extent of its neutrality. This analysis shows that evolution leads to a class of robust genetic networks with an expression pattern characteristic of lateral inhibition. This class is a repertoire of distinct implementations of this key developmental process, the diversity of which provides valuable clues about its underlying causal principles. PMID:19023404

Morpho-functional characterization of the systemic venous pole of the reptile heart.

PubMed

Jensen, Bjarke; Vesterskov, Signe; Boukens, Bastiaan J; Nielsen, Jan M; Moorman, Antoon F M; Christoffels, Vincent M; Wang, Tobias

2017-07-27

Mammals evolved from reptile-like ancestors, and while the mammalian heart is driven by a distinct sinus node, a sinus node is not apparent in reptiles. We characterized the myocardial systemic venous pole, the sinus venosus, in reptiles to identify the dominant pacemaker and to assess whether the sinus venosus remodels and adopts an atrium-like phenotype as observed in mammals. Anolis lizards had an extensive sinus venosus of myocardium expressing Tbx18. A small sub-population of cells encircling the sinuatrial junction expressed Isl1, Bmp2, Tbx3, and Hcn4, homologues of genes marking the mammalian sinus node. Electrical mapping showed that hearts of Anolis lizards and Python snakes were driven from the sinuatrial junction. The electrical impulse was delayed between the sinus venosus and the right atrium, allowing the sinus venosus to contract and aid right atrial filling. In proximity of the systemic veins, the Anolis sinus venosus expressed markers of the atrial phenotype Nkx2-5 and Gja5. In conclusion, the reptile heart is driven by a pacemaker region with an expression signature similar to that of the immature sinus node of mammals. Unlike mammals, reptiles maintain a sinuatrial delay of the impulse, allowing the partly atrialized sinus venosus to function as a chamber.

Tau pathology does not affect experience-driven single-neuron and network-wide Arc/Arg3.1 responses.

PubMed

Rudinskiy, Nikita; Hawkes, Jonathan M; Wegmann, Susanne; Kuchibhotla, Kishore V; Muzikansky, Alona; Betensky, Rebecca A; Spires-Jones, Tara L; Hyman, Bradley T

2014-06-10

Intraneuronal neurofibrillary tangles (NFTs) - a characteristic pathological feature of Alzheimer's and several other neurodegenerative diseases - are considered a major target for drug development. Tangle load correlates well with the severity of cognitive symptoms and mouse models of tauopathy are behaviorally impaired. However, there is little evidence that NFTs directly impact physiological properties of host neurons. Here we used a transgenic mouse model of tauopathy to study how advanced tau pathology in different brain regions affects activity-driven expression of immediate-early gene Arc required for experience-dependent consolidation of long-term memories. We demonstrate in vivo that visual cortex neurons with tangles are as likely to express comparable amounts of Arc in response to structured visual stimulation as their neighbors without tangles. Probability of experience-dependent Arc response was not affected by tau tangles in both visual cortex and hippocampal pyramidal neurons as determined postmortem. Moreover, whole brain analysis showed that network-wide activity-driven Arc expression was not affected by tau pathology in any of the brain regions, including brain areas with the highest tangle load. Our findings suggest that intraneuronal NFTs do not affect signaling cascades leading to experience-dependent gene expression required for long-term synaptic plasticity.

GPER in CAFs regulates hypoxia-driven breast cancer invasion in a CTGF-dependent manner.

PubMed

Ren, Juan; Guo, Hui; Wu, Huili; Tian, Tao; Dong, Danfeng; Zhang, Yuelang; Sui, Yanxia; Zhang, Yong; Zhao, Dongli; Wang, Shufeng; Li, Zongfang; Zhang, Xiaozhi; Liu, Rui; Qian, Jianshneg; Wei, Hongxia; Jiang, Wenjun; Liu, Ya; Li, Yi

2015-04-01

Recent advances indicate that cancer‑associated fibroblasts (CAFs) play a key role in cancer progression by contributing to invasion, metastasis and angiogenesis. Solid tumors often experience low oxygen tension environments, which induce gene expression changes and biological features leading to poor outcomes. The G-protein estrogen receptor (GPER) exhibits a stimulatory role in diverse types of cancer cells and in CAFs under hypoxic conditions. We investigated the role of CAFs and hypoxia in breast cancer aggressiveness, and examined the effect of GPER in CAFs on hypoxia-driven breast cancer progression. The results showed that hypoxia upregulated HIF-1α, GPER and α-SMA expression in CAFs, and induced the secretion of Interleukin-6 (IL-6), vascular endothelial growth factor (VEGF) and connective tissue growth factor (CTGF) in CAFs. However, GPER silencing abrogated the above hypoxia-driven cytokine expression in CAFs. Moreover, knockdown of GPER in CAFs suppressed breast cancer cell invasion induced by CAF conditioned media (CM). Furthermore, GPER silencing in CAFs inhibited hypoxia-increased CTGF expression in CAFs and breast cancer cells cultured with CM from CAFs under hypoxic conditions. In addition, CTGF is responsible for the observed effects of GPER on CAFs activation and breast cancer invasion. Our findings further extend the molecular mechanisms through which the tumor microenvironment may contribute to cancer progression.

Image ratio features for facial expression recognition application.

PubMed

Song, Mingli; Tao, Dacheng; Liu, Zicheng; Li, Xuelong; Zhou, Mengchu

2010-06-01

Video-based facial expression recognition is a challenging problem in computer vision and human-computer interaction. To target this problem, texture features have been extracted and widely used, because they can capture image intensity changes raised by skin deformation. However, existing texture features encounter problems with albedo and lighting variations. To solve both problems, we propose a new texture feature called image ratio features. Compared with previously proposed texture features, e.g., high gradient component features, image ratio features are more robust to albedo and lighting variations. In addition, to further improve facial expression recognition accuracy based on image ratio features, we combine image ratio features with facial animation parameters (FAPs), which describe the geometric motions of facial feature points. The performance evaluation is based on the Carnegie Mellon University Cohn-Kanade database, our own database, and the Japanese Female Facial Expression database. Experimental results show that the proposed image ratio feature is more robust to albedo and lighting variations, and the combination of image ratio features and FAPs outperforms each feature alone. In addition, we study asymmetric facial expressions based on our own facial expression database and demonstrate the superior performance of our combined expression recognition system.

Robust Linear Models for Cis-eQTL Analysis.

PubMed

Rantalainen, Mattias; Lindgren, Cecilia M; Holmes, Christopher C

2015-01-01

Expression Quantitative Trait Loci (eQTL) analysis enables characterisation of functional genetic variation influencing expression levels of individual genes. In outbread populations, including humans, eQTLs are commonly analysed using the conventional linear model, adjusting for relevant covariates, assuming an allelic dosage model and a Gaussian error term. However, gene expression data generally have noise that induces heavy-tailed errors relative to the Gaussian distribution and often include atypical observations, or outliers. Such departures from modelling assumptions can lead to an increased rate of type II errors (false negatives), and to some extent also type I errors (false positives). Careful model checking can reduce the risk of type-I errors but often not type II errors, since it is generally too time-consuming to carefully check all models with a non-significant effect in large-scale and genome-wide studies. Here we propose the application of a robust linear model for eQTL analysis to reduce adverse effects of deviations from the assumption of Gaussian residuals. We present results from a simulation study as well as results from the analysis of real eQTL data sets. Our findings suggest that in many situations robust models have the potential to provide more reliable eQTL results compared to conventional linear models, particularly in respect to reducing type II errors due to non-Gaussian noise. Post-genomic data, such as that generated in genome-wide eQTL studies, are often noisy and frequently contain atypical observations. Robust statistical models have the potential to provide more reliable results and increased statistical power under non-Gaussian conditions. The results presented here suggest that robust models should be considered routinely alongside other commonly used methodologies for eQTL analysis.

Cardiomyocyte Circadian Oscillations Are Cell-Autonomous, Amplified by β-Adrenergic Signaling, and Synchronized in Cardiac Ventricle Tissue

PubMed Central

Welsh, David K.

2016-01-01

Circadian clocks impact vital cardiac parameters such as blood pressure and heart rate, and adverse cardiac events such as myocardial infarction and sudden cardiac death. In mammals, the central circadian pacemaker, located in the suprachiasmatic nucleus of the hypothalamus, synchronizes cellular circadian clocks in the heart and many other tissues throughout the body. Cardiac ventricle explants maintain autonomous contractions and robust circadian oscillations of clock gene expression in culture. In the present study, we examined the relationship between intrinsic myocardial function and circadian rhythms in cultures from mouse heart. We cultured ventricular explants or dispersed cardiomyocytes from neonatal mice expressing a PER2::LUC bioluminescent reporter of circadian clock gene expression. We found that isoproterenol, a β-adrenoceptor agonist known to increase heart rate and contractility, also amplifies PER2 circadian rhythms in ventricular explants. We found robust, cell-autonomous PER2 circadian rhythms in dispersed cardiomyocytes. Single-cell rhythms were initially synchronized in ventricular explants but desynchronized in dispersed cells. In addition, we developed a method for long-term, simultaneous monitoring of clock gene expression, contraction rate, and basal intracellular Ca2+ level in cardiomyocytes using PER2::LUC in combination with GCaMP3, a genetically encoded fluorescent Ca2+ reporter. In contrast to robust PER2 circadian rhythms in cardiomyocytes, we detected no rhythms in contraction rate and only weak rhythms in basal Ca2+ level. In summary, we found that PER2 circadian rhythms of cardiomyocytes are cell-autonomous, amplified by adrenergic signaling, and synchronized by intercellular communication in ventricle explants, but we detected no robust circadian rhythms in contraction rate or basal Ca2+. PMID:27459195

Precipitation, temperature, and teleconnection signals across the combined North American, Monsoon Asia, and Old World Drought Atlases

NASA Astrophysics Data System (ADS)

Smerdon, J. E.; Baek, S. H.; Coats, S.; Williams, P.; Cook, B.; Cook, E. R.; Seager, R.

2017-12-01

The tree-ring-based North American Drought Atlas (NADA), Monsoon Asia Drought Atlas (MADA), and Old World Drought Atlas (OWDA) collectively yield a near-hemispheric gridded reconstruction of hydroclimate variability over the last millennium. To test the robustness of the large-scale representation of hydroclimate variability across the drought atlases, the joint expression of seasonal climate variability and teleconnections in the NADA, MADA, and OWDA are compared against two global, observation-based PDSI products. Predominantly positive (negative) correlations are determined between seasonal precipitation (surface air temperature) and collocated tree-ring-based PDSI, with average Pearson's correlation coefficients increasing in magnitude from boreal winter to summer. For precipitation, these correlations tend to be stronger in the boreal winter and summer when calculated for the observed PDSI record, while remaining similar for temperature. Notwithstanding these differences, the drought atlases robustly express teleconnection patterns associated with the El Niño-Southern Oscillation (ENSO), North Atlantic Oscillation (NAO), Pacific Decadal Oscillation (PDO), and Atlantic Multidecadal Oscillation (AMO). These expressions exist in the drought atlas estimates of boreal summer PDSI despite the fact that these modes of climate variability are dominant in boreal winter, with the exception of the Atlantic Multidecadal Oscillation. ENSO and NAO teleconnection patterns in the drought atlases are particularly consistent with their well-known dominant expressions in boreal winter and over the OWDA domain, respectively. Collectively, our findings confirm that the joint Northern Hemisphere drought atlases robustly reflect large-scale patterns of hydroclimate variability on seasonal to multidecadal timescales over the 20th century and are likely to provide similarly robust estimates of hydroclimate variability prior to the existence of widespread instrumental data.

Robust optical signal-to-noise ratio monitoring scheme using a phase-modulator-embedded fiber loop mirror.

PubMed

Ku, Yuen-Ching; Chan, Chun-Kit; Chen, Lian-Kuan

2007-06-15

We propose and experimentally demonstrate a novel in-band optical signal-to-noise ratio (OSNR) monitoring technique using a phase-modulator-embedded fiber loop mirror. This technique measures the in-band OSNR accurately by observing the output power of a fiber loop mirror filter, where the transmittance is adjusted by an embedded phase modulator driven by a low-frequency periodic signal. The measurement errors are less than 0.5 dB for an OSNR between 0 and 40 dB in a 10 Gbit/s non-return-to-zero system. This technique was also shown experimentally to have high robustness against various system impairments and high feasibility to be deployed in practical implementation.

Advances and new directions in crystallization control.

PubMed

Nagy, Zoltan K; Braatz, Richard D

2012-01-01

The academic literature on and industrial practice of control of solution crystallization processes have seen major advances in the past 15 years that have been enabled by progress in in-situ real-time sensor technologies and driven primarily by needs in the pharmaceutical industry for improved and more consistent quality of drug crystals. These advances include the accurate measurement of solution concentrations and crystal characteristics as well as the first-principles modeling and robust model-based and model-free feedback control of crystal size and polymorphic identity. Research opportunities are described in model-free controller design, new crystallizer designs with enhanced control of crystal size distribution, strategies for the robust control of crystal shape, and interconnected crystallization systems for multicomponent crystallization.

A prefoldin-associated WD-repeat protein (WDR92) is required for the correct architectural assembly of motile cilia

PubMed Central

Patel-King, Ramila S.; King, Stephen M.

2016-01-01

WDR92 is a highly conserved WD-repeat protein that has been proposed to be involved in apoptosis and also to be part of a prefoldin-like cochaperone complex. We found that WDR92 has a phylogenetic signature that is generally compatible with it playing a role in the assembly or function of specifically motile cilia. To test this hypothesis, we performed an RNAi-based knockdown of WDR92 gene expression in the planarian Schmidtea mediterranea and were able to achieve a robust reduction in mRNA expression to levels undetectable under our standard RT-PCR conditions. We found that this treatment resulted in a dramatic reduction in the rate of organismal movement that was caused by a switch in the mode of locomotion from smooth, cilia-driven gliding to muscle-based, peristaltic contractions. Although the knockdown animals still assembled cilia of normal length and in similar numbers to controls, these structures had reduced beat frequency and did not maintain hydrodynamic coupling. By transmission electron microscopy we observed that many cilia had pleiomorphic defects in their architecture, including partial loss of dynein arms, incomplete closure of the B-tubule, and occlusion or replacement of the central pair complex by accumulated electron-dense material. These observations suggest that WDR92 is part of a previously unrecognized cytoplasmic chaperone system that is specifically required to fold key components necessary to build motile ciliary axonemes. PMID:26912790

Kruppel-like factor KLF10 is a link between the circadian clock and metabolism in liver.

PubMed

Guillaumond, Fabienne; Gréchez-Cassiau, Aline; Subramaniam, Malayannan; Brangolo, Sophie; Peteri-Brünback, Brigitta; Staels, Bart; Fiévet, Catherine; Spelsberg, Thomas C; Delaunay, Franck; Teboul, Michèle

2010-06-01

The circadian timing system coordinates many aspects of mammalian physiology and behavior in synchrony with the external light/dark cycle. These rhythms are driven by endogenous molecular clocks present in most body cells. Many clock outputs are transcriptional regulators, suggesting that clock genes primarily control physiology through indirect pathways. Here, we show that Krüppel-like factor 10 (KLF10) displays a robust circadian expression pattern in wild-type mouse liver but not in clock-deficient Bmal1 knockout mice. Consistently, the Klf10 promoter recruited the BMAL1 core clock protein and was transactivated by the CLOCK-BMAL1 heterodimer through a conserved E-box response element. Profiling the liver transcriptome from Klf10(-/-) mice identified 158 regulated genes with significant enrichment for transcripts involved in lipid and carbohydrate metabolism. Importantly, approximately 56% of these metabolic genes are clock controlled. Male Klf10(-/-) mice displayed postprandial and fasting hyperglycemia, a phenotype accompanied by a significant time-of-day-dependent upregulation of the gluconeogenic gene Pepck and increased hepatic glucose production. Consistently, functional data showed that the proximal Pepck promoter is repressed directly by KLF10. Klf10(-/-) females were normoglycemic but displayed higher plasma triglycerides. Correspondingly, rhythmic gene expression of components of the lipogenic pathway, including Srebp1c, Fas, and Elovl6, was altered in females. Collectively, these data establish KLF10 as a required circadian transcriptional regulator that links the molecular clock to energy metabolism in the liver.

Uncovering a Dynamic Feature of the Transcriptional Regulatory Network for Anterior-Posterior Patterning in the Drosophila Embryo

PubMed Central

Liu, Junbo; Ma, Jun

2013-01-01

Anterior-posterior (AP) patterning in the Drosophila embryo is dependent on the Bicoid (Bcd) morphogen gradient. However, most target genes of Bcd also require additional inputs to establish their expression domains, reflective of the operation of a cross-regulatory network and contributions of other maternal signals. This is in contrast to hunchback (hb), which has an anterior expression domain driven by an enhancer that appears to respond primarily to the Bcd input. To gain a better understanding of the regulatory logic of the AP patterning network, we perform quantitative studies that specifically investigate the dynamics of hb transcription during development. We show that Bcd-dependent hb transcription, monitored by the intron-containing nascent transcripts near the P2 promoter, is turned off quickly–on the order of a few minutes–upon entering the interphase of nuclear cycle 14A. This shutdown contrasts with earlier cycles during which active hb transcription can persist until the moment when the nucleus enters mitosis. The shutdown takes place at a time when the nuclear Bcd gradient profile in the embryo remains largely intact, suggesting that this is a process likely subject to control of a currently unknown regulatory mechanism. We suggest that this dynamic feature offers a window of opportunity for hb to faithfully interpret, and directly benefit from, Bcd gradient properties, including its scaling properties, to help craft a robust AP patterning outcome. PMID:23646132

Satellite-like cells contribute to pax7-dependent skeletal muscle repair in adult zebrafish

PubMed Central

Berberoglu, Michael A.; Gallagher, Thomas L.; Morrow, Zachary T.; Talbot, Jared C.; Hromowyk, Kimberly J.; Tenente, Inês M.; Langenau, David M.; Amacher, Sharon L.

2017-01-01

Satellite cells, also known as muscle stem cells, are responsible for skeletal muscle growth and repair in mammals. Pax7 and Pax3 transcription factors are established satellite cell markers required for muscle development and regeneration, and there is great interest in identifying additional factors that regulate satellite cell proliferation, differentiation, and/or skeletal muscle regeneration. Due to the powerful regenerative capacity of many zebrafish tissues, even in adults, we are exploring the regenerative potential of adult zebrafish skeletal muscle. Here, we show that adult zebrafish skeletal muscle contains cells similar to mammalian satellite cells. Adult zebrafish satellite-like cells have dense heterochromatin, express Pax7 and Pax3, proliferate in response to injury, and show peak myogenic responses 4–5 days post-injury (dpi). Furthermore, using a pax7a-driven GFP reporter, we present evidence implicating satellite-like cells as a possible source of new muscle. In lieu of central nucleation, which distinguishes regenerating myofibers in mammals, we describe several characteristics that robustly identify newly-forming myofibers from surrounding fibers in injured adult zebrafish muscle. These characteristics include partially overlapping expression in satellite cells and regenerating myofibers of two RNA-binding proteins Rbfox2 and Rbfoxl1, known to regulate embryonic muscle development and function. Finally, by analyzing pax7a; pax7b double mutant zebrafish, we show that Pax7 is required for adult skeletal muscle repair, as it is in the mouse. PMID:28279710

Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling

PubMed Central

Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto

2018-01-01

The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance. PMID:29495311

Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling.

PubMed

Fanunza, Elisa; Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto; Corona, Angela; Tramontano, Enzo

2018-02-24

The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z'- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.

TALEN-mediated functional correction of human iPSC-derived macrophages in context of hereditary pulmonary alveolar proteinosis.

PubMed

Kuhn, Alexandra; Ackermann, Mania; Mussolino, Claudio; Cathomen, Toni; Lachmann, Nico; Moritz, Thomas

2017-11-09

Hereditary pulmonary alveolar proteinosis (herPAP) constitutes a rare, life threatening lung disease characterized by the inability of alveolar macrophages to clear the alveolar airspaces from surfactant phospholipids. On a molecular level, the disorder is defined by a defect in the CSF2RA gene coding for the GM-CSF receptor alpha-chain (CD116). As therapeutic options are limited, we currently pursue a cell and gene therapy approach aiming for the intrapulmonary transplantation of gene-corrected macrophages derived from herPAP-specific induced pluripotent stem cells (herPAP-iPSC) employing transcriptional activator-like effector nucleases (TALENs). Targeted insertion of a codon-optimized CSF2RA-cDNA driven by the hybrid cytomegalovirus (CMV) early enhancer/chicken beta actin (CAG) promoter into the AAVS1 locus resulted in robust expression of the CSF2RA gene in gene-edited herPAP-iPSCs as well as thereof derived macrophages. These macrophages displayed typical morphology, surface phenotype, phagocytic and secretory activity, as well as functional CSF2RA expression verified by STAT5 phosphorylation and GM-CSF uptake studies. Thus, our study provides a proof-of-concept, that TALEN-mediated integration of the CSF2RA gene into the AAVS1 safe harbor locus in patient-specific iPSCs represents an efficient strategy to generate functionally corrected monocytes/macrophages, which in the future may serve as a source for an autologous cell-based gene therapy for the treatment of herPAP.

Cardiac stem cell genetic engineering using the alphaMHC promoter.

PubMed

Bailey, Brandi; Izarra, Alberto; Alvarez, Roberto; Fischer, Kimberlee M; Cottage, Christopher T; Quijada, Pearl; Díez-Juan, Antonio; Sussman, Mark A

2009-11-01

Cardiac stem cells (CSCs) show potential as a cellular therapeutic approach to blunt tissue damage and facilitate reparative and regenerative processes after myocardial infarction. Despite multiple published reports of improvement, functional benefits remain modest using normal stem cells delivered by adoptive transfer into damaged myocardium. The goal of this study is to enhance survival and proliferation of CSCs that have undergone lineage commitment in early phases as evidenced by expression of proteins driven by the alpha-myosin heavy chain (alphaMHC) promoter. The early increased expression of survival kinases augments expansion of the cardiogenic CSC pool and subsequent daughter progeny. Normal CSCs engineered with fluorescent reporter protein constructs under control of the alphaMHC promoter show transgene protein expression, confirming activity of the promoter in CSCs. Cultured CSCs from both nontransgenic and cardiac-specific transgenic mice expressing survival kinases driven by the alphaMHC promoter were analyzed to characterize transgene expression following treatments to promote differentiation in culture. Therapeutic genes controlled by the alphaMHC promoter can be engineered into and expressed in CSCs and cardiomyocyte progeny with the goal of improving the efficacy of cardiac stem cell therapy.

Preventable effect of L-threonate, an ascorbate metabolite, on androgen-driven balding via repression of dihydrotestosterone-induced dickkopf-1 expression in human hair dermal papilla cells.

PubMed

Kwack, Mi Hee; Ahn, Ji Sup; Kim, Moon Kyu; Kim, Jung Chul; Sung, Young Kwan

2010-10-01

In a previous study, we recently claimed that dihydrotestosterone (DHT)-inducible dickkopf-1 (DKK-1) expression is one of the key factors involved in androgen-potentiated balding. We also demonstrated that L-ascorbic acid 2-phosphate (Asc 2-P) represses DHT-induced DKK-1 expression in cultured dermal papilla cells (DPCs). Here, we investigated whether or not L-threonate could attenuate DHT-induced DKK-1 expression. We observed via RT-PCR analysis and enzyme-linked immunosorbent assay that DHT-induced DKK-1 expression was attenuated in the presence of L-threonate. We also found that DHT-induced activation of DKK-1 promoter activity was significantly repressed by L-threonate. Moreover, a co-culture system featuring outer root sheath (ORS) keratinocytes and DPCs showed that DHT inhibited the growth of ORS cells, which was then significantly reversed by L-threonate. Collectively, these results indicate that L-threonate inhibited DKK-1 expression in DPCs and therefore is a good treatment for the prevention of androgen-driven balding.

v-Src-driven transformation is due to chromosome abnormalities but not Src-mediated growth signaling.

PubMed

Honda, Takuya; Morii, Mariko; Nakayama, Yuji; Suzuki, Ko; Yamaguchi, Noritaka; Yamaguchi, Naoto

2018-01-18

v-Src is the first identified oncogene product and has a strong tyrosine kinase activity. Much of the literature indicates that v-Src expression induces anchorage-independent and infinite cell proliferation through continuous stimulation of growth signaling by v-Src activity. Although all of v-Src-expressing cells are supposed to form transformed colonies, low frequencies of v-Src-induced colony formation have been observed so far. Using cells that exhibit high expression efficiencies of inducible v-Src, we show that v-Src expression causes cell-cycle arrest through p21 up-regulation despite ERK activation. v-Src expression also induces chromosome abnormalities and unexpected suppression of v-Src expression, leading to p21 down-regulation and ERK inactivation. Importantly, among v-Src-suppressed cells, only a limited number of cells gain the ability to re-proliferate and form transformed colonies. Our findings provide the first evidence that v-Src-driven transformation is attributed to chromosome abnormalities, but not continuous stimulation of growth signaling, possibly through stochastic genetic alterations.

Epithelial reticulon 4B (Nogo-B) is an endogenous regulator of Th2-driven lung inflammation

PubMed Central

Wright, Paulette L.; Yu, Jun; Di, Y.P. Peter; Homer, Robert J.; Chupp, Geoffrey; Elias, Jack A.; Cohn, Lauren

2010-01-01

Nogo-B is a member of the reticulon family of proteins (RTN-4B) that is highly expressed in lung tissue; however, its function remains unknown. We show that mice with Th2-driven lung inflammation results in a loss of Nogo expression in airway epithelium and smooth muscle compared with nonallergic mice, a finding which is replicated in severe human asthma. Mice lacking Nogo-A/B (Nogo-KO) display an exaggerated asthma-like phenotype, and epithelial reconstitution of Nogo-B in transgenic mice blunts Th2-mediated lung inflammation. Microarray analysis of lungs from Nogo-KO mice reveals a marked reduction in palate lung and nasal clone (PLUNC) gene expression, and the levels of PLUNC are enhanced in epithelial Nogo-B transgenic mice. Finally, transgenic expression of PLUNC into Nogo-KO mice rescues the enhanced asthmatic-like responsiveness in these KO mice. These data identify Nogo-B as a novel protective gene expressed in lung epithelia, and its expression regulates the levels of the antibacterial antiinflammatory protein PLUNC. PMID:20975041

Tradeoff between robustness and elaboration in carotenoid networks produces cycles of avian color diversification.

PubMed

Badyaev, Alexander V; Morrison, Erin S; Belloni, Virginia; Sanderson, Michael J

2015-08-20

Resolution of the link between micro- and macroevolution calls for comparing both processes on the same deterministic landscape, such as genomic, metabolic or fitness networks. We apply this perspective to the evolution of carotenoid pigmentation that produces spectacular diversity in avian colors and show that basic structural properties of the underlying carotenoid metabolic network are reflected in global patterns of elaboration and diversification in color displays. Birds color themselves by consuming and metabolizing several dietary carotenoids from the environment. Such fundamental dependency on the most upstream external compounds should intrinsically constrain sustained evolutionary elongation of multi-step metabolic pathways needed for color elaboration unless the metabolic network gains robustness - the ability to synthesize the same carotenoid from an additional dietary starting point. We found that gains and losses of metabolic robustness were associated with evolutionary cycles of elaboration and stasis in expressed carotenoids in birds. Lack of metabolic robustness constrained lineage's metabolic explorations to the immediate biochemical vicinity of their ecologically distinct dietary carotenoids, whereas gains of robustness repeatedly resulted in sustained elongation of metabolic pathways on evolutionary time scales and corresponding color elaboration. The structural link between length and robustness in metabolic pathways may explain periodic convergence of phylogenetically distant and ecologically distinct species in expressed carotenoid pigmentation; account for stasis in carotenoid colors in some ecological lineages; and show how the connectivity of the underlying metabolic network provides a mechanistic link between microevolutionary elaboration and macroevolutionary diversification.

Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Siqi; Joseph, Antony; Hammonds, Ann S.

Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set of Drosophila early embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identifiedmore » 21 principal patterns (PP). Providing a compact yet biologically interpretable representation of Drosophila expression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. In conclusion, the performance of PP with the Drosophila data suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.« less

Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks

DOE PAGES

Wu, Siqi; Joseph, Antony; Hammonds, Ann S.; ...

2016-04-06

Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set of Drosophila early embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identifiedmore » 21 principal patterns (PP). Providing a compact yet biologically interpretable representation of Drosophila expression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. In conclusion, the performance of PP with the Drosophila data suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.« less

Robustness of multidimensional Brownian ratchets as directed transport mechanisms.

PubMed

González-Candela, Ernesto; Romero-Rochín, Víctor; Del Río, Fernando

2011-08-07

Brownian ratchets have recently been considered as models to describe the ability of certain systems to locate very specific states in multidimensional configuration spaces. This directional process has particularly been proposed as an alternative explanation for the protein folding problem, in which the polypeptide is driven toward the native state by a multidimensional Brownian ratchet. Recognizing the relevance of robustness in biological systems, in this work we analyze such a property of Brownian ratchets by pushing to the limits all the properties considered essential to produce directed transport. Based on the results presented here, we can state that Brownian ratchets are able to deliver current and locate funnel structures under a wide range of conditions. As a result, they represent a simple model that solves the Levinthal's paradox with great robustness and flexibility and without requiring any ad hoc biased transition probability. The behavior of Brownian ratchets shown in this article considerably enhances the plausibility of the model for at least part of the structural mechanism behind protein folding process.

Threat driven modeling framework using petri nets for e-learning system.

PubMed

Khamparia, Aditya; Pandey, Babita

2016-01-01

Vulnerabilities at various levels are main cause of security risks in e-learning system. This paper presents a modified threat driven modeling framework, to identify the threats after risk assessment which requires mitigation and how to mitigate those threats. To model those threat mitigations aspects oriented stochastic petri nets are used. This paper included security metrics based on vulnerabilities present in e-learning system. The Common Vulnerability Scoring System designed to provide a normalized method for rating vulnerabilities which will be used as basis in metric definitions and calculations. A case study has been also proposed which shows the need and feasibility of using aspect oriented stochastic petri net models for threat modeling which improves reliability, consistency and robustness of the e-learning system.

XMM-Newton Proposal 03060602

NASA Astrophysics Data System (ADS)

Strickland, David

2004-10-01

We propose to observe 3 edge-on Milky-Way-like normal spiral galaxies in order to constrain the presence, properties and physical origin of hot gas in their halos, a topic about which relatively little is currently known. These observations will complete our sample of 8 edge-on normal spirals for which we have a wide range of existing observational data, so that all galaxies will have deep XMM-Newton and/or Chandra observations. With this sample we can assess the relative contribution to the halo X-ray emission of normal spirals from SNII-driven galactic fountains, accretion of primordial gas, and SNIa-driven outflows. The observations will robustly detect NGC 891-like hot halos, broadly quantify their properties, and can be used to constrain the efficiency of mechanical energy feedback.

31P NMR study of discrete time-crystalline signatures in an ordered crystal of ammonium dihydrogen phosphate

NASA Astrophysics Data System (ADS)

Rovny, Jared; Blum, Robert L.; Barrett, Sean E.

2018-05-01

The rich dynamics and phase structure of driven systems include the recently described phenomenon of the "discrete time crystal" (DTC), a robust phase which spontaneously breaks the discrete time translation symmetry of its driving Hamiltonian. Experiments in trapped ions and diamond nitrogen vacancy centers have recently shown evidence for this DTC order. Here, we show nuclear magnetic resonance (NMR) data of DTC behavior in a third, strikingly different, system: a highly ordered spatial crystal in three dimensions. We devise a DTC echo experiment to probe the coherence of the driven system. We examine potential decay mechanisms for the DTC oscillations, and demonstrate the important effect of the internal Hamiltonian during nonzero duration pulses.

Fluctuation-driven price dynamics and investment strategies

PubMed Central

Li, Yan; Zheng, Bo; Chen, Ting-Ting; Jiang, Xiong-Fei

2017-01-01

Investigation of the driven mechanism of the price dynamics in complex financial systems is important and challenging. In this paper, we propose an investment strategy to study how dynamic fluctuations drive the price movements. The strategy is successfully applied to different stock markets in the world, and the result indicates that the driving effect of the dynamic fluctuations is rather robust. We investigate how the strategy performance is influenced by the market states and optimize the strategy performance by introducing two parameters. The strategy is also compared with several typical technical trading rules. Our findings not only provide an investment strategy which extends investors’ profits, but also offer a useful method to look into the dynamic properties of complex financial systems. PMID:29240783

Fluctuation-driven price dynamics and investment strategies.

PubMed

Li, Yan; Zheng, Bo; Chen, Ting-Ting; Jiang, Xiong-Fei

2017-01-01

Investigation of the driven mechanism of the price dynamics in complex financial systems is important and challenging. In this paper, we propose an investment strategy to study how dynamic fluctuations drive the price movements. The strategy is successfully applied to different stock markets in the world, and the result indicates that the driving effect of the dynamic fluctuations is rather robust. We investigate how the strategy performance is influenced by the market states and optimize the strategy performance by introducing two parameters. The strategy is also compared with several typical technical trading rules. Our findings not only provide an investment strategy which extends investors' profits, but also offer a useful method to look into the dynamic properties of complex financial systems.

Explicit asymmetric bounds for robust stability of continuous and discrete-time systems

NASA Technical Reports Server (NTRS)

Gao, Zhiqiang; Antsaklis, Panos J.

1993-01-01

The problem of robust stability in linear systems with parametric uncertainties is considered. Explicit stability bounds on uncertain parameters are derived and expressed in terms of linear inequalities for continuous systems, and inequalities with quadratic terms for discrete-times systems. Cases where system parameters are nonlinear functions of an uncertainty are also examined.

ProteoLens: a visual analytic tool for multi-scale database-driven biological network data mining.

PubMed

Huan, Tianxiao; Sivachenko, Andrey Y; Harrison, Scott H; Chen, Jake Y

2008-08-12

New systems biology studies require researchers to understand how interplay among myriads of biomolecular entities is orchestrated in order to achieve high-level cellular and physiological functions. Many software tools have been developed in the past decade to help researchers visually navigate large networks of biomolecular interactions with built-in template-based query capabilities. To further advance researchers' ability to interrogate global physiological states of cells through multi-scale visual network explorations, new visualization software tools still need to be developed to empower the analysis. A robust visual data analysis platform driven by database management systems to perform bi-directional data processing-to-visualizations with declarative querying capabilities is needed. We developed ProteoLens as a JAVA-based visual analytic software tool for creating, annotating and exploring multi-scale biological networks. It supports direct database connectivity to either Oracle or PostgreSQL database tables/views, on which SQL statements using both Data Definition Languages (DDL) and Data Manipulation languages (DML) may be specified. The robust query languages embedded directly within the visualization software help users to bring their network data into a visualization context for annotation and exploration. ProteoLens supports graph/network represented data in standard Graph Modeling Language (GML) formats, and this enables interoperation with a wide range of other visual layout tools. The architectural design of ProteoLens enables the de-coupling of complex network data visualization tasks into two distinct phases: 1) creating network data association rules, which are mapping rules between network node IDs or edge IDs and data attributes such as functional annotations, expression levels, scores, synonyms, descriptions etc; 2) applying network data association rules to build the network and perform the visual annotation of graph nodes and edges according to associated data values. We demonstrated the advantages of these new capabilities through three biological network visualization case studies: human disease association network, drug-target interaction network and protein-peptide mapping network. The architectural design of ProteoLens makes it suitable for bioinformatics expert data analysts who are experienced with relational database management to perform large-scale integrated network visual explorations. ProteoLens is a promising visual analytic platform that will facilitate knowledge discoveries in future network and systems biology studies.

Robustness of remote stress detection from visible spectrum recordings

NASA Astrophysics Data System (ADS)

Kaur, Balvinder; Moses, Sophia; Luthra, Megha; Ikonomidou, Vasiliki N.

2016-05-01

In our recent work, we have shown that it is possible to extract high fidelity timing information of the cardiac pulse wave from visible spectrum videos, which can then be used as a basis for stress detection. In that approach, we used both heart rate variability (HRV) metrics and the differential pulse transit time (dPTT) as indicators of the presence of stress. One of the main concerns in this analysis is its robustness in the presence of noise, as the remotely acquired signal that we call blood wave (BW) signal is degraded with respect to the signal acquired using contact sensors. In this work, we discuss the robustness of our metrics in the presence of multiplicative noise. Specifically, we study the effects of subtle motion due to respiration and changes in illumination levels due to light flickering on the BW signal, the HRV-driven features, and the dPTT. Our sensitivity study involved both Monte Carlo simulations and experimental data from human facial videos, and indicates that our metrics are robust even under moderate amounts of noise. Generated results will help the remote stress detection community with developing requirements for visual spectrum based stress detection systems.

Vascular smooth muscle-specific knockdown of the noncardiac form of the L-type calcium channel by microRNA-based short hairpin RNA as a potential antihypertensive therapy.

PubMed

Rhee, Sung W; Stimers, Joseph R; Wang, Wenze; Pang, Li

2009-05-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (Ca(L)) current and vascular tone is increased because of increased expression of the noncardiac form of the Ca(L) (Ca(v)1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Ca(v)1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Ca(v)1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Ca(v)1.2 expression by 61% and decreased the Ca(L) current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Ca(v)1.2, it did not affect the Ca(L) expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Ca(v)1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Ca(v)1.2 siRNA without similarly affecting cardiac Ca(L) expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension.

Light directs zebrafish period2 expression via conserved D and E boxes.

PubMed

Vatine, Gad; Vallone, Daniela; Appelbaum, Lior; Mracek, Philipp; Ben-Moshe, Zohar; Lahiri, Kajori; Gothilf, Yoav; Foulkes, Nicholas S

2009-10-01

For most species, light represents the principal environmental signal for entraining the endogenous circadian clock. The zebrafish is a fascinating vertebrate model for studying this process since unlike mammals, direct exposure of most of its tissues to light leads to local clock entrainment. Importantly, light induces the expression of a set of genes including certain clock genes in most zebrafish cell types in vivo and in vitro. However, the mechanism linking light to gene expression remains poorly understood. To elucidate this key mechanism, here we focus on how light regulates transcription of the zebrafish period2 (per2) gene. Using transgenic fish and stably transfected cell line-based assays, we define a Light Responsive Module (LRM) within the per2 promoter. The LRM lies proximal to the transcription start site and is both necessary and sufficient for light-driven gene expression and also for a light-dependent circadian clock regulation. Curiously, the LRM sequence is strongly conserved in other vertebrate per2 genes, even in species lacking directly light-sensitive peripheral clocks. Furthermore, we reveal that the human LRM can substitute for the zebrafish LRM to confer light-regulated transcription in zebrafish cells. The LRM contains E- and D-box elements that are critical for its function. While the E-box directs circadian clock regulation by mediating BMAL/CLOCK activity, the D-box confers light-driven expression. The zebrafish homolog of the thyrotroph embryonic factor binds efficiently to the LRM D-box and transactivates expression. We demonstrate that tef mRNA levels are light inducible and that knock-down of tef expression attenuates light-driven transcription from the per2 promoter in vivo. Together, our results support a model where a light-dependent crosstalk between E- and D-box binding factors is a central determinant of per2 expression. These findings extend the general understanding of the mechanism whereby the clock is entrained by light and how the regulation of clock gene expression by light has evolved in vertebrates.

Vascular Smooth Muscle-Specific Knockdown of the Noncardiac Form of the L-Type Calcium Channel by MicroRNA-Based Short Hairpin RNA as a Potential Antihypertensive Therapy

PubMed Central

Rhee, Sung W.; Stimers, Joseph R.; Wang, Wenze; Pang, Li

2009-01-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (CaL) current and vascular tone is increased because of increased expression of the noncardiac form of the CaL (Cav1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Cav1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Cav1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Cav1.2 expression by 61% and decreased the CaL current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Cav1.2, it did not affect the CaL expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Cav1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Cav1.2 siRNA without similarly affecting cardiac CaL expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension. PMID:19244098

Altered entrainment to the day/night cycle attenuates the daily rise in circulating corticosterone in the mouse.

PubMed

Sollars, Patricia J; Weiser, Michael J; Kudwa, Andrea E; Bramley, Jayne R; Ogilvie, Malcolm D; Spencer, Robert L; Handa, Robert J; Pickard, Gary E

2014-01-01

The suprachiasmatic nucleus (SCN) is a circadian oscillator entrained to the day/night cycle via input from the retina. Serotonin (5-HT) afferents to the SCN modulate retinal signals via activation of 5-HT1B receptors, decreasing responsiveness to light. Consequently, 5-HT1B receptor knockout (KO) mice entrain to the day/night cycle with delayed activity onsets. Since circulating corticosterone levels exhibit a robust daily rhythm peaking around activity onset, we asked whether delayed entrainment of activity onsets affects rhythmic corticosterone secretion. Wheel-running activity and plasma corticosterone were monitored in mice housed under several different lighting regimens. Both duration of the light:dark cycle (T cycle) and the duration of light within that cycle was altered. 5-HT1B KO mice that entrained to a 9.5L:13.5D (short day in a T = 23 h) cycle with activity onsets delayed more than 4 h after light offset exhibited a corticosterone rhythm in phase with activity rhythms but reduced 50% in amplitude compared to animals that initiated daily activity <4 h after light offset. Wild type mice in 8L:14D (short day in a T = 22 h) conditions with highly delayed activity onsets also exhibited a 50% reduction in peak plasma corticosterone levels. Exogenous adrenocorticotropin (ACTH) stimulation in animals exhibiting highly delayed entrainment suggested that the endogenous rhythm of adrenal responsiveness to ACTH remained aligned with SCN-driven behavioral activity. Circadian clock gene expression in the adrenal cortex of these same animals suggested that the adrenal circadian clock was also aligned with SCN-driven behavior. Under T cycles <24 h, altered circadian entrainment to short day (winter-like) conditions, manifest as long delays in activity onset after light offset, severely reduces the amplitude of the diurnal rhythm of plasma corticosterone. Such a pronounced reduction in the glucocorticoid rhythm may alter rhythmic gene expression in the central nervous system and in peripheral organs contributing to an array of potential pathophysiologies.

Altered Entrainment to the Day/Night Cycle Attenuates the Daily Rise in Circulating Corticosterone in the Mouse

PubMed Central

Sollars, Patricia J.; Weiser, Michael J.; Kudwa, Andrea E.; Bramley, Jayne R.; Ogilvie, Malcolm D.; Spencer, Robert L.; Handa, Robert J.; Pickard, Gary E.

2014-01-01

The suprachiasmatic nucleus (SCN) is a circadian oscillator entrained to the day/night cycle via input from the retina. Serotonin (5-HT) afferents to the SCN modulate retinal signals via activation of 5-HT1B receptors, decreasing responsiveness to light. Consequently, 5-HT1B receptor knockout (KO) mice entrain to the day/night cycle with delayed activity onsets. Since circulating corticosterone levels exhibit a robust daily rhythm peaking around activity onset, we asked whether delayed entrainment of activity onsets affects rhythmic corticosterone secretion. Wheel-running activity and plasma corticosterone were monitored in mice housed under several different lighting regimens. Both duration of the light∶dark cycle (T cycle) and the duration of light within that cycle was altered. 5-HT1B KO mice that entrained to a 9.5L:13.5D (short day in a T = 23 h) cycle with activity onsets delayed more than 4 h after light offset exhibited a corticosterone rhythm in phase with activity rhythms but reduced 50% in amplitude compared to animals that initiated daily activity <4 h after light offset. Wild type mice in 8L:14D (short day in a T = 22 h) conditions with highly delayed activity onsets also exhibited a 50% reduction in peak plasma corticosterone levels. Exogenous adrenocorticotropin (ACTH) stimulation in animals exhibiting highly delayed entrainment suggested that the endogenous rhythm of adrenal responsiveness to ACTH remained aligned with SCN-driven behavioral activity. Circadian clock gene expression in the adrenal cortex of these same animals suggested that the adrenal circadian clock was also aligned with SCN-driven behavior. Under T cycles <24 h, altered circadian entrainment to short day (winter-like) conditions, manifest as long delays in activity onset after light offset, severely reduces the amplitude of the diurnal rhythm of plasma corticosterone. Such a pronounced reduction in the glucocorticoid rhythm may alter rhythmic gene expression in the central nervous system and in peripheral organs contributing to an array of potential pathophysiologies. PMID:25365210

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

PubMed Central

Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

2015-01-01

Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

Digital transcriptome profiling of normal and glioblastoma-derived neural stem cells identifies genes associated with patient survival

PubMed Central

2012-01-01

Background Glioblastoma multiforme, the most common type of primary brain tumor in adults, is driven by cells with neural stem (NS) cell characteristics. Using derivation methods developed for NS cells, it is possible to expand tumorigenic stem cells continuously in vitro. Although these glioblastoma-derived neural stem (GNS) cells are highly similar to normal NS cells, they harbor mutations typical of gliomas and initiate authentic tumors following orthotopic xenotransplantation. Here, we analyzed GNS and NS cell transcriptomes to identify gene expression alterations underlying the disease phenotype. Methods Sensitive measurements of gene expression were obtained by high-throughput sequencing of transcript tags (Tag-seq) on adherent GNS cell lines from three glioblastoma cases and two normal NS cell lines. Validation by quantitative real-time PCR was performed on 82 differentially expressed genes across a panel of 16 GNS and 6 NS cell lines. The molecular basis and prognostic relevance of expression differences were investigated by genetic characterization of GNS cells and comparison with public data for 867 glioma biopsies. Results Transcriptome analysis revealed major differences correlated with glioma histological grade, and identified misregulated genes of known significance in glioblastoma as well as novel candidates, including genes associated with other malignancies or glioma-related pathways. This analysis further detected several long non-coding RNAs with expression profiles similar to neighboring genes implicated in cancer. Quantitative PCR validation showed excellent agreement with Tag-seq data (median Pearson r = 0.91) and discerned a gene set robustly distinguishing GNS from NS cells across the 22 lines. These expression alterations include oncogene and tumor suppressor changes not detected by microarray profiling of tumor tissue samples, and facilitated the identification of a GNS expression signature strongly associated with patient survival (P = 1e-6, Cox model). Conclusions These results support the utility of GNS cell cultures as a model system for studying the molecular processes driving glioblastoma and the use of NS cells as reference controls. The association between a GNS expression signature and survival is consistent with the hypothesis that a cancer stem cell component drives tumor growth. We anticipate that analysis of normal and malignant stem cells will be an important complement to large-scale profiling of primary tumors. PMID:23046790

IL-27 driven upregulation of surface HLA-E expression on monocytes inhibits IFN-γ release by autologous NK cells.

PubMed

Morandi, Fabio; Airoldi, Irma; Pistoia, Vito

2014-01-01

HLA-G and HLA-E are HLA-Ib molecules with several immunoregulatory properties. Their cell surface expression can be modulated by different cytokines. Since IL-27 and IL-30 may either stimulate or regulate immune responses, we have here tested whether these cytokines may modulate HLA-G and -E expression and function on human monocytes. Monocytes expressed gp130 and WSX-1, the two chains of IL27 receptor (R), and IL6Rα (that serves as IL-30R, in combination with gp130). However, only IL27R appeared to be functional, as witnessed by IL-27 driven STAT1/ STAT3 phosphorylation. IL-27, but not IL-30, significantly upregulated HLA-E (but not HLA-G) expression on monocytes. IFN-γ; secretion by activated NK cells was dampened when the latter cells were cocultured with IL-27 pretreated autologous monocytes. Such effect was not achieved using untreated or IL-30 pretreated monocytes, thus indicating that IL-27 driven HLA-E upregulation might be involved, possibly through the interaction of this molecule with CD94/NKG2A inhibitory receptor on NK cells. In contrast, cytotoxic granules release by NK cell in response to K562 cells was unaffected in the presence of IL-27 pretreated monocytes. In conclusion, we delineated a novel immunoregulatory function of IL-27 involving HLA-E upregulation on monocytes that might in turn indirectly impair some NK cell functions.

Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks.

PubMed

Wu, Siqi; Joseph, Antony; Hammonds, Ann S; Celniker, Susan E; Yu, Bin; Frise, Erwin

2016-04-19

Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set ofDrosophilaearly embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identified 21 principal patterns (PP). Providing a compact yet biologically interpretable representation ofDrosophilaexpression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. The performance of PP with theDrosophiladata suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.

Identification of novel and robust internal control genes from Volvariella volvacea that are suitable for RT-qPCR in filamentous fungi.

PubMed

Tao, Yongxin; van Peer, Arend Frans; Huang, Qianhui; Shao, Yanping; Zhang, Lei; Xie, Bin; Jiang, Yuji; Zhu, Jian; Xie, Baogui

2016-07-12

The selection of appropriate internal control genes (ICGs) is a crucial step in the normalization of real-time quantitative PCR (RT-qPCR) data. Housekeeping genes are habitually selected for this purpose, despite accumulating evidence on their instability. We screened for novel, robust ICGs in the mushroom forming fungus Volvariella volvacea. Nine commonly used and five newly selected ICGs were evaluated for expression stability using RT-qPCR data in eight different stages of the life cycle of V. volvacea. Three different algorithms consistently determined that three novel ICGs (SPRYp, Ras and Vps26) exhibited the highest expression stability in V. volvacea. Subsequent analysis of ICGs in twenty-four expression profiles from nine filamentous fungi revealed that Ras was the most stable ICG amongst the Basidiomycetous samples, followed by SPRYp, Vps26 and ACTB. Vps26 was expressed most stably within the analyzed data of Ascomycetes, followed by HH3 and β-TUB. No ICG was universally stable for all fungal species, or for all experimental conditions within a species. Ultimately, the choice of an ICG will depend on a specific set of experiments. This study provides novel, robust ICGs for Basidiomycetes and Ascomycetes. Together with the presented guiding principles, this enables the efficient selection of suitable ICGs for RT-qPCR.

Discovering mutated driver genes through a robust and sparse co-regularized matrix factorization framework with prior information from mRNA expression patterns and interaction network.

PubMed

Xi, Jianing; Wang, Minghui; Li, Ao

2018-06-05

Discovery of mutated driver genes is one of the primary objective for studying tumorigenesis. To discover some relatively low frequently mutated driver genes from somatic mutation data, many existing methods incorporate interaction network as prior information. However, the prior information of mRNA expression patterns are not exploited by these existing network-based methods, which is also proven to be highly informative of cancer progressions. To incorporate prior information from both interaction network and mRNA expressions, we propose a robust and sparse co-regularized nonnegative matrix factorization to discover driver genes from mutation data. Furthermore, our framework also conducts Frobenius norm regularization to overcome overfitting issue. Sparsity-inducing penalty is employed to obtain sparse scores in gene representations, of which the top scored genes are selected as driver candidates. Evaluation experiments by known benchmarking genes indicate that the performance of our method benefits from the two type of prior information. Our method also outperforms the existing network-based methods, and detect some driver genes that are not predicted by the competing methods. In summary, our proposed method can improve the performance of driver gene discovery by effectively incorporating prior information from interaction network and mRNA expression patterns into a robust and sparse co-regularized matrix factorization framework.

A laser pointer driven microheater for precise local heating and conditional gene regulation in vivo. Microheater driven gene regulation in zebrafish.

PubMed

Placinta, Mike; Shen, Meng-Chieh; Achermann, Marc; Karlstrom, Rolf O

2009-12-30

Tissue heating has been employed to study a variety of biological processes, including the study of genes that control embryonic development. Conditional regulation of gene expression is a particularly powerful approach for understanding gene function. One popular method for mis-expressing a gene of interest employs heat-inducible heat shock protein (hsp) promoters. Global heat shock of hsp-promoter-containing transgenic animals induces gene expression throughout all tissues, but does not allow for spatial control. Local heating allows for spatial control of hsp-promoter-driven transgenes, but methods for local heating are cumbersome and variably effective. We describe a simple, highly controllable, and versatile apparatus for heating biological tissue and other materials on the micron-scale. This microheater employs micron-scale fiber optics and uses an inexpensive laser-pointer as a power source. Optical fibers can be pulled on a standard electrode puller to produce tips of varying sizes that can then be used to reliably heat 20-100 mum targets. We demonstrate precise spatiotemporal control of hsp70l:GFP transgene expression in a variety of tissue types in zebrafish embryos and larvae. We also show how this system can be employed as part of a new method for lineage tracing that would greatly facilitate the study of organogenesis and tissue regulation at any time in the life cycle. This versatile and simple local heater has broad utility for the study of gene function and for lineage tracing. This system could be used to control hsp-driven gene expression in any organism simply by bringing the fiber optic tip in contact with the tissue of interest. Beyond these uses for the study of gene function, this device has wide-ranging utility in materials science and could easily be adapted for therapeutic purposes in humans.

Goal-Driven Autonomy and Robust Architecture for Long-Duration Missions (Year 1: 1 July 2013 - 31 July 2014)

DTIC Science & Technology

2014-09-30

Mental Domain = Ω Goal Management goal change goal input World =Ψ Memory Mission & Goals( ) World Model (-Ψ) Episodic Memory Semantic Memory ...Activations Trace Meta-Level Control Introspective Monitoring Memory Reasoning Trace ( ) Strategies Episodic Memory Metaknowledge Self Model...it is from incorrect or missing memory associations (i.e., indices). Similarly, correct information may exist in the input stream, but may not be

Mechanistic Basis for Biological Polymer Stability, Electron Transfer and Molecular Sensing in Extreme Environments

DTIC Science & Technology

2015-12-02

electrically driven CO2 fixation. Many different types of extremophiles are known that are robust and resistant to heat or DISTRIBUTION A: Distribution...Metabolic and photosynthetic consequences of blocking starch biosynthesis in the green alga Chlamydomonas reinhardtii sta6 mutant. Plant Journal 81...photosynthetic consequences of blocking starch biosynthesis in the green alga Chlamydomonas reinhardtii sta6 mutant. Plant Journal 81, 947-960

Investigating Criterial Discourse Features across Second Language Development: Lexical Bundles in Rated Learner Essays, CEFR B1, B2 and C1

ERIC Educational Resources Information Center

Chen, Yu-Hua; Baker, Paul

2016-01-01

In this study, we investigated criterial discourse features in L2 writing through the use of recurrent word combinations, a.k.a. lexical bundles, taking a corpus-driven and expert-judged approach by examining L2 English data across various proficiency levels from L1 Chinese learners. Proficiency was determined by a robust rating procedure which is…

A Semiautomated Framework for Integrating Expert Knowledge into Disease Marker Identification

DOE PAGES

Wang, Jing; Webb-Robertson, Bobbie-Jo M.; Matzke, Melissa M.; ...

2013-01-01

Background . The availability of large complex data sets generated by high throughput technologies has enabled the recent proliferation of disease biomarker studies. However, a recurring problem in deriving biological information from large data sets is how to best incorporate expert knowledge into the biomarker selection process. Objective . To develop a generalizable framework that can incorporate expert knowledge into data-driven processes in a semiautomated way while providing a metric for optimization in a biomarker selection scheme. Methods . The framework was implemented as a pipeline consisting of five components for the identification of signatures from integrated clustering (ISIC). Expertmore » knowledge was integrated into the biomarker identification process using the combination of two distinct approaches; a distance-based clustering approach and an expert knowledge-driven functional selection. Results . The utility of the developed framework ISIC was demonstrated on proteomics data from a study of chronic obstructive pulmonary disease (COPD). Biomarker candidates were identified in a mouse model using ISIC and validated in a study of a human cohort. Conclusions . Expert knowledge can be introduced into a biomarker discovery process in different ways to enhance the robustness of selected marker candidates. Developing strategies for extracting orthogonal and robust features from large data sets increases the chances of success in biomarker identification.« less

A Semiautomated Framework for Integrating Expert Knowledge into Disease Marker Identification

PubMed Central

Wang, Jing; Webb-Robertson, Bobbie-Jo M.; Matzke, Melissa M.; Varnum, Susan M.; Brown, Joseph N.; Riensche, Roderick M.; Adkins, Joshua N.; Jacobs, Jon M.; Hoidal, John R.; Scholand, Mary Beth; Pounds, Joel G.; Blackburn, Michael R.; Rodland, Karin D.; McDermott, Jason E.

2013-01-01

Background. The availability of large complex data sets generated by high throughput technologies has enabled the recent proliferation of disease biomarker studies. However, a recurring problem in deriving biological information from large data sets is how to best incorporate expert knowledge into the biomarker selection process. Objective. To develop a generalizable framework that can incorporate expert knowledge into data-driven processes in a semiautomated way while providing a metric for optimization in a biomarker selection scheme. Methods. The framework was implemented as a pipeline consisting of five components for the identification of signatures from integrated clustering (ISIC). Expert knowledge was integrated into the biomarker identification process using the combination of two distinct approaches; a distance-based clustering approach and an expert knowledge-driven functional selection. Results. The utility of the developed framework ISIC was demonstrated on proteomics data from a study of chronic obstructive pulmonary disease (COPD). Biomarker candidates were identified in a mouse model using ISIC and validated in a study of a human cohort. Conclusions. Expert knowledge can be introduced into a biomarker discovery process in different ways to enhance the robustness of selected marker candidates. Developing strategies for extracting orthogonal and robust features from large data sets increases the chances of success in biomarker identification. PMID:24223463

A Semiautomated Framework for Integrating Expert Knowledge into Disease Marker Identification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jing; Webb-Robertson, Bobbie-Jo M.; Matzke, Melissa M.

2013-10-01

Background. The availability of large complex data sets generated by high throughput technologies has enabled the recent proliferation of disease biomarker studies. However, a recurring problem in deriving biological information from large data sets is how to best incorporate expert knowledge into the biomarker selection process. Objective. To develop a generalizable framework that can incorporate expert knowledge into data-driven processes in a semiautomated way while providing a metric for optimization in a biomarker selection scheme. Methods. The framework was implemented as a pipeline consisting of five components for the identification of signatures from integrated clustering (ISIC). Expert knowledge was integratedmore » into the biomarker identification process using the combination of two distinct approaches; a distance-based clustering approach and an expert knowledge-driven functional selection. Results. The utility of the developed framework ISIC was demonstrated on proteomics data from a study of chronic obstructive pulmonary disease (COPD). Biomarker candidates were identified in a mouse model using ISIC and validated in a study of a human cohort. Conclusions. Expert knowledge can be introduced into a biomarker discovery process in different ways to enhance the robustness of selected marker candidates. Developing strategies for extracting orthogonal and robust features from large data sets increases the chances of success in biomarker identification.« less

A computational framework for estimating statistical power and planning hypothesis-driven experiments involving one-dimensional biomechanical continua.

PubMed

Pataky, Todd C; Robinson, Mark A; Vanrenterghem, Jos

2018-01-03

Statistical power assessment is an important component of hypothesis-driven research but until relatively recently (mid-1990s) no methods were available for assessing power in experiments involving continuum data and in particular those involving one-dimensional (1D) time series. The purpose of this study was to describe how continuum-level power analyses can be used to plan hypothesis-driven biomechanics experiments involving 1D data. In particular, we demonstrate how theory- and pilot-driven 1D effect modeling can be used for sample-size calculations for both single- and multi-subject experiments. For theory-driven power analysis we use the minimum jerk hypothesis and single-subject experiments involving straight-line, planar reaching. For pilot-driven power analysis we use a previously published knee kinematics dataset. Results show that powers on the order of 0.8 can be achieved with relatively small sample sizes, five and ten for within-subject minimum jerk analysis and between-subject knee kinematics, respectively. However, the appropriate sample size depends on a priori justifications of biomechanical meaning and effect size. The main advantage of the proposed technique is that it encourages a priori justification regarding the clinical and/or scientific meaning of particular 1D effects, thereby robustly structuring subsequent experimental inquiry. In short, it shifts focus from a search for significance to a search for non-rejectable hypotheses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Customizing microarrays for neuroscience drug discovery.

PubMed

Girgenti, Matthew J; Newton, Samuel S

2007-08-01

Microarray-based gene profiling has become the centerpiece of gene expression studies in the biological sciences. The ability to now interrogate the entire genome using a single chip demonstrates the progress in technology and instrumentation that has been made over the last two decades. Although this unbiased approach provides researchers with an immense quantity of data, obtaining meaningful insight is not possible without intensive data analysis and processing. Custom developed arrays have emerged as a viable and attractive alternative that can take advantage of this robust technology and tailor it to suit the needs and requirements of individual investigations. The ability to simplify data analysis, reduce noise and carefully optimize experimental conditions makes it a suitable tool that can be effectively utilized in neuroscience drug discovery efforts. Furthermore, incorporating recent advancements in fine focusing gene profiling to include specific cellular phenotypes can help resolve the complex cellular heterogeneity of the brain. This review surveys the use of microarray technology in neuroscience paying special attention to customized arrays and their potential in drug discovery. Novel applications of microarrays and ancillary techniques, such as laser microdissection, FAC sorting and RNA amplification, have also been discussed. The notion that a hypothesis-driven approach can be integrated into drug development programs is highlighted.

A damped oscillator imposes temporal order on posterior gap gene expression in Drosophila.

PubMed

Verd, Berta; Clark, Erik; Wotton, Karl R; Janssens, Hilde; Jiménez-Guri, Eva; Crombach, Anton; Jaeger, Johannes

2018-02-01

Insects determine their body segments in two different ways. Short-germband insects, such as the flour beetle Tribolium castaneum, use a molecular clock to establish segments sequentially. In contrast, long-germband insects, such as the vinegar fly Drosophila melanogaster, determine all segments simultaneously through a hierarchical cascade of gene regulation. Gap genes constitute the first layer of the Drosophila segmentation gene hierarchy, downstream of maternal gradients such as that of Caudal (Cad). We use data-driven mathematical modelling and phase space analysis to show that shifting gap domains in the posterior half of the Drosophila embryo are an emergent property of a robust damped oscillator mechanism, suggesting that the regulatory dynamics underlying long- and short-germband segmentation are much more similar than previously thought. In Tribolium, Cad has been proposed to modulate the frequency of the segmentation oscillator. Surprisingly, our simulations and experiments show that the shift rate of posterior gap domains is independent of maternal Cad levels in Drosophila. Our results suggest a novel evolutionary scenario for the short- to long-germband transition and help explain why this transition occurred convergently multiple times during the radiation of the holometabolan insects.

A damped oscillator imposes temporal order on posterior gap gene expression in Drosophila

PubMed Central

Verd, Berta; Clark, Erik; Wotton, Karl R.; Janssens, Hilde; Jiménez-Guri, Eva; Crombach, Anton

2018-01-01

Insects determine their body segments in two different ways. Short-germband insects, such as the flour beetle Tribolium castaneum, use a molecular clock to establish segments sequentially. In contrast, long-germband insects, such as the vinegar fly Drosophila melanogaster, determine all segments simultaneously through a hierarchical cascade of gene regulation. Gap genes constitute the first layer of the Drosophila segmentation gene hierarchy, downstream of maternal gradients such as that of Caudal (Cad). We use data-driven mathematical modelling and phase space analysis to show that shifting gap domains in the posterior half of the Drosophila embryo are an emergent property of a robust damped oscillator mechanism, suggesting that the regulatory dynamics underlying long- and short-germband segmentation are much more similar than previously thought. In Tribolium, Cad has been proposed to modulate the frequency of the segmentation oscillator. Surprisingly, our simulations and experiments show that the shift rate of posterior gap domains is independent of maternal Cad levels in Drosophila. Our results suggest a novel evolutionary scenario for the short- to long-germband transition and help explain why this transition occurred convergently multiple times during the radiation of the holometabolan insects. PMID:29451884

Influencing Mechanism of Ocean Acidification on Byssus Performance in the Pearl Oyster Pinctada fucata.

PubMed

Li, Shiguo; Liu, Chuang; Zhan, Aibin; Xie, Liping; Zhang, Rongqing

2017-07-05

The byssus is an important adhesive structure by which bivalves robustly adhere to underwater substrates. It is susceptible to carbon dioxide-driven ocean acidification (OA). Previous investigations have documented significant adverse effects of OA on the performance of byssal threads, but the mechanisms remain largely unknown. In this study, multiple approaches were employed to reveal the underlying mechanisms for the effects of OA on byssus production and mechanical properties in the pearl oyster Pinctada fucata. The results showed that OA altered the abundance and secondary structure of byssal proteins and affected the contents of metal ions in distal threads, which together reduced the byssus diameter and amplified byssus nanocavity, causing reductions in mechanical properties (strength and extensibility). Expression analysis of key foot protein genes further confirmed changes in byssal protein abundance. Moreover, comparative transcriptome analysis revealed enrichment of ion transportation- and apoptosis-related categories, up-regulation of apoptosis-related pathways, and down-regulation of the "extracellular matrix-receptor interaction" pathway, which may influence foot locomotion physiology, leading to a decrease in byssus production. This study provides mechanistic insight into the effects of OA on pearl oyster byssus, which should broaden our overall understanding of the impacts of OA on marine ecosystem.

Six hydrophobins are involved in hydrophobin rodlet formation in Aspergillus nidulans and contribute to hydrophobicity of the spore surface.

PubMed

Grünbacher, André; Throm, Tanja; Seidel, Constanze; Gutt, Beatrice; Röhrig, Julian; Strunk, Timo; Vincze, Paul; Walheim, Stefan; Schimmel, Thomas; Wenzel, Wolfgang; Fischer, Reinhard

2014-01-01

Hydrophobins are amphiphilic proteins able to self-assemble at water-air interphases and are only found in filamentous fungi. In Aspergillus nidulans two hydrophobins, RodA and DewA, have been characterized, which both localize on the conidiospore surface and contribute to its hydrophobicity. RodA is the constituent protein of very regularly arranged rodlets, 10 nm in diameter. Here we analyzed four more hydrophobins, DewB-E, in A. nidulans and found that all six hydrophobins contribute to the hydrophobic surface of the conidiospores but only deletion of rodA caused loss of the rodlet structure. Analysis of the rodlets in the dewB-E deletion strains with atomic force microscopy revealed that the rodlets appeared less robust. Expression of DewA and DewB driven from the rodA promoter and secreted with the RodA secretion signal in a strain lacking RodA, restored partly the hydrophobicity. DewA and B were able to form rodlets to some extent but never reached the rodlet structure of RodA. The rodlet-lacking rodA-deletion strain opens the possibility to systematically study rodlet formation of other natural or synthetic hydrophobins.

Six Hydrophobins Are Involved in Hydrophobin Rodlet Formation in Aspergillus nidulans and Contribute to Hydrophobicity of the Spore Surface

PubMed Central

Seidel, Constanze; Gutt, Beatrice; Röhrig, Julian; Strunk, Timo; Vincze, Paul; Walheim, Stefan; Schimmel, Thomas; Wenzel, Wolfgang; Fischer, Reinhard

2014-01-01

Hydrophobins are amphiphilic proteins able to self-assemble at water-air interphases and are only found in filamentous fungi. In Aspergillus nidulans two hydrophobins, RodA and DewA, have been characterized, which both localize on the conidiospore surface and contribute to its hydrophobicity. RodA is the constituent protein of very regularly arranged rodlets, 10 nm in diameter. Here we analyzed four more hydrophobins, DewB-E, in A. nidulans and found that all six hydrophobins contribute to the hydrophobic surface of the conidiospores but only deletion of rodA caused loss of the rodlet structure. Analysis of the rodlets in the dewB-E deletion strains with atomic force microscopy revealed that the rodlets appeared less robust. Expression of DewA and DewB driven from the rodA promoter and secreted with the RodA secretion signal in a strain lacking RodA, restored partly the hydrophobicity. DewA and B were able to form rodlets to some extent but never reached the rodlet structure of RodA. The rodlet-lacking rodA-deletion strain opens the possibility to systematically study rodlet formation of other natural or synthetic hydrophobins. PMID:24722460

PD-L1 is an activation-independent marker of brown adipocytes.

PubMed

Ingram, Jessica R; Dougan, Michael; Rashidian, Mohammad; Knoll, Marko; Keliher, Edmund J; Garrett, Sarah; Garforth, Scott; Blomberg, Olga S; Espinosa, Camilo; Bhan, Atul; Almo, Steven C; Weissleder, Ralph; Lodish, Harvey; Dougan, Stephanie K; Ploegh, Hidde L

2017-09-21

Programmed death ligand 1 (PD-L1) is expressed on a number of immune and cancer cells, where it can downregulate antitumor immune responses. Its expression has been linked to metabolic changes in these cells. Here we develop a radiolabeled camelid single-domain antibody (anti-PD-L1 VHH) to track PD-L1 expression by immuno-positron emission tomography (PET). PET-CT imaging shows a robust and specific PD-L1 signal in brown adipose tissue (BAT). We confirm expression of PD-L1 on brown adipocytes and demonstrate that signal intensity does not change in response to cold exposure or β-adrenergic activation. This is the first robust method of visualizing murine brown fat independent of its activation state.Current approaches to visualise brown adipose tissue (BAT) rely primarily on markers that reflect its metabolic activity. Here, the authors show that PD-L1 is expressed on brown adipocytes, does not change upon BAT activation, and that BAT volume in mice can be measured by PET-CT with a radiolabeled anti-PD-L1 antibody.

Decentralized Formation Flying Control in a Multiple-Team Hierarchy

NASA Technical Reports Server (NTRS)

Mueller, Joseph .; Thomas, Stephanie J.

2005-01-01

This paper presents the prototype of a system that addresses these objectives-a decentralized guidance and control system that is distributed across spacecraft using a multiple-team framework. The objective is to divide large clusters into teams of manageable size, so that the communication and computational demands driven by N decentralized units are related to the number of satellites in a team rather than the entire cluster. The system is designed to provide a high-level of autonomy, to support clusters with large numbers of satellites, to enable the number of spacecraft in the cluster to change post-launch, and to provide for on-orbit software modification. The distributed guidance and control system will be implemented in an object-oriented style using MANTA (Messaging Architecture for Networking and Threaded Applications). In this architecture, tasks may be remotely added, removed or replaced post-launch to increase mission flexibility and robustness. This built-in adaptability will allow software modifications to be made on-orbit in a robust manner. The prototype system, which is implemented in MATLAB, emulates the object-oriented and message-passing features of the MANTA software. In this paper, the multiple-team organization of the cluster is described, and the modular software architecture is presented. The relative dynamics in eccentric reference orbits is reviewed, and families of periodic, relative trajectories are identified, expressed as sets of static geometric parameters. The guidance law design is presented, and an example reconfiguration scenario is used to illustrate the distributed process of assigning geometric goals to the cluster. Next, a decentralized maneuver planning approach is presented that utilizes linear-programming methods to enact reconfiguration and coarse formation keeping maneuvers. Finally, a method for performing online collision avoidance is discussed, and an example is provided to gauge its performance.

Tyrosine-mutant AAV8 delivery of human MERTK provides long-term retinal preservation in RCS rats.

PubMed

Deng, Wen-Tao; Dinculescu, Astra; Li, Qiuhong; Boye, Sanford L; Li, Jie; Gorbatyuk, Marina S; Pang, Jijing; Chiodo, Vince A; Matthes, Michael T; Yasumura, Douglas; Liu, Li; Alkuraya, Fowzan S; Zhang, Kang; Vollrath, Douglas; LaVail, Matthew M; Hauswirth, William W

2012-04-06

The absence of Mertk in RCS rats results in defective RPE phagocytosis, accumulation of outer segment (OS) debris in the subretinal space, and subsequent death of photoreceptors. Previous research utilizing Mertk gene replacement therapy in RCS rats provided proof of concept for treatment of this form of recessive retinitis pigmentosa (RP); however, the beneficial effects on retinal function were transient. In the present study, we evaluated whether delivery of a MERTK transgene using a tyrosine-mutant AAV8 capsid could lead to more robust and longer-term therapeutic outcomes than previously reported. An AAV8 Y733F vector expressing a human MERTK cDNA driven by a RPE-selective promoter was administrated subretinally at postnatal day 2. Functional and morphological analyses were performed at 4 months and 8 months post-treatment. Retinal vasculature and Müller cell activation were analyzed by quantifying acellular capillaries and glial fibrillary acidic protein immunostaining, respectively. Electroretinographic responses from treated eyes were more than one-third of wild-type levels and OS were well preserved in the injection area even at 8 months. Rescue of RPE phagocytosis, prevention of retinal vasculature degeneration, and inhibition of Müller cell activation were demonstrated in the treated eyes for at least 8 months. This research describes a longer and much more robust functional and morphological rescue than previous studies. We also demonstrate for the first time that an AAV8 mutant capsid serotype vector has a substantial therapeutic potential for RPE-specific gene delivery. These results suggest that tyrosine-mutant AAV8 vectors hold promise for the treatment of individuals with MERTK-associated RP.

Tyrosine-Mutant AAV8 Delivery of Human MERTK Provides Long-Term Retinal Preservation in RCS Rats

PubMed Central

Deng, Wen-Tao; Dinculescu, Astra; Li, Qiuhong; Boye, Sanford L.; Li, Jie; Gorbatyuk, Marina S.; Pang, Jijing; Chiodo, Vince A.; Matthes, Michael T.; Yasumura, Douglas; Liu, Li; Alkuraya, Fowzan S.; Zhang, Kang; Vollrath, Douglas; LaVail, Matthew M.; Hauswirth, William W.

2012-01-01

Purpose. The absence of Mertk in RCS rats results in defective RPE phagocytosis, accumulation of outer segment (OS) debris in the subretinal space, and subsequent death of photoreceptors. Previous research utilizing Mertk gene replacement therapy in RCS rats provided proof of concept for treatment of this form of recessive retinitis pigmentosa (RP); however, the beneficial effects on retinal function were transient. In the present study, we evaluated whether delivery of a MERTK transgene using a tyrosine-mutant AAV8 capsid could lead to more robust and longer-term therapeutic outcomes than previously reported. Methods. An AAV8 Y733F vector expressing a human MERTK cDNA driven by a RPE-selective promoter was administrated subretinally at postnatal day 2. Functional and morphological analyses were performed at 4 months and 8 months post-treatment. Retinal vasculature and Müller cell activation were analyzed by quantifying acellular capillaries and glial fibrillary acidic protein immunostaining, respectively. Results. Electroretinographic responses from treated eyes were more than one-third of wild-type levels and OS were well preserved in the injection area even at 8 months. Rescue of RPE phagocytosis, prevention of retinal vasculature degeneration, and inhibition of Müller cell activation were demonstrated in the treated eyes for at least 8 months. Conclusions. This research describes a longer and much more robust functional and morphological rescue than previous studies. We also demonstrate for the first time that an AAV8 mutant capsid serotype vector has a substantial therapeutic potential for RPE-specific gene delivery. These results suggest that tyrosine-mutant AAV8 vectors hold promise for the treatment of individuals with MERTK-associated RP. PMID:22408006

Boundedness and global robust stability analysis of delayed complex-valued neural networks with interval parameter uncertainties.

PubMed

Song, Qiankun; Yu, Qinqin; Zhao, Zhenjiang; Liu, Yurong; Alsaadi, Fuad E

2018-07-01

In this paper, the boundedness and robust stability for a class of delayed complex-valued neural networks with interval parameter uncertainties are investigated. By using Homomorphic mapping theorem, Lyapunov method and inequality techniques, sufficient condition to guarantee the boundedness of networks and the existence, uniqueness and global robust stability of equilibrium point is derived for the considered uncertain neural networks. The obtained robust stability criterion is expressed in complex-valued LMI, which can be calculated numerically using YALMIP with solver of SDPT3 in MATLAB. An example with simulations is supplied to show the applicability and advantages of the acquired result. Copyright © 2018 Elsevier Ltd. All rights reserved.

Moving Faces

ERIC Educational Resources Information Center

Journal of College Science Teaching, 2005

2005-01-01

A recent study by Zara Ambadar and Jeffrey F. Cohn of the University of Pittsburgh and Jonathan W. Schooler of the University of British Columbia, examined how motion affects people's judgment of subtle facial expressions. Two experiments demonstrated robust effects of motion in facilitating the perception of subtle facial expressions depicting…

Evaluation of two outlier-detection-based methods for detecting tissue-selective genes from microarray data.

PubMed

Kadota, Koji; Konishi, Tomokazu; Shimizu, Kentaro

2007-05-01

Large-scale expression profiling using DNA microarrays enables identification of tissue-selective genes for which expression is considerably higher and/or lower in some tissues than in others. Among numerous possible methods, only two outlier-detection-based methods (an AIC-based method and Sprent's non-parametric method) can treat equally various types of selective patterns, but they produce substantially different results. We investigated the performance of these two methods for different parameter settings and for a reduced number of samples. We focused on their ability to detect selective expression patterns robustly. We applied them to public microarray data collected from 36 normal human tissue samples and analyzed the effects of both changing the parameter settings and reducing the number of samples. The AIC-based method was more robust in both cases. The findings confirm that the use of the AIC-based method in the recently proposed ROKU method for detecting tissue-selective expression patterns is correct and that Sprent's method is not suitable for ROKU.

A Novel Persistence Associated EBV miRNA Expression Profile Is Disrupted in Neoplasia

PubMed Central

Qiu, Jin; Cosmopoulos, Katherine; Pegtel, Michiel; Hopmans, Erik; Murray, Paul; Middeldorp, Jaap; Shapiro, Michael; Thorley-Lawson, David A.

2011-01-01

We have performed the first extensive profiling of Epstein-Barr virus (EBV) miRNAs on in vivo derived normal and neoplastic infected tissues. We describe a unique pattern of viral miRNA expression by normal infected cells in vivo expressing restricted viral latency programs (germinal center: Latency II and memory B: Latency I/0). This includes the complete absence of 15 of the 34 miRNAs profiled. These consist of 12 BART miRNAs (including approximately half of Cluster 2) and 3 of the 4 BHRF1 miRNAs. All but 2 of these absent miRNAs become expressed during EBV driven growth (Latency III). Furthermore, EBV driven growth is accompanied by a 5–10 fold down regulation in the level of the BART miRNAs expressed in germinal center and memory B cells. Therefore, Latency III also expresses a unique pattern of viral miRNAs. We refer to the miRNAs that are specifically expressed in EBV driven growth as the Latency III associated miRNAs. In EBV associated tumors that employ Latency I or II (Burkitt's lymphoma, Hodgkin's disease, nasopharyngeal carcinoma and gastric carcinoma), the Latency III associated BART but not BHRF1 miRNAs are up regulated. Thus BART miRNA expression is deregulated in the EBV associated tumors. This is the first demonstration that Latency III specific genes (the Latency III associated BARTs) can be expressed in these tumors. The EBV associated tumors demonstrate very similar patterns of miRNA expression yet were readily distinguished when the expression data were analyzed either by heat-map/clustering or principal component analysis. Systematic analysis revealed that the information distinguishing the tumor types was redundant and distributed across all the miRNAs. This resembles “secret sharing” algorithms where information can be distributed among a large number of recipients in such a way that any combination of a small number of recipients is able to understand the message. Biologically, this may be a consequence of functional redundancy between the miRNAs. PMID:21901094

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity.

PubMed

Caddell, Daniel F; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C

2015-05-05

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21 , recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas , and confers robust resistance to X. oryzae pv. oryzae ( Xoo ). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21 . Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression.

The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity

PubMed Central

Caddell, Daniel F.; Wei, Tong; Park, Chang-Jin; Ronald, Pamela C.

2016-01-01

Inducible gene expression systems offer researchers the opportunity to synchronize target gene expression at particular developmental stages and in particular tissues. The glucocorticoid receptor (GR), a vertebrate steroid receptor, has been well adopted for this purpose in plants. To generate steroid-inducible plants, a construct of GAL4-binding domain-VP16 activation domain-GR fusion (GVG) with the target gene under the control of upstream activation sequence (UAS) has been developed and extensively used in plant research. Immune receptors perceive conserved molecular patterns secreted by pathogens and initiate robust immune responses. The rice immune receptor, XA21, recognizes a molecular pattern highly conserved in all sequenced genomes of Xanthomonas, and confers robust resistance to X. oryzae pv. oryzae (Xoo). However, identifying genes downstream of XA21 has been hindered because of the restrained lesion and thus limited defense response region in the plants expressing Xa21. Inducible expression allows for a synchronized immune response across a large amount of rice tissue, well suited for studying XA21-mediated immunity by genome-wide approaches such as transcriptomics and proteomics. In this protocol, we describe the use of this GVG system to synchronize Xa21 expression. PMID:27525297

An Automated Pipeline for Engineering Many-Enzyme Pathways: Computational Sequence Design, Pathway Expression-Flux Mapping, and Scalable Pathway Optimization.

PubMed

Halper, Sean M; Cetnar, Daniel P; Salis, Howard M

2018-01-01

Engineering many-enzyme metabolic pathways suffers from the design curse of dimensionality. There are an astronomical number of synonymous DNA sequence choices, though relatively few will express an evolutionary robust, maximally productive pathway without metabolic bottlenecks. To solve this challenge, we have developed an integrated, automated computational-experimental pipeline that identifies a pathway's optimal DNA sequence without high-throughput screening or many cycles of design-build-test. The first step applies our Operon Calculator algorithm to design a host-specific evolutionary robust bacterial operon sequence with maximally tunable enzyme expression levels. The second step applies our RBS Library Calculator algorithm to systematically vary enzyme expression levels with the smallest-sized library. After characterizing a small number of constructed pathway variants, measurements are supplied to our Pathway Map Calculator algorithm, which then parameterizes a kinetic metabolic model that ultimately predicts the pathway's optimal enzyme expression levels and DNA sequences. Altogether, our algorithms provide the ability to efficiently map the pathway's sequence-expression-activity space and predict DNA sequences with desired metabolic fluxes. Here, we provide a step-by-step guide to applying the Pathway Optimization Pipeline on a desired multi-enzyme pathway in a bacterial host.

Tumor-Like Stem Cells Derived from Human Keloid Are Governed by the Inflammatory Niche Driven by IL-17/IL-6 Axis

PubMed Central

Zhang, Qunzhou; Yamaza, Takayoshi; Kelly, A. Paul; Shi, Shihong; Wang, Songlin; Brown, Jimmy; Wang, Lina; French, Samuel W.; Shi, Songtao; Le, Anh D.

2009-01-01

Background Alterations in the stem cell niche are likely to contribute to tumorigenesis; however, the concept of niche promoted benign tumor growth remains to be explored. Here we use keloid, an exuberant fibroproliferative dermal growth unique to human skin, as a model to characterize benign tumor-like stem cells and delineate the role of their “pathological” niche in the development of the benign tumor. Methods and Findings Subclonal assay, flow cytometric and multipotent differentiation analyses demonstrate that keloid contains a new population of stem cells, named keloid derived precursor cells (KPCs), which exhibit clonogenicity, self-renewal, distinct embryonic and mesenchymal stem cell surface markers, and multipotent differentiation. KPCs display elevated telomerase activity and an inherently upregulated proliferation capability as compared to their peripheral normal skin counterparts. A robust elevation of IL-6 and IL-17 expression in keloid is confirmed by cytokine array, western blot and ELISA analyses. The altered biological functions are tightly regulated by the inflammatory niche mediated by an autocrine/paracrine cytokine IL-17/IL-6 axis. Utilizing KPCs transplanted subcutaneously in immunocompromised mice we generate for the first time a human keloid-like tumor model that is driven by the in vivo inflammatory niche and allows testing of the anti-tumor therapeutic effect of antibodies targeting distinct niche components, specifically IL-6 and IL-17. Conclusions/Significance These findings support our hypothesis that the altered niche in keloids, predominantly inflammatory, contributes to the acquirement of a benign tumor-like stem cell phenotype of KPCs characterized by the uncontrolled self-renewal and increased proliferation, supporting the rationale for in vivo modification of the “pathological” stem cell niche as a novel therapy for keloid and other mesenchymal benign tumors. PMID:19907660

Effector cell signature in peripheral blood following nasal allergen challenge in grass pollen allergic individuals.

PubMed

Shamji, M H; Bellido, V; Scadding, G W; Layhadi, J A; Cheung, D K M; Calderon, M A; Asare, A; Gao, Z; Turka, L A; Tchao, N; Togias, A; Phippard, D; Durham, S R

2015-02-01

Several studies have demonstrated the time course of inflammatory mediators in nasal fluids following nasal allergen challenge (NAC), whereas the effects of NAC on cells in the periphery are unknown. We examined the time course of effector cell markers (for basophils, dendritic cells and T cells) in peripheral blood after nasal grass pollen allergen challenge. Twelve participants with seasonal allergic rhinitis underwent a control (diluent) challenge followed by NAC after an interval of 14 days. Nasal symptoms and peak nasal inspiratory flow (PNIF) were recorded along with peripheral basophil, T-cell and dendritic cell responses (flow cytometry), T-cell proliferative responses (thymidine incorporation), and cytokine expression (FluoroSpot assay). Robust increases in nasal symptoms and decreases in PNIF were observed during the early (0-1 h) response and modest significant changes during the late (1-24 h) response. Sequential peaks in peripheral blood basophil activation markers were observed (CD107a at 3 h, CD63 at 6 h, and CD203c(bright) at 24 h). T effector/memory cells (CD4(+) CD25(lo) ) were increased at 6 h and accompanied by increases in CD80(+) and CD86(+) plasmacytoid dendritic cells (pDCs). Ex vivo grass antigen-driven T-cell proliferative responses and the frequency of IL-4(+) CD4(+) T cells were significantly increased at 6 h after NAC when compared to the control day. Basophil, T-cell, and dendritic cell activation increased the frequency of allergen-driven IL-4(+) CD4(+) T cells, and T-cell proliferative responses are detectable in the periphery after NAC. These data confirm systemic cellular activation following a local nasal provocation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Image analysis driven single-cell analytics for systems microbiology.

PubMed

Balomenos, Athanasios D; Tsakanikas, Panagiotis; Aspridou, Zafiro; Tampakaki, Anastasia P; Koutsoumanis, Konstantinos P; Manolakos, Elias S

2017-04-04

Time-lapse microscopy is an essential tool for capturing and correlating bacterial morphology and gene expression dynamics at single-cell resolution. However state-of-the-art computational methods are limited in terms of the complexity of cell movies that they can analyze and lack of automation. The proposed Bacterial image analysis driven Single Cell Analytics (BaSCA) computational pipeline addresses these limitations thus enabling high throughput systems microbiology. BaSCA can segment and track multiple bacterial colonies and single-cells, as they grow and divide over time (cell segmentation and lineage tree construction) to give rise to dense communities with thousands of interacting cells in the field of view. It combines advanced image processing and machine learning methods to deliver very accurate bacterial cell segmentation and tracking (F-measure over 95%) even when processing images of imperfect quality with several overcrowded colonies in the field of view. In addition, BaSCA extracts on the fly a plethora of single-cell properties, which get organized into a database summarizing the analysis of the cell movie. We present alternative ways to analyze and visually explore the spatiotemporal evolution of single-cell properties in order to understand trends and epigenetic effects across cell generations. The robustness of BaSCA is demonstrated across different imaging modalities and microscopy types. BaSCA can be used to analyze accurately and efficiently cell movies both at a high resolution (single-cell level) and at a large scale (communities with many dense colonies) as needed to shed light on e.g. how bacterial community effects and epigenetic information transfer play a role on important phenomena for human health, such as biofilm formation, persisters' emergence etc. Moreover, it enables studying the role of single-cell stochasticity without losing sight of community effects that may drive it.

Catchments as non-linear filters: evaluating data-driven approaches for spatio-temporal predictions in ungauged basins

NASA Astrophysics Data System (ADS)

Bellugi, D. G.; Tennant, C.; Larsen, L.

2016-12-01

Catchment and climate heterogeneity complicate prediction of runoff across time and space, and resulting parameter uncertainty can lead to large accumulated errors in hydrologic models, particularly in ungauged basins. Recently, data-driven modeling approaches have been shown to avoid the accumulated uncertainty associated with many physically-based models, providing an appealing alternative for hydrologic prediction. However, the effectiveness of different methods in hydrologically and geomorphically distinct catchments, and the robustness of these methods to changing climate and changing hydrologic processes remain to be tested. Here, we evaluate the use of machine learning techniques to predict daily runoff across time and space using only essential climatic forcing (e.g. precipitation, temperature, and potential evapotranspiration) time series as model input. Model training and testing was done using a high quality dataset of daily runoff and climate forcing data for 25+ years for 600+ minimally-disturbed catchments (drainage area range 5-25,000 km2, median size 336 km2) that cover a wide range of climatic and physical characteristics. Preliminary results using Support Vector Regression (SVR) suggest that in some catchments this nonlinear-based regression technique can accurately predict daily runoff, while the same approach fails in other catchments, indicating that the representation of climate inputs and/or catchment filter characteristics in the model structure need further refinement to increase performance. We bolster this analysis by using Sparse Identification of Nonlinear Dynamics (a sparse symbolic regression technique) to uncover the governing equations that describe runoff processes in catchments where SVR performed well and for ones where it performed poorly, thereby enabling inference about governing processes. This provides a robust means of examining how catchment complexity influences runoff prediction skill, and represents a contribution towards the integration of data-driven inference and physically-based models.

Diffusion pseudotime robustly reconstructs lineage branching.

PubMed

Haghverdi, Laleh; Büttner, Maren; Wolf, F Alexander; Buettner, Florian; Theis, Fabian J

2016-10-01

The temporal order of differentiating cells is intrinsically encoded in their single-cell expression profiles. We describe an efficient way to robustly estimate this order according to diffusion pseudotime (DPT), which measures transitions between cells using diffusion-like random walks. Our DPT software implementations make it possible to reconstruct the developmental progression of cells and identify transient or metastable states, branching decisions and differentiation endpoints.

Gene Expression Signatures Based on Variability can Robustly Predict Tumor Progression and Prognosis

PubMed Central

Dinalankara, Wikum; Bravo, Héctor Corrada

2015-01-01

Gene expression signatures are commonly used to create cancer prognosis and diagnosis methods, yet only a small number of them are successfully deployed in the clinic since many fail to replicate performance on subsequent validation. A primary reason for this lack of reproducibility is the fact that these signatures attempt to model the highly variable and unstable genomic behavior of cancer. Our group recently introduced gene expression anti-profiles as a robust methodology to derive gene expression signatures based on the observation that while gene expression measurements are highly heterogeneous across tumors of a specific cancer type relative to the normal tissue, their degree of deviation from normal tissue expression in specific genes involved in tissue differentiation is a stable tumor mark that is reproducible across experiments and cancer types. Here we show that constructing gene expression signatures based on variability and the anti-profile approach yields classifiers capable of successfully distinguishing benign growths from cancerous growths based on deviation from normal expression. We then show that this same approach generates stable and reproducible signatures that predict probability of relapse and survival based on tumor gene expression. These results suggest that using the anti-profile framework for the discovery of genomic signatures is an avenue leading to the development of reproducible signatures suitable for adoption in clinical settings. PMID:26078586

GOexpress: an R/Bioconductor package for the identification and visualisation of robust gene ontology signatures through supervised learning of gene expression data.

PubMed

Rue-Albrecht, Kévin; McGettigan, Paul A; Hernández, Belinda; Nalpas, Nicolas C; Magee, David A; Parnell, Andrew C; Gordon, Stephen V; MacHugh, David E

2016-03-11

Identification of gene expression profiles that differentiate experimental groups is critical for discovery and analysis of key molecular pathways and also for selection of robust diagnostic or prognostic biomarkers. While integration of differential expression statistics has been used to refine gene set enrichment analyses, such approaches are typically limited to single gene lists resulting from simple two-group comparisons or time-series analyses. In contrast, functional class scoring and machine learning approaches provide powerful alternative methods to leverage molecular measurements for pathway analyses, and to compare continuous and multi-level categorical factors. We introduce GOexpress, a software package for scoring and summarising the capacity of gene ontology features to simultaneously classify samples from multiple experimental groups. GOexpress integrates normalised gene expression data (e.g., from microarray and RNA-seq experiments) and phenotypic information of individual samples with gene ontology annotations to derive a ranking of genes and gene ontology terms using a supervised learning approach. The default random forest algorithm allows interactions between all experimental factors, and competitive scoring of expressed genes to evaluate their relative importance in classifying predefined groups of samples. GOexpress enables rapid identification and visualisation of ontology-related gene panels that robustly classify groups of samples and supports both categorical (e.g., infection status, treatment) and continuous (e.g., time-series, drug concentrations) experimental factors. The use of standard Bioconductor extension packages and publicly available gene ontology annotations facilitates straightforward integration of GOexpress within existing computational biology pipelines.

GUS expression in sweet oranges (Citrus sinensis L. Osbeck) driven by three different phloem-specific promoters.

PubMed

Miyata, Luzia Yuriko; Harakava, Ricardo; Stipp, Liliane Cristina Libório; Mendes, Beatriz Madalena Januzzi; Appezzato-da-Glória, Beatriz; de Assis Alves Mourão Filho, Francisco

2012-11-01

Huanglongbing (HLB) is associated with Candidatus Liberibacter spp., endogenous, sieve tube-restricted bacteria that are transmitted by citrus psyllid insect vectors. Transgenic expression in the phloem of specific genes that might affect Ca. Liberibacter spp. growth and development may be an adequate strategy to improve citrus resistance to HLB. To study specific phloem gene expression in citrus, we developed three different binary vector constructs with expression cassettes bearing the β-glucuronidase (GUS) reporter gene (uidA) under the control of one of the three different promoters: Citrus phloem protein 2 (CsPP2), Arabidopsis thaliana phloem protein 2 (AtPP2), and Arabidopsis thaliana sucrose transporter 2 (AtSUC2). Transgenic lines of 'Hamlin', 'Pera', and 'Valencia' sweet oranges [Citrus sinensis (L.) Osbeck] were produced via Agrobacterium tumefaciens transformation. The epicotyl segments collected from in vitro germinated seedlings were used as explants. The gene nptII, which confers resistance to the antibiotic kanamycin, was used for selection. The transformation efficiency was expressed as the number of GUS-positive shoots over the total number of explants and varied from 1.54 to 6.08 % among the three cultivars and three constructs studied. Several lines of the three sweet orange cultivars analyzed using PCR and Southern blot analysis were genetically transformed with the three constructs evaluated. The histological GUS activity in the leaves indicates that the uidA gene was preferentially expressed in the phloem, which suggests that the use of the three promoters might be adequate for producing HLB-resistant transgenic sweet oranges. The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters. Key message The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters.

A systems immunology approach identifies the collective impact of 5 miRs in Th2 inflammation.

PubMed

Kılıç, Ayşe; Santolini, Marc; Nakano, Taiji; Schiller, Matthias; Teranishi, Mizue; Gellert, Pascal; Ponomareva, Yuliya; Braun, Thomas; Uchida, Shizuka; Weiss, Scott T; Sharma, Amitabh; Renz, Harald

2018-06-07

Allergic asthma is a chronic inflammatory disease dominated by a CD4+ T helper 2 (Th2) cell signature. The immune response amplifies in self-enforcing loops, promoting Th2-driven cellular immunity and leaving the host unable to terminate inflammation. Posttranscriptional mechanisms, including microRNAs (miRs), are pivotal in maintaining immune homeostasis. Since an altered expression of various miRs has been associated with T cell-driven diseases, including asthma, we hypothesized that miRs control mechanisms ensuring Th2 stability and maintenance in the lung. We isolated murine CD4+ Th2 cells from allergic inflamed lungs and profiled gene and miR expression. Instead of focusing on the magnitude of miR differential expression, here we addressed the secondary consequences for the set of molecular interactions in the cell, the interactome. We developed the Impact of Differential Expression Across Layers, a network-based algorithm to prioritize disease-relevant miRs based on the central role of their targets in the molecular interactome. This method identified 5 Th2-related miRs (mir27b, mir206, mir106b, mir203, and mir23b) whose antagonization led to a sharp reduction of the Th2 phenotype. Overall, a systems biology tool was developed and validated, highlighting the role of miRs in Th2-driven immune response. This result offers potentially novel approaches for therapeutic interventions.

A zebrafish model of chordoma initiated by notochord-driven expression of HRASV12

PubMed Central

Burger, Alexa; Vasilyev, Aleksandr; Tomar, Ritu; Selig, Martin K.; Nielsen, G. Petur; Peterson, Randall T.; Drummond, Iain A.; Haber, Daniel A.

2014-01-01

Chordoma is a malignant tumor thought to arise from remnants of the embryonic notochord, with its origin in the bones of the axial skeleton. Surgical resection is the standard treatment, usually in combination with radiation therapy, but neither chemotherapeutic nor targeted therapeutic approaches have demonstrated success. No animal model and only few chordoma cell lines are available for preclinical drug testing, and, although no druggable genetic drivers have been identified, activation of EGFR and downstream AKT-PI3K pathways have been described. Here, we report a zebrafish model of chordoma, based on stable transgene-driven expression of HRASV12 in notochord cells during development. Extensive intra-notochordal tumor formation is evident within days of transgene expression, ultimately leading to larval death. The zebrafish tumors share characteristics of human chordoma as demonstrated by immunohistochemistry and electron microscopy. The mTORC1 inhibitor rapamycin, which has some demonstrated activity in a chordoma cell line, delays the onset of tumor formation in our zebrafish model, and improves survival of tumor-bearing fish. Consequently, the HRASV12-driven zebrafish model of chordoma could enable high-throughput screening of potential therapeutic agents for the treatment of this refractory cancer. PMID:24311731

Laser pulse shape design for laser-indirect-driven quasi-isentropic compression experiments

NASA Astrophysics Data System (ADS)

Xue, Quanxi; Jiang, Shaoen; Wang, Zhebin; Wang, Feng; Zhao, Xueqing; Ding, Yongkun

2018-02-01

Laser pulse shape design is a key work in the design of indirect-laser-driven experiments, especially for long pulse laser driven quasi-isentropic compression experiments. A method for designing such a laser pulse shape is given here. What's more, application experiments were performed, and the results of a typical shot are presented. At last of this article, the details of the application of the method are discussed, such as the equation parameter choice, radiation ablation pressure expression, and approximations in the method. The application shows that the method can provide reliable descriptions of the energy distribution in a hohlraum target; thus, it can be used in the design of long-pulse laser driven quasi-isentropic compression experiments and even other indirect-laser-driven experiments.

Robust and efficient estimation with weighted composite quantile regression

NASA Astrophysics Data System (ADS)

Jiang, Xuejun; Li, Jingzhi; Xia, Tian; Yan, Wanfeng

2016-09-01

In this paper we introduce a weighted composite quantile regression (CQR) estimation approach and study its application in nonlinear models such as exponential models and ARCH-type models. The weighted CQR is augmented by using a data-driven weighting scheme. With the error distribution unspecified, the proposed estimators share robustness from quantile regression and achieve nearly the same efficiency as the oracle maximum likelihood estimator (MLE) for a variety of error distributions including the normal, mixed-normal, Student's t, Cauchy distributions, etc. We also suggest an algorithm for the fast implementation of the proposed methodology. Simulations are carried out to compare the performance of different estimators, and the proposed approach is used to analyze the daily S&P 500 Composite index, which verifies the effectiveness and efficiency of our theoretical results.

HIFU Transducer Characterization Using a Robust Needle Hydrophone

NASA Astrophysics Data System (ADS)

Howard, Samuel M.; Zanelli, Claudio I.

2007-05-01

A robust needle hydrophone has been developed for HIFU transducer characterization and reported on earlier. After a brief review of the hydrophone design and performance, we demonstrate its use to characterize a 1.5 MHz, 10 cm diameter, F-number 1.5 spherically focused source driven to exceed an intensity of 1400 W/cm2at its focus. Quantitative characterization of this source at high powers is assisted by deconvolving the hydrophone's calibrated frequency response in order to accurately reflect the contribution of harmonics generated by nonlinear propagation in the water testing environment. Results are compared to measurements with a membrane hydrophone at 0.3% duty cycle and to theoretical calculations, using measurements of the field at the source's radiating surface as input to a numerical solution of the KZK equation.

Temporal Order in Periodically Driven Spins in Star-Shaped Clusters

NASA Astrophysics Data System (ADS)

Pal, Soham; Nishad, Naveen; Mahesh, T. S.; Sreejith, G. J.

2018-05-01

We experimentally study the response of star-shaped clusters of initially unentangled N =4 , 10, and 37 nuclear spin-1 /2 moments to an inexact π -pulse sequence and show that an Ising coupling between the center and the satellite spins results in robust period-2 magnetization oscillations. The period is stable against bath effects, but the amplitude decays with a timescale that depends on the inexactness of the pulse. Simulations reveal a semiclassical picture in which the rigidity of the period is due to a randomizing effect of the Larmor precession under the magnetization of surrounding spins. The timescales with stable periodicity increase with net initial magnetization, even in the presence of perturbations, indicating a robust temporal ordered phase for large systems with finite magnetization per spin.

Interface for Light-Driven Electron Transfer by Photosynthetic Complexes Across Block Copolymer Membranes.

PubMed

Kuang, Liangju; Olson, Tien L; Lin, Su; Flores, Marco; Jiang, Yunjiang; Zheng, Wan; Williams, JoAnn C; Allen, James P; Liang, Hongjun

2014-03-06

Incorporation of membrane proteins into nanodevices to mediate recognition and transport in a collective and scalable fashion remains a challenging problem. We demonstrate how nanoscale photovoltaics could be designed using robust synthetic nanomembranes with incorporated photosynthetic reaction centers (RCs). Specifically, RCs from Rhodobacter sphaeroides are reconstituted spontaneously into rationally designed polybutadiene membranes to form hierarchically organized proteopolymer membrane arrays via a charge-interaction-directed reconstitution mechanism. Once incorporated, the RCs are fully active for prolonged periods based upon a variety of spectroscopic measurements, underscoring preservation of their 3D pigment configuration critical for light-driven charge transfer. This result provides a strategy to construct solar conversion devices using structurally versatile proteopolymer membranes with integrated RC functions to harvest broad regions of the solar spectrum.

Extreme learning machine for reduced order modeling of turbulent geophysical flows.

PubMed

San, Omer; Maulik, Romit

2018-04-01

We investigate the application of artificial neural networks to stabilize proper orthogonal decomposition-based reduced order models for quasistationary geophysical turbulent flows. An extreme learning machine concept is introduced for computing an eddy-viscosity closure dynamically to incorporate the effects of the truncated modes. We consider a four-gyre wind-driven ocean circulation problem as our prototype setting to assess the performance of the proposed data-driven approach. Our framework provides a significant reduction in computational time and effectively retains the dynamics of the full-order model during the forward simulation period beyond the training data set. Furthermore, we show that the method is robust for larger choices of time steps and can be used as an efficient and reliable tool for long time integration of general circulation models.

Optically driven self-oscillations of a silica nanospike at low gas pressures

NASA Astrophysics Data System (ADS)

Xie, Shangran; Pennetta, Riccardo; Noskov, Roman E.; Russell, Philip St. J.

2016-09-01

We report light-driven instability and optomechanical self-oscillation of a fused silica "nanospike" at low gas pressures. The nanospike (tip diameter 400 nm), fabricated by thermally tapering and HF-etching a single mode fiber (SMF), was set pointing at the endface of a hollow-core photonic crystal fiber (HC-PCF) into the field created by the fundamental optical mode emerging from the HC-PCF. At low pressures, the nanospike became unstable and began to self-oscillate for optical powers above a certain threshold, acting like a phonon laser or "phaser". Because the nanospike is robustly connected to the base, direct measurement of the temporal dynamics of the instability is possible. The experiment sheds light on why particles escape from optical traps at low pressures.

Extreme learning machine for reduced order modeling of turbulent geophysical flows

NASA Astrophysics Data System (ADS)

San, Omer; Maulik, Romit

2018-04-01

We investigate the application of artificial neural networks to stabilize proper orthogonal decomposition-based reduced order models for quasistationary geophysical turbulent flows. An extreme learning machine concept is introduced for computing an eddy-viscosity closure dynamically to incorporate the effects of the truncated modes. We consider a four-gyre wind-driven ocean circulation problem as our prototype setting to assess the performance of the proposed data-driven approach. Our framework provides a significant reduction in computational time and effectively retains the dynamics of the full-order model during the forward simulation period beyond the training data set. Furthermore, we show that the method is robust for larger choices of time steps and can be used as an efficient and reliable tool for long time integration of general circulation models.

Data-driven outbreak forecasting with a simple nonlinear growth model

PubMed Central

Lega, Joceline; Brown, Heidi E.

2016-01-01

Recent events have thrown the spotlight on infectious disease outbreak response. We developed a data-driven method, EpiGro, which can be applied to cumulative case reports to estimate the order of magnitude of the duration, peak and ultimate size of an ongoing outbreak. It is based on a surprisingly simple mathematical property of many epidemiological data sets, does not require knowledge or estimation of disease transmission parameters, is robust to noise and to small data sets, and runs quickly due to its mathematical simplicity. Using data from historic and ongoing epidemics, we present the model. We also provide modeling considerations that justify this approach and discuss its limitations. In the absence of other information or in conjunction with other models, EpiGro may be useful to public health responders. PMID:27770752

Human Papillomavirus Drives Tumor Development Throughout the Head and Neck: Improved Prognosis Is Associated With an Immune Response Largely Restricted to the Oropharynx

PubMed Central

Chakravarthy, Ankur; Henderson, Stephen; Thirdborough, Stephen M.; Ottensmeier, Christian H.; Su, Xiaoping; Lechner, Matt; Feber, Andrew; Thomas, Gareth J.

2016-01-01

Purpose In squamous cell carcinomas of the head and neck (HNSCC), the increasing incidence of oropharyngeal squamous cell carcinomas (OPSCCs) is attributable to human papillomavirus (HPV) infection. Despite commonly presenting at late stage, HPV-driven OPSCCs are associated with improved prognosis compared with HPV-negative disease. HPV DNA is also detectable in nonoropharyngeal (non-OPSCC), but its pathogenic role and clinical significance are unclear. The objectives of this study were to determine whether HPV plays a causal role in non-OPSCC and to investigate whether HPV confers a survival benefit in these tumors. Methods Meta-analysis was used to build a cross-tissue gene-expression signature for HPV-driven cancer. Classifiers trained by machine-learning approaches were used to predict the HPV status of 520 HNSCCs profiled by The Cancer Genome Atlas project. DNA methylation data were similarly used to classify 464 HNSCCs and these analyses were integrated with genomic, histopathology, and survival data to permit a comprehensive comparison of HPV transcript-positive OPSCC and non-OPSCC. Results HPV-driven tumors accounted for 4.1% of non-OPSCCs. Regardless of anatomic site, HPV+ HNSCCs shared highly similar gene expression and DNA methylation profiles; nonkeratinizing, basaloid histopathological features; and lack of TP53 or CDKN2A alterations. Improved overall survival, however, was largely restricted to HPV-driven OPSCCs, which were associated with increased levels of tumor-infiltrating lymphocytes compared with HPV-driven non-OPSCCs. Conclusion Our analysis identified a causal role for HPV in transcript-positive non-OPSCCs throughout the head and neck. Notably, however, HPV-driven non-OPSCCs display a distinct immune microenvironment and clinical behavior compared with HPV-driven OPSCCs. PMID:27863190

Model-driven Service Engineering with SoaML

NASA Astrophysics Data System (ADS)

Elvesæter, Brian; Carrez, Cyril; Mohagheghi, Parastoo; Berre, Arne-Jørgen; Johnsen, Svein G.; Solberg, Arnor

This chapter presents a model-driven service engineering (MDSE) methodology that uses OMG MDA specifications such as BMM, BPMN and SoaML to identify and specify services within a service-oriented architecture. The methodology takes advantage of business modelling practices and provides a guide to service modelling with SoaML. The presentation is case-driven and illuminated using the telecommunication example. The chapter focuses in particular on the use of the SoaML modelling language as a means for expressing service specifications that are aligned with business models and can be realized in different platform technologies.

Expression, subcellular localization and regulation of sigma receptor in retinal Müller cells

PubMed Central

Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P.; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Purpose Sigma receptors (σR) are non-opioid, non-phencyclidine binding sites with robust neuroprotective properties. σR1 is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity and regulation of σR1 in retinal Müller cells. Methods Primary mouse Müller cells (1°MC) were analyzed by RT-PCR, immunoblotting and immunocytochemistry for the expression of σR1 and data were compared to the rat Müller cell line, rMC-1 and rat ganglion cell line, RGC-5. Confocal microscopy was used to determine the subcellular σR1 location in 1°MC. Membranes prepared from these cells were used for binding assays using [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various σR1 ligands to compete with σR1 binding and the effects of nitric oxide (NO) and reactive oxygen species (ROS) donors on binding were examined. Results σR1 is expressed in 1°MC and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in 1°MCs, rMC-1 and RGC-5 cells, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells and the binding was similarly robust in 1°MC. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of σR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased σR1 binding activity. Conclusions Müller cells express σR1 and demonstrate robust σR1 binding activity, which is inhibited by σR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind σR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy. PMID:17122151

Expression, subcellular localization, and regulation of sigma receptor in retinal muller cells.

PubMed

Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B

2006-12-01

Sigma receptors (sigmaRs) are nonopioid, nonphencyclidine binding sites with robust neuroprotective properties. Type 1 sigmaR1 (sigmaR1) is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity, and regulation of sigmaR1 in retinal Müller cells. Primary mouse Müller cells (MCs) were analyzed by RT-PCR, immunoblotting, and immunocytochemistry for the expression of sigmaR1, and data were compared with those of the rat Müller cell line (rMC-1) and the rat ganglion cell line (RGC-5). Confocal microscopy was used to determine the subcellular sigmaR1 location in primary mouse MCs. Membranes prepared from these cells were used for binding assays with [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various sigmaR1 ligands to compete with sigmaR1 binding, and the effects of donated nitric oxide (NO) and reactive oxygen species (ROS) on binding were examined. sigmaR1 is expressed in primary mouse MCs and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in primary mouse MCs, rMC-1, and RGC-5, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells, and the binding was similarly robust in primary mouse MCs. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of sigmaR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased sigmaR1 binding activity. MCs express sigmaR1 and demonstrate robust sigmaR1 binding activity, which is inhibited by sigmaR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind sigmaR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy.

Facial expressions perceived by the adolescent brain: Towards the proficient use of low spatial frequency information.

PubMed

Peters, Judith C; Kemner, Chantal

2017-10-01

Rapid decoding of emotional expressions is essential for social communication. Fast processing of facial expressions depends on the adequate (subcortical) processing of important global face cues in the low spatial frequency (LSF) ranges. However, children below 9 years of age extract fearful expression information from local details represented by high SF (HSF) image content. Our ERP study investigated at which developmental stage this ineffective HSF-driven processing is replaced by the proficient and rapid LSF-driven perception of fearful faces, in which adults are highly skilled. We examined behavioral and neural responses to high- and low-pass filtered faces with a fearful or neutral expression in groups of children on the verge of pre-adolescence (9-10 years), adolescents (14-15 years), and young adults (20-28 years). Our results suggest that the neural emotional face processing network has a protracted maturational course into adolescence, which is related to changes in SF processing. In mid-adolescence, increased sensitivity to emotional LSF cues is developed, which aids the fast and adequate processing of fearful expressions that might signal impending danger. Copyright © 2017 Elsevier B.V. All rights reserved.

Memory-Relevant Mushroom Body Output Synapses Are Cholinergic.

PubMed

Barnstedt, Oliver; Owald, David; Felsenberg, Johannes; Brain, Ruth; Moszynski, John-Paul; Talbot, Clifford B; Perrat, Paola N; Waddell, Scott

2016-03-16

Memories are stored in the fan-out fan-in neural architectures of the mammalian cerebellum and hippocampus and the insect mushroom bodies. However, whereas key plasticity occurs at glutamatergic synapses in mammals, the neurochemistry of the memory-storing mushroom body Kenyon cell output synapses is unknown. Here we demonstrate a role for acetylcholine (ACh) in Drosophila. Kenyon cells express the ACh-processing proteins ChAT and VAChT, and reducing their expression impairs learned olfactory-driven behavior. Local ACh application, or direct Kenyon cell activation, evokes activity in mushroom body output neurons (MBONs). MBON activation depends on VAChT expression in Kenyon cells and is blocked by ACh receptor antagonism. Furthermore, reducing nicotinic ACh receptor subunit expression in MBONs compromises odor-evoked activation and redirects odor-driven behavior. Lastly, peptidergic corelease enhances ACh-evoked responses in MBONs, suggesting an interaction between the fast- and slow-acting transmitters. Therefore, olfactory memories in Drosophila are likely stored as plasticity of cholinergic synapses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.

PubMed

Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves

2003-08-01

A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.

ClinData Express – A Metadata Driven Clinical Research Data Management System for Secondary Use of Clinical Data

PubMed Central

Li, Zuofeng; Wen, Jingran; Zhang, Xiaoyan; Wu, Chunxiao; Li, Zuogao; Liu, Lei

2012-01-01

Aim to ease the secondary use of clinical data in clinical research, we introduce a metadata driven web-based clinical data management system named ClinData Express. ClinData Express is made up of two parts: 1) m-designer, a standalone software for metadata definition; 2) a web based data warehouse system for data management. With ClinData Express, what the researchers need to do is to define the metadata and data model in the m-designer. The web interface for data collection and specific database for data storage will be automatically generated. The standards used in the system and the data export modular make sure of the data reuse. The system has been tested on seven disease-data collection in Chinese and one form from dbGap. The flexibility of system makes its great potential usage in clinical research. The system is available at http://code.google.com/p/clindataexpress. PMID:23304327

Fuzzy support vector machine: an efficient rule-based classification technique for microarrays.

PubMed

Hajiloo, Mohsen; Rabiee, Hamid R; Anooshahpour, Mahdi

2013-01-01

The abundance of gene expression microarray data has led to the development of machine learning algorithms applicable for tackling disease diagnosis, disease prognosis, and treatment selection problems. However, these algorithms often produce classifiers with weaknesses in terms of accuracy, robustness, and interpretability. This paper introduces fuzzy support vector machine which is a learning algorithm based on combination of fuzzy classifiers and kernel machines for microarray classification. Experimental results on public leukemia, prostate, and colon cancer datasets show that fuzzy support vector machine applied in combination with filter or wrapper feature selection methods develops a robust model with higher accuracy than the conventional microarray classification models such as support vector machine, artificial neural network, decision trees, k nearest neighbors, and diagonal linear discriminant analysis. Furthermore, the interpretable rule-base inferred from fuzzy support vector machine helps extracting biological knowledge from microarray data. Fuzzy support vector machine as a new classification model with high generalization power, robustness, and good interpretability seems to be a promising tool for gene expression microarray classification.

Targeted proteomics identifies liquid-biopsy signatures for extracapsular prostate cancer

PubMed Central

Kim, Yunee; Jeon, Jouhyun; Mejia, Salvador; Yao, Cindy Q; Ignatchenko, Vladimir; Nyalwidhe, Julius O; Gramolini, Anthony O; Lance, Raymond S; Troyer, Dean A; Drake, Richard R; Boutros, Paul C; Semmes, O. John; Kislinger, Thomas

2016-01-01

Biomarkers are rapidly gaining importance in personalized medicine. Although numerous molecular signatures have been developed over the past decade, there is a lack of overlap and many biomarkers fail to validate in independent patient cohorts and hence are not useful for clinical application. For these reasons, identification of novel and robust biomarkers remains a formidable challenge. We combine targeted proteomics with computational biology to discover robust proteomic signatures for prostate cancer. Quantitative proteomics conducted in expressed prostatic secretions from men with extraprostatic and organ-confined prostate cancers identified 133 differentially expressed proteins. Using synthetic peptides, we evaluate them by targeted proteomics in a 74-patient cohort of expressed prostatic secretions in urine. We quantify a panel of 34 candidates in an independent 207-patient cohort. We apply machine-learning approaches to develop clinical predictive models for prostate cancer diagnosis and prognosis. Our results demonstrate that computationally guided proteomics can discover highly accurate non-invasive biomarkers. PMID:27350604

Engineering artificial cells by combining HeLa-based cell-free expression and ultra-thin double emulsion template

PubMed Central

Ho, Kwun Yin; Murray, Victoria L.; Liu, Allen P.

2015-01-01

Generation of artificial cells provides the bridge needed to cover the gap between studying the complexity of biological processes in whole cells and studying these same processes in an in vitro reconstituted system. Artificial cells are defined as the encapsulation of biologically active material in a biological or synthetic membrane. Here, we describe a robust and general method to produce artificial cells for the purpose of mimicking one or more behaviors of a cell. A microfluidic double emulsion system is used to encapsulate a mammalian cell free expression system that is able to express membrane proteins into the bilayer or soluble proteins inside the vesicles. The development of a robust platform that allows the assembly of artificial cells is valuable in understanding subcellular functions and emergent behaviors in a more cell-like environment as well as for creating novel signaling pathways to achieve specific cellular behaviors. PMID:25997354

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

Robust Least-Squares Support Vector Machine With Minimization of Mean and Variance of Modeling Error.

PubMed

Lu, Xinjiang; Liu, Wenbo; Zhou, Chuang; Huang, Minghui

2017-06-13

The least-squares support vector machine (LS-SVM) is a popular data-driven modeling method and has been successfully applied to a wide range of applications. However, it has some disadvantages, including being ineffective at handling non-Gaussian noise as well as being sensitive to outliers. In this paper, a robust LS-SVM method is proposed and is shown to have more reliable performance when modeling a nonlinear system under conditions where Gaussian or non-Gaussian noise is present. The construction of a new objective function allows for a reduction of the mean of the modeling error as well as the minimization of its variance, and it does not constrain the mean of the modeling error to zero. This differs from the traditional LS-SVM, which uses a worst-case scenario approach in order to minimize the modeling error and constrains the mean of the modeling error to zero. In doing so, the proposed method takes the modeling error distribution information into consideration and is thus less conservative and more robust in regards to random noise. A solving method is then developed in order to determine the optimal parameters for the proposed robust LS-SVM. An additional analysis indicates that the proposed LS-SVM gives a smaller weight to a large-error training sample and a larger weight to a small-error training sample, and is thus more robust than the traditional LS-SVM. The effectiveness of the proposed robust LS-SVM is demonstrated using both artificial and real life cases.

Configurations of a two-tiered amplified gene expression system in adenoviral vectors designed to improve the specificity of in vivo prostate cancer imaging

PubMed Central

Sato, M; Figueiredo, ML; Burton, JB; Johnson, M; Chen, M; Powell, R; Gambhir, SS; Carey, M; Wu, L

2009-01-01

Effective treatment for recurrent, disseminated prostate cancer is notably limited. We have developed adenoviral vectors with a prostate-specific two-step transcriptional amplification (TSTA) system that would express therapeutic genes at a robust level to target metastatic disease. The TSTA system employs the prostate-specific antigen (PSA) promoter/enhancer to drive a potent synthetic activator, which in turn activates the expression of the therapeutic gene. In this study, we explored different configurations of this bipartite system and discovered that physical separation of the two TSTA components into E1 and E3 regions of adenovirus was able to enhance androgen regulation and cell-discriminatory expression. The TSTA vectors that express imaging reporter genes were assessed by noninvasive imaging technologies in animal models. The improved selectivity of the E1E3 configured vector was reflected in silenced ectopic expression in the lung. Significantly, the enhanced specificity of the E1E3 vector enabled the detection of lung metastasis of prostate cancer. An E1E3 TSTA vector that expresses the herpes simplex virus thymidine kinase gene can effectively direct positron emission tomography (PET) imaging of the tumor. The prostate-targeted gene delivery vectors with robust and cell-specific expression capability will advance the development of safe and effective imaging guided therapy for recurrent metastatic stages of prostate cancer. PMID:18305574

Bioinforrnatics of Gene Expression Profiling Data Provide Mechanistic Understanding of Acute Ozone-Induced Lung injury

EPA Science Inventory

Acute ozone-induced pulmonary injury and inflammation are well characterized. A few studies have used gene expression profiling to determine the types of changes induced by ozone; however the mechanisms or the pathways involved are less well understood. We presumed that robust bi...

Expression and Purification of Sperm Whale Myoglobin

ERIC Educational Resources Information Center

Miller, Stephen; Indivero, Virginia; Burkhard, Caroline

2010-01-01

We present a multiweek laboratory exercise that exposes students to the fundamental techniques of bacterial expression and protein purification through the preparation of sperm whale myoglobin. Myoglobin, a robust oxygen-binding protein, contains a single heme that gives the protein a reddish color, making it an ideal subject for the teaching…

Distillability of Werner states using entanglement witnesses and robust semidefinite programs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vianna, Reinaldo O.; Departamento de Fisica, ICEX, Universidade Federal de Minas Gerais, Av. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais; Doherty, Andrew C.

2006-11-15

We use robust semidefinite programs and entanglement witnesses to study the distillability of Werner states. We perform exact numerical calculations that show two-undistillability in a region of the state space, which was previously conjectured to be undistillable. We also introduce bases that yield interesting expressions for the distillability witnesses and for a tensor product of Werner states with an arbitrary number of copies.

Mesopic and Photopic Rod and Cone Photoreceptor-Driven Visual Processes in Mice With Long-Wavelength-Shifted Cone Pigments.

PubMed

Tsai, Tina I; Joachimsthaler, Anneka; Kremers, Jan

2017-10-01

The clearer divergence in spectral sensitivity between native rod and human L-cone (L*-cone) opsins in the transgenic Opn1lwLIAIS mouse (LIAIS) allows normal visual processes mediated by these photoreceptor subtypes to be isolated effectively using the silent substitution technique. The objective of this study was to further characterize the influence of mean luminance and temporal frequency on the functional properties of signals originating in each photoreceptor separately and independently of adaptation state in LIAIS mice. Electroretinographic (ERG) recordings to sine-wave rod and L*-cone modulation at different mean luminances (0.1-130.0 cd/m2) and temporal frequencies (6-26 Hz) were examined in anesthetized LIAIS (N = 17) and C57Bl/6 mice (N = 8). We report maximum rod-driven response with 8-Hz modulation at 0.1 to 0.5 cd/m2, which was almost four times larger than maximum cone-driven response at 8 Hz, 21.5 to 130 cd/m2. Over these optimal luminances, both rod- and cone-driven response amplitudes exhibited low-pass functions with similar frequency resolution limits, albeit their distinct luminance sensitivities. There were, however, two distinguishing features: (1) the frequency-dependent amplitude decrease of rod-driven responses was more profound, and (2) linear relationships describing rod-driven response phases as a function of stimulus frequency were steeper. Employing the silent substitution method with stimuli of appropriate luminance on the LIAIS mouse (as on human observers) increases the specificity, robustness, and scope to which photoreceptor-driven responses can be reliably assayed compared to the standard photoreceptor isolation methods.

Innate and cytokine-driven signals, rather than microbial antigens, dominate in natural killer T cell activation during microbial infection.

PubMed

Brigl, Manfred; Tatituri, Raju V V; Watts, Gerald F M; Bhowruth, Veemal; Leadbetter, Elizabeth A; Barton, Nathaniel; Cohen, Nadia R; Hsu, Fong-Fu; Besra, Gurdyal S; Brenner, Michael B

2011-06-06

Invariant natural killer T cells (iNKT cells) are critical for host defense against a variety of microbial pathogens. However, the central question of how iNKT cells are activated by microbes has not been fully explained. The example of adaptive MHC-restricted T cells, studies using synthetic pharmacological α-galactosylceramides, and the recent discovery of microbial iNKT cell ligands have all suggested that recognition of foreign lipid antigens is the main driver for iNKT cell activation during infection. However, when we compared the role of microbial antigens versus innate cytokine-driven mechanisms, we found that iNKT cell interferon-γ production after in vitro stimulation or infection with diverse bacteria overwhelmingly depended on toll-like receptor-driven IL-12. Importantly, activation of iNKT cells in vivo during infection with Sphingomonas yanoikuyae or Streptococcus pneumoniae, pathogens which are known to express iNKT cell antigens and which require iNKT cells for effective protection, also predominantly depended on IL-12. Constitutive expression of high levels of IL-12 receptor by iNKT cells enabled instant IL-12-induced STAT4 activation, demonstrating that among T cells, iNKT cells are uniquely equipped for immediate, cytokine-driven activation. These findings reveal that innate and cytokine-driven signals, rather than cognate microbial antigen, dominate in iNKT cell activation during microbial infections.

Robustly detecting differential expression in RNA sequencing data using observation weights

PubMed Central

Zhou, Xiaobei; Lindsay, Helen; Robinson, Mark D.

2014-01-01

A popular approach for comparing gene expression levels between (replicated) conditions of RNA sequencing data relies on counting reads that map to features of interest. Within such count-based methods, many flexible and advanced statistical approaches now exist and offer the ability to adjust for covariates (e.g. batch effects). Often, these methods include some sort of ‘sharing of information’ across features to improve inferences in small samples. It is important to achieve an appropriate tradeoff between statistical power and protection against outliers. Here, we study the robustness of existing approaches for count-based differential expression analysis and propose a new strategy based on observation weights that can be used within existing frameworks. The results suggest that outliers can have a global effect on differential analyses. We demonstrate the effectiveness of our new approach with real data and simulated data that reflects properties of real datasets (e.g. dispersion-mean trend) and develop an extensible framework for comprehensive testing of current and future methods. In addition, we explore the origin of such outliers, in some cases highlighting additional biological or technical factors within the experiment. Further details can be downloaded from the project website: http://imlspenticton.uzh.ch/robinson_lab/edgeR_robust/. PMID:24753412

kruX: matrix-based non-parametric eQTL discovery.

PubMed

Qi, Jianlong; Asl, Hassan Foroughi; Björkegren, Johan; Michoel, Tom

2014-01-14

The Kruskal-Wallis test is a popular non-parametric statistical test for identifying expression quantitative trait loci (eQTLs) from genome-wide data due to its robustness against variations in the underlying genetic model and expression trait distribution, but testing billions of marker-trait combinations one-by-one can become computationally prohibitive. We developed kruX, an algorithm implemented in Matlab, Python and R that uses matrix multiplications to simultaneously calculate the Kruskal-Wallis test statistic for several millions of marker-trait combinations at once. KruX is more than ten thousand times faster than computing associations one-by-one on a typical human dataset. We used kruX and a dataset of more than 500k SNPs and 20k expression traits measured in 102 human blood samples to compare eQTLs detected by the Kruskal-Wallis test to eQTLs detected by the parametric ANOVA and linear model methods. We found that the Kruskal-Wallis test is more robust against data outliers and heterogeneous genotype group sizes and detects a higher proportion of non-linear associations, but is more conservative for calling additive linear associations. kruX enables the use of robust non-parametric methods for massive eQTL mapping without the need for a high-performance computing infrastructure and is freely available from http://krux.googlecode.com.

Risk, Robustness and Water Resources Planning Under Uncertainty

NASA Astrophysics Data System (ADS)

Borgomeo, Edoardo; Mortazavi-Naeini, Mohammad; Hall, Jim W.; Guillod, Benoit P.

2018-03-01

Risk-based water resources planning is based on the premise that water managers should invest up to the point where the marginal benefit of risk reduction equals the marginal cost of achieving that benefit. However, this cost-benefit approach may not guarantee robustness under uncertain future conditions, for instance under climatic changes. In this paper, we expand risk-based decision analysis to explore possible ways of enhancing robustness in engineered water resources systems under different risk attitudes. Risk is measured as the expected annual cost of water use restrictions, while robustness is interpreted in the decision-theoretic sense as the ability of a water resource system to maintain performance—expressed as a tolerable risk of water use restrictions—under a wide range of possible future conditions. Linking risk attitudes with robustness allows stakeholders to explicitly trade-off incremental increases in robustness with investment costs for a given level of risk. We illustrate the framework through a case study of London's water supply system using state-of-the -art regional climate simulations to inform the estimation of risk and robustness.

A robust sound perception model suitable for neuromorphic implementation.

PubMed

Coath, Martin; Sheik, Sadique; Chicca, Elisabetta; Indiveri, Giacomo; Denham, Susan L; Wennekers, Thomas

2013-01-01

We have recently demonstrated the emergence of dynamic feature sensitivity through exposure to formative stimuli in a real-time neuromorphic system implementing a hybrid analog/digital network of spiking neurons. This network, inspired by models of auditory processing in mammals, includes several mutually connected layers with distance-dependent transmission delays and learning in the form of spike timing dependent plasticity, which effects stimulus-driven changes in the network connectivity. Here we present results that demonstrate that the network is robust to a range of variations in the stimulus pattern, such as are found in naturalistic stimuli and neural responses. This robustness is a property critical to the development of realistic, electronic neuromorphic systems. We analyze the variability of the response of the network to "noisy" stimuli which allows us to characterize the acuity in information-theoretic terms. This provides an objective basis for the quantitative comparison of networks, their connectivity patterns, and learning strategies, which can inform future design decisions. We also show, using stimuli derived from speech samples, that the principles are robust to other challenges, such as variable presentation rate, that would have to be met by systems deployed in the real world. Finally we demonstrate the potential applicability of the approach to real sounds.

Early warning of climate tipping points from critical slowing down: comparing methods to improve robustness

PubMed Central

Lenton, T. M.; Livina, V. N.; Dakos, V.; Van Nes, E. H.; Scheffer, M.

2012-01-01

We address whether robust early warning signals can, in principle, be provided before a climate tipping point is reached, focusing on methods that seek to detect critical slowing down as a precursor of bifurcation. As a test bed, six previously analysed datasets are reconsidered, three palaeoclimate records approaching abrupt transitions at the end of the last ice age and three models of varying complexity forced through a collapse of the Atlantic thermohaline circulation. Approaches based on examining the lag-1 autocorrelation function or on detrended fluctuation analysis are applied together and compared. The effects of aggregating the data, detrending method, sliding window length and filtering bandwidth are examined. Robust indicators of critical slowing down are found prior to the abrupt warming event at the end of the Younger Dryas, but the indicators are less clear prior to the Bølling-Allerød warming, or glacial termination in Antarctica. Early warnings of thermohaline circulation collapse can be masked by inter-annual variability driven by atmospheric dynamics. However, rapidly decaying modes can be successfully filtered out by using a long bandwidth or by aggregating data. The two methods have complementary strengths and weaknesses and we recommend applying them together to improve the robustness of early warnings. PMID:22291229

Flexible design in water and wastewater engineering--definitions, literature and decision guide.

PubMed

Spiller, Marc; Vreeburg, Jan H G; Leusbrock, Ingo; Zeeman, Grietje

2015-02-01

Urban water and wastewater systems face uncertain developments including technological progress, climate change and urban development. To ensure the sustainability of these systems under dynamic conditions it has been proposed that technologies and infrastructure should be flexible, adaptive and robust. However, in literature it is often unclear what these technologies and infrastructure are. Furthermore, the terms flexible, adaptive and robust are often used interchangeably, despite important differences. In this paper we will i) define the terminology, ii) provide an overview of the status of flexible infrastructure design alternatives for water and wastewater networks and treatment, and iii) develop guidelines for the selection of flexible design alternatives. Results indicate that, with the exception of Net Present Valuation methods, there is little research available on the design and evaluation of technologies that can enable flexibility. Flexible design alternatives reviewed include robust design, phased design, modular design, modular/component platform design and design for remanufacturing. As developments in the water sector are driven by slow variables (climate change, urban development), rather than market forces, it is suggested that phased design or component platform designs are suitable for responding to change, while robust design is an option when operations face highly dynamic variability. Copyright © 2014 Elsevier Ltd. All rights reserved.

Gap-metric-based robustness analysis of nonlinear systems with full and partial feedback linearisation

NASA Astrophysics Data System (ADS)

Al-Gburi, A.; Freeman, C. T.; French, M. C.

2018-06-01

This paper uses gap metric analysis to derive robustness and performance margins for feedback linearising controllers. Distinct from previous robustness analysis, it incorporates the case of output unstructured uncertainties, and is shown to yield general stability conditions which can be applied to both stable and unstable plants. It then expands on existing feedback linearising control schemes by introducing a more general robust feedback linearising control design which classifies the system nonlinearity into stable and unstable components and cancels only the unstable plant nonlinearities. This is done in order to preserve the stabilising action of the inherently stabilising nonlinearities. Robustness and performance margins are derived for this control scheme, and are expressed in terms of bounds on the plant nonlinearities and the accuracy of the cancellation of the unstable plant nonlinearity by the controller. Case studies then confirm reduced conservatism compared with standard methods.

The Impact of CO2-Driven Vegetation Changes on Wildfire Risk

NASA Astrophysics Data System (ADS)

Skinner, C. B.; Poulsen, C. J.

2017-12-01

While wildfires are a key component of natural ecological restoration and succession, they also pose tremendous risks to human life, health, and property. Wildfire frequency is expected to increase in many regions as the radiative effects of elevated CO2 drive warmer surface air temperatures, earlier spring snow melt, and more frequent meteorological drought. However, high CO2 concentrations will also directly impact vegetation growth and physiology, potentially altering wildfire characteristics through changes in fuel amount and surface hydrology. Depending on the biome and time of year, these vegetation-driven responses may mitigate or enhance radiative-driven wildfire changes. In this study, we use a suite of earth system models from the Coupled Model Intercomparison Project 5 with active biogeophysics and biogeochemistry to understand how the vegetation response to high CO2 (CO2 quadrupling) contributes to future changes in wildfire risk across the globe. Across the models, projected CO2 fertilization enhances aboveground biomass (about a 30% leaf area index (LAI) increase averaged across the globe) during the spring and summer months, increasing the availability of wildfire fuel across all biomes. Despite greater LAI, models robustly project widespread reductions in summer season transpiration (about -15% averaged across the globe) in response to reduced stomatal conductance from CO2 physiological forcing. Reduced transpiration warms summer season near surface temperatures and lowers relative humidity across vegetated regions of the mid-to-high latitudes, heightening the risk of wildfire occurrence. However, as transpiration goes down in response to greater plant water use efficiency, a larger fraction of soil water remains in the soil, potentially halting the spread of wildfires in some regions. Given the myriad ways in which the vegetation response to CO2 may alter wildfire risk, and the robustness of the responses across models, an explicit simulation of the wildfire response to CO2-driven vegetation change with the Community Earth System Model will be presented. The results suggest that many atmosphere-centric statistical wildfire metrics do not capture the many processes that will shape future wildfire risk in a high CO2 world and highlight the need for process-based fire modeling.

Facial expression recognition based on improved deep belief networks

NASA Astrophysics Data System (ADS)

Wu, Yao; Qiu, Weigen

2017-08-01

In order to improve the robustness of facial expression recognition, a method of face expression recognition based on Local Binary Pattern (LBP) combined with improved deep belief networks (DBNs) is proposed. This method uses LBP to extract the feature, and then uses the improved deep belief networks as the detector and classifier to extract the LBP feature. The combination of LBP and improved deep belief networks is realized in facial expression recognition. In the JAFFE (Japanese Female Facial Expression) database on the recognition rate has improved significantly.

Robust Transgene Expression from Bicistronic mRNA in the Green Alga Chlamydomonas reinhardtii

PubMed Central

Onishi, Masayuki; Pringle, John R.

2016-01-01

The unicellular green alga Chlamydomonas reinhardtii is a model organism that provides an opportunity to understand the evolution and functional biology of the lineage that includes the land plants, as well as aspects of the fundamental core biology conserved throughout the eukaryotic phylogeny. Although many tools are available to facilitate genetic, molecular biological, biochemical, and cell biological studies in Chlamydomonas, expression of unselected transgenes of interest (GOIs) has been challenging. In most methods used previously, the GOI and a selectable marker are expressed from two separate mRNAs, so that their concomitant expression is not guaranteed. In this study, we developed constructs that allow expression of an upstream GOI and downstream selectable marker from a single bicistronic mRNA. Although this approach in other systems has typically required a translation-enhancing element such as an internal ribosome entry site for the downstream marker, we found that a short stretch of unstructured junction sequence was sufficient to obtain adequate expression of the downstream gene, presumably through post-termination reinitiation. With this system, we obtained robust expression of both endogenous and heterologous GOIs, including fluorescent proteins and tagged fusion proteins, in the vast majority of transformants, thus eliminating the need for tedious secondary screening for GOI-expressing transformants. This improved efficiency should greatly facilitate a variety of genetic and cell-biological studies in Chlamydomonas and also enable new applications such as expression-based screens and large-scale production of foreign proteins. PMID:27770025

Adapted Resistance to the Knockdown Effect of shRNA-Derived Srsf3 siRNAs in Mouse Littermates | Center for Cancer Research

Cancer.gov

Gene silencing techniques are widely used to control gene expression and have potential for RNAi-based therapeutics. In this report, transgenic mouse lines were created for conditional knockdown of Srsf3 (SRp20) expression in liver and mammary gland tissues by expressing Srsf3-specific shRNAs driven by a U6 promoter.

Miniaturized, High-Speed, Modulated X-Ray Source

NASA Technical Reports Server (NTRS)

Gendreau, Keith; Arzoumanian, Zaven; Kenyon, Steve; Spartana, Nick

2013-01-01

A low-cost, miniature x-ray source has been developed that can be modulated in intensity from completely off to full intensity on nanosecond timescales. This modulated x-ray source (MXS) has no filaments and is extremely rugged. The energy level of the MXS is adjustable from 0 to more than 100 keV. It can be used as the core of many new devices, providing the first practical, arbitrarily time-variable source of x-rays. The high-speed switching capability and miniature size make possible many new technologies including x-ray-based communication, compact time-resolved x-ray diffraction, novel x-ray fluorescence instruments, and low- and precise-dose medical x-rays. To make x-rays, the usual method is to accelerate electrons into a target material held at a high potential. When the electrons stop in the target, x-rays are produced with a spectrum that is a function of the target material and the energy to which the electrons are accelerated. Most commonly, the electrons come from a hot filament. In the MXS, the electrons start off as optically driven photoelectrons. The modulation of the x-rays is then tied to the modulation of the light that drives the photoelectron source. Much of the recent development has consisted of creating a photoelectrically-driven electron source that is robust, low in cost, and offers high intensity. For robustness, metal photocathodes were adopted, including aluminum and magnesium. Ultraviolet light from 255- to 350-nm LEDs (light emitting diodes) stimulated the photoemissions from these photocathodes with an efficiency that is maximized at the low-wavelength end (255 nm) to a value of roughly 10(exp -4). The MXS units now have much higher brightness, are much smaller, and are made using a number of commercially available components, making them extremely inexpensive. In the latest MXS design, UV efficiency is addressed by using a high-gain electron multiplier. The photocathode is vapor-deposited onto the input cone of a Burle Magnum(TradeMark) multiplier. This system yields an extremely robust photon-driven electron source that can tolerate long, weeks or more, exposure to air with negligible degradation. The package is also small. When combined with the electron target, necessary vacuum fittings, and supporting components (but not including LED electronics or high-voltage sources), the entire modulated x-ray source weighs as little as 158 grams.

Food Choice Questionnaire (FCQ) revisited. Suggestions for the development of an enhanced general food motivation model.

PubMed

Fotopoulos, Christos; Krystallis, Athanasios; Vassallo, Marco; Pagiaslis, Anastasios

2009-02-01

Recognising the need for a more statistically robust instrument to investigate general food selection determinants, the research validates and confirms Food Choice Questionnaire (FCQ's) factorial design, develops ad hoc a more robust FCQ version and tests its ability to discriminate between consumer segments in terms of the importance they assign to the FCQ motivational factors. The original FCQ appears to represent a comprehensive and reliable research instrument. However, the empirical data do not support the robustness of its 9-factorial design. On the other hand, segmentation results at the subpopulation level based on the enhanced FCQ version bring about an optimistic message for the FCQ's ability to predict food selection behaviour. The paper concludes that some of the basic components of the original FCQ can be used as a basis for a new general food motivation typology. The development of such a new instrument, with fewer, of higher abstraction FCQ-based dimensions and fewer items per dimension, is a right step forward; yet such a step should be theory-driven, while a rigorous statistical testing across and within population would be necessary.

Cytomegalovirus vector expressing RAE-1γ induces enhanced anti-tumor capacity of murine CD8+ T cells.

PubMed

Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan

2017-08-01

Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

FoxP2 Expression in a Highly Vocal Teleost Fish with Comparisons to Tetrapods.

PubMed

Pengra, Ian G G; Marchaterre, Margaret A; Bass, Andrew H

2018-04-19

Motivated by studies of speech deficits in humans, several studies over the past two decades have investigated the potential role of a forkhead domain transcription factor, FoxP2, in the central control of acoustic signaling/vocalization among vertebrates. Comparative neuroanatomical studies that mainly include mammalian and avian species have mapped the distribution of FoxP2 expression in multiple brain regions that imply a greater functional significance beyond vocalization that might be shared broadly across vertebrate lineages. To date, reports for teleost fish have been limited in number and scope to nonvocal species. Here, we map the neuroanatomical distribution of FoxP2 mRNA expression in a highly vocal teleost, the plainfin midshipman (Porichthys notatus). We report an extensive overlap between FoxP2 expression and vocal, auditory, and steroid-signaling systems with robust expression at multiple sites in the telencephalon, the preoptic area, the diencephalon, and the midbrain. Label was far more restricted in the hindbrain though robust in one region of the reticular formation. A comparison with other teleosts and tetrapods suggests an evolutionarily conserved FoxP2 phenotype important to vocal-acoustic and, more broadly, sensorimotor function among vertebrates. © 2018 S. Karger AG, Basel.

Network analysis of transcriptomics expands regulatory landscapes in Synechococcus sp. PCC 7002

DOE Office of Scientific and Technical Information (OSTI.GOV)

McClure, Ryan S.; Overall, Christopher C.; McDermott, Jason E.

Cyanobacterial regulation of gene expression must contend with a genome organization that lacks apparent functional context, as the majority of cellular processes and metabolic pathways are encoded by genes found at disparate locations across the genome. In addition, the fact that coordinated regulation of cyanobacterial cellular machinery takes place with significantly fewer transcription factors, compared to other Eubacteria, suggests the involvement of post-transcriptional mechanisms and regulatory adaptations which are not fully understood. Global transcript abundance from model cyanobacterium Synechococcus sp. PCC 7002 grown under 42 different conditions was analyzed using context-likelihood of relatedness. The resulting 903-gene network, which was organizedmore » into 11 modules, not only allowed classification of cyanobacterial responses to specific environmental variables but provided insight into the transcriptional network topology and led to the expansion of predicted regulons. When used in conjunction with genome sequence, the global transcript abundance allowed identification of putative post-transcriptional changes in expression as well as novel potential targets of both DNA binding proteins and asRNA regulators. The results offer a new perspective into the multi-level regulation that governs cellular adaptations of fast-growing physiologically robust cyanobacterium Synechococcus sp. PCC 7002 to changing environmental variables. It also extends a methodological knowledge-based framework for studying multi-scale regulatory mechanisms that operate in cyanobacteria. Finally, it provides valuable context for integrating systems-level data to enhance evidence-driven genomic annotation, especially in organisms where traditional context analyses cannot be implemented due to lack of operon-based functional organization.« less

Sleeping Beauty transposon-based system for rapid generation of HBV-replicating stable cell lines.

PubMed

Wu, Yong; Zhang, Tian-Ying; Fang, Lin-Lin; Chen, Zi-Xuan; Song, Liu-Wei; Cao, Jia-Li; Yang, Lin; Yuan, Quan; Xia, Ning-Shao

2016-08-01

The stable HBV-replicating cell lines, which carry replication-competent HBV genome stably integrated into the genome of host cell, are widely used to evaluate the effects of antiviral agents. However, current methods to generate HBV-replicating cell lines, which are mostly dependent on random integration of foreign DNA via plasmid transfection, are less-efficient and time-consuming. To address this issue, we constructed an all-in-one Sleeping Beauty transposon system (denoted pTSMP-HBV vector) for robust generation of stable cell lines carrying replication-competent HBV genome of different genotype. This vector contains a Sleeping Beauty transposon containing HBV 1.3-copy genome with an expression cassette of the SV40 promoter driving red fluorescent protein (mCherry) and self-cleaving P2A peptide linked puromycin resistance gene (PuroR). In addition, a PGK promoter-driven SB100X hyperactive transposase cassette is placed in the outside of the transposon in the same plasmid.The HBV-replicating stable cells could be obtained from pTSMP-HBV transfected HepG2 cells by red fluorescence-activated cell sorting and puromycin resistant cell selection within 4-week. Using this system, we successfully constructed four cell lines carrying replication-competent HBV genome of genotypes A-D. The replication and viral protein expression profiles of these cells were systematically characterized. In conclusion, our study provides a high-efficiency strategy to generate HBV-replicating stable cell lines, which may facilitate HBV-related virological study. Copyright © 2016. Published by Elsevier B.V.

Phosphoinositide-Driven Epithelial Proliferation in Prostatic Inflammation

DTIC Science & Technology

2009-04-01

IL-1β expression is localized to the urethral urothelium during development, and little or no expression is observed in the developing prostatic...ducts [Figure 3B]. By comparison, IL-1α expression is found both in the urethral urothelium and in the developing prostatic ducts [Figure 3A]. In...adult [C]. Hyperplasia was induced by E. coli for 5 days. In contrast, IL-1β [B,D] expression is localized to the urethral urothelium at P10 [B] and

Facial expression recognition based on improved local ternary pattern and stacked auto-encoder

NASA Astrophysics Data System (ADS)

Wu, Yao; Qiu, Weigen

2017-08-01

In order to enhance the robustness of facial expression recognition, we propose a method of facial expression recognition based on improved Local Ternary Pattern (LTP) combined with Stacked Auto-Encoder (SAE). This method uses the improved LTP extraction feature, and then uses the improved depth belief network as the detector and classifier to extract the LTP feature. The combination of LTP and improved deep belief network is realized in facial expression recognition. The recognition rate on CK+ databases has improved significantly.

Mathematical Modeling of RNA-Based Architectures for Closed Loop Control of Gene Expression.

PubMed

Agrawal, Deepak K; Tang, Xun; Westbrook, Alexandra; Marshall, Ryan; Maxwell, Colin S; Lucks, Julius; Noireaux, Vincent; Beisel, Chase L; Dunlop, Mary J; Franco, Elisa

2018-05-08

Feedback allows biological systems to control gene expression precisely and reliably, even in the presence of uncertainty, by sensing and processing environmental changes. Taking inspiration from natural architectures, synthetic biologists have engineered feedback loops to tune the dynamics and improve the robustness and predictability of gene expression. However, experimental implementations of biomolecular control systems are still far from satisfying performance specifications typically achieved by electrical or mechanical control systems. To address this gap, we present mathematical models of biomolecular controllers that enable reference tracking, disturbance rejection, and tuning of the temporal response of gene expression. These controllers employ RNA transcriptional regulators to achieve closed loop control where feedback is introduced via molecular sequestration. Sensitivity analysis of the models allows us to identify which parameters influence the transient and steady state response of a target gene expression process, as well as which biologically plausible parameter values enable perfect reference tracking. We quantify performance using typical control theory metrics to characterize response properties and provide clear selection guidelines for practical applications. Our results indicate that RNA regulators are well-suited for building robust and precise feedback controllers for gene expression. Additionally, our approach illustrates several quantitative methods useful for assessing the performance of biomolecular feedback control systems.

IRON INCREASES EXPRESSION OF IRON-EXPORT PROTEIN MTP1 IN LUNG CELLS

EPA Science Inventory

Accumulation of reactive iron in acute and chronic lung disease suggests that iron-driven free radical formation could contribute to tissue injury. Safe transport and sequestration of this metal is likely to be of importance in lung defense. We provide evidence for the expression...

Transgene expression in pear (Pyrus communis L.) driven by a phloem-specific promoter

USDA-ARS?s Scientific Manuscript database

A gene expression cassette carrying ß-glucuronidase (uidA) reporter gene under the control of the promoter of the Arabidopsis sucrose-H+ symporter gene (AtSUC2) was introduced to pear plants via an Agrobacterium-mediated leaf-explant transformation procedure. Transgenic shoots were regenerated from...

Reflection of a Year Long Model-Driven Business and UI Modeling Development Project

NASA Astrophysics Data System (ADS)

Sukaviriya, Noi; Mani, Senthil; Sinha, Vibha

Model-driven software development enables users to specify an application at a high level - a level that better matches problem domain. It also promises the users with better analysis and automation. Our work embarks on two collaborating domains - business process and human interactions - to build an application. Business modeling expresses business operations and flows then creates business flow implementation. Human interaction modeling expresses a UI design, its relationship with business data, logic, and flow, and can generate working UI. This double modeling approach automates the production of a working system with UI and business logic connected. This paper discusses the human aspects of this modeling approach after a year long of building a procurement outsourcing contract application using the approach - the result of which was deployed in December 2008. The paper discusses in multiple areas the happy endings and some heartache. We end with insights on how a model-driven approach could do better for humans in the process.

Coherence explored between emotion components: evidence from event-related potentials and facial electromyography.

PubMed

Gentsch, Kornelia; Grandjean, Didier; Scherer, Klaus R

2014-04-01

Componential theories assume that emotion episodes consist of emergent and dynamic response changes to relevant events in different components, such as appraisal, physiology, motivation, expression, and subjective feeling. In particular, Scherer's Component Process Model hypothesizes that subjective feeling emerges when the synchronization (or coherence) of appraisal-driven changes between emotion components has reached a critical threshold. We examined the prerequisite of this synchronization hypothesis for appraisal-driven response changes in facial expression. The appraisal process was manipulated by using feedback stimuli, presented in a gambling task. Participants' responses to the feedback were investigated in concurrently recorded brain activity related to appraisal (event-related potentials, ERP) and facial muscle activity (electromyography, EMG). Using principal component analysis, the prediction of appraisal-driven response changes in facial EMG was examined. Results support this prediction: early cognitive processes (related to the feedback-related negativity) seem to primarily affect the upper face, whereas processes that modulate P300 amplitudes tend to predominantly drive cheek region responses. Copyright © 2013 Elsevier B.V. All rights reserved.

Activation of the PD-1 pathway contributes to immune escape in EGFR-driven lung tumors

PubMed Central

Akbay, Esra A; Koyama, Shohei; Carretero, Julian; Altabef, Abigail; Tchaicha, Jeremy H; Christensen, Camilla L; Mikse, Oliver R; Cherniack, Andrew D; Beauchamp, Ellen M; Pugh, Trevor J; Wilkerson, Matthew D; Fecci, Peter E; Butaney, Mohit; Reibel, Jacob B; Soucheray, Margaret; Cohoon, Travis J; Janne, Pasi A; Meyerson, Matthew; Hayes, D. Neil; Shapiro, Geoffrey I; Shimamura, Takeshi; Sholl, Lynette M; Rodig, Scott J; Freeman, Gordon J; Hammerman, Peter S; Dranoff, Glenn; Wong, Kwok-Kin

2013-01-01

The success in lung cancer therapy with Programmed Death (PD)-1 blockade suggests that immune escape mechanisms contribute to lung tumor pathogenesis. We identified a correlation between Epidermal Growth Factor Receptor (EGFR) pathway activation and a signature of immunosuppression manifested by upregulation of PD-1, PD-L1, cytotoxic T lymphocyte antigen-4 (CTLA-4), and multiple tumor-promoting inflammatory cytokines. We observed decreased cytotoxic T cells and increased markers of T cell exhaustion in mouse models of EGFR-driven lung cancer. PD-1 antibody blockade improved the survival of mice with EGFR-driven adenocarcinomas by enhancing effector T cell function and lowering the levels of tumor-promoting cytokines. Expression of mutant EGFR in bronchial epithelial cells induced PD-L1, and PD-L1 expression was reduced by EGFR inhibitors in non-small cell lung cancer cell lines with activated EGFR. These data suggest that oncogenic EGFR signaling remodels the tumor microenvironment to trigger immune escape, and mechanistically link treatment response to PD-1 inhibition. PMID:24078774

Exploration of the Hypothalamic-Pituitary-Adrenal Axis to Improve Animal Welfare by Means of Genetic Selection: Lessons from the South African Merino.

PubMed

Hough, Denise; Swart, Pieter; Cloete, Schalk

2013-05-17

It is a difficult task to improve animal production by means of genetic selection, if the environment does not allow full expression of the animal's genetic potential. This concept may well be the future for animal welfare, because it highlights the need to incorporate traits related to production and robustness, simultaneously, to reach sustainable breeding goals. This review explores the identification of potential genetic markers for robustness within the hypothalamic-pituitary-adrenal axis (HPAA), since this axis plays a vital role in the stress response. If genetic selection for superior HPAA responses to stress is possible, then it ought to be possible to breed robust and easily managed genotypes that might be able to adapt to a wide range of environmental conditions whilst expressing a high production potential. This approach is explored in this review by means of lessons learnt from research on Merino sheep, which were divergently selected for their multiple rearing ability. These two selection lines have shown marked differences in reproduction, production and welfare, which makes this breeding programme ideal to investigate potential genetic markers of robustness. The HPAA function is explored in detail to elucidate where such genetic markers are likely to be found.

Modeling stochasticity and robustness in gene regulatory networks.

PubMed

Garg, Abhishek; Mohanram, Kartik; Di Cara, Alessandro; De Micheli, Giovanni; Xenarios, Ioannis

2009-06-15

Understanding gene regulation in biological processes and modeling the robustness of underlying regulatory networks is an important problem that is currently being addressed by computational systems biologists. Lately, there has been a renewed interest in Boolean modeling techniques for gene regulatory networks (GRNs). However, due to their deterministic nature, it is often difficult to identify whether these modeling approaches are robust to the addition of stochastic noise that is widespread in gene regulatory processes. Stochasticity in Boolean models of GRNs has been addressed relatively sparingly in the past, mainly by flipping the expression of genes between different expression levels with a predefined probability. This stochasticity in nodes (SIN) model leads to over representation of noise in GRNs and hence non-correspondence with biological observations. In this article, we introduce the stochasticity in functions (SIF) model for simulating stochasticity in Boolean models of GRNs. By providing biological motivation behind the use of the SIF model and applying it to the T-helper and T-cell activation networks, we show that the SIF model provides more biologically robust results than the existing SIN model of stochasticity in GRNs. Algorithms are made available under our Boolean modeling toolbox, GenYsis. The software binaries can be downloaded from http://si2.epfl.ch/ approximately garg/genysis.html.

Multi-Directional Multi-Level Dual-Cross Patterns for Robust Face Recognition.

PubMed

Ding, Changxing; Choi, Jonghyun; Tao, Dacheng; Davis, Larry S

2016-03-01

To perform unconstrained face recognition robust to variations in illumination, pose and expression, this paper presents a new scheme to extract "Multi-Directional Multi-Level Dual-Cross Patterns" (MDML-DCPs) from face images. Specifically, the MDML-DCPs scheme exploits the first derivative of Gaussian operator to reduce the impact of differences in illumination and then computes the DCP feature at both the holistic and component levels. DCP is a novel face image descriptor inspired by the unique textural structure of human faces. It is computationally efficient and only doubles the cost of computing local binary patterns, yet is extremely robust to pose and expression variations. MDML-DCPs comprehensively yet efficiently encodes the invariant characteristics of a face image from multiple levels into patterns that are highly discriminative of inter-personal differences but robust to intra-personal variations. Experimental results on the FERET, CAS-PERL-R1, FRGC 2.0, and LFW databases indicate that DCP outperforms the state-of-the-art local descriptors (e.g., LBP, LTP, LPQ, POEM, tLBP, and LGXP) for both face identification and face verification tasks. More impressively, the best performance is achieved on the challenging LFW and FRGC 2.0 databases by deploying MDML-DCPs in a simple recognition scheme.

Robust diagnosis of non-Hodgkin lymphoma phenotypes validated on gene expression data from different laboratories.

PubMed

Bhanot, Gyan; Alexe, Gabriela; Levine, Arnold J; Stolovitzky, Gustavo

2005-01-01

A major challenge in cancer diagnosis from microarray data is the need for robust, accurate, classification models which are independent of the analysis techniques used and can combine data from different laboratories. We propose such a classification scheme originally developed for phenotype identification from mass spectrometry data. The method uses a robust multivariate gene selection procedure and combines the results of several machine learning tools trained on raw and pattern data to produce an accurate meta-classifier. We illustrate and validate our method by applying it to gene expression datasets: the oligonucleotide HuGeneFL microarray dataset of Shipp et al. (www.genome.wi.mit.du/MPR/lymphoma) and the Hu95Av2 Affymetrix dataset (DallaFavera's laboratory, Columbia University). Our pattern-based meta-classification technique achieves higher predictive accuracies than each of the individual classifiers , is robust against data perturbations and provides subsets of related predictive genes. Our techniques predict that combinations of some genes in the p53 pathway are highly predictive of phenotype. In particular, we find that in 80% of DLBCL cases the mRNA level of at least one of the three genes p53, PLK1 and CDK2 is elevated, while in 80% of FL cases, the mRNA level of at most one of them is elevated.

Vitamin D Counteracts an IL-23-Dependent IL-17A+IFN-γ+ Response Driven by Urban Particulate Matter.

PubMed

Mann, Elizabeth H; Ho, Tzer-Ren; Pfeffer, Paul E; Matthews, Nick C; Chevretton, Elfy; Mudway, Ian; Kelly, Frank J; Hawrylowicz, Catherine M

2017-09-01

Urban particulate matter (UPM) air pollution and vitamin D deficiency are detrimentally associated with respiratory health. This is hypothesized to be due in part to regulation of IL-17A, which UPM is reported to promote. Here, we used a myeloid dendritic cell (DC)-memory CD4 + T cell co-culture system to characterize UPM-driven IL-17A + cells, investigate the mechanism by which UPM-primed DCs promote this phenotype, and address evidence for cross-regulation by vitamin D. CD1c + myeloid DCs were cultured overnight with or without a reference source of UPM and/or active vitamin D (1,25[OH] 2 D 3 ) before they were co-cultured with autologous memory CD4 + T cells. Supernatants were harvested for cytokine analysis on Day 5 of co-culture, and intracellular cytokine staining was performed on Day 7. UPM-primed DCs increased the proportion of memory CD4 + T cells expressing the T helper 17 cell (Th17)-associated cytokines IL-17A, IL-17F, and IL-22, as well as IFN-γ, granulocyte-macrophage colony-stimulating factor, and granzyme B. Notably, a large proportion of the UPM-driven IL-17A + cells co-expressed these cytokines, but not IL-10, indicative of a proinflammatory Th17 profile. UPM-treated DCs expressed elevated levels of il23 mRNA and increased secretion of IL-23p40. Neutralization of IL-23 in culture reduced the frequency of IL-17A + IFN-γ + cells without affecting cell proliferation. 1,25(OH) 2 D 3 counteracted the UPM-driven DC maturation and inhibited the frequency of IL-17A + IFN-γ + cells, most prominently when DCs were co-treated with the corticosteroid dexamethasone, while maintaining antiinflammatory IL-10 synthesis. These data indicate that UPM might promote an inflammatory milieu in part by inducing an IL-23-driven proinflammatory Th17 response. Restoring vitamin D sufficiency may counteract these UPM-driven effects without obliterating important homeostatic immune functions.

Mitochondrial remodeling in the liver following chronic alcohol feeding to rats.

PubMed

Han, Derick; Johnson, Heather S; Rao, Madhuri P; Martin, Gary; Sancheti, Harsh; Silkwood, Kai H; Decker, Carl W; Nguyen, Kim Tho; Casian, Joseph G; Cadenas, Enrique; Kaplowitz, Neil

2017-01-01

The feeding of alcohol orally (Lieber-DeCarli diet) to rats has been shown to cause declines in mitochondrial respiration (state III), decreased expression of respiratory complexes, and decreased respiratory control ratios (RCR) in liver mitochondria. These declines and other mitochondrial alterations have led to the hypothesis that alcohol feeding causes "mitochondrial dysfunction" in the liver. If oral alcohol feeding leads to mitochondrial dysfunction, one would predict that increasing alcohol delivery by intragastric (IG) alcohol feeding to rats would cause greater declines in mitochondrial bioenergetics in the liver. In this study, we examined the mitochondrial alterations that occur in rats fed alcohol both orally and intragastrically. Oral alcohol feeding decreased glutamate/malate-, acetaldehyde- and succinate-driven state III respiration, RCR, and expression of respiratory complexes (I, III, IV, V) in liver mitochondria, in agreement with previous results. IG alcohol feeding, on the other hand, caused a slight increase in glutamate/malate-driven respiration, and significantly increased acetaldehyde-driven respiration in liver mitochondria. IG feeding also caused liver mitochondria to experience a decline in succinate-driven respiration, but these decreases were smaller than those observed with oral alcohol feeding. Surprisingly, oral and IG alcohol feeding to rats increased mitochondrial respiration using other substrates, including glycerol-3-phosphate (which delivers electrons from cytoplasmic NADH to mitochondria) and octanoate (a substrate for beta-oxidation). The enhancement of glycerol-3-phosphate- and octanoate-driven respiration suggests that liver mitochondria remodeled in response to alcohol feeding. In support of this notion, we observed that IG alcohol feeding also increased expression of mitochondrial glycerol phosphate dehydrogenase-2 (GPD2), transcription factor A (TFAM), and increased mitochondrial NAD + -NADH and NADP + -NADPH levels in the liver. Our findings suggest that mitochondrial dysfunction represents an incomplete picture of mitochondrial dynamics that occur in the liver following alcohol feeding. While alcohol feeding causes some mitochondrial dysfunction (i.e. succinate-driven respiration), our work suggests that the major consequence of alcohol feeding is mitochondrial remodeling in the liver as an adaptation. This mitochondrial remodeling may play an important role in the enhanced alcohol metabolism and other adaptations in the liver that develop with alcohol intake. Copyright © 2016 Elsevier Inc. All rights reserved.

Experiments with a pressure-driven Stirling refrigerator with flexible chambers

NASA Astrophysics Data System (ADS)

McFarlane, Patrick; Suire, Jonathan; Sen, Mihir; Semperlotti, Fabio

2014-06-01

We report on the design and experimental testing of a Stirling refrigerator that uses air as the working fluid, and where the conventional piston-cylinder assemblies are replaced by pressure-driven flexible chambers. The two chambers are periodically compressed by pneumatic actuators resulting in airflow through the regenerator and in a net temperature difference between the chambers. An experimental setup is used to investigate the performance of the refrigerator under different operating conditions with particular attention to actuation frequencies, driving pressure differences, and phase angles between the two inputs. The time constant of the temperature difference between the two chambers is determined, and the temperature difference is measured as a function of the system parameters. The results of several tests conducted under different operating conditions show that the refrigerating effect is very robust and allows good performance even for modulated inputs. The frequency response is radically different from that of a traditional motion-driven device. This work suggests that mechanical to thermal energy conversion devices based on this principle can be successfully powered by human motion.

Fast-moving soft electronic fish.

PubMed

Li, Tiefeng; Li, Guorui; Liang, Yiming; Cheng, Tingyu; Dai, Jing; Yang, Xuxu; Liu, Bangyuan; Zeng, Zedong; Huang, Zhilong; Luo, Yingwu; Xie, Tao; Yang, Wei

2017-04-01

Soft robots driven by stimuli-responsive materials have unique advantages over conventional rigid robots, especially in their high adaptability for field exploration and seamless interaction with humans. The grand challenge lies in achieving self-powered soft robots with high mobility, environmental tolerance, and long endurance. We are able to advance a soft electronic fish with a fully integrated onboard system for power and remote control. Without any motor, the fish is driven solely by a soft electroactive structure made of dielectric elastomer and ionically conductive hydrogel. The electronic fish can swim at a speed of 6.4 cm/s (0.69 body length per second), which is much faster than previously reported untethered soft robotic fish driven by soft responsive materials. The fish shows consistent performance in a wide temperature range and permits stealth sailing due to its nearly transparent nature. Furthermore, the fish is robust, as it uses the surrounding water as the electric ground and can operate for 3 hours with one single charge. The design principle can be potentially extended to a variety of flexible devices and soft robots.

Fast-moving soft electronic fish

PubMed Central

Li, Tiefeng; Li, Guorui; Liang, Yiming; Cheng, Tingyu; Dai, Jing; Yang, Xuxu; Liu, Bangyuan; Zeng, Zedong; Huang, Zhilong; Luo, Yingwu; Xie, Tao; Yang, Wei

2017-01-01

Soft robots driven by stimuli-responsive materials have unique advantages over conventional rigid robots, especially in their high adaptability for field exploration and seamless interaction with humans. The grand challenge lies in achieving self-powered soft robots with high mobility, environmental tolerance, and long endurance. We are able to advance a soft electronic fish with a fully integrated onboard system for power and remote control. Without any motor, the fish is driven solely by a soft electroactive structure made of dielectric elastomer and ionically conductive hydrogel. The electronic fish can swim at a speed of 6.4 cm/s (0.69 body length per second), which is much faster than previously reported untethered soft robotic fish driven by soft responsive materials. The fish shows consistent performance in a wide temperature range and permits stealth sailing due to its nearly transparent nature. Furthermore, the fish is robust, as it uses the surrounding water as the electric ground and can operate for 3 hours with one single charge. The design principle can be potentially extended to a variety of flexible devices and soft robots. PMID:28435879

Heterogeneous Bimetallic Phosphide/Sulfide Nanocomposite for Efficient Solar-Energy-Driven Overall Water Splitting.

PubMed

Xin, Yanmei; Kan, Xiang; Gan, Li-Yong; Zhang, Zhonghai

2017-10-24

Solar-driven overall water splitting is highly desirable for hydrogen generation with sustainable energy sources, which need efficient, earth-abundant, robust, and bifunctional electrocatalysts for both oxygen evolution reaction (OER) and hydrogen evolution reaction (HER). Herein, we propose a heterogeneous bimetallic phosphide/sulfide nanocomposite electrocatalyst of NiFeSP on nickel foam (NiFeSP/NF), which shows superior electrocatalytic activity of low overpotentials of 91 mV at -10 mA cm -2 for HER and of 240 mV at 50 mA cm -2 for OER in 1 M KOH solution. In addition, the NiFeSP/NF presents excellent overall water splitting performance with a cell voltage as low as 1.58 V at a current density of 10 mA cm -2 . Combining with a photovoltaic device of a Si solar cell or integrating into photoelectrochemical (PEC) systems, the bifunctional NiFeSP/NF electrocatalyst implements unassisted solar-driven water splitting with a solar-to-hydrogen conversion efficiency of ∼9.2% and significantly enhanced PEC performance, respectively.

Baroclinic Adjustment of the Eddy-Driven Jet

NASA Astrophysics Data System (ADS)

Novak, Lenka; Ambaum, Maarten H. P.; Harvey, Ben J.

2017-04-01

The prediction of poleward shift in the midlatitude eddy-driven jets due to anthropogenic climate change is now a robust feature of climate models, but the magnitude of this shift or the processes responsible for it are less certain. This uncertainty comes from the complex response in storm tracks to large-scale forcing and their nonlinear modulation of the jet. This study uses global circulation models to reveal a relationship between eddy growth rate (referred to as baroclinicity) and eddy activity, whereby baroclinicity responds most rapidly to an eddy-dissipating forcing whereas eddy activity responds most rapidly to a baroclinicity-replenishing forcing. This nonlinearity can be generally explained using a two-dimensional dynamical system essentially describing the baroclinic adjustment as a predator-prey relationship. Despite this nonlinearity, the barotropic changes in the eddy-driven jet appear to be of a comparable magnitude for the ranges of both types of forcing tested in this study. It is implied that while changes in eddy activity or baroclinicity may indicate the sign of latitudinal jet shifting, the precise magnitude of this shifting is a result of a balance between these two quantities.

Nonlinear Tracking Control of a Conductive Supercoiled Polymer Actuator.

PubMed

Luong, Tuan Anh; Cho, Kyeong Ho; Song, Min Geun; Koo, Ja Choon; Choi, Hyouk Ryeol; Moon, Hyungpil

2018-04-01

Artificial muscle actuators made from commercial nylon fishing lines have been recently introduced and shown as a new type of actuator with high performance. However, the actuators also exhibit significant nonlinearities, which make them difficult to control, especially in precise trajectory-tracking applications. In this article, we present a nonlinear mathematical model of a conductive supercoiled polymer (SCP) actuator driven by Joule heating for model-based feedback controls. Our efforts include modeling of the hysteresis behavior of the actuator. Based on nonlinear modeling, we design a sliding mode controller for SCP actuator-driven manipulators. The system with proposed control law is proven to be asymptotically stable using the Lyapunov theory. The control performance of the proposed method is evaluated experimentally and compared with that of a proportional-integral-derivative (PID) controller through one-degree-of-freedom SCP actuator-driven manipulators. Experimental results show that the proposed controller's performance is superior to that of a PID controller, such as the tracking errors are nearly 10 times smaller compared with those of a PID controller, and it is more robust to external disturbances such as sensor noise and actuator modeling error.

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Analytic expressions for ULF wave radiation belt radial diffusion coefficients

PubMed Central

Ozeke, Louis G; Mann, Ian R; Murphy, Kyle R; Jonathan Rae, I; Milling, David K

2014-01-01

We present analytic expressions for ULF wave-derived radiation belt radial diffusion coefficients, as a function of L and Kp, which can easily be incorporated into global radiation belt transport models. The diffusion coefficients are derived from statistical representations of ULF wave power, electric field power mapped from ground magnetometer data, and compressional magnetic field power from in situ measurements. We show that the overall electric and magnetic diffusion coefficients are to a good approximation both independent of energy. We present example 1-D radial diffusion results from simulations driven by CRRES-observed time-dependent energy spectra at the outer boundary, under the action of radial diffusion driven by the new ULF wave radial diffusion coefficients and with empirical chorus wave loss terms (as a function of energy, Kp and L). There is excellent agreement between the differential flux produced by the 1-D, Kp-driven, radial diffusion model and CRRES observations of differential electron flux at 0.976 MeV—even though the model does not include the effects of local internal acceleration sources. Our results highlight not only the importance of correct specification of radial diffusion coefficients for developing accurate models but also show significant promise for belt specification based on relatively simple models driven by solar wind parameters such as solar wind speed or geomagnetic indices such as Kp. Key Points Analytic expressions for the radial diffusion coefficients are presented The coefficients do not dependent on energy or wave m value The electric field diffusion coefficient dominates over the magnetic PMID:26167440

Performance Assessment of Kernel Density Clustering for Gene Expression Profile Data

PubMed Central

Zeng, Beiyan; Chen, Yiping P.; Smith, Oscar H.

2003-01-01

Kernel density smoothing techniques have been used in classification or supervised learning of gene expression profile (GEP) data, but their applications to clustering or unsupervised learning of those data have not been explored and assessed. Here we report a kernel density clustering method for analysing GEP data and compare its performance with the three most widely-used clustering methods: hierarchical clustering, K-means clustering, and multivariate mixture model-based clustering. Using several methods to measure agreement, between-cluster isolation, and withincluster coherence, such as the Adjusted Rand Index, the Pseudo F test, the r2 test, and the profile plot, we have assessed the effectiveness of kernel density clustering for recovering clusters, and its robustness against noise on clustering both simulated and real GEP data. Our results show that the kernel density clustering method has excellent performance in recovering clusters from simulated data and in grouping large real expression profile data sets into compact and well-isolated clusters, and that it is the most robust clustering method for analysing noisy expression profile data compared to the other three methods assessed. PMID:18629292

Evaluation of Two Outlier-Detection-Based Methods for Detecting Tissue-Selective Genes from Microarray Data

PubMed Central

Kadota, Koji; Konishi, Tomokazu; Shimizu, Kentaro

2007-01-01

Large-scale expression profiling using DNA microarrays enables identification of tissue-selective genes for which expression is considerably higher and/or lower in some tissues than in others. Among numerous possible methods, only two outlier-detection-based methods (an AIC-based method and Sprent’s non-parametric method) can treat equally various types of selective patterns, but they produce substantially different results. We investigated the performance of these two methods for different parameter settings and for a reduced number of samples. We focused on their ability to detect selective expression patterns robustly. We applied them to public microarray data collected from 36 normal human tissue samples and analyzed the effects of both changing the parameter settings and reducing the number of samples. The AIC-based method was more robust in both cases. The findings confirm that the use of the AIC-based method in the recently proposed ROKU method for detecting tissue-selective expression patterns is correct and that Sprent’s method is not suitable for ROKU. PMID:19936074

Using adaptive processes and adverse outcome pathways to develop meaningful, robust, and actionable environmental monitoring programs.

PubMed

Arciszewski, Tim J; Munkittrick, Kelly R; Scrimgeour, Garry J; Dubé, Monique G; Wrona, Fred J; Hazewinkel, Rod R

2017-09-01

The primary goals of environmental monitoring are to indicate whether unexpected changes related to development are occurring in the physical, chemical, and biological attributes of ecosystems and to inform meaningful management intervention. Although achieving these objectives is conceptually simple, varying scientific and social challenges often result in their breakdown. Conceptualizing, designing, and operating programs that better delineate monitoring, management, and risk assessment processes supported by hypothesis-driven approaches, strong inference, and adverse outcome pathways can overcome many of the challenges. Generally, a robust monitoring program is characterized by hypothesis-driven questions associated with potential adverse outcomes and feedback loops informed by data. Specifically, key and basic features are predictions of future observations (triggers) and mechanisms to respond to success or failure of those predictions (tiers). The adaptive processes accelerate or decelerate the effort to highlight and overcome ignorance while preventing the potentially unnecessary escalation of unguided monitoring and management. The deployment of the mutually reinforcing components can allow for more meaningful and actionable monitoring programs that better associate activities with consequences. Integr Environ Assess Manag 2017;13:877-891. © 2017 The Authors. Integrated Environmental Assessment and Management Published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC). © 2017 The Authors. Integrated Environmental Assessment and Management Published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC).

A synergy-driven approach to a myoelectric hand.

PubMed

Godfrey, S B; Ajoudani, A; Catalano, M; Grioli, G; Bicchi, A

2013-06-01

In this paper, we present the Pisa/IIT SoftHand with myoelectric control as a synergy-driven approach for a prosthetic hand. Commercially available myoelectric hands are more expensive, heavier, and less robust than their body-powered counterparts; however, they can offer greater freedom of motion and a more aesthetically pleasing appearance. The Pisa/IIT SoftHand is built on the motor control principle of synergies through which the immense complexity of the hand is simplified into distinct motor patterns. As the SoftHand grasps, it follows a synergistic path with built-in flexibility to allow grasping of a wide variety of objects with a single motor. Here we test, as a proof-of-concept, 4 myoelectric controllers: a standard controller in which the EMG signal is used only as a position reference, an impedance controller that determines both position and stiffness references from the EMG input, a standard controller with vibrotactile force feedback, and finally a combined vibrotactile-impedance (VI) controller. Four healthy subjects tested the control algorithms by grasping various objects. All controllers were sufficient for basic grasping, however the impedance and vibrotactile controllers reduced the physical and cognitive load on the user, while the combined VI mode was the easiest to use of the four. While these results need to be validated with amputees, they suggest a low-cost, robust hand employing hardware-based synergies is a viable alternative to traditional myoelectric prostheses.

Functional cliques in the amygdala and related brain networks driven by fear assessment acquired during movie viewing.

PubMed

Kinreich, Sivan; Intrator, Nathan; Hendler, Talma

2011-01-01

One of the greatest challenges involved in studying the brain mechanisms of fear is capturing the individual's unique instantaneous experience. Brain imaging studies to date commonly sacrifice valuable information regarding the individual real-time conscious experience, especially when focusing on elucidating the amygdala's activity. Here, we assumed that by using a minimally intrusive cue along with applying a robust clustering approach to probe the amygdala, it would be possible to rate fear in real time and to derive the related network of activation. During functional magnetic resonance imaging scanning, healthy volunteers viewed two excerpts from horror movies and were periodically auditory cued to rate their instantaneous experience of "I'm scared." Using graph theory and community mathematical concepts, data-driven clustering of the fear-related functional cliques in the amygdala was performed guided by the individually marked periods of heightened fear. Individually tailored functions derived from these amygdala activation cliques were subsequently applied as general linear model predictors to a whole-brain analysis to reveal the correlated networks. Our results suggest that by using a localized robust clustering approach, it is possible to probe activation in the right dorsal amygdala that is directly related to individual real-time emotional experience. Moreover, this fear-evoked amygdala revealed two opposing networks of co-activation and co-deactivation, which correspond to vigilance and rest-related circuits, respectively.

Enhanced identification and biological validation of differential gene expression via Illumina whole-genome expression arrays through the use of the model-based background correction methodology

PubMed Central

Ding, Liang-Hao; Xie, Yang; Park, Seongmi; Xiao, Guanghua; Story, Michael D.

2008-01-01

Despite the tremendous growth of microarray usage in scientific studies, there is a lack of standards for background correction methodologies, especially in single-color microarray platforms. Traditional background subtraction methods often generate negative signals and thus cause large amounts of data loss. Hence, some researchers prefer to avoid background corrections, which typically result in the underestimation of differential expression. Here, by utilizing nonspecific negative control features integrated into Illumina whole genome expression arrays, we have developed a method of model-based background correction for BeadArrays (MBCB). We compared the MBCB with a method adapted from the Affymetrix robust multi-array analysis algorithm and with no background subtraction, using a mouse acute myeloid leukemia (AML) dataset. We demonstrated that differential expression ratios obtained by using the MBCB had the best correlation with quantitative RT–PCR. MBCB also achieved better sensitivity in detecting differentially expressed genes with biological significance. For example, we demonstrated that the differential regulation of Tnfr2, Ikk and NF-kappaB, the death receptor pathway, in the AML samples, could only be detected by using data after MBCB implementation. We conclude that MBCB is a robust background correction method that will lead to more precise determination of gene expression and better biological interpretation of Illumina BeadArray data. PMID:18450815

Fourier Phase Domain Steganography: Phase Bin Encoding Via Interpolation

NASA Astrophysics Data System (ADS)

Rivas, Edward

2007-04-01

In recent years there has been an increased interest in audio steganography and watermarking. This is due primarily to two reasons. First, an acute need to improve our national security capabilities in light of terrorist and criminal activity has driven new ideas and experimentation. Secondly, the explosive proliferation of digital media has forced the music industry to rethink how they will protect their intellectual property. Various techniques have been implemented but the phase domain remains a fertile ground for improvement due to the relative robustness to many types of distortion and immunity to the Human Auditory System. A new method for embedding data in the phase domain of the Discrete Fourier Transform of an audio signal is proposed. Focus is given to robustness and low perceptibility, while maintaining a relatively high capacity rate of up to 172 bits/s.

Personalized health care and health information technology policy: an exploratory analysis.

PubMed

Wald, Jonathan S; Shapiro, Michael

2013-01-01

Personalized healthcare (PHC) is envisioned to enhance clinical practice decision-making using new genome-driven knowledge that tailors diagnosis, treatment, and prevention to the individual patient. In 2012, we conducted a focused environmental scan and informal interviews with fifteen experts to anticipate how PHC might impact health Information Technology (IT) policy in the United States. Findings indicatedthat PHC has a variable impact on current clinical practice, creates complex questions for providers, patients, and policy-makers, and will require a robust health IT infrastructure with advanced data architecture, clinical decision support, provider workflow tools, and re-use of clinical data for research. A number of health IT challenge areas were identified, along with five policy areas including: interoperable clinical decision support, standards for patient values and preferences, patient engagement, data transparency, and robust privacy and security.

Robustness of Many-Body Localization in the Presence of Dissipation

NASA Astrophysics Data System (ADS)

Levi, Emanuele; Heyl, Markus; Lesanovsky, Igor; Garrahan, Juan P.

2016-06-01

Many-body localization (MBL) has emerged as a novel paradigm for robust ergodicity breaking in closed quantum many-body systems. However, it is not yet clear to which extent MBL survives in the presence of dissipative processes induced by the coupling to an environment. Here we study heating and ergodicity for a paradigmatic MBL system—an interacting fermionic chain subject to quenched disorder—in the presence of dephasing. We find that, even though the system is eventually driven into an infinite-temperature state, heating as monitored by the von Neumann entropy can progress logarithmically slowly, implying exponentially large time scales for relaxation. This slow loss of memory of initial conditions makes signatures of nonergodicity visible over a long, but transient, time regime. We point out a potential controlled realization of the considered setup with cold atomic gases held in optical lattices.

Quantitative Proteomics Reveals Fundamental Regulatory Differences in Oncogenic HRAS and Isocitrate Dehydrogenase (IDH1) Driven Astrocytoma.

PubMed

Doll, Sophia; Urisman, Anatoly; Oses-Prieto, Juan A; Arnott, David; Burlingame, Alma L

2017-01-01

Glioblastoma multiformes (GBMs) are high-grade astrocytomas and the most common brain malignancies. Primary GBMs are often associated with disturbed RAS signaling, and expression of oncogenic HRAS results in a malignant phenotype in glioma cell lines. Secondary GBMs arise from lower-grade astrocytomas, have slower progression than primary tumors, and contain IDH1 mutations in over 70% of cases. Despite significant amount of accumulating genomic and transcriptomic data, the fundamental mechanistic differences of gliomagenesis in these two types of high-grade astrocytoma remain poorly understood. Only a few studies have attempted to investigate the proteome, phosphorylation signaling, and epigenetic regulation in astrocytoma. In the present study, we applied quantitative phosphoproteomics to identify the main signaling differences between oncogenic HRAS and mutant IDH1-driven glioma cells as models of primary and secondary GBM, respectively. Our analysis confirms the driving roles of the MAPK and PI3K/mTOR signaling pathways in HRAS driven cells and additionally uncovers dysregulation of other signaling pathways. Although a subset of the signaling changes mediated by HRAS could be reversed by a MEK inhibitor, dual inhibition of MEK and PI3K resulted in more complete reversal of the phosphorylation patterns produced by HRAS expression. In contrast, cells expressing mutant IDH1 did not show significant activation of MAPK or PI3K/mTOR pathways. Instead, global downregulation of protein expression was observed. Targeted proteomic analysis of histone modifications identified significant histone methylation, acetylation, and butyrylation changes in the mutant IDH1 expressing cells, consistent with a global transcriptional repressive state. Our findings offer novel mechanistic insight linking mutant IDH1 associated inhibition of histone demethylases with specific histone modification changes to produce global transcriptional repression in secondary glioblastoma. Our proteomic datasets are available for download and provide a comprehensive catalogue of alterations in protein abundance, phosphorylation, and histone modifications in oncogenic HRAS and IDH1 driven astrocytoma cells beyond the transcriptomic level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

8-Oxoguanine DNA glycosylase1-driven DNA repair-A paradoxical role in lung aging.

PubMed

German, Peter; Saenz, David; Szaniszlo, Peter; Aguilera-Aguirre, Leopoldo; Pan, Lang; Hegde, Muralidhar L; Bacsi, Attila; Hajas, Gyorgy; Radak, Zsolt; Ba, Xueqing; Mitra, Sankar; Papaconstantinou, John; Boldogh, Istvan

2017-01-01

Age-associated changes in lung structure and function are some of the most important predictors of overall health, cognitive activities and longevity. Common to all aging cells is an increase in oxidatively modified DNA bases, primarily 8-oxo-7,8-dihydroguanine (8-oxoG). It is repaired via DNA base excision repair pathway driven by 8-oxoguanine DNA glycosylase-1 (OGG1-BER), whose role in aging has been the focus of many studies. This study hypothesizes that signaling and consequent gene expression during cellular response to OGG1-BER "wires" senescence/aging processes. To test OGG1-BER was mimicked by repeatedly exposing diploid lung fibroblasts cells and airways of mice to 8-oxoG base. Results showed that repeated exposures led to G1 cell cycle arrest and pre-matured senescence of cultured cells in which over 1000 genes were differentially expressed -86% of them been identical to those in naturally senesced cells. Gene ontology analysis of gene expression displayed biological processes driven by small GTPases, phosphoinositide 3-kinase and mitogen activated kinase cascades both in cultured cells and lungs. These results together, points to a new paradigm about the role of DNA damage and repair by OGG1 in aging and age-associated disease processes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

The extracellular calcium-sensing receptor regulates human fetal lung development via CFTR

PubMed Central

Brennan, Sarah C.; Wilkinson, William J.; Tseng, Hsiu-Er; Finney, Brenda; Monk, Bethan; Dibble, Holly; Quilliam, Samantha; Warburton, David; Galietta, Luis J.; Kemp, Paul J.; Riccardi, Daniela

2016-01-01

Optimal fetal lung growth requires anion-driven fluid secretion into the lumen of the developing organ. The fetus is hypercalcemic compared to the mother and here we show that in the developing human lung this hypercalcaemia acts on the extracellular calcium-sensing receptor, CaSR, to promote fluid-driven lung expansion through activation of the cystic fibrosis transmembrane conductance regulator, CFTR. Several chloride channels including TMEM16, bestrophin, CFTR, CLCN2 and CLCA1, are also expressed in the developing human fetal lung at gestational stages when CaSR expression is maximal. Measurements of Cl−-driven fluid secretion in organ explant cultures show that pharmacological CaSR activation by calcimimetics stimulates lung fluid secretion through CFTR, an effect which in humans, but not mice, was also mimicked by fetal hypercalcemic conditions, demonstrating that the physiological relevance of such a mechanism appears to be species-specific. Calcimimetics promote CFTR opening by activating adenylate cyclase and we show that Ca2+-stimulated type I adenylate cyclase is expressed in the developing human lung. Together, these observations suggest that physiological fetal hypercalcemia, acting on the CaSR, promotes human fetal lung development via cAMP-dependent opening of CFTR. Disturbances in this process would be expected to permanently impact lung structure and might predispose to certain postnatal respiratory diseases. PMID:26911344

A zebrafish model of chordoma initiated by notochord-driven expression of HRASV12.

PubMed

Burger, Alexa; Vasilyev, Aleksandr; Tomar, Ritu; Selig, Martin K; Nielsen, G Petur; Peterson, Randall T; Drummond, Iain A; Haber, Daniel A

2014-07-01

Chordoma is a malignant tumor thought to arise from remnants of the embryonic notochord, with its origin in the bones of the axial skeleton. Surgical resection is the standard treatment, usually in combination with radiation therapy, but neither chemotherapeutic nor targeted therapeutic approaches have demonstrated success. No animal model and only few chordoma cell lines are available for preclinical drug testing, and, although no druggable genetic drivers have been identified, activation of EGFR and downstream AKT-PI3K pathways have been described. Here, we report a zebrafish model of chordoma, based on stable transgene-driven expression of HRASV12 in notochord cells during development. Extensive intra-notochordal tumor formation is evident within days of transgene expression, ultimately leading to larval death. The zebrafish tumors share characteristics of human chordoma as demonstrated by immunohistochemistry and electron microscopy. The mTORC1 inhibitor rapamycin, which has some demonstrated activity in a chordoma cell line, delays the onset of tumor formation in our zebrafish model, and improves survival of tumor-bearing fish. Consequently, the HRASV12-driven zebrafish model of chordoma could enable high-throughput screening of potential therapeutic agents for the treatment of this refractory cancer. © 2014. Published by The Company of Biologists Ltd.

Lack of promoter IV-driven BDNF transcription results in depression-like behavior.

PubMed

Sakata, K; Jin, L; Jha, S

2010-10-01

Transcription of Bdnf is controlled by multiple promoters, in which promoter IV contributes significantly to activity-dependent Bdnf transcription. We have generated promoter IV mutant mice [brain-derived neurotrophic factor (BDNF)-KIV] in which promoter IV-driven expression of BDNF is selectively disrupted by inserting a green fluorescent protein (GFP)-STOP cassette within the Bdnf exon IV locus. BDNF-KIV animals exhibited depression-like behavior as shown by the tail suspension test (TST), sucrose preference test (SPT) and learned helplessness test (LHT). In addition, BDNF-KIV mice showed reduced activity in the open field test (OFT) and reduced food intake in the novelty-suppressed feeding test (NSFT). The mutant mice did not display anxiety-like behavior in the light and dark box test and elevated plus maze tests. Interestingly, the mutant mice showed defective response inhibition in the passive avoidance test (PAT) even though their learning ability was intact when measured with the active avoidance test (AAT). These results suggest that promoter IV-dependent BDNF expression plays a critical role in the control of mood-related behaviors. This is the first study that directly addressed the effects of endogenous promoter-driven expression of BDNF in depression-like behavior. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Engineering entropy-driven reactions and networks catalyzed by DNA.

PubMed

Zhang, David Yu; Turberfield, Andrew J; Yurke, Bernard; Winfree, Erik

2007-11-16

Artificial biochemical circuits are likely to play as large a role in biological engineering as electrical circuits have played in the engineering of electromechanical devices. Toward that end, nucleic acids provide a designable substrate for the regulation of biochemical reactions. However, it has been difficult to incorporate signal amplification components. We introduce a design strategy that allows a specified input oligonucleotide to catalyze the release of a specified output oligonucleotide, which in turn can serve as a catalyst for other reactions. This reaction, which is driven forward by the configurational entropy of the released molecule, provides an amplifying circuit element that is simple, fast, modular, composable, and robust. We have constructed and characterized several circuits that amplify nucleic acid signals, including a feedforward cascade with quadratic kinetics and a positive feedback circuit with exponential growth kinetics.

Materials discovery guided by data-driven insights

NASA Astrophysics Data System (ADS)

Klintenberg, Mattias

As the computational power continues to grow systematic computational exploration has become an important tool for materials discovery. In this presentation the Electronic Structure Project (ESP/ELSA) will be discussed and a number of examples presented that show some of the capabilities of a data-driven methodology for guiding materials discovery. These examples include topological insulators, detector materials and 2D materials. ESP/ELSA is an initiative that dates back to 2001 and today contain many tens of thousands of materials that have been investigated using a robust and high accuracy electronic structure method (all-electron FP-LMTO) thus providing basic materials first-principles data for most inorganic compounds that have been structurally characterized. The web-site containing the ESP/ELSA data has as of today been accessed from more than 4,000 unique computers from all around the world.

Data-driven process decomposition and robust online distributed modelling for large-scale processes

NASA Astrophysics Data System (ADS)

Shu, Zhang; Lijuan, Li; Lijuan, Yao; Shipin, Yang; Tao, Zou

2018-02-01

With the increasing attention of networked control, system decomposition and distributed models show significant importance in the implementation of model-based control strategy. In this paper, a data-driven system decomposition and online distributed subsystem modelling algorithm was proposed for large-scale chemical processes. The key controlled variables are first partitioned by affinity propagation clustering algorithm into several clusters. Each cluster can be regarded as a subsystem. Then the inputs of each subsystem are selected by offline canonical correlation analysis between all process variables and its controlled variables. Process decomposition is then realised after the screening of input and output variables. When the system decomposition is finished, the online subsystem modelling can be carried out by recursively block-wise renewing the samples. The proposed algorithm was applied in the Tennessee Eastman process and the validity was verified.

GEOMORPHOLOGY. Experimental evidence for hillslope control of landscape scale.

PubMed

Sweeney, K E; Roering, J J; Ellis, C

2015-07-03

Landscape evolution theory suggests that climate sets the scale of landscape dissection by modulating the competition between diffusive processes that sculpt convex hillslopes and advective processes that carve concave valleys. However, the link between the relative dominance of hillslope and valley transport processes and landscape scale is difficult to demonstrate in natural landscapes due to the episodic nature of erosion. Here, we report results from laboratory experiments combining diffusive and advective processes in an eroding landscape. We demonstrate that rainsplash-driven disturbances in our experiments are a robust proxy for hillslope transport, such that increasing hillslope transport efficiency decreases drainage density. Our experimental results demonstrate how the coupling of climate-driven hillslope- and valley-forming processes, such as bioturbation and runoff, dictates the scale of eroding landscapes. Copyright © 2015, American Association for the Advancement of Science.

Polynomial chaos representation of databases on manifolds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soize, C., E-mail: christian.soize@univ-paris-est.fr; Ghanem, R., E-mail: ghanem@usc.edu

2017-04-15

Characterizing the polynomial chaos expansion (PCE) of a vector-valued random variable with probability distribution concentrated on a manifold is a relevant problem in data-driven settings. The probability distribution of such random vectors is multimodal in general, leading to potentially very slow convergence of the PCE. In this paper, we build on a recent development for estimating and sampling from probabilities concentrated on a diffusion manifold. The proposed methodology constructs a PCE of the random vector together with an associated generator that samples from the target probability distribution which is estimated from data concentrated in the neighborhood of the manifold. Themore » method is robust and remains efficient for high dimension and large datasets. The resulting polynomial chaos construction on manifolds permits the adaptation of many uncertainty quantification and statistical tools to emerging questions motivated by data-driven queries.« less

Collision-model approach to steering of an open driven qubit

NASA Astrophysics Data System (ADS)

Beyer, Konstantin; Luoma, Kimmo; Strunz, Walter T.

2018-03-01

We investigate quantum steering of an open quantum system by measurements on its environment in the framework of collision models. As an example we consider a coherently driven qubit dissipatively coupled to a bath. We construct local nonadaptive and adaptive as well as nonlocal measurement scenarios specifying explicitly the measured observable on the environment. Our approach shows transparently how the conditional evolution of the open system depends on the type of the measurement scenario and the measured observables. These can then be optimized for steering. The nonlocal measurement scenario leads to maximal violation of the used steering inequality at zero temperature. Further, we investigate the robustness of the constructed scenarios against thermal noise. We find generally that steering becomes harder at higher temperatures. Surprisingly, the system can be steered even when bipartite entanglement between the system and individual subenvironments vanishes.

Implosion of multilayered cylindrical targets driven by intense heavy ion beams.

PubMed

Piriz, A R; Portugues, R F; Tahir, N A; Hoffmann, D H H

2002-11-01

An analytical model for the implosion of a multilayered cylindrical target driven by an intense heavy ion beam has been developed. The target is composed of a cylinder of frozen hydrogen or deuterium, which is enclosed in a thick shell of solid lead. This target has been designed for future high-energy-density matter experiments to be carried out at the Gesellschaft für Schwerionenforschung, Darmstadt. The model describes the implosion dynamics including the motion of the incident shock and the first reflected shock and allows for calculation of the physical conditions of the hydrogen at stagnation. The model predicts that the conditions of the compressed hydrogen are not sensitive to significant variations in target and beam parameters. These predictions are confirmed by one-dimensional numerical simulations and thus allow for a robust target design.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

G-Protein-Coupled Receptor Gpr17 Expression in Two Multiple Sclerosis Remyelination Models.

PubMed

Nyamoya, Stella; Leopold, Patrizia; Becker, Birte; Beyer, Cordian; Hustadt, Fabian; Schmitz, Christoph; Michel, Anne; Kipp, Markus

2018-06-05

In multiple sclerosis patients, demyelination is prominent in both the white and gray matter. Chronic clinical deficits are known to result from acute or chronic injury to the myelin sheath and inadequate remyelination. The underlying molecular mechanisms of remyelination and its failure remain currently unclear. Recent studies have recognized G protein-coupled receptor 17 (GPR17) as an important regulator of oligodendrocyte development and remyelination. So far, the relevance of GPR17 for myelin repair was mainly tested in remyelinating white matter lesions. The relevance of GPR17 for gray matter remyelination as well as remyelination of chronic white matter lesions was not addressed so far. Here, we provide a detailed characterization of GPR17 expression during experimental de- and remyelination. Experimental lesions with robust and limited endogenous remyelination capacity were established by either acute or chronic cuprizone-induced demyelination. Furthermore, remyelinating lesions were induced by the focal injection of lysophosphatidylcholine (LPC) into the corpus callosum. GPR17 expression was analyzed by complementary techniques including immunohistochemistry, in situ hybridization, and real-time PCR. In control animals, GPR17 + cells were evenly distributed in the corpus callosum and cortex and displayed a highly ramified morphology. Virtually all GPR17 + cells also expressed the oligodendrocyte-specific transcription factor OLIG2. After acute cuprizone-induced demyelination, robust endogenous remyelination was evident in the white matter corpus callosum but not in the gray matter cortex. Endogenous callosal remyelination was paralleled by a robust induction of GPR17 expression which was absent in the gray matter cortex. Higher numbers of GPR17 + cells were as well observed after LPC-induced focal white matter demyelination. In contrast, densities of GPR17 + cells were comparable to control animals after chronic cuprizone-induced demyelination indicating quiescence of this cell population. Our findings demonstrate that GPR17 expression induction correlates with acute demyelination and sufficient endogenous remyelination. This strengthens the view that manipulation of this receptor might be a therapeutic opportunity to support endogenous remyelination.

Protein kinase CK2 modulates IL-6 expression in inflammatory breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Drygin, Denis, E-mail: ddrygin@cylenepharma.com; Ho, Caroline B.; Omori, Mayuko

Highlights: Black-Right-Pointing-Pointer We examine the potential cross-talk between CK2 and IL-6. Black-Right-Pointing-Pointer Inhibition of CK2 by siRNA or CX-4945 inhibits expression of IL-6 in models of IBC. Black-Right-Pointing-Pointer Treatment of IBC patient in the clinic with CX-4945 reduces her IL-6 plasma levels. Black-Right-Pointing-Pointer We demonstrate that CK2 is a potential therapeutic target for IL-6 driven diseases. -- Abstract: Inflammatory breast cancer is driven by pro-angiogenic and pro-inflammatory cytokines. One of them Interleukin-6 (IL-6) is implicated in cancer cell proliferation and survival, and promotes angiogenesis, inflammation and metastasis. While IL-6 has been shown to be upregulated by several oncogenes, the mechanismmore » behind this phenomenon is not well characterized. Here we demonstrate that the pleotropic Serine/Threonine kinase CK2 is implicated in the regulation of IL-6 expression in a model of inflammatory breast cancer. We used siRNAs targeted toward CK2 and a selective small molecule inhibitor of CK2, CX-4945, to inhibit the expression and thus suppress the secretion of IL-6 in in vitro as well as in vivo models. Moreover, we report that in a clinical trial, CX-4945 was able to dramatically reduce IL-6 levels in plasma of an inflammatory breast cancer patient. Our data shed a new light on the regulation of IL-6 expression and position CX-4945 and potentially other inhibitors of CK2, for the treatment of IL-6-driven cancers and possibly other diseases where IL-6 is instrumental, including rheumatoid arthritis.« less

Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death

PubMed Central

Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M

2016-01-01

The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393

Mesenchymal stem cell-based HSP70 promoter-driven VEGFA induction by resveratrol promotes angiogenesis in a mouse model.

PubMed

Chen, Young-Bin; Lan, Ying-Wei; Hung, Tsai-Hsien; Chen, Lih-Geeng; Choo, Kong-Bung; Cheng, Winston T K; Lee, Hsuan-Shu; Chong, Kowit-Yu

2015-07-01

Several studies of stem cell-based gene therapy have indicated that long-lasting regeneration following vessel ischemia may be stimulated through VEGFA gene therapy and/or MSC transplantation for reduction of ischemic injury in limb ischemia and heart failure. The therapeutic potential of MSC transplantation can be further improved by genetically modifying MSCs with genes which enhance angiogenesis following ischemic injury. In the present study, we aimed to develop an approach in MSC-based therapy for repair and mitigation of ischemic injury and regeneration of damaged tissues in ischemic disease. HSP70 promoter-driven VEGFA expression was induced by resveratrol (RSV) in MSCs, and in combination with known RSV biological functions, the protective effects of our approach were investigated by using ex vivo aortic ring coculture system and a 3D scaffolds in vivo model. Results of this investigation demonstrated that HSP promoter-driven VEGFA expression in MSC increased approximately 2-fold over the background VEGFA levels upon HSP70 promoter induction by RSV. Exposure of HUVEC cells to medium containing MSC in which VEGFA had been induced by cis-RSV enhanced tube formation in the treated HUVEC cells. RSV-treated MSC cells differentiated into endothelial-like phenotypes, exhibiting markedly elevated expression of endothelial cell markers. These MSCs also induced aortic ring sprouting, characteristic of neovascular formation from pre-existing vessels, and additionally promoted neovascularization at the MSC transplantation site in a mouse model. These observations support a hypothesis that VEGFA expression induced by cis-RSV acting on the HSP70 promoter in transplanted MSC augments the angiogenic effects of stem cell gene therapy. The use of an inducible system also vastly reduces possible clinical risks associated with constitutive VEGFA expression.

A sustained increase in plasma NEFA upregulates the Toll-like receptor network in human muscle.

PubMed

Hussey, Sophie E; Lum, Helen; Alvarez, Andrea; Cipriani, Yolanda; Garduño-Garcia, Jesús; Anaya, Luis; Dube, John; Musi, Nicolas

2014-03-01

Insulin-sensitive tissues (muscle, liver) of individuals with obesity and type 2 diabetes mellitus are in a state of low-grade inflammation, characterised by increased Toll-like receptor (TLR) expression and TLR-driven signalling. However, the cause of this mild inflammatory state is unclear. We tested the hypothesis that a prolonged mild increase in plasma NEFA will increase TLR expression and TLR-driven signalling (nuclear factor κB [NFκB] and mitogen-activated kinase [MAPK]) and impair insulin action in muscle of lean healthy individuals. Twelve lean, normal-glucose-tolerant participants were randomised to receive a 48 h infusion (30 ml/h) of saline or Intralipid followed by a euglycaemic-hyperinsulinaemic clamp. Vastus lateralis muscle biopsies were performed before and during the clamp. Lipid infusion impaired insulin-stimulated IRS-1 tyrosine phosphorylation and reduced peripheral insulin sensitivity (p < 0.01). The elevation in circulating NEFA increased expression of TLR3, TLR4 and TLR5, and several MAPK (MAPK8, MAP4K4, MAP2K3) and inhibitor of κB kinase-NFκB (CHUK [IKKA], c-REL [REL] and p65 [RELA, NFKB3, p65]) signalling genes (p < 0.05). The lipid infusion also increased extracellular signal-regulated kinase (ERK) phosphorylation (p < 0.05) and tended to reduce the content of inhibitor of kappa Bα (p = 0.09). The muscle content of most diacylglycerol, ceramide and acylcarnitine species was unaffected. In summary, insulin resistance induced by prolonged low-dose lipid infusion occurs together with increased TLR-driven inflammatory signalling and impaired insulin-stimulated IRS-1 tyrosine phosphorylation. A sustained, mild elevation in plasma NEFA is sufficient to increase TLR expression and TLR-driven signalling (NFκB and MAPK) in lean individuals. The activation of this pathway by NEFA may be involved in the pathogenesis of insulin resistance in humans. ClinicalTrials.gov NCT01740817.

A sustained increase in plasma NEFA upregulates the Toll-like receptor network in human muscle

PubMed Central

Hussey, Sophie E.; Lum, Helen; Alvarez, Andrea; Cipriani, Yolanda; Garduño-Garcia, José de Jesús; Anaya, Luis; Dube, John; Musi, Nicolas

2014-01-01

Aims/hypothesis Insulin-sensitive tissues (muscle, liver) of individuals with obesity and type 2 diabetes mellitus are in a state of low-grade inflammation, characterised by increased Toll-like receptor (TLR) expression and TLR-driven signalling. However, the cause of this mild inflammatory state is unclear. We tested the hypothesis that a prolonged mild increase in plasma NEFA will increase TLR expression and TLR-driven signalling (nuclear factor κB [NFκB] and mitogen-activated kinase [MAPK]) and impair insulin action in muscle of lean healthy individuals. Methods Twelve lean, normal-glucose-tolerant participants were randomised to receive a 48 h infusion (30 ml/h) of saline or Intralipid followed by a euglycaemic–hyperinsulinaemic clamp. Vastus lateralis muscle biopsies were performed before and during the clamp. Results Lipid infusion impaired insulin-stimulated IRS-1 tyrosine phosphorylation and reduced peripheral insulin sensitivity (p < 0.01). The elevation in circulating NEFA increased expression of TLR3, TLR4 and TLR5, and several MAPK (MAPK8, MAP4K4, MAP2K3) and inhibitor of κB kinase-NFκB (CHUK [IKKA], c-REL [REL] and p65 [RELA, NFKB3,p65]) signalling genes (p < 0.05). The lipid infusion also increased extracellular signal-regulated kinase (ERK) phosphorylation (p < 0.05) and tended to reduce the content of nuclear factor of light polypeptide gene enhancer in B cells inhibitor α (p = 0.09). The muscle content of most diacyglycerol, ceramide and acylcarnitine species was unaffected. In summary, insulin resistance induced by prolonged low-dose lipid infusion occurs together with increased TLR-driven inflammatory signalling and impaired insulin-stimulated IRS-1 tyrosine phosphorylation. Conclusions/interpretation A sustained, mild elevation in plasma NEFA is sufficient to increase TLR expression and TLR-driven signalling (NFκB and MAPK) in lean individuals. The activation of this pathway by NEFA may be involved in the pathogenesis of insulin resistance in humans. PMID:24337154

Knowledge-driven genomic interactions: an application in ovarian cancer.

PubMed

Kim, Dokyoon; Li, Ruowang; Dudek, Scott M; Frase, Alex T; Pendergrass, Sarah A; Ritchie, Marylyn D

2014-01-01

Effective cancer clinical outcome prediction for understanding of the mechanism of various types of cancer has been pursued using molecular-based data such as gene expression profiles, an approach that has promise for providing better diagnostics and supporting further therapies. However, clinical outcome prediction based on gene expression profiles varies between independent data sets. Further, single-gene expression outcome prediction is limited for cancer evaluation since genes do not act in isolation, but rather interact with other genes in complex signaling or regulatory networks. In addition, since pathways are more likely to co-operate together, it would be desirable to incorporate expert knowledge to combine pathways in a useful and informative manner. Thus, we propose a novel approach for identifying knowledge-driven genomic interactions and applying it to discover models associated with cancer clinical phenotypes using grammatical evolution neural networks (GENN). In order to demonstrate the utility of the proposed approach, an ovarian cancer data from the Cancer Genome Atlas (TCGA) was used for predicting clinical stage as a pilot project. We identified knowledge-driven genomic interactions associated with cancer stage from single knowledge bases such as sources of pathway-pathway interaction, but also knowledge-driven genomic interactions across different sets of knowledge bases such as pathway-protein family interactions by integrating different types of information. Notably, an integration model from different sources of biological knowledge achieved 78.82% balanced accuracy and outperformed the top models with gene expression or single knowledge-based data types alone. Furthermore, the results from the models are more interpretable because they are framed in the context of specific biological pathways or other expert knowledge. The success of the pilot study we have presented herein will allow us to pursue further identification of models predictive of clinical cancer survival and recurrence. Understanding the underlying tumorigenesis and progression in ovarian cancer through the global view of interactions within/between different biological knowledge sources has the potential for providing more effective screening strategies and therapeutic targets for many types of cancer.

Decentralized formation flying control in a multiple-team hierarchy.

PubMed

Mueller, Joseph B; Thomas, Stephanie J

2005-12-01

In recent years, formation flying has been recognized as an enabling technology for a variety of mission concepts in both the scientific and defense arenas. Examples of developing missions at NASA include magnetospheric multiscale (MMS), solar imaging radio array (SIRA), and terrestrial planet finder (TPF). For each of these missions, a multiple satellite approach is required in order to accomplish the large-scale geometries imposed by the science objectives. In addition, the paradigm shift of using a multiple satellite cluster rather than a large, monolithic spacecraft has also been motivated by the expected benefits of increased robustness, greater flexibility, and reduced cost. However, the operational costs of monitoring and commanding a fleet of close-orbiting satellites is likely to be unreasonable unless the onboard software is sufficiently autonomous, robust, and scalable to large clusters. This paper presents the prototype of a system that addresses these objectives-a decentralized guidance and control system that is distributed across spacecraft using a multiple team framework. The objective is to divide large clusters into teams of "manageable" size, so that the communication and computation demands driven by N decentralized units are related to the number of satellites in a team rather than the entire cluster. The system is designed to provide a high level of autonomy, to support clusters with large numbers of satellites, to enable the number of spacecraft in the cluster to change post-launch, and to provide for on-orbit software modification. The distributed guidance and control system will be implemented in an object-oriented style using a messaging architecture for networking and threaded applications (MANTA). In this architecture, tasks may be remotely added, removed, or replaced post launch to increase mission flexibility and robustness. This built-in adaptability will allow software modifications to be made on-orbit in a robust manner. The prototype system, which is implemented in Matlab, emulates the object-oriented and message-passing features of the MANTA software. In this paper, the multiple team organization of the cluster is described, and the modular software architecture is presented. The relative dynamics in eccentric reference orbits is reviewed, and families of periodic, relative trajectories are identified, expressed as sets of static geometric parameters. The guidance law design is presented, and an example reconfiguration scenario is used to illustrate the distributed process of assigning geometric goals to the cluster. Next, a decentralized maneuver planning approach is presented that utilizes linear-programming methods to enact reconfiguration and coarse formation keeping maneuvers. Finally, a method for performing online collision avoidance is discussed, and an example is provided to gauge its performance.

Phosphoinositide-Driven Epithelial Proliferation in Prostatic Inflammation

DTIC Science & Technology

2008-01-01

that IL-1β expression is localized to the urethral urothelium during development, and little or no expression is observed in the developing prostatic...ducts [Figure 3B]. By comparison, IL-1α expression is found both in the urethral urothelium and in the developing prostatic ducts [Figure 3A]. In...adult [C]. Hyperplasia was induced by E. coli for 5 days. In contrast, IL-1β [B,D] expression is localized to the urethral urothelium at P10 [B] and

Allen Brain Atlas-Driven Visualizations: a web-based gene expression energy visualization tool.

PubMed

Zaldivar, Andrew; Krichmar, Jeffrey L

2014-01-01

The Allen Brain Atlas-Driven Visualizations (ABADV) is a publicly accessible web-based tool created to retrieve and visualize expression energy data from the Allen Brain Atlas (ABA) across multiple genes and brain structures. Though the ABA offers their own search engine and software for researchers to view their growing collection of online public data sets, including extensive gene expression and neuroanatomical data from human and mouse brain, many of their tools limit the amount of genes and brain structures researchers can view at once. To complement their work, ABADV generates multiple pie charts, bar charts and heat maps of expression energy values for any given set of genes and brain structures. Such a suite of free and easy-to-understand visualizations allows for easy comparison of gene expression across multiple brain areas. In addition, each visualization links back to the ABA so researchers may view a summary of the experimental detail. ABADV is currently supported on modern web browsers and is compatible with expression energy data from the Allen Mouse Brain Atlas in situ hybridization data. By creating this web application, researchers can immediately obtain and survey numerous amounts of expression energy data from the ABA, which they can then use to supplement their work or perform meta-analysis. In the future, we hope to enable ABADV across multiple data resources.

Patterns of activity expressed by juvenile horseshoe crabs.

PubMed

Dubofsky, E A; Simpson, S D; Chabot, Christopher C; Watson, Winsor H

2013-09-01

Adult American horseshoe crabs, Limulus polyphemus, possess endogenous circadian and circatidal clocks controlling visual sensitivity and locomotion, respectively. The goal of this study was to determine the types of activity rhythms expressed by juvenile horseshoe crabs (n = 24) when exposed to a 14:10 light/dark cycle (LD) for 10 days, followed by 10 days of constant darkness (DD). Horseshoe crab activity was recorded with a digital time-lapse video system that used an infrared-sensitive camera so animals could be monitored at night. In LD, 15 animals expressed daily patterns of activity, 6 displayed a circatidal pattern, and the remaining 3 were arrhythmic. Of the 15 animals with daily patterns of locomotion, 7 had a significant preference (P < 0.05) for diurnal activity and 3 for nocturnal activity; the remainder did not express a significant preference for day or night activity. In DD, 13 horseshoe crabs expressed circatidal rhythms and 8 maintained a pattern of about 24 h. Although these results suggest the presence of a circadian clock influencing circatidal patterns of locomotion, these apparent circadian rhythms may actually represent the expression of just one of the two bouts of activity driven by the putative circalunidian clocks that control their tidal rhythms. Overall, these results indicate that, like adults, juvenile horseshoe crabs express both daily and tidal patterns of activity and that at least one, and maybe both, of these patterns is driven by endogenous clocks.

Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.

PubMed

Mikami, Masafumi; Toki, Seiichi; Endo, Masaki

2015-08-01

The CRISPR/Cas9 system is an efficient tool used for genome editing in a variety of organisms. Despite several recent reports of successful targeted mutagenesis using the CRISPR/Cas9 system in plants, in each case the target gene of interest, the Cas9 expression system and guide-RNA (gRNA) used, and the tissues used for transformation and subsequent mutagenesis differed, hence the reported frequencies of targeted mutagenesis cannot be compared directly. Here, we evaluated mutation frequency in rice using different Cas9 and/or gRNA expression cassettes under standardized experimental conditions. We introduced Cas9 and gRNA expression cassettes separately or sequentially into rice calli, and assessed the frequency of mutagenesis at the same endogenous targeted sequences. Mutation frequencies differed significantly depending on the Cas9 expression cassette used. In addition, a gRNA driven by the OsU6 promoter was superior to one driven by the OsU3 promoter. Using an all-in-one expression vector harboring the best combined Cas9/gRNA expression cassette resulted in a much improved frequency of targeted mutagenesis in rice calli, and bi-allelic mutant plants were produced in the T0 generation. The approach presented here could be adapted to optimize the construction of Cas9/gRNA cassettes for genome editing in a variety of plants.

A Systems' Biology Approach to Study MicroRNA-Mediated Gene Regulatory Networks

PubMed Central

Kunz, Manfred; Vera, Julio; Wolkenhauer, Olaf

2013-01-01

MicroRNAs (miRNAs) are potent effectors in gene regulatory networks where aberrant miRNA expression can contribute to human diseases such as cancer. For a better understanding of the regulatory role of miRNAs in coordinating gene expression, we here present a systems biology approach combining data-driven modeling and model-driven experiments. Such an approach is characterized by an iterative process, including biological data acquisition and integration, network construction, mathematical modeling and experimental validation. To demonstrate the application of this approach, we adopt it to investigate mechanisms of collective repression on p21 by multiple miRNAs. We first construct a p21 regulatory network based on data from the literature and further expand it using algorithms that predict molecular interactions. Based on the network structure, a detailed mechanistic model is established and its parameter values are determined using data. Finally, the calibrated model is used to study the effect of different miRNA expression profiles and cooperative target regulation on p21 expression levels in different biological contexts. PMID:24350286

Synaptic Plasticity and NO-cGMP-PKG Signaling Coordinately Regulate ERK-Driven Gene Expression in the Lateral Amygdala and in the Auditory Thalamus Following Pavlovian Fear Conditioning

ERIC Educational Resources Information Center

Ota, Kristie T.; Monsey, Melissa S.; Wu, Melissa S.; Young, Grace J.; Schafe, Glenn E.

2010-01-01

We have recently hypothesized that NO-cGMP-PKG signaling in the lateral nucleus of the amygdala (LA) during auditory fear conditioning coordinately regulates ERK-driven transcriptional changes in both auditory thalamic (MGm/PIN) and LA neurons that serve to promote pre- and postsynaptic alterations at thalamo-LA synapses, respectively. In the…

Deletion of Nrf2 reduces skeletal mechanical properties and decreases load-driven bone formation.

PubMed

Sun, Yong-Xin; Li, Lei; Corry, Kylie A; Zhang, Pei; Yang, Yang; Himes, Evan; Mihuti, Cristina Layla; Nelson, Cecilia; Dai, Guoli; Li, Jiliang

2015-05-01

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor expressed in many cell types, including osteoblasts, osteocytes, and osteoclasts. Nrf2 has been considered a master regulator of cytoprotective genes against oxidative and chemical insults. The lack of Nrf2 can induce pathologies in multiple organs. The aim of this study was to investigate the role of Nrf2 in load-driven bone metabolism using Nrf2 knockout (KO) mice. Compared to age-matched littermate wild-type controls, Nrf2 KO mice have significantly lowered femoral bone mineral density (-7%, p<0.05), bone formation rate (-40%, p<0.05), as well as ultimate force (-11%, p<0.01). The ulna loading experiment showed that Nrf2 KO mice were less responsive than littermate controls, as indicated by reduction in relative mineralizing surface (rMS/BS, -69%, p<0.01) and relative bone formation rate (rBFR/BS, -84%, p<0.01). Furthermore, deletion of Nrf2 suppressed the load-driven gene expression of antioxidant enzymes and Wnt5a in cultured primary osteoblasts. Taken together, the results suggest that the loss-of-function mutation of Nrf2 in bone impairs bone metabolism and diminishes load-driven bone formation. Copyright © 2015 Elsevier Inc. All rights reserved.

Chronic paroxetine treatment prevents disruption of methamphetamine-sensitive circadian oscillator in a transgenic mouse model of Huntington's disease.

PubMed

Ouk, Koliane; Aungier, Juliet; Cuesta, Marc; Morton, A Jennifer

2018-03-15

Circadian abnormalities seen in Huntington's disease (HD) patients are recapitulated in several HD transgenic mouse models. In mice, alongside the master clock located in the suprachiasmatic nucleus (SCN), two other oscillators may influence circadian behaviour. These are the food-entrainable oscillator (FEO) and the methamphetamine-sensitive circadian oscillator (MASCO). SCN- and MASCO- (but not FEO-) driven rhythms are progressively disrupted in the R6/2 mouse model of HD. MASCO-driven rhythms are induced by chronic treatment with low dose of methamphetamine and characterised by an increase in period length to greater than 24 h. Interestingly, the rhythms mediated by MASCO deteriorate earlier than those mediated by the SCN in R6/2 mice. Here, we used a pharmacological strategy to investigate the mechanisms underlying MASCO-driven rhythms in WT mice. In contrast to methamphetamine, chronic cocaine was ineffective in generating a MASCO-like component of activity although it markedly increased locomotion. Furthermore, neither blocking dopamine (DA) receptors (with the DA antagonist haloperidol) nor blocking neurotransmission by inhibiting the activity of vesicular monoamine transporter (with reserpine) prevented the expression of the MASCO-driven rhythms, although both treatments downregulated locomotor activity. Interestingly, chronic treatment with paroxetine, a serotonin-specific reuptake inhibitor commonly used as antidepressant in HD, was able to restore the expression of MASCO-driven rhythms in R6/2 mice. Thus, MASCO-driven rhythms appear to be mediated by both serotoninergic and dopaminergic systems. This supports the idea that abnormalities in MASCO output may contribute to both the HD circadian and psychiatric phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cytokine stimulation of MUC4 expression in human female reproductive tissue carcinoma cell lines and endometrial cancer.

PubMed

Chapela, Patricia J; Broaddus, Russell R; Hawkins, Shannon M; Lessey, Bruce A; Carson, Daniel D

2015-11-01

MUC4, a transmembrane glycoprotein, interferes with cell adhesion, and promotes EGFR signaling in cancer. Studies in rat models have demonstrated steroid hormonal regulation of endometrial MUC4 expression. In this study, qRT-PCR screening of mouse tissues determined that Muc4 mRNA also was robustly expressed in mouse uteri. Previous studies from our labs have demonstrated MUC4 mRNA was expressed at levels <1% of MUC1 mRNA in human endometrium and endometriotic tissue. Multiple human endometrial adenocarcinoma cell lines were assayed for MUC4 mRNA expression revealing extremely low basal expression in the Ishikawa, RL-95-2, AN3CA, and KLE lines. Moderate to high expression was observed in HEC50 and HEC-1A cells. MUC4 mRNA expression was not affected by progesterone and/or estrogen treatment, but was greatly stimulated at both mRNA and protein levels by proinflammatory cytokines (IFN-γ and TNF-α), particularly when used in combination. In endometrial tissue, MUC4 mRNA levels did not change significantly between normal or cancerous samples; although, a subset of patients with grade 1 and 2 tumors displayed substantially higher expression. Likewise, immunostaining of human endometrial adenocarcinoma tissues revealed little to no staining in many patients (low MUC4), but strong staining in some patients (high MUC4) independent of cancer grade. In cases where staining was observed, it was heterogeneous with some cells displaying robust MUC4 expression and others displaying little or no staining. Collectively, these observations demonstrate that while MUC4 is highly expressed in the mouse uterus, it is not a major mucin in normal human endometrium. Rather, MUC4 is a potential marker of endometrial adenocarcinoma in a subset of patients. © 2015 Wiley Periodicals, Inc.

Application of stakeholder-based and modelling approaches for supporting robust adaptation decision making under future climatic uncertainty and changing urban-agricultural water demand

NASA Astrophysics Data System (ADS)

Bhave, Ajay; Dessai, Suraje; Conway, Declan; Stainforth, David

2016-04-01

Deep uncertainty in future climate change and socio-economic conditions necessitates the use of assess-risk-of-policy approaches over predict-then-act approaches for adaptation decision making. Robust Decision Making (RDM) approaches embody this principle and help evaluate the ability of adaptation options to satisfy stakeholder preferences under wide-ranging future conditions. This study involves the simultaneous application of two RDM approaches; qualitative and quantitative, in the Cauvery River Basin in Karnataka (population ~23 million), India. The study aims to (a) determine robust water resources adaptation options for the 2030s and 2050s and (b) compare the usefulness of a qualitative stakeholder-driven approach with a quantitative modelling approach. For developing a large set of future scenarios a combination of climate narratives and socio-economic narratives was used. Using structured expert elicitation with a group of climate experts in the Indian Summer Monsoon, climatic narratives were developed. Socio-economic narratives were developed to reflect potential future urban and agricultural water demand. In the qualitative RDM approach, a stakeholder workshop helped elicit key vulnerabilities, water resources adaptation options and performance criteria for evaluating options. During a second workshop, stakeholders discussed and evaluated adaptation options against the performance criteria for a large number of scenarios of climatic and socio-economic change in the basin. In the quantitative RDM approach, a Water Evaluation And Planning (WEAP) model was forced by precipitation and evapotranspiration data, coherent with the climatic narratives, together with water demand data based on socio-economic narratives. We find that compared to business-as-usual conditions options addressing urban water demand satisfy performance criteria across scenarios and provide co-benefits like energy savings and reduction in groundwater depletion, while options reducing agricultural water demand significantly affect downstream water availability. Water demand options demonstrate potential to improve environmental flow conditions and satisfy legal water supply requirements for downstream riparian states. On the other hand, currently planned large scale infrastructural projects demonstrate reduced value in certain scenarios, illustrating the impacts of lock-in effects of large scale infrastructure. From a methodological perspective, we find that while the stakeholder-driven approach revealed robust options in a resource-light manner and helped initiate much needed interaction amongst stakeholders, the modelling approach provides complementary quantitative information. The study reveals robust adaptation options for this important basin and provides a strong methodological basis for carrying out future studies that support adaptation decision making.

kruX: matrix-based non-parametric eQTL discovery

PubMed Central

2014-01-01

Background The Kruskal-Wallis test is a popular non-parametric statistical test for identifying expression quantitative trait loci (eQTLs) from genome-wide data due to its robustness against variations in the underlying genetic model and expression trait distribution, but testing billions of marker-trait combinations one-by-one can become computationally prohibitive. Results We developed kruX, an algorithm implemented in Matlab, Python and R that uses matrix multiplications to simultaneously calculate the Kruskal-Wallis test statistic for several millions of marker-trait combinations at once. KruX is more than ten thousand times faster than computing associations one-by-one on a typical human dataset. We used kruX and a dataset of more than 500k SNPs and 20k expression traits measured in 102 human blood samples to compare eQTLs detected by the Kruskal-Wallis test to eQTLs detected by the parametric ANOVA and linear model methods. We found that the Kruskal-Wallis test is more robust against data outliers and heterogeneous genotype group sizes and detects a higher proportion of non-linear associations, but is more conservative for calling additive linear associations. Conclusion kruX enables the use of robust non-parametric methods for massive eQTL mapping without the need for a high-performance computing infrastructure and is freely available from http://krux.googlecode.com. PMID:24423115

Robust Gaussian Graphical Modeling via l1 Penalization

PubMed Central

Sun, Hokeun; Li, Hongzhe

2012-01-01

Summary Gaussian graphical models have been widely used as an effective method for studying the conditional independency structure among genes and for constructing genetic networks. However, gene expression data typically have heavier tails or more outlying observations than the standard Gaussian distribution. Such outliers in gene expression data can lead to wrong inference on the dependency structure among the genes. We propose a l1 penalized estimation procedure for the sparse Gaussian graphical models that is robustified against possible outliers. The likelihood function is weighted according to how the observation is deviated, where the deviation of the observation is measured based on its own likelihood. An efficient computational algorithm based on the coordinate gradient descent method is developed to obtain the minimizer of the negative penalized robustified-likelihood, where nonzero elements of the concentration matrix represents the graphical links among the genes. After the graphical structure is obtained, we re-estimate the positive definite concentration matrix using an iterative proportional fitting algorithm. Through simulations, we demonstrate that the proposed robust method performs much better than the graphical Lasso for the Gaussian graphical models in terms of both graph structure selection and estimation when outliers are present. We apply the robust estimation procedure to an analysis of yeast gene expression data and show that the resulting graph has better biological interpretation than that obtained from the graphical Lasso. PMID:23020775

Emergence of robustness in networks of networks

NASA Astrophysics Data System (ADS)

Roth, Kevin; Morone, Flaviano; Min, Byungjoon; Makse, Hernán A.

2017-06-01

A model of interdependent networks of networks (NONs) was introduced recently [Proc. Natl. Acad. Sci. (USA) 114, 3849 (2017), 10.1073/pnas.1620808114] in the context of brain activation to identify the neural collective influencers in the brain NON. Here we investigate the emergence of robustness in such a model, and we develop an approach to derive an exact expression for the random percolation transition in Erdös-Rényi NONs of this kind. Analytical calculations are in agreement with numerical simulations, and highlight the robustness of the NON against random node failures, which thus presents a new robust universality class of NONs. The key aspect of this robust NON model is that a node can be activated even if it does not belong to the giant mutually connected component, thus allowing the NON to be built from below the percolation threshold, which is not possible in previous models of interdependent networks. Interestingly, the phase diagram of the model unveils particular patterns of interconnectivity for which the NON is most vulnerable, thereby marking the boundary above which the robustness of the system improves with increasing dependency connections.

Task-Driven Activity Reduces the Cortical Activity Space of the Brain: Experiment and Whole-Brain Modeling

PubMed Central

Hagmann, Patric; Deco, Gustavo

2015-01-01

How a stimulus or a task alters the spontaneous dynamics of the brain remains a fundamental open question in neuroscience. One of the most robust hallmarks of task/stimulus-driven brain dynamics is the decrease of variability with respect to the spontaneous level, an effect seen across multiple experimental conditions and in brain signals observed at different spatiotemporal scales. Recently, it was observed that the trial-to-trial variability and temporal variance of functional magnetic resonance imaging (fMRI) signals decrease in the task-driven activity. Here we examined the dynamics of a large-scale model of the human cortex to provide a mechanistic understanding of these observations. The model allows computing the statistics of synaptic activity in the spontaneous condition and in putative tasks determined by external inputs to a given subset of brain regions. We demonstrated that external inputs decrease the variance, increase the covariances, and decrease the autocovariance of synaptic activity as a consequence of single node and large-scale network dynamics. Altogether, these changes in network statistics imply a reduction of entropy, meaning that the spontaneous synaptic activity outlines a larger multidimensional activity space than does the task-driven activity. We tested this model’s prediction on fMRI signals from healthy humans acquired during rest and task conditions and found a significant decrease of entropy in the stimulus-driven activity. Altogether, our study proposes a mechanism for increasing the information capacity of brain networks by enlarging the volume of possible activity configurations at rest and reliably settling into a confined stimulus-driven state to allow better transmission of stimulus-related information. PMID:26317432

Optics of human eye: 400 years of exploration from Galileo's time.

PubMed

Artal, Pablo; Tabernero, Juan

2010-06-01

We present a brief historical background and a description of the main features of the eye's optical properties: the eye is a simple, but rather optimized, optical instrument. It is only since Galileo's time that the importance of the eye as a part of different optical instruments has driven a continuous scientific exploration of ocular optics. In the past decade, the use of wavefront sensing technology allowed us to complete our understating of eye optics as a robust aplanatic system.

Care staff perceptions of a social robot called Paro and a look-alike Plush Toy: a descriptive qualitative approach.

PubMed

Moyle, Wendy; Bramble, Marguerite; Jones, Cindy; Murfield, Jenny

2018-03-01

Social robots such as Paro, a therapeutic companion robot, have recently been introduced into dementia care as a means to reduce behavioural and psychological symptoms of dementia. The purpose of this study was to explore care staff perceptions of Paro and a look-alike non-robotic animal, including benefits and limitations in dementia care. The study assumed a descriptive qualitative approach, nested within a large cluster-randomised controlled trial. We interviewed a subsample of 20 facility care staff, from nine long-term care facilities in Southeast Queensland, Australia. Thematic analysis of the data, which was inductive and data-driven, was undertaken with the assistance of the qualitative software, ATLAS.ti®. The findings refer to four categories: increasing excitement for Paro and decreasing enthusiasm for Plush Toy; value and function of Paro; opportunities for engagement; and alternatives vs. robustness. Staff caring for people with dementia preferred Paro compared to a look-alike Plush Toy. Staff identified that Paro had the potential to improve quality of life for people with dementia, whereas the Plush Toy had limitations when compared to Paro. However, participants expressed concern that the cost of Paro could reduce opportunities for use within aged care.

The Unidata LDM Data Distribution System

NASA Astrophysics Data System (ADS)

Emmerson, S.; Yoksas, T. C.; Weber, W. J.; Schmidt, M.

2010-12-01

The Unidata LDM is a near real-time, event-driven system for transmitting frequently-generated data-products, 24/7, from a producer to multiple subscribers using the Internet. Once received, a data-product is processed according to user specifications. A data-product can be anything up to 4 gigabytes in size. Downstream LDM-s register a regular expression based selection predicate with upstream LDM-s. Network topologies include point-to-point, star, and tree. Based on ONC RPC, the LDM system is extremely robust and efficient. Since its initial release in 1994, a network of LDM-s called the Internet Data Distribution (IDD) system has been the primary means by which many if not most Earth Sciences departments in the US obtain and process meteorological data (up to 20 GB/hour and 250k products/hour) with latencies measured in seconds or less. Data-products include numerical model output, radar data, WMO bulletins, and lightning data. Users of the LDM also include the international atmospheric science university community, NOAA, NASA, USGS, the US military, ECMWF, and the meteorological agencies of China, Australia, Brazil, South Korea, and Vietnam. The LDM is the highest volume advanced application on Internet-2 (currently averaging 27 terabytes per week). The LDM history and architecture is presented together with an analysis of its strengths and weaknesses.

Regulation of the ErbB network by the MIG6 feedback loop in physiology, tumor suppression and responses to oncogene-targeted therapeutics.

PubMed

Anastasi, Sergio; Lamberti, Dante; Alemà, Stefano; Segatto, Oreste

2016-02-01

The ErbB signaling network instructs the execution of key cellular programs, such as cell survival, proliferation and motility, through the generation of robust signals of defined strength and duration. In contrast, unabated ErbB signaling disrupts tissue homeostasis and leads to cell transformation. Cells oppose the threat inherent in excessive ErbB activity through several mechanisms of negative feedback regulation. Inducible feedback inhibitors (IFIs) are expressed in the context of transcriptional responses triggered by ErbB signaling, thus being uniquely suited to regulate ErbB activity during the execution of complex cellular programs. This review focuses on MIG6, an IFI that restrains ErbB signaling by mediating ErbB kinase suppression and receptor down-regulation. We will review key issues in MIG6 function, regulation and tumor suppressor activity. Subsequently, the role for MIG6 loss in the pathogenesis of tumors driven by ErbB oncogenes as well as in the generation of cellular addiction to ErbB signaling will be discussed. We will conclude by analyzing feedback inhibition by MIG6 in the context of therapies directed against ErbB and non-ErbB oncogenes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Tunable elastin-like polypeptide hollow sphere as a high payload and controlled delivery gene depot.

PubMed

Dash, Biraja C; Mahor, Sunil; Carroll, Oliver; Mathew, Asha; Wang, Wenxin; Woodhouse, Kimberly A; Pandit, Abhay

2011-06-30

Self-assembly driven processes can be utilized to produce a variety of nanostructures useful for various in vitro and in vivo applications. Characteristics such as size, stability, biocompatibility, high therapeutic loading and controlled delivery of these nanostructures are particularly crucial in relation to in vivo applications. In this study, we report the fabrication of tunable monodispersed elastin-like polypeptide (ELP) hollow spheres of 100, 300, 500 and 1000 nm by exploiting the self-assembly property and net positive charge of ELP. The microbial transglutaminase (mTGase) cross-linking provided robustness and stability to the hollow spheres while maintaining surface functional groups for further modifications. The resulting hollow spheres showed a higher loading efficiency of plasmid DNA (pDNA) by using polyplex (~70 μg pDNA/mg of hollow sphere) than that of self-assembled ELP particles and demonstrated controlled release triggered by protease and elastase. Moreover, polyplex-loaded hollow spheres showed better cell viability than polyplex alone and yielded higher luciferase expression by providing protection against endosomal degradation. Overall, the monodispersed, tunable hollow spheres with a capability of post-functionalization can provide an exciting new opportunity for use in a range of therapeutic and diagnostic applications. Copyright © 2011 Elsevier B.V. All rights reserved.

Modeling the Pineapple Express phenomenon via Multivariate Extreme Value Theory

NASA Astrophysics Data System (ADS)

Weller, G.; Cooley, D. S.

2011-12-01

The pineapple express (PE) phenomenon is responsible for producing extreme winter precipitation events in the coastal and mountainous regions of the western United States. Because the PE phenomenon is also associated with warm temperatures, the heavy precipitation and associated snowmelt can cause destructive flooding. In order to study impacts, it is important that regional climate models from NARCCAP are able to reproduce extreme precipitation events produced by PE. We define a daily precipitation quantity which captures the spatial extent and intensity of precipitation events produced by the PE phenomenon. We then use statistical extreme value theory to model the tail dependence of this quantity as seen in an observational data set and each of the six NARCCAP regional models driven by NCEP reanalysis. We find that most NCEP-driven NARCCAP models do exhibit tail dependence between daily model output and observations. Furthermore, we find that not all extreme precipitation events are pineapple express events, as identified by Dettinger et al. (2011). The synoptic-scale atmospheric processes that drive extreme precipitation events produced by PE have only recently begun to be examined. Much of the current work has focused on pattern recognition, rather than quantitative analysis. We use daily mean sea-level pressure (MSLP) fields from NCEP to develop a "pineapple express index" for extreme precipitation, which exhibits tail dependence with our observed precipitation quantity for pineapple express events. We build a statistical model that connects daily precipitation output from the WRFG model, daily MSLP fields from NCEP, and daily observed precipitation in the western US. Finally, we use this model to simulate future observed precipitation based on WRFG output driven by the CCSM model, and our pineapple express index derived from future CCSM output. Our aim is to use this model to develop a better understanding of the frequency and intensity of extreme precipitation events produced by PE under climate change.

Immunogenicity and protective efficacy of a recombinant yellow fever vaccine against the murine malarial parasite Plasmodium yoelii.

PubMed

Stoyanov, Cristina T; Boscardin, Silvia B; Deroubaix, Stephanie; Barba-Spaeth, Giovanna; Franco, David; Nussenzweig, Ruth S; Nussenzweig, Michel; Rice, Charles M

2010-06-23

The live-attenuated yellow fever vaccine (YF17D) is one of the safest and most effective vaccines available today. Here, YF17D was genetically altered to express the circumsporozoite protein (CSP) from the murine malarial parasite Plasmodium yoelii. Reconstituted recombinant virus was viable and exhibited robust CSP expression. Immunization of naïve mice resulted in extensive proliferation of adoptively transferred CSP-specific transgenic CD8(+) T-cells. A single immunization of naïve mice with recombinant YF17D resulted in robust production of IFN-gamma by CD8(+) T-cells and IFN-gamma and IL-2 by CD4(+) T-cells. A prime-boost regimen consisting of recombinant virus followed by a low-dose of irradiated sporozoites conferred protection against challenge with P. yoelii. Taken together, these results show that recombinant YF17D can efficiently express CSP in culture, and prime a protective immune response in vivo. (c) 2010 Elsevier Ltd. All rights reserved.

Hydrogen-driven asymmetric reduction of hydroxyacetone to (R)-1,2-propanediol by Ralstonia eutropha transformant expressing alcohol dehydrogenase from Kluyveromyces lactis.

PubMed

Oda, Takahiro; Oda, Koji; Yamamoto, Hiroaki; Matsuyama, Akinobu; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi

2013-01-10

Conversion of industrial processes to more nature-friendly modes is a crucial subject for achieving sustainable development. Utilization of hydrogen-oxidation reactions by hydrogenase as a driving force of bioprocess reaction can be an environmentally ideal method because the reaction creates no pollutants. We expressed NAD-dependent alcohol dehydrogenase from Kluyveromyces lactis in a hydrogen-oxidizing bacterium: Ralstonia eutropha. This is the first report of hydrogen-driven in vivo coupling reaction of the alcohol dehydrogenase and indigenous soluble NAD-reducing hydrogenase. Asymmetric reduction of hydroxyacetone to (R)-1,2-propanediol, which is a commercial building block for antibacterial agents, was performed using the transformant as the microbial cell catalyst. The two enzymes coupled in vitro in vials without a marked decrease of reactivity during the 20 hr reaction because of the hydrogenase reaction, which generates no by-product that affects enzymes. Alcohol dehydrogenase was expressed functionally in R. eutropha in an activity level equivalent to that of indigenous NAD-reducing hydrogenase under the hydrogenase promoter. The hydrogen-driven in vivo coupling reaction proceeded only by the transformant cell without exogenous addition of a cofactor. The decrease of reaction velocity at higher concentration of hydroxyacetone was markedly reduced by application of an in vivo coupling system. Production of (R)-1,2-propanediol (99.8% e.e.) reached 67.7 g/l in 76 hr with almost a constant rate using a jar fermenter. The reaction velocity under 10% PH2 was almost equivalent to that under 100% hydrogen, indicating the availability of crude hydrogen gas from various sources. The in vivo coupling system enabled cell-recycling as catalysts. Asymmetric reduction of hydroxyacetone by a coupling reaction of the two enzymes continued in both in vitro and in vivo systems in the presence of hydrogen. The in vivo reaction system using R. eutropha transformant expressing heterologous alcohol dehydrogenase showed advantages for practical usage relative to the in vitro coupling system. The results suggest a hopeful perspective of the hydrogen-driven bioprocess as an environmentally outstanding method to achieve industrial green innovation. Hydrogen-oxidizing bacteria can be useful hosts for the development of hydrogen-driven microbial cell factories.

Bioactivity screening and mass spectrometric confirmation for the detection of PPARδ agonists that increase type 1 muscle fibres.

PubMed

Bovee, Toine F H; Blokland, Marco; Kersten, Sander; Hamers, Astrid R M; Heskamp, Henri H; Essers, Martien L; Nielen, Michel W F; van Ginkel, Leendert A

2014-01-01

Sensitive and robust bioassays able to detect nuclear receptor activation are very useful for veterinary and doping control, pharmaceutical industry and environmental scientists. Here, we used bioassays based on human leukemic monocyte lymphoma U937 and human liver hepatocellular carcinoma HepG2 cell lines to detect the ligand-induced activation of the peroxisome proliferator-activated receptor delta (PPARδ). Exposure of U937 cells to the PPARδ agonist GW501516 resulted in a marked increase in mRNA expression of the PPARδ target gene Angptl4 which was quantified by qRT-PCR analysis. Exposure of HepG2 cells transiently transfected with a PPARδ expression plasmid and a PPAR-response element-driven luciferase reporter plasmid to PPARδ agonists GW501516, GW610742 and L-165041 resulted in clear dose-response curves. Although the qRT-PCR resulted in higher fold inductions, the luciferase assay with transfected HepG2 cells is cheaper and quicker and about ten times more sensitive to GW501516 compared to analysis of Angptl4 mRNA expression in U937 cells by qRT-PCR. The HepG2-based luciferase assay was therefore used to screen GW501516-spiked supplements and feed and water samples. After liquid extraction and clean-up by solid phase extraction using a weak anion exchange column, extracts were screened in the HepG2 bioassay followed by confirmation with a newly developed UPLC-MS/MS method, using two transitions for each compound, i.e., for GW501516, 454.07>188.15 (collision energy (CE) 46 V) and 454.07>257.08 (CE 30 V); for GW610742, 472.07>206.2 (CE 48 V) and 472.07>275.08 (CE 30 V); and for L-165041, 401.2>193.15 (CE 26 V) and 401.2>343.2 (CE 20 V).

Opto-current-clamp actuation of cortical neurons using a strategically designed channelrhodopsin.

PubMed

Wen, Lei; Wang, Hongxia; Tanimoto, Saki; Egawa, Ryo; Matsuzaka, Yoshiya; Mushiake, Hajime; Ishizuka, Toru; Yawo, Hiromu

2010-09-23

Optogenetic manipulation of a neuronal network enables one to reveal how high-order functions emerge in the central nervous system. One of the Chlamydomonas rhodopsins, channelrhodopsin-1 (ChR1), has several advantages over channelrhodopsin-2 (ChR2) in terms of the photocurrent kinetics. Improved temporal resolution would be expected by the optogenetics using the ChR1 variants with enhanced photocurrents. The photocurrent retardation of ChR1 was overcome by exchanging the sixth helix domain with its counterpart in ChR2 producing Channelrhodopsin-green receiver (ChRGR) with further reform of the molecule. When the ChRGR photocurrent was measured from the expressing HEK293 cells under whole-cell patch clamp, it was preferentially activated by green light and has fast kinetics with minimal desensitization. With its kinetic advantages the use of ChRGR would enable one to inject a current into a neuron by the time course as predicted by the intensity of the shedding light (opto-current clamp). The ChRGR was also expressed in the motor cortical neurons of a mouse using Sindbis pseudovirion vectors. When an oscillatory LED light signal was applied sweeping through frequencies, it robustly evoked action potentials synchronized to the oscillatory light at 5-10 Hz in layer 5 pyramidal cells in the cortical slice. The ChRGR-expressing neurons were also driven in vivo with monitoring local field potentials (LFPs) and the time-frequency energy distribution of the light-evoked response was investigated using wavelet analysis. The oscillatory light enhanced both the in-phase and out-phase responses of LFP at the preferential frequencies of 5-10 Hz. The spread of activity was evidenced by the fact that there were many c-Fos-immunoreactive neurons that were negative for ChRGR in a region of the motor cortex. The opto-current-clamp study suggests that the depolarization of a small number of neurons wakes up the motor cortical network over some critical point to the activated state.

Gaze Behavior Consistency among Older and Younger Adults When Looking at Emotional Faces

PubMed Central

Chaby, Laurence; Hupont, Isabelle; Avril, Marie; Luherne-du Boullay, Viviane; Chetouani, Mohamed

2017-01-01

The identification of non-verbal emotional signals, and especially of facial expressions, is essential for successful social communication among humans. Previous research has reported an age-related decline in facial emotion identification, and argued for socio-emotional or aging-brain model explanations. However, more perceptual differences in the gaze strategies that accompany facial emotional processing with advancing age have been under-explored yet. In this study, 22 young (22.2 years) and 22 older (70.4 years) adults were instructed to look at basic facial expressions while their gaze movements were recorded by an eye-tracker. Participants were then asked to identify each emotion, and the unbiased hit rate was applied as performance measure. Gaze data were first analyzed using traditional measures of fixations over two preferential regions of the face (upper and lower areas) for each emotion. Then, to better capture core gaze changes with advancing age, spatio-temporal gaze behaviors were deeper examined using data-driven analysis (dimension reduction, clustering). Results first confirmed that older adults performed worse than younger adults at identifying facial expressions, except for “joy” and “disgust,” and this was accompanied by a gaze preference toward the lower-face. Interestingly, this phenomenon was maintained during the whole time course of stimulus presentation. More importantly, trials corresponding to older adults were more tightly clustered, suggesting that the gaze behavior patterns of older adults are more consistent than those of younger adults. This study demonstrates that, confronted to emotional faces, younger and older adults do not prioritize or ignore the same facial areas. Older adults mainly adopted a focused-gaze strategy, consisting in focusing only on the lower part of the face throughout the whole stimuli display time. This consistency may constitute a robust and distinctive “social signature” of emotional identification in aging. Younger adults, however, were more dispersed in terms of gaze behavior and used a more exploratory-gaze strategy, consisting in repeatedly visiting both facial areas. PMID:28450841

The Receptor That Tames the Innate Immune Response

PubMed Central

Brines, Michael; Cerami, Anthony

2012-01-01

Tissue injury, hypoxia and significant metabolic stress activate innate immune responses driven by tumor necrosis factor (TNF)-α and other proinflammatory cytokines that typically increase damage surrounding a lesion. In a compensatory protective response, erythropoietin (EPO) is synthesized in surrounding tissues, which subsequently triggers antiinflammatory and antiapoptotic processes that delimit injury and promote repair. What we refer to as the sequelae of injury or disease are often the consequences of this intentionally discoordinated, primitive system that uses a “scorched earth” strategy to rid the invader at the expense of a serious lesion. The EPO-mediated tissue-protective system depends on receptor expression that is upregulated by inflammation and hypoxia in a distinctive temporal and spatial pattern. The tissue-protective receptor (TPR) is generally not expressed by normal tissues but becomes functional immediately after injury. In contrast to robust and early receptor expression within the immediate injury site, EPO production is delayed, transient and relatively weak. The functional EPO receptor that attenuates tissue injury is distinct from the hematopoietic receptor responsible for erythropoiesis. On the basis of current evidence, the TPR is composed of the β common receptor subunit (CD131) in combination with the same EPO receptor subunit that is involved in erythropoiesis. Additional receptors, including that for the vascular endothelial growth factor, also appear to be a component of the TPR in some tissues, for example, the endothelium. The discoordination of the EPO response system and its relative weakness provide a window of opportunity to intervene with the exogenous ligand. Recently, molecules were designed that preferentially activate only the TPR and thus avoid the potential adverse consequences of activating the hematopoietic receptor. On administration, these agents successfully substitute for a relative deficiency of EPO production in damaged tissues in multiple animal models of disease and may pave the way to effective treatment of a wide variety of insults that cause tissue injury, leading to profoundly expanded lesions and attendant, irreversible sequelae. PMID:22183892

The receptor that tames the innate immune response.

PubMed

Brines, Michael; Cerami, Anthony

2012-05-09

Tissue injury, hypoxia and significant metabolic stress activate innate immune responses driven by tumor necrosis factor (TNF)-α and other proinflammatory cytokines that typically increase damage surrounding a lesion. In a compensatory protective response, erythropoietin (EPO) is synthesized in surrounding tissues, which subsequently triggers antiinflammatory and antiapoptotic processes that delimit injury and promote repair. What we refer to as the sequelae of injury or disease are often the consequences of this intentionally discoordinated, primitive system that uses a "scorched earth" strategy to rid the invader at the expense of a serious lesion. The EPO-mediated tissue-protective system depends on receptor expression that is upregulated by inflammation and hypoxia in a distinctive temporal and spatial pattern. The tissue-protective receptor (TPR) is generally not expressed by normal tissues but becomes functional immediately after injury. In contrast to robust and early receptor expression within the immediate injury site, EPO production is delayed, transient and relatively weak. The functional EPO receptor that attenuates tissue injury is distinct from the hematopoietic receptor responsible for erythropoiesis. On the basis of current evidence, the TPR is composed of the β common receptor subunit (CD131) in combination with the same EPO receptor subunit that is involved in erythropoiesis. Additional receptors, including that for the vascular endothelial growth factor, also appear to be a component of the TPR in some tissues, for example, the endothelium. The discoordination of the EPO response system and its relative weakness provide a window of opportunity to intervene with the exogenous ligand. Recently, molecules were designed that preferentially activate only the TPR and thus avoid the potential adverse consequences of activating the hematopoietic receptor. On administration, these agents successfully substitute for a relative deficiency of EPO production in damaged tissues in multiple animal models of disease and may pave the way to effective treatment of a wide variety of insults that cause tissue injury, leading to profoundly expanded lesions and attendant, irreversible sequelae.