Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

PubMed

Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

2014-01-01

Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

A long and abundant non-coding RNA in Lactobacillus salivarius.

PubMed

Cousin, Fabien J; Lynch, Denise B; Chuat, Victoria; Bourin, Maxence J B; Casey, Pat G; Dalmasso, Marion; Harris, Hugh M B; McCann, Angela; O'Toole, Paul W

2017-09-01

Lactobacillus salivarius , found in the intestinal microbiota of humans and animals, is studied as an example of the sub-dominant intestinal commensals that may impart benefits upon their host. Strains typically harbour at least one megaplasmid that encodes functions contributing to contingency metabolism and environmental adaptation. RNA sequencing (RNA-seq)transcriptomic analysis of L. salivarius strain UCC118 identified the presence of a novel unusually abundant long non-coding RNA (lncRNA) encoded by the megaplasmid, and which represented more than 75 % of the total RNA-seq reads after depletion of rRNA species. The expression level of this 520 nt lncRNA in L. salivarius UCC118 exceeded that of the 16S rRNA, it accumulated during growth, was very stable over time and was also expressed during intestinal transit in a mouse. This lncRNA sequence is specific to the L. salivarius species; however, among 45 L . salivarius genomes analysed, not all (only 34) harboured the sequence for the lncRNA. This lncRNA was produced in 27 tested L. salivarius strains, but at strain-specific expression levels. High-level lncRNA expression correlated with high megaplasmid copy number. Transcriptome analysis of a deletion mutant lacking this lncRNA identified altered expression levels of genes in a number of pathways, but a definitive function of this new lncRNA was not identified. This lncRNA presents distinctive and unique properties, and suggests potential basic and applied scientific developments of this phenomenon.

Housekeeping while brain's storming Validation of normalizing factors for gene expression studies in a murine model of traumatic brain injury

PubMed Central

Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie

2008-01-01

Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first-intention normalizing factor with a broad field of applications is highlighted. Pros and cons of the three methods of normalization factors selection are discussed. A generic time- and cost-effective procedure for normalization factor validation is proposed. PMID:18611280

Reliable reference genes for normalization of gene expression data in tea plants (Camellia sinensis) exposed to metal stresses.

PubMed

Wang, Ming-Le; Li, Qing-Hui; Xin, Hua-Hong; Chen, Xuan; Zhu, Xu-Jun; Li, Xing-Hui

2017-01-01

Tea plants [Camellia sinensis (L.) O. Kuntze] are an important leaf-type crop that are widely used for the production of non-alcoholic beverages in the world. Exposure to excessive amounts of heavy metals adversely affects the quality and yield of tea leaves. To analyze the molecular responses of tea plants to heavy metals, a reliable quantification of gene expression is important and of major importance herein is the normalization of the measured expression levels for the target genes. Ideally, stably expressed reference genes should be evaluated in all experimental systems. In this study, 12 candidate reference genes (i.e., 18S rRNA, Actin, CYP, EF-1α, eIF-4α, GAPDH, MON1, PP2AA3, TBP, TIP41, TUA, and UBC) were cloned from tea plants, and the stability of their expression was examined systematically in 60 samples exposed to diverse heavy metals (i.e., manganese, aluminum, copper, iron, and zinc). Three Excel-based algorithms (geNorm, NormFinder, and BestKeeper) were used to evaluate the expression stability of these genes. PP2AA3 and 18S rRNA were the most stably expressed genes, even though their expression profiles exhibited some variability. Moreover, commonly used reference genes (i.e., GAPDH and TBP) were the least appropriate reference genes for most samples. To further validate the suitability of the analyzed reference genes, the expression level of a phytochelatin synthase gene (i.e., CsPCS1) was determined using the putative reference genes for data normalizations. Our results may be beneficial for future studies involving the quantification of relative gene expression levels in tea plants.

Reliable reference genes for normalization of gene expression data in tea plants (Camellia sinensis) exposed to metal stresses

PubMed Central

Wang, Ming-Le; Li, Qing-Hui; Xin, Hua-Hong; Chen, Xuan; Zhu, Xu-Jun

2017-01-01

Tea plants [Camellia sinensis (L.) O. Kuntze] are an important leaf-type crop that are widely used for the production of non-alcoholic beverages in the world. Exposure to excessive amounts of heavy metals adversely affects the quality and yield of tea leaves. To analyze the molecular responses of tea plants to heavy metals, a reliable quantification of gene expression is important and of major importance herein is the normalization of the measured expression levels for the target genes. Ideally, stably expressed reference genes should be evaluated in all experimental systems. In this study, 12 candidate reference genes (i.e., 18S rRNA, Actin, CYP, EF-1α, eIF-4α, GAPDH, MON1, PP2AA3, TBP, TIP41, TUA, and UBC) were cloned from tea plants, and the stability of their expression was examined systematically in 60 samples exposed to diverse heavy metals (i.e., manganese, aluminum, copper, iron, and zinc). Three Excel-based algorithms (geNorm, NormFinder, and BestKeeper) were used to evaluate the expression stability of these genes. PP2AA3 and 18S rRNA were the most stably expressed genes, even though their expression profiles exhibited some variability. Moreover, commonly used reference genes (i.e., GAPDH and TBP) were the least appropriate reference genes for most samples. To further validate the suitability of the analyzed reference genes, the expression level of a phytochelatin synthase gene (i.e., CsPCS1) was determined using the putative reference genes for data normalizations. Our results may be beneficial for future studies involving the quantification of relative gene expression levels in tea plants. PMID:28453515

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

PubMed

Hotto, Amber M; Huston, Zoe E; Stern, David B

2010-09-29

The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

Localization of nucleolar chromatin by immunocytochemistry and in situ hybridization at the electron microscopic level.

PubMed

Thiry, M; Scheer, U; Goessens, G

1991-01-01

Nucleoli are the morphological expression of the activity of a defined set of chromosomal segments bearing rRNA genes. The topological distribution and composition of the intranucleolar chromatin as well as the definition of nucleolar structures in which enzymes of the rDNA transcription machinery reside have been investigated in mammalian cells by various immunogold labelling approaches at the ultrastructural level. The precise intranucleolar location of rRNA genes has been further specified by electron microscopic in situ hybridization with a non-autoradiographic procedure. Our results indicate that the fibrillar centers are the sole nucleolar structures where rDNA, core histones, RNA polymerase I and DNA topoisomerase I are located together. Taking into account the potential value and limitations of immunoelectron microscopic techniques, we propose that transcription of the rRNA genes takes place within the confines of the fibrillar centers, probably close to the boundary regions to the surrounding dense fibrillar component.

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

PubMed

Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

2008-01-15

The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes Tü57

PubMed Central

Weitnauer, Gabriele; Gaisser, Sibylle; Trefzer, Axel; Stockert, Sigrid; Westrich, Lucy; Quiros, Luis M.; Mendez, Carmen; Salas, Jose A.; Bechthold, Andreas

2001-01-01

Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 μg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 μg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA. PMID:11181344

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

Fluctuations in Species-Level Protein Expression Occur during Element and Nutrient Cycling in the Subsurface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkins, Michael J.; Wrighton, Kelly C.; Nicora, Carrie D.

2013-03-05

While microbial activities in environmental systems play a key role in the utilization and cycling of essential elements and compounds, microbial activity and growth frequently fluctuates in response to environmental stimuli and perturbations. To investigate these fluctuations within a saturated aquifer system, we monitored a carbon-stimulated in situ Geobacter population while iron reduction was occurring, using 16S rRNA abundances and high-resolution tandem mass spectrometry proteome measurements. Following carbon amendment, 16S rRNA analysis of temporally separated samples revealed the rapid enrichment of Geobacter-like environmental strains with strong similarity to G. bemidjiensis. Tandem mass spectrometry proteomics measurements suggest high carbon flux throughmore » Geobacter respiratory pathways, and the synthesis of anapleurotic four carbon compounds from acetyl-CoA via pyruvate ferredoxin oxidoreductase activity. Across a 40-day period where Fe(III) reduction was occurring, fluctuations in protein expression reflected changes in anabolic versus catabolic reactions, with increased levels of biosynthesis occurring soon after acetate arrival in the aquifer. In addition, localized shifts in nutrient limitation were inferred based on expression of nitrogenase enzymes and phosphate uptake proteins. These temporal data offer the first example of differing microbial protein expression associated with changing geochemical conditions in a subsurface environment.« less

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

PubMed Central

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Effects of guanosine tetraphosphate on cell-free synthesis of Escherichia coli ribosomal RNA and other gene products.

PubMed Central

Reiness, G; Yang, H L; Zubay, G; Cashel, M

1975-01-01

A cell-free system derived from E. coli is described in which mature-sized 16S and 23S ribosomal RNAs (rRNA) are synthesized at a high relative rate, comprising 17-25% of the total transcription. The addition of guanosine tetraphosphate (ppGpp) to this system results in up to a 5-fold selective inhibition of rRNA accumulation. This effect is exerted at the level of synthesis rather than degradation. It is concluded that ppGpp, which is produced in large amounts by E. coli during amino-acid deprivation, could mediate the decrease in rRNA synthesis that accompanies such deprivation. The expression of other genes has also been investigated. No selective reduction of transfer RNA synthesis by ppGpp is observed. The trp and lac operons are found to be stimulated at the transcriptional level by the presence of this nucleotide. It is hypothesized that ppGpp interacts with the RNA polymerase in such a manner as to alter the affinity of the enzyme for promoters in an operon-specific fashion. PMID:1103124

DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

PubMed

Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

2010-04-01

Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

A Molecular Titration System Coordinates Ribosomal Protein Gene Transcription with Ribosomal RNA Synthesis.

PubMed

Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David

2016-11-17

Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection

PubMed Central

Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin

2015-01-01

qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937

In situ expression of nifD in Geobacteraceae in subsurface sediments

USGS Publications Warehouse

Holmes, Dawn E.; Nevin, Kelly P.; Lovely, Derek R.

2004-01-01

In order to determine whether the metabolic state of Geobacteraceae involved in bioremediation of subsurface sediments might be inferred from levels of mRNA for key genes, in situ expression of nifD, a highly conserved gene involved in nitrogen fixation, was investigated. When Geobacter sulfurreducens was grown without a source of fixed nitrogen in chemostats with acetate provided as the limiting electron donor and Fe(III) as the electron acceptor, levels of nifD transcripts were 4 to 5 orders of magnitude higher than in chemostat cultures provided with ammonium. In contrast, the number of transcripts of recA and the 16S rRNA gene were slightly lower in the absence of ammonium. The addition of acetate to organic- and nitrogen-poor subsurface sediments stimulated the growth of Geobacteraceae and Fe(III) reduction, as well as the expression of nifD in Geobacteraceae. Levels of nifD transcripts in Geobacteraceae decreased more than 100-fold within 2 days after the addition of 100 μM ammonium, while levels of recA and total bacterial 16S rRNA in Geobacteraceae remained relatively constant. Ammonium amendments had no effect on rates of Fe(III) reduction in acetate-amended sediments or toluene degradation in petroleum-contaminated sediments, suggesting that other factors, such as the rate that Geobacteraceae could access Fe(III) oxides, limited Fe(III) reduction. These results demonstrate that it is possible to monitor one aspect of the in situ metabolic state of Geobacteraceae species in subsurface sediments via analysis of mRNA levels, which is the first step toward a more global analysis of in situ gene expression related to nutrient status and stress response during bioremediation by Geobacteraceae.

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

Droplet microfluidics for amplification-free genetic detection of single cells.

PubMed

Rane, Tushar D; Zec, Helena C; Puleo, Chris; Lee, Abraham P; Wang, Tza-Huei

2012-09-21

In this article we present a novel droplet microfluidic chip enabling amplification-free detection of single pathogenic cells. The device streamlines multiple functionalities to carry out sample digitization, cell lysis, probe-target hybridization for subsequent fluorescent detection. A peptide nucleic acid fluorescence resonance energy transfer probe (PNA beacon) is used to detect 16S rRNA present in pathogenic cells. Initially the sensitivity and quantification abilities of the platform are tested using a synthetic target mimicking the actual expression level of 16S rRNA in single cells. The capability of the device to perform "sample-to-answer" pathogen detection of single cells is demonstrated using E. coli as a model pathogen.

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

PubMed

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

Nucleolar DEAD-Box RNA Helicase TOGR1 Regulates Thermotolerant Growth as a Pre-rRNA Chaperone in Rice

PubMed Central

Tang, Ding; Zhang, Yu’e; Cheng, Zhukuan; Xue, Yongbiao

2016-01-01

Plants have evolved a considerable number of intrinsic tolerance strategies to acclimate to ambient temperature increase. However, their molecular mechanisms remain largely obscure. Here we report a DEAD-box RNA helicase, TOGR1 (Thermotolerant Growth Required1), prerequisite for rice growth themotolerance. Regulated by both temperature and the circadian clock, its expression is tightly coupled to daily temperature fluctuations and its helicase activities directly promoted by temperature increase. Located in the nucleolus and associated with the small subunit (SSU) pre-rRNA processome, TOGR1 maintains a normal rRNA homeostasis at high temperature. Natural variation in its transcript level is positively correlated with plant height and its overexpression significantly improves rice growth under hot conditions. Our findings reveal a novel molecular mechanism of RNA helicase as a key chaperone for rRNA homeostasis required for rice thermotolerant growth and provide a potential strategy to breed heat-tolerant crops by modulating the expression of TOGR1 and its orthologs. PMID:26848586

Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

PubMed

Fu, Rao; Gong, Jun

2017-11-01

Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Limitations of commonly used internal controls for real-time RT-PCR analysis of renal epithelial-mesenchymal cell transition.

PubMed

Elberg, Gerard; Elberg, Dorit; Logan, Charlotte J; Chen, Lijuan; Turman, Martin A

2006-01-01

Progressive renal fibrotic disease is accompanied by the massive accumulation of myofibroblasts as defined by alpha smooth muscle actin (alphaSMA) expression. We quantitated gene expression using real-time RT-PCR analysis during conversion of primary cultured human renal tubular cells (RTC) to myofibroblasts after treatment with transforming growth factor-beta1 (TGF-beta1). We report herein the limitations of commonly used reference genes for mRNA quantitation. We determined the expression of alphaSMA and megakaryoblastic leukemia-1 (MKL1), a transcriptional regulator of alphaSMA, by quantitative real-time PCR using three common internal controls, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclophilin A and 18S rRNA. Expression of GAPDH mRNA and cyclophilin A mRNA, and to a lesser extent, 18S rRNA levels varied over time in culture and with exposure to TGF-beta1. Thus, depending on which reference gene was used, TGF-beta1 appeared to have different effects on expression of MKL1 and alphaSMA. RTC converting to myofibroblasts in primary culture is a valuable system to study renal fibrosis in humans. However, variability in expression of reference genes with TGF-beta1 treatment illustrates the need to validate mRNA quantitation with multiple reference genes to provide accurate interpretation of fibrosis studies in the absence of a universal internal standard for mRNA expression. 2006 S. Karger AG, Basel.

Selection of reference genes for quantitative real-time RT-PCR assays in different morphological forms of dimorphic zygomycetous fungus Benjaminiella poitrasii.

PubMed

Pathan, Ejaj K; Ghormade, Vandana; Deshpande, Mukund V

2017-01-01

Benjaminiella poitrasii, a dimorphic non-pathogenic zygomycetous fungus, exhibits a morphological yeast (Y) to hypha (H) reversible transition in the vegetative phase, sporangiospores (S) in the asexual phase and zygospores (Z) in the sexual phase. To study the gene expression across these diverse morphological forms, suitable reference genes are required. In the present study, 13 genes viz. ACT, 18S rRNA, eEF1α, eEF-Tu,eIF-1A, Tub-α, Tub-b, Ubc, GAPDH, Try, WS-21, NADGDH and NADPGDH were evaluated for their potential as a reference, particularly for studying gene expression during the Y-H reversible transition and also for other asexual and sexual life stages of B. poitrasii. Analysis of RT-qPCR data using geNorm, normFinder and BestKeeper software revealed that genes such as Ubc, 18S rRNA and WS-21 were expressed at constant levels in each given subset of RNA samples from all the morphological phases of B. poitrasii. Therefore, these reference genes can be used to elucidate the role of morpho-genes in B. poitrasii. Further, use of the two most stably expressed genes (Ubc and WS-21) to normalize the expression of the ornithine decarboxylase gene (Bpodc) in different morphological forms of B. poitrasii, generated more reliable results, indicating that our selection of reference genes was appropriate.

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

PubMed Central

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

PubMed

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

[PIWI protein as a nucleolus visitor in Drosophila melanogaster].

PubMed

Mikhaleva, E A; Iakushev, E Iu; Stoliarenko, A D; Klenov, M S; Pozovskiĭ, Ia M; Gvozdev, V A

2015-01-01

The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus--the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins--fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwi(Nt)) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

PubMed

Wieckowski, Yana; Schiefelbein, John

2012-07-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

PubMed Central

Wieckowski, Yana; Schiefelbein, John

2012-01-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

Dyskerin and TERC expression may condition survival in lung cancer patients

PubMed Central

Penzo, Marianna; Ludovini, Vienna; Treré, Davide; Siggillino, Annamaria; Vannucci, Jacopo; Bellezza, Guido; Crinò, Lucio; Montanaro, Lorenzo

2015-01-01

Dyskerin mediates both the modification of uridine on ribosomal and small nuclear RNAs and the stabilization of the telomerase RNA component (TERC). In human tumors dyskerin expression was found to be associated with both rRNA modification and TERC levels. Moreover, dyskerin overexpression has been linked to unfavorable prognosis in a variety of tumor types, however an explanation for the latter association is not available. To clarify this point, we analyzed the connection between dyskerin expression, TERC levels and clinical outcome in two series of primary lung cancers, differing for the presence of TERC gene amplification, a genetic alteration inducing strong TERC overexpression. TERC levels were significantly higher in tumors bearing TERC gene amplification (P = 0.017). In addition, the well-established association between dyskerin expression and TERC levels was observed only in the series without TERC gene amplification (P = 0.003), while it was not present in TERC amplified tumors (P = 0.929). Similarly, the association between dyskerin expression and survival was found in cases not bearing TERC gene amplification (P = 0.009) and was not observed in TERC amplified tumors (P = 0.584). These results indicate that the influence of dyskerin expression on tumor clinical outcome is linked to its role on the maintenance of high levels of TERC. PMID:26301749

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

PubMed

Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

2014-12-01

Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

NMD3 regulates both mRNA and rRNA nuclear export in African trypanosomes via an XPOI-linked pathway

PubMed Central

Bühlmann, Melanie; Walrad, Pegine; Rico, Eva; Ivens, Alasdair; Capewell, Paul; Naguleswaran, Arunasalam; Roditi, Isabel; Matthews, Keith R.

2015-01-01

Trypanosomes mostly regulate gene expression through post-transcriptional mechanisms, particularly mRNA stability. However, much mRNA degradation is cytoplasmic such that mRNA nuclear export must represent an important level of regulation. Ribosomal RNAs must also be exported from the nucleus and the trypanosome orthologue of NMD3 has been confirmed to be involved in rRNA processing and export, matching its function in other organisms. Surprisingly, we found that TbNMD3 depletion also generates mRNA accumulation of procyclin-associated genes (PAGs), these being co-transcribed by RNA polymerase I with the procyclin surface antigen genes expressed on trypanosome insect forms. By whole transcriptome RNA-seq analysis of TbNMD3-depleted cells we confirm the regulation of the PAG transcripts by TbNMD3 and using reporter constructs reveal that PAG1 regulation is mediated by its 5′UTR. Dissection of the mechanism of regulation demonstrates that it is not dependent upon translational inhibition mediated by TbNMD3 depletion nor enhanced transcription. However, depletion of the nuclear export factors XPO1 or MEX67 recapitulates the effects of TbNMD3 depletion on PAG mRNAs and mRNAs accumulated in the nucleus of TbNMD3-depleted cells. These results invoke a novel RNA regulatory mechanism involving the NMD3-dependent nuclear export of mRNA cargos, suggesting a shared platform for mRNA and rRNA export. PMID:25873624

Influence of the stringent control system on the transcription of ribosomal ribonucleic acid and ribosomal protein genes in Escherichia coli.

PubMed Central

Dennis, P P

1977-01-01

The fraction of the total ribonucleic acid (RNA) synthesis rate that is messenger RNA (mRNA) for ribosomal protein (r-protein) and ribosomal RNA (rRNA) has been estimated in valS(Ts) rel+ stringent and valS(Ts) relA1 relaxed strains of Escherichia coli during a partial inhibition of valyl-transfer RNA aminoacylation. The partial inhibition was accomplished by shifting the strains from the permissive growth temperature of 29.5 degrees C to the semipermissive temperature of 35.5 degrees C. The RNA synthesized at the elevated temperature was pulse labeled with [3H]uracil. The fraction of the total incorpoarted 3H radioactivity in r-protein mRNA or in rRNA was estimated by specific hybridization to the transducing phages gammaspc1, which carries about 15 r-protein genes and lambdailv5, which carries an rRNA transcription unit. The results clearly demonstrate that the rel gene influences the fraction of the total RNA synthesis rate that is r protein mRNA and rRNA; in the rel+ strain they are significantly increased relative to control cultures. This indicates that the expression of the genes coding for the RNA and protein component of the ribosome are most likely regulated at the level of transcription. Furthermore, it appears that the distribution of functioning RNA polymerase between rRNA genes, r-protein genes, and other types of genes is influenced by the rel gene control system; presumably this influence is mediated through the unusual nucleotide guanosine tetraphosphate. PMID:320185

DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

PubMed

Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

2013-10-01

We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

Exploration of RNA structure spaces

NASA Technical Reports Server (NTRS)

Fox, G. E.

1991-01-01

In order to understand the structure of real structure spaces, we are studying the 5S rRNA structure space experimentally. A plasmid containing a synthetic 5S rRNA gene, two rRNA promoters, and transcription terminators has been assembled. Assays are conducted to determine if the foreign 5S rRNA is expressed, and to see whether or not it is incorporated into ribosomes. Evolutionary competition is used to determine the relative fitness of strains containing the foreign 5S rRNA and a control 5S rRNA. By using site directed mutagenesis, a number of mutants can be made in order to study the boundaries of the structure space and how sharply defined they are. By making similar studies in the vicinity of structure space, it will be possible to determine how homogeneous the 5S rRNA structure space is. Useable experimental protocols have been developed, and a number of mutants have already been studied. Initial results suggest an explanation of why single stranded regions of the RNA are less subject to mutation than double stranded regions.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

P143 proteins from heterologous nucleopolyhedroviruses induce apoptosis in BM-N cells derived from the silkworm Bombyx mori.

PubMed

Hamajima, Rina; Kobayashi, Michihiro; Ikeda, Motoko

2017-04-02

We previously demonstrated that ribosomal RNA (rRNA) of Bombyx mori BM-N cells is rapidly degraded upon infection with heterologous nucleopolyhedroviruses (NPVs), including Autographa californica multiple NPV (AcMNPV), Hyphantria cunea MNPV, Spodoptera exigua MNPV and S. litura MNPV, and that this response is triggered by viral P143 proteins. The transient expression of P143 proteins from heterologous NPVs was also shown to induce apoptosis and caspase-3-like protease activation in BM-N cells. In the present study, we conducted a transient expression assay using BM-N cells expressing mutant AcMNPV P143 (Ac-P143) proteins and demonstrated that five amino acid residues cooperatively participate in Ac-P143 protein-triggered apoptosis of BM-N cells. Notably, these five residues were previously shown to be required for triggering rRNA degradation in BM-N cells. As rRNA degradation in BM-N cells does not result from apoptosis, the present results suggest that Ac-P143-triggered rRNA degradation is the upstream signal for apoptosis induction in BM-N cells. We further showed that P143 protein-triggered apoptosis does not occur in S. frugiperda Sf9 or Lymantria dispar Ld652Y cells, indicating that apoptosis induction by heterologous P143 proteins is a BM-N cell-specific response. In addition, the observed induction of apoptosis in BM-N cells was found to be mediated by activation of the initiator caspase Bm-Dronc. Taken together, these results suggest that BM-N cells evolved a unique antiviral system that recognizes heterologous NPV P143 proteins to induce rRNA degradation and caspase-dependent apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

A Cold-Inducible DEAD-Box RNA Helicase from Arabidopsis thaliana Regulates Plant Growth and Development under Low Temperature.

PubMed

Liu, Yuelin; Tabata, Daisuke; Imai, Ryozo

2016-01-01

DEAD-box RNA helicases comprise a large family and are involved in a range of RNA processing events. Here, we identified one of the Arabidopsis thaliana DEAD-box RNA helicases, AtRH7, as an interactor of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 (AtCSP3), which is an RNA chaperone involved in cold adaptation. Promoter:GUS transgenic plants revealed that AtRH7 is expressed ubiquitously and that its levels of the expression are higher in rapidly growing tissues. Knockout mutant lines displayed several morphological alterations such as disturbed vein pattern, pointed first true leaves, and short roots, which resemble ribosome-related mutants of Arabidopsis. In addition, aberrant floral development was also observed in rh7 mutants. When the mutants were germinated at low temperature (12°C), both radicle and first leaf emergence were severely delayed; after exposure of seedlings to a long period of cold, the mutants developed aberrant, fewer, and smaller leaves. RNA blots and circular RT-PCR revealed that 35S and 18S rRNA precursors accumulated to higher levels in the mutants than in WT under both normal and cold conditions, suggesting the mutants are partially impaired in pre-rRNA processing. Taken together, the results suggest that AtRH7 affects rRNA biogenesis and plays an important role in plant growth under cold.

5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

PubMed

Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

2018-04-30

The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

rRNA fragmentation induced by a yeast killer toxin.

PubMed

Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

2014-02-01

Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the parasites. Conclusive functional proof of different rRNAs in regulating parasite development, however, is still absent or controversial. Here we functionally demonstrate for the first time that a stage-specifically expressed D-type small-subunit rRNA gene (D-ssu) is essential for oocyst development of the malaria parasite Plasmodium yoelii in the mosquito. This study also shows that variations in D-ssu sequence and/or the timing of transcription may have profound effects on parasite oocyst development. The results show that in addition to protein translation, rRNAs of malaria parasites also regulate parasite development and differentiation in a strain-specific manner, which can be explored for controlling parasite transmission. Copyright © 2015 Qi et al.

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

Fluctuations and synchrony of RNA synthesis in nucleoli.

PubMed

Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

2015-06-01

Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

AML1-ETO requires enhanced C/D box snoRNA/RNP formation to induce self-renewal and leukaemia.

PubMed

Zhou, Fengbiao; Liu, Yi; Rohde, Christian; Pauli, Cornelius; Gerloff, Dennis; Köhn, Marcel; Misiak, Danny; Bäumer, Nicole; Cui, Chunhong; Göllner, Stefanie; Oellerich, Thomas; Serve, Hubert; Garcia-Cuellar, Maria-Paz; Slany, Robert; Maciejewski, Jaroslaw P; Przychodzen, Bartlomiej; Seliger, Barbara; Klein, Hans-Ulrich; Bartenhagen, Christoph; Berdel, Wolfgang E; Dugas, Martin; Taketo, Makoto Mark; Farouq, Daneyal; Schwartz, Schraga; Regev, Aviv; Hébert, Josée; Sauvageau, Guy; Pabst, Caroline; Hüttelmaier, Stefan; Müller-Tidow, Carsten

2017-07-01

Leukaemogenesis requires enhanced self-renewal, which is induced by oncogenes. The underlying molecular mechanisms remain incompletely understood. Here, we identified C/D box snoRNAs and rRNA 2'-O-methylation as critical determinants of leukaemic stem cell activity. Leukaemogenesis by AML1-ETO required expression of the groucho-related amino-terminal enhancer of split (AES). AES functioned by inducing snoRNA/RNP formation via interaction with the RNA helicase DDX21. Similarly, global loss of C/D box snoRNAs with concomitant loss of rRNA 2'-O-methylation resulted in decreased leukaemia self-renewal potential. Genomic deletion of either C/D box snoRNA SNORD14D or SNORD35A suppressed clonogenic potential of leukaemia cells in vitro and delayed leukaemogenesis in vivo. We further showed that AML1-ETO9a, MYC and MLL-AF9 all enhanced snoRNA formation. Expression levels of C/D box snoRNAs in AML patients correlated closely with in vivo frequency of leukaemic stem cells. Collectively, these findings indicate that induction of C/D box snoRNA/RNP function constitutes an important pathway in leukaemogenesis.

Ki-67 protein is associated with ribosomal RNA transcription in quiescent and proliferating cells.

PubMed

Bullwinkel, Jörn; Baron-Lühr, Bettina; Lüdemann, Anja; Wohlenberg, Claudia; Gerdes, Johannes; Scholzen, Thomas

2006-03-01

The nuclear Ki-67 protein (pKi-67) has previously been shown to be exclusively expressed in proliferating cells. As a result, antibodies against this protein are widely used as prognostic tools in cancer diagnostics. Here we show, that despite the strong downregulation of pKi-67 expression in non-proliferating cells, the protein can nevertheless be detected at sites linked to ribosomal RNA (rRNA) synthesis. Although this finding does not argue against the use of pKi-67 as a proliferation marker, it has wide ranging implications for the elucidation of pKi-67 function. Employing the novel antibody TuBB-9, we could further demonstrate that also in proliferating cells, a fraction of pKi-67 is found at sites linked to the rRNA transcription machinery during interphase and mitosis. Moreover, chromatin immunoprecipitation (ChIP) assays provided evidence for a physical association of pKi-67 with chromatin of the promoter and transcribed region of the rRNA gene cluster. These data strongly suggest a role for pKi-67 in the early steps of rRNA synthesis. Copyright 2005 Wiley-Liss, Inc.

An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

PubMed Central

Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

2013-01-01

There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway.

PubMed

Grewal, Savraj S; Evans, Justin R; Edgar, Bruce A

2007-12-17

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA(-/-) mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth-regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components.

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway

PubMed Central

Grewal, Savraj S.; Evans, Justin R.; Edgar, Bruce A.

2007-01-01

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA −/− mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth–regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components. PMID:18086911

Target of Rapamycin Regulates Development and Ribosomal RNA Expression through Kinase Domain in Arabidopsis1[W][OA

PubMed Central

Ren, Maozhi; Qiu, Shuqing; Venglat, Prakash; Xiang, Daoquan; Feng, Li; Selvaraj, Gopalan; Datla, Raju

2011-01-01

Target of rapamycin (TOR) is a central regulator of cell growth, cell death, nutrition, starvation, hormone, and stress responses in diverse eukaryotes. However, very little is known about TOR signaling and the associated functional domains in plants. We have taken a genetic approach to dissect TOR functions in Arabidopsis (Arabidopsis thaliana) and report here that the kinase domain is essential for the role of TOR in embryogenesis and 45S rRNA expression. Twelve new T-DNA insertion mutants, spanning 14.2 kb of TOR-encoding genomic region, have been characterized. Nine of these share expression of defective kinase domain and embryo arrest at 16 to 32 cell stage. However, three T-DNA insertion lines affecting FATC domain displayed normal embryo development, indicating that FATC domain was dispensable in Arabidopsis. Genetic complementation showed that the TOR kinase domain alone in tor-10/tor-10 mutant background can rescue early embryo lethality and restore normal development. Overexpression of full-length TOR or kinase domain in Arabidopsis displayed developmental abnormalities in meristem, leaf, root, stem, flowering time, and senescence. We further show that TOR, especially the kinase domain, plays a role in ribosome biogenesis by activating 45S rRNA production. Of the six putative nuclear localization sequences in the kinase domain, nuclear localization sequence 6 was identified to confer TOR nuclear targeting in transient expression assays. Chromatin immunoprecipitation studies revealed that the HEAT repeat domain binds to 45S rRNA promoter and the 5′ external transcribed spacer elements motif. Together, these results show that TOR controls the embryogenesis, postembryonic development, and 45S rRNA production through its kinase domain in Arabidopsis. PMID:21266656

Ontogeny-Driven rDNA Rearrangement, Methylation, and Transcription, and Paternal Influence

PubMed Central

Shiao, Yih-Horng; Leighty, Robert M.; Wang, Cuiju; Ge, Xin; Crawford, Erik B.; Spurrier, Joshua M.; McCann, Sean D.; Fields, Janet R.; Fornwald, Laura; Riffle, Lisa; Driver, Craig; Quiñones, Octavio A.; Wilson, Ralph E.; Kasprzak, Kazimierz S.; Travlos, Gregory S.; Alvord, W. Gregory; Anderson, Lucy M.

2011-01-01

Gene rearrangement occurs during development in some cell types and this genome dynamics is modulated by intrinsic and extrinsic factors, including growth stimulants and nutrients. This raises a possibility that such structural change in the genome and its subsequent epigenetic modifications may also take place during mammalian ontogeny, a process undergoing finely orchestrated cell division and differentiation. We tested this hypothesis by comparing single nucleotide polymorphism-defined haplotype frequencies and DNA methylation of the rDNA multicopy gene between two mouse ontogenic stages and among three adult tissues of individual mice. Possible influences to the genetic and epigenetic dynamics by paternal exposures were also examined for Cr(III) and acid saline extrinsic factors. Variables derived from litters, individuals, and duplicate assays in large mouse populations were examined using linear mixed-effects model. We report here that active rDNA rearrangement, represented by changes of haplotype frequencies, arises during ontogenic progression from day 8 embryos to 6-week adult mice as well as in different tissue lineages and is modifiable by paternal exposures. The rDNA methylation levels were also altered in concordance with this ontogenic progression and were associated with rDNA haplotypes. Sperm showed highest level of methylation, followed by lungs and livers, and preferentially selected haplotypes that are positively associated with methylation. Livers, maintaining lower levels of rDNA methylation compared with lungs, expressed more rRNA transcript. In vitro transcription demonstrated haplotype-dependent rRNA expression. Thus, the genome is also dynamic during mammalian ontogeny and its rearrangement may trigger epigenetic changes and subsequent transcriptional controls, that are further influenced by paternal exposures. PMID:21765958

Conditional Inactivation of Upstream Binding Factor Reveals Its Epigenetic Functions and the Existence of a Somatic Nucleolar Precursor Body

PubMed Central

Hamdane, Nourdine; Stefanovsky, Victor Y.; Tremblay, Michel G.; Németh, Attila; Paquet, Eric; Lessard, Frédéric; Sanij, Elaine; Hannan, Ross; Moss, Tom

2014-01-01

Upstream Binding Factor (UBF) is a unique multi-HMGB-box protein first identified as a co-factor in RNA polymerase I (RPI/PolI) transcription. However, its poor DNA sequence selectivity and its ability to generate nucleosome-like nucleoprotein complexes suggest a more generalized role in chromatin structure. We previously showed that extensive depletion of UBF reduced the number of actively transcribed ribosomal RNA (rRNA) genes, but had little effect on rRNA synthesis rates or cell proliferation, leaving open the question of its requirement for RPI transcription. Using gene deletion in mouse, we now show that UBF is essential for embryo development beyond morula. Conditional deletion in cell cultures reveals that UBF is also essential for transcription of the rRNA genes and that it defines the active chromatin conformation of both gene and enhancer sequences. Loss of UBF prevents formation of the SL1/TIF1B pre-initiation complex and recruitment of the RPI-Rrn3/TIF1A complex. It is also accompanied by recruitment of H3K9me3, canonical histone H1 and HP1α, but not by de novo DNA methylation. Further, genes retain penta-acetyl H4 and H2A.Z, suggesting that even in the absence of UBF the rRNA genes can maintain a potentially active state. In contrast to canonical histone H1, binding of H1.4 is dependent on UBF, strongly suggesting that it plays a positive role in gene activity. Unexpectedly, arrest of rRNA synthesis does not suppress transcription of the 5S, tRNA or snRNA genes, nor expression of the several hundred mRNA genes implicated in ribosome biogenesis. Thus, rRNA gene activity does not coordinate global gene expression for ribosome biogenesis. Loss of UBF also unexpectedly induced the formation in cells of a large sub-nuclear structure resembling the nucleolar precursor body (NPB) of oocytes and early embryos. These somatic NPBs contain rRNA synthesis and processing factors but do not associate with the rRNA gene loci (NORs). PMID:25121932

Usefulness of acr expression for monitoring latent Mycobacterium tuberculosis bacilli in 'in vitro' and 'in vivo' experimental models.

PubMed

Gordillo, S; Guirado, E; Gil, O; Díaz, J; Amat, I; Molinos, S; Vilaplana, C; Ausina, V; Cardona, P-J

2006-07-01

Real-time RT-PCR was used to quantify the expression of genes possibly involved in Mycobacterium tuberculosis latency in in vitro and murine models. Exponential and stationary phase (EP and SP) bacilli were exposed to decreasing pH levels (from 6.5 to 4.5) in an unstirred culture, and mRNA levels for 16S rRNA, sigma factors sigA,B,E,F,G,H and M, Rv0834c, icl, nirA, narG, fpbB, acr, rpoA, recA and cysH were quantified. The expression of acr was the one that best correlated with the CFU decrease observed in SP bacilli. In the murine model, the expressions of icl, acr and sigF tended to decrease when bacillary counts increased and vice versa. Values from immunodepressed mice (e.g. alpha/beta T cells, TNF, IFN-gamma and iNOs knock out strains), with accelerated bacillary growth rate, confirmed this fact. Finally, the expression of acr was maintained in mice following long-term treatment with antibiotics. The quantification of acr expression could be useful for monitoring the presence of latent bacilli in some murine models of tuberculosis.

Enhanced NOLC1 promotes cell senescence and represses hepatocellular carcinoma cell proliferation by disturbing the organization of nucleolus.

PubMed

Yuan, Fuwen; Zhang, Yu; Ma, Liwei; Cheng, Qian; Li, Guodong; Tong, Tanjun

2017-08-01

The nucleolus is a key organelle that is responsible for the synthesis of rRNA and assembly of ribosomal subunits, which is also the center of metabolic control because of the critical role of ribosomes in protein synthesis. Perturbations of rRNA biogenesis are closely related to cell senescence and tumor progression; however, the underlying molecular mechanisms are not well understood. Here, we report that cellular senescence-inhibited gene (CSIG) knockdown up-regulated NOLC1 by stabilizing the 5'UTR of NOLC1 mRNA, and elevated NOLC1 induced the retention of NOG1 in the nucleolus, which is responsible for rRNA processing. Besides, the expression of NOLC1 was negatively correlated with CSIG in the aged mouse tissue and replicative senescent 2BS cells, and the down-regulation of NOLC1 could rescue CSIG knockdown-induced 2BS senescence. Additionally, NOLC1 expression was decreased in human hepatocellular carcinoma (HCC) tissue, and the ectopic expression of NOLC1 repressed the proliferation of HCC cells and tumor growth in a HCC xenograft model. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Digital genome-wide ncRNA expression, including SnoRNAs, across 11 human tissues using polyA-neutral amplification.

PubMed

Castle, John C; Armour, Christopher D; Löwer, Martin; Haynor, David; Biery, Matthew; Bouzek, Heather; Chen, Ronghua; Jackson, Stuart; Johnson, Jason M; Rohl, Carol A; Raymond, Christopher K

2010-07-26

Non-coding RNAs (ncRNAs) are an essential class of molecular species that have been difficult to monitor on high throughput platforms due to frequent lack of polyadenylation. Using a polyadenylation-neutral amplification protocol and next-generation sequencing, we explore ncRNA expression in eleven human tissues. ncRNAs 7SL, U2, 7SK, and HBII-52 are expressed at levels far exceeding mRNAs. C/D and H/ACA box snoRNAs are associated with rRNA methylation and pseudouridylation, respectively: spleen expresses both, hypothalamus expresses mainly C/D box snoRNAs, and testes show enriched expression of both H/ACA box snoRNAs and RNA telomerase TERC. Within the snoRNA 14q cluster, 14q(I-6) is expressed at much higher levels than other cluster members. More reads align to mitochondrial than nuclear tRNAs. Many lincRNAs are actively transcribed, particularly those overlapping known ncRNAs. Within the Prader-Willi syndrome loci, the snoRNA HBII-85 (group I) cluster is highly expressed in hypothalamus, greater than in other tissues and greater than group II or III. Additionally, within the disease locus we find novel transcription across a 400,000 nt span in ovaries. This genome-wide polyA-neutral expression compendium demonstrates the richness of ncRNA expression, their high expression patterns, their function-specific expression patterns, and is publicly available.

rRNA Genes Are Not Fully Activated in Mouse Somatic Cell Nuclear Transfer Embryos*

PubMed Central

Zheng, Zhong; Jia, Jia-Lin; Bou, Gerelchimeg; Hu, Li-Li; Wang, Zhen-Dong; Shen, Xing-Hui; Shan, Zhi-Yan; Shen, Jing-Ling; Liu, Zhong-Hua; Lei, Lei

2012-01-01

The well known and most important function of nucleoli is ribosome biogenesis. However, the nucleolus showed delayed development and malfunction in somatic cell nuclear transfer (NT) embryos. Previous studies indicated that nearly half rRNA genes (rDNA) in somatic cells were inactive and not transcribed. We compared the rDNA methylation level, active nucleolar organizer region (NORs) numbers, nucleolar proteins (upstream binding factor (UBF), nucleophosmin (B23)) distribution, and nucleolar-related gene expression in three different donor cells and NT embryos. The results showed embryonic stem cells (ESCs) had the most active NORs and lowest rDNA methylation level (7.66 and 6.76%), whereas mouse embryonic fibroblasts (MEFs) were the opposite (4.70 and 22.57%). After the donor cells were injected into enucleated MII oocytes, cumulus cells and MEFs nuclei lost B23 and UBF signals in 20 min, whereas in ESC-NT embryos, B23 and UBF signals could still be detected at 60 min post-NT. The embryos derived from ESCs, cumulus cells, and MEFs showed the same trend in active NORs numbers (7.19 versus 6.68 versus 5.77, p < 0.05) and rDNA methylation levels (6.36 versus 9.67% versus 15.52%) at the 4-cell stage as that in donor cells. However, the MEF-NT embryos displayed low rRNA synthesis/processing potential at morula stage and had an obvious decrease in blastocyst developmental rate. The results presented clear evidences that the rDNA reprogramming efficiency in NT embryos was determined by the rDNA activity in donor cells from which they derived. PMID:22467869

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

Increased expression of LD1 genes transcribed by RNA polymerase I in Leishmania donovani as a result of duplication into the rRNA gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lodes, M.J.; Merlin, G.; DeVos, T.

1995-12-01

This report investigates the duplication of two LD1 genes into the rRNA locus and the resultant transcription by RNA polymerase I, which has a faster transcription rate than that of RNA polymerase II. This was conducted using a 2.2-Mb chromosome in Leishmania donovani. 55 refs., 6 figs.

Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

PubMed

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2015-01-01

The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

PubMed

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

PubMed

Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

2015-12-21

5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

PubMed

Burlibașa, Liliana; Suciu, Ilinca

2015-12-01

Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

PubMed

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

NASA Technical Reports Server (NTRS)

Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.

1993-01-01

A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

Decreased Expression of Stable RNA Can Alleviate the Lethality Associated with RNase E Deficiency in Escherichia coli.

PubMed

Himabindu, P; Anupama, K

2017-04-15

The endoribonuclease RNase E participates in mRNA degradation, rRNA processing, and tRNA maturation in Escherichia coli , but the precise reasons for its essentiality are unclear and much debated. The enzyme is most active on RNA substrates with a 5'-terminal monophosphate, which is sensed by a domain in the enzyme that includes residue R169; E. coli also possesses a 5'-pyrophosphohydrolase, RppH, that catalyzes conversion of 5'-terminal triphosphate to 5'-terminal monophosphate on RNAs. Although the C-terminal half (CTH), beyond residue approximately 500, of RNase E is dispensable for viability, deletion of the CTH is lethal when combined with an R169Q mutation or with deletion of rppH In this work, we show that both these lethalities can be rescued in derivatives in which four or five of the seven rrn operons in the genome have been deleted. We hypothesize that the reduced stable RNA levels under these conditions minimize the need of RNase E to process them, thereby allowing for its diversion for mRNA degradation. In support of this hypothesis, we have found that other conditions that are known to reduce stable RNA levels also suppress one or both lethalities: (i) alterations in relA and spoT , which are expected to lead to increased basal ppGpp levels; (ii) stringent rpoB mutations, which mimic high intracellular ppGpp levels; and (iii) overexpression of DksA. Lethality suppression by these perturbations was RNase R dependent. Our work therefore suggests that its actions on the various substrates (mRNA, rRNA, and tRNA) jointly contribute to the essentiality of RNase E in E. coli IMPORTANCE The endoribonuclease RNase E is essential for viability in many Gram-negative bacteria, including Escherichia coli Different explanations have been offered for its essentiality, including its roles in global mRNA degradation or in the processing of several tRNA and rRNA species. Our work suggests that, rather than its role in the processing of any one particular substrate, its distributed functions on all the different substrates (mRNA, rRNA, and tRNA) are responsible for the essentiality of RNase E in E. coli . Copyright © 2017 American Society for Microbiology.

Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

PubMed

Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

2005-04-21

Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

Digital Genome-Wide ncRNA Expression, Including SnoRNAs, across 11 Human Tissues Using PolyA-Neutral Amplification

PubMed Central

Castle, John C.; Armour, Christopher D.; Löwer, Martin; Haynor, David; Biery, Matthew; Bouzek, Heather; Chen, Ronghua; Jackson, Stuart; Johnson, Jason M.; Rohl, Carol A.; Raymond, Christopher K.

2010-01-01

Non-coding RNAs (ncRNAs) are an essential class of molecular species that have been difficult to monitor on high throughput platforms due to frequent lack of polyadenylation. Using a polyadenylation-neutral amplification protocol and next-generation sequencing, we explore ncRNA expression in eleven human tissues. ncRNAs 7SL, U2, 7SK, and HBII-52 are expressed at levels far exceeding mRNAs. C/D and H/ACA box snoRNAs are associated with rRNA methylation and pseudouridylation, respectively: spleen expresses both, hypothalamus expresses mainly C/D box snoRNAs, and testes show enriched expression of both H/ACA box snoRNAs and RNA telomerase TERC. Within the snoRNA 14q cluster, 14q(I-6) is expressed at much higher levels than other cluster members. More reads align to mitochondrial than nuclear tRNAs. Many lincRNAs are actively transcribed, particularly those overlapping known ncRNAs. Within the Prader-Willi syndrome loci, the snoRNA HBII-85 (group I) cluster is highly expressed in hypothalamus, greater than in other tissues and greater than group II or III. Additionally, within the disease locus we find novel transcription across a 400,000 nt span in ovaries. This genome-wide polyA-neutral expression compendium demonstrates the richness of ncRNA expression, their high expression patterns, their function-specific expression patterns, and is publicly available. PMID:20668672

Validation of housekeeping genes as internal controls for studying gene expression during Pacific oyster (Crassostrea gigas) development by quantitative real-time PCR.

PubMed

Du, Yishuai; Zhang, Linlin; Xu, Fei; Huang, Baoyu; Zhang, Guofan; Li, Li

2013-03-01

Hatchery-reared larvae of the Pacific oyster (Crassostrea gigas) often suffer from massive mortality induced by Ostreid herpesvirus 1 (OsHV-1) infection, indicating the importance of better understanding of oyster immune defense systems. The accuracy of measurements of gene expression levels based on quantitative real-time PCR assays relies on the use of housekeeping genes as internal controls; however, few studies have focused on the selection of such internal controls. In this study, we conducted a comprehensive investigation of internal control genes during oyster development in virus-infected and uninfected samples. Transcriptome data for 38 developmental stages were downloaded and the gene expression patterns were classified into 30 clusters. A total of 317 orthologs of classical housekeeping genes in the oyster genome were annotated. After combining the expression profiles and oyster housekeeping gene dataset, 14 candidate internal controls were selected for further investigation: Elongation factor-1α (EF-1α), 18S rRNA (18S), 28S rRNA (28S), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-actin (ACT), Ribosomal protein L7 (RL7), Ribosomal protein L27 (RL27), Ribosomal protein L36 (RL36), Ribosomal protein S18 (RS18), Heterogeneous nuclear ribonucleoprotein A2/B1 (RO21), Eukaryotic translation elongation factor 2 (EF2), Ubiquitin-conjugating enzyme E2D2 (UBCD1), S-phase kinase-associated protein 1 (SKP1) and Heterogeneous nuclear ribonucleoprotein Q (HNRPQ). RNA was extracted from oyster larvae infected with OsHV-1 (group A; GA), and OsHV-1 free larvae (group B; GB). The expression levels of the 14 candidate internal controls were studied in GA and GB larvae by real-time PCR. Their expression stabilities were further analyzed using the GeNorm program. RL7 and RS18 were the most stable genes in both OsHV-1 infected (GA) and uninfected (GB) larvae. These results suggest that RL7 and RS18 could be used as internal controls for studying gene expression in normal growing oyster larvae and in OsHV-1 infected larvae. These high quality internal controls will be a valuable resource in future studies of oyster larval mortality. Copyright © 2012 Elsevier Ltd. All rights reserved.

Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer

PubMed Central

Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R.; Tang, Dean G.

2016-01-01

The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features. PMID:26924072

Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer.

PubMed

Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R; Tang, Dean G

2016-02-29

The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features.

Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

PubMed

Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

2018-05-03

The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Determination of internal controls for quantitative gene expression of Isochrysis zhangjiangensis at nitrogen stress condition

NASA Astrophysics Data System (ADS)

Wu, Shuang; Zhou, Jiannan; Cao, Xupeng; Xue, Song

2016-02-01

Isochrysis zhangjiangensis is a potential marine microalga for biodiesel production, which accumulates lipid under nitrogen limitation conditions, but the mechanism on molecular level is veiled. Quantitative real-time polymerase chain reaction (qPCR) provides the possibility to investigate the gene expression levels, and a valid reference for data normalization is an essential prerequisite for firing up the analysis. In this study, five housekeeping genes, actin (ACT), α-tubulin (TUA), ß-tubulin (TUB), ubiquitin (UBI), 18S rRNA (18S) and one target gene, diacylglycerol acyltransferase (DGAT), were used for determining the reference. By analyzing the stabilities based on calculation of the stability index and on operating the two types of software, geNorm and bestkeeper, it showed that the reference genes widely used in higher plant and microalgae, such as UBI, TUA and 18S, were not the most stable ones in nitrogen-stressed I. zhangjiangensis, and thus are not suitable for exploring the mRNA expression levels under these experimental conditions. Our results show that ACT together with TUB is the most feasible internal control for investigating gene expression under nitrogen-stressed conditions. Our findings will contribute not only to future qPCR studies of I. zhangjiangensis, but also to verification of comparative transcriptomics studies of the microalgae under similar conditions.

Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

PubMed

Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

2016-03-30

The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status.

Light differentially regulates cell division and the mRNA abundance of pea nucleolin during de-etiolation

NASA Technical Reports Server (NTRS)

Reichler, S. A.; Balk, J.; Brown, M. E.; Woodruff, K.; Clark, G. B.; Roux, S. J.

2001-01-01

The abundance of plant nucleolin mRNA is regulated during de-etiolation by phytochrome. A close correlation between the mRNA abundance of nucleolin and mitosis has also been previously reported. These results raised the question of whether the effects of light on nucleolin mRNA expression were a consequence of light effects on mitosis. To test this we compared the kinetics of light-mediated increases in cell proliferation with that of light-mediated changes in the abundance of nucleolin mRNA using plumules of dark-grown pea (Pisum sativum) seedlings. These experiments show that S-phase increases 9 h after a red light pulse, followed by M-phase increases in the plumule leaves at 12 h post-irradiation, a time course consistent with separately measured kinetics of red light-induced increases in the expression of cell cycle-regulated genes. These increases in cell cycle-regulated genes are photoreversible, implying that the light-induced increases in cell proliferation are, like nucleolin mRNA expression, regulated via phytochrome. Red light stimulates increases in the mRNA for nucleolin at 6 h post-irradiation, prior to any cell proliferation changes and concurrent with the reported timing of phytochrome-mediated increases of rRNA abundance. After a green light pulse, nucleolin mRNA levels increase without increasing S-phase or M-phase. Studies in animals and yeast indicate that nucleolin plays a significant role in ribosome biosynthesis. Consistent with this function, pea nucleolin can rescue nucleolin deletion mutants of yeast that are defective in rRNA synthesis. Our data show that during de-etiolation, the increased expression of nucleolin mRNA is more directly regulated by light than by mitosis.

The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.

PubMed

Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

2005-07-15

Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.

Genome-Wide Characterization of Light-Regulated Genes in Neurospora crassa

PubMed Central

Wu, Cheng; Yang, Fei; Smith, Kristina M.; Peterson, Matthew; Dekhang, Rigzin; Zhang, Ying; Zucker, Jeremy; Bredeweg, Erin L.; Mallappa, Chandrashekara; Zhou, Xiaoying; Lyubetskaya, Anna; Townsend, Jeffrey P.; Galagan, James E.; Freitag, Michael; Dunlap, Jay C.; Bell-Pedersen, Deborah; Sachs, Matthew S.

2014-01-01

The filamentous fungus Neurospora crassa responds to light in complex ways. To thoroughly study the transcriptional response of this organism to light, RNA-seq was used to analyze capped and polyadenylated mRNA prepared from mycelium grown for 24 hr in the dark and then exposed to light for 0 (control) 15, 60, 120, and 240 min. More than three-quarters of all defined protein coding genes (79%) were expressed in these cells. The increased sensitivity of RNA-seq compared with previous microarray studies revealed that the RNA levels for 31% of expressed genes were affected two-fold or more by exposure to light. Additionally, a large class of mRNAs, enriched for transcripts specifying products involved in rRNA metabolism, showed decreased expression in response to light, indicating a heretofore undocumented effect of light on this pathway. Based on measured changes in mRNA levels, light generally increases cellular metabolism and at the same time causes significant oxidative stress to the organism. To deal with this stress, protective photopigments are made, antioxidants are produced, and genes involved in ribosome biogenesis are transiently repressed. PMID:25053707

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selection of reference genes for expression analysis in the entomophthoralean fungus Pandora neoaphidis.

PubMed

Chen, Chun; Xie, Tingna; Ye, Sudan; Jensen, Annette Bruun; Eilenberg, Jørgen

2016-01-01

The selection of suitable reference genes is crucial for accurate quantification of gene expression and can add to our understanding of host-pathogen interactions. To identify suitable reference genes in Pandora neoaphidis, an obligate aphid pathogenic fungus, the expression of three traditional candidate genes including 18S rRNA(18S), 28S rRNA(28S) and elongation factor 1 alpha-like protein (EF1), were measured by quantitative polymerase chain reaction at different developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae), and under different nutritional conditions. We calculated the expression stability of candidate reference genes using four algorithms including geNorm, NormFinder, BestKeeper and Delta Ct. The analysis results revealed that the comprehensive ranking of candidate reference genes from the most stable to the least stable was 18S (1.189), 28S (1.414) and EF1 (3). The 18S was, therefore, the most suitable reference gene for real-time RT-PCR analysis of gene expression under all conditions. These results will support further studies on gene expression in P. neoaphidis. Copyright © 2015 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

TIF-IA-dependent regulation of ribosome synthesis in drosophila muscle is required to maintain systemic insulin signaling and larval growth.

PubMed

Ghosh, Abhishek; Rideout, Elizabeth J; Grewal, Savraj S

2014-10-01

The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis-a limiting step in ribosome biogenesis-via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs) from the brain and increased expression of Imp-L2-a secreted factor that binds and inhibits dILP activity-from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis.

TIF-IA-Dependent Regulation of Ribosome Synthesis in Drosophila Muscle Is Required to Maintain Systemic Insulin Signaling and Larval Growth

PubMed Central

Ghosh, Abhishek; Rideout, Elizabeth J.; Grewal, Savraj S.

2014-01-01

The conserved TOR kinase signaling network links nutrient availability to cell, tissue and body growth in animals. One important growth-regulatory target of TOR signaling is ribosome biogenesis. Studies in yeast and mammalian cell culture have described how TOR controls rRNA synthesis—a limiting step in ribosome biogenesis—via the RNA Polymerase I transcription factor TIF-IA. However, the contribution of TOR-dependent ribosome synthesis to tissue and body growth in animals is less clear. Here we show in Drosophila larvae that ribosome synthesis in muscle is required non-autonomously to maintain normal body growth and development. We find that amino acid starvation and TOR inhibition lead to reduced levels of TIF-IA, and decreased rRNA synthesis in larval muscle. When we mimic this decrease in muscle ribosome synthesis using RNAi-mediated knockdown of TIF-IA, we observe delayed larval development and reduced body growth. This reduction in growth is caused by lowered systemic insulin signaling via two endocrine responses: reduced expression of Drosophila insulin-like peptides (dILPs) from the brain and increased expression of Imp-L2—a secreted factor that binds and inhibits dILP activity—from muscle. We also observed that maintaining TIF-IA levels in muscle could partially reverse the starvation-mediated suppression of systemic insulin signaling. Finally, we show that activation of TOR specifically in muscle can increase overall body size and this effect requires TIF-IA function. These data suggest that muscle ribosome synthesis functions as a nutrient-dependent checkpoint for overall body growth: in nutrient rich conditions, TOR is required to maintain levels of TIF-IA and ribosome synthesis to promote high levels of systemic insulin, but under conditions of starvation stress, reduced muscle ribosome synthesis triggers an endocrine response that limits systemic insulin signaling to restrict growth and maintain homeostasis. PMID:25356674

Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

PubMed Central

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2015-01-01

The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (−8, −6, −4, −2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens. PMID:25585250

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

PubMed

Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

2010-11-01

MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species

PubMed Central

Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, StÉphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

2014-01-01

Abstract Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin–Benson cycle enzymes. In mature leaves, soluble protein and Calvin–Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin–Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use. PMID:24895754

Low levels of ribosomal RNA partly account for the very high photosynthetic phosphorus-use efficiency of Proteaceae species.

PubMed

Sulpice, Ronan; Ishihara, Hirofumi; Schlereth, Armin; Cawthray, Gregory R; Encke, Beatrice; Giavalisco, Patrick; Ivakov, Alexander; Arrivault, Stéphanie; Jost, Ricarda; Krohn, Nicole; Kuo, John; Laliberté, Etienne; Pearse, Stuart J; Raven, John A; Scheible, Wolf-Rüdiger; Teste, François; Veneklaas, Erik J; Stitt, Mark; Lambers, Hans

2014-06-01

Proteaceae species in south-western Australia occur on phosphorus- (P) impoverished soils. Their leaves contain very low P levels, but have relatively high rates of photosynthesis. We measured ribosomal RNA (rRNA) abundance, soluble protein, activities of several enzymes and glucose 6-phosphate (Glc6P) levels in expanding and mature leaves of six Proteaceae species in their natural habitat. The results were compared with those for Arabidopsis thaliana. Compared with A. thaliana, immature leaves of Proteaceae species contained very low levels of rRNA, especially plastidic rRNA. Proteaceae species showed slow development of the photosynthetic apparatus (‘delayed greening’), with young leaves having very low levels of chlorophyll and Calvin-Benson cycle enzymes. In mature leaves, soluble protein and Calvin-Benson cycle enzyme activities were low, but Glc6P levels were similar to those in A. thaliana. We propose that low ribosome abundance contributes to the high P efficiency of these Proteaceae species in three ways: (1) less P is invested in ribosomes; (2) the rate of growth and, hence, demand for P is low; and (3) the especially low plastidic ribosome abundance in young leaves delays formation of the photosynthetic machinery, spreading investment of P in rRNA. Although Calvin-Benson cycle enzyme activities are low, Glc6P levels are maintained, allowing their effective use.

Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

PubMed

Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

2015-01-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human patients have so far not shown defects in pseudouridylation or ribosomal RNA processing. None of the mutant iPS cells presented here show decreased pseudouridine levels in rRNA or defective rRNA processing suggesting telomere maintenance defects account for most of the phenotype of X-linked DC. Finally gene expression analysis of the iPS cells shows that WNT signaling is significantly decreased in all mutant cells, raising the possibility that defective WNT signaling may contribute to disease pathogenesis.

Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients

PubMed Central

Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A.; French, Deborah; Podsakoff, Gregory M.; Bessler, Monica; Mason, Philip J.

2015-01-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed “corrected” lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human patients have so far not shown defects in pseudouridylation or ribosomal RNA processing. None of the mutant iPS cells presented here show decreased pseudouridine levels in rRNA or defective rRNA processing suggesting telomere maintenance defects account for most of the phenotype of X-linked DC. Finally gene expression analysis of the iPS cells shows that WNT signaling is significantly decreased in all mutant cells, raising the possibility that defective WNT signaling may contribute to disease pathogenesis. PMID:25992652

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription

PubMed Central

Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-01-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.

PubMed

Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-03-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

PubMed Central

2012-01-01

Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson's disease.

PubMed

Garcia-Esparcia, Paula; Hernández-Ortega, Karina; Koneti, Anusha; Gil, Laura; Delgado-Morales, Raul; Castaño, Ester; Carmona, Margarita; Ferrer, Isidre

2015-12-01

Parkinson's disease (PD) is characterized by the accumulation of abnormal α-synuclein in selected regions of the brain following a gradient of severity with disease progression. Whether this is accompanied by globally altered protein synthesis is poorly documented. The present study was carried out in PD stages 1-6 of Braak and middle-aged (MA) individuals without alterations in brain in the substantia nigra, frontal cortex area 8, angular gyrus, precuneus and putamen. Reduced mRNA expression of nucleolar proteins nucleolin (NCL), nucleophosmin (NPM1), nucleoplasmin 3 (NPM3) and upstream binding transcription factor (UBF), decreased NPM1 but not NPM3 nucleolar protein immunostaining in remaining neurons; diminished 18S rRNA, 28S rRNA; reduced expression of several mRNAs encoding ribosomal protein (RP) subunits; and altered protein levels of initiation factor eIF3 and elongation factor eEF2 of protein synthesis was found in the substantia nigra in PD along with disease progression. Although many of these changes can be related to neuron loss in the substantia nigra, selective alteration of certain factors indicates variable degree of vulnerability of mRNAs, rRNAs and proteins in degenerating sustantia nigra. NPM1 mRNA and 18S rRNA was increased in the frontal cortex area 8 at stage 5-6; modifications were less marked and region-dependent in the angular gyrus and precuneus. Several RPs were abnormally regulated in the frontal cortex area 8 and precuneus, but only one RP in the angular gyrus, in PD. Altered levels of eIF3 and eIF1, and decrease eEF1A and eEF2 protein levels were observed in the frontal cortex in PD. No modifications were found in the putamen at any time of the study except transient modifications in 28S rRNA and only one RP mRNA at stages 5-6. These observations further indicate marked region-dependent and stage-dependent alterations in the cerebral cortex in PD. Altered solubility and α-synuclein oligomer formation, assessed in total homogenate fractions blotted with anti-α-synuclein oligomer-specific antibody, was demonstrated in the substantia nigra and frontal cortex, but not in the putamen, in PD. Dramatic increase in α-synuclein oligomers was also seen in fluorescent-activated cell sorter (FACS)-isolated nuclei in the frontal cortex in PD. Altered machinery of protein synthesis is altered in the substantia nigra and cerebral cortex in PD being the frontal cortex area 8 more affected than the angular gyrus and precuneus; in contrast, pathways of protein synthesis are apparently preserved in the putamen. This is associated with the presence of α-synuclein oligomeric species in total homogenates; substantia nigra and frontal cortex are enriched, albeit with different band patterns, in α-synuclein oligomeric species, whereas α-synuclein oligomers are not detected in the putamen.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Appropriate 'housekeeping' genes for use in expression profiling the effects of environmental estrogens in fish

PubMed Central

Filby, Amy L; Tyler, Charles R

2007-01-01

Background Attempts to develop a mechanistic understanding of the effects of environmental estrogens on fish are increasingly conducted at the level of gene expression. Appropriate application of real-time PCR in such studies requires the use of a stably expressed 'housekeeping' gene as an internal control to normalize for differences in the amount of starting template between samples. Results We sought to identify appropriate genes for use as internal controls in experimental treatments with estrogen by analyzing the expression of eight functionally distinct 'housekeeping' genes (18S ribosomal RNA [18S rRNA], ribosomal protein l8 [rpl8], elongation factor 1 alpha [ef1a], glucose-6-phosphate dehydrogenase [g6pd], beta actin [bactin], glyceraldehyde-3-phosphate dehydrogenase [gapdh], hypoxanthine phosphoribosyltransferase 1 [hprt1], and tata box binding protein [tbp]) following exposure to the environmental estrogen, 17α-ethinylestradiol (EE2), in the fathead minnow (Pimephales promelas). Exposure to 10 ng/L EE2 for 21 days down-regulated the expression of ef1a, g6pd, bactin and gapdh in the liver, and bactin and gapdh in the gonad. Some of these effects were gender-specific, with bactin in the liver and gapdh in the gonad down-regulated by EE2 in males only. Furthermore, when ef1a, g6pd, bactin or gapdh were used for normalization, the hepatic expression of two genes of interest, vitellogenin (vtg) and cytochrome P450 1A (cyp1a) following exposure to EE2 was overestimated. Conclusion Based on the data presented, we recommend 18S rRNA, rpl8, hprt1 and/or tbp, but not ef1a, g6pd, bactin and/or gapdh, as likely appropriate internal controls in real-time PCR studies of estrogens effects in fish. Our studies show that pre-validation of control genes considering the scope and nature of the experiments to be performed, including both gender and tissue type, is critical for accurate assessments of the effects of environmental estrogens on gene expression in fish. PMID:17288598

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

Suppression of Allene Oxide Cyclase in Hairy Roots of Medicago truncatula Reduces Jasmonate Levels and the Degree of Mycorrhization with Glomus intraradices1[w

PubMed Central

Isayenkov, Stanislav; Mrosk, Cornelia; Stenzel, Irene; Strack, Dieter; Hause, Bettina

2005-01-01

During the symbiotic interaction between Medicago truncatula and the arbuscular mycorrhizal (AM) fungus Glomus intraradices, an endogenous increase in jasmonic acid (JA) occurs. Two full-length cDNAs coding for the JA-biosynthetic enzyme allene oxide cyclase (AOC) from M. truncatula, designated as MtAOC1 and MtAOC2, were cloned and characterized. The AOC protein was localized in plastids and found to occur constitutively in all vascular tissues of M. truncatula. In leaves and roots, MtAOCs are expressed upon JA application. Enhanced expression was also observed during mycorrhization with G. intraradices. A partial suppression of MtAOC expression was achieved in roots following transformation with Agrobacterium rhizogenes harboring the MtAOC1 cDNA in the antisense direction under control of the cauliflower mosaic virus 35S promoter. In comparison to samples transformed with 35S∷uidA, roots with suppressed MtAOC1 expression exhibited lower JA levels and a remarkable delay in the process of colonization with G. intraradices. Both the mycorrhization rate, quantified by fungal rRNA, and the arbuscule formation, analyzed by the expression level of the AM-specific gene MtPT4, were affected. Staining of fungal material in roots with suppressed MtAOC1 revealed a decreased number of arbuscules, but these did not exhibit an altered structure. Our results indicate a crucial role for JA in the establishment of AM symbiosis. PMID:16244141

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

PubMed

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

PubMed Central

Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

2016-01-01

Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

RNA isolation and fractionation with compaction agents

NASA Technical Reports Server (NTRS)

Murphy, J. C.; Fox, G. E.; Willson, R. C.

2001-01-01

A new approach to the isolation of RNA from bacterial lysates employs selective precipitation by compaction agents, such as hexammine cobalt and spermidine. Using 3.5 mM hexammine cobalt, total RNA can be selectively precipitated from a cell lysate. At a concentration of 2 mM hexammine cobalt, rRNA can be fractionated from low molecular weight RNA. The resulting RNA mixture is readily resolved to pure 5S and mixed 16S/23S rRNA by nondenaturing anion-exchange chromatography. Using a second stage of precipitation at 8 mM hexammine cobalt, the low molecular weight RNA fraction can be isolated by precipitation. Compaction precipitation was also applied to the purification of an artificial stable RNA derived from Escherichia coli 5S rRNA and to the isolation of an Escherichia coli-expressed ribozyme. Copyright 2001 Academic Press.

Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

PubMed

Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

2015-01-01

We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N. vectensis holobiont defined by both internal and external gradients of chemicals and nutrients in a dynamic coastal habitat.

Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

PubMed Central

Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

2015-01-01

We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing <85% identity with cultivated strains, and two γ-Proteobacterial ribotypes sharing >99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N. vectensis holobiont defined by both internal and external gradients of chemicals and nutrients in a dynamic coastal habitat. PMID:26388838

Expression profile of Rab5, Rab7, tryptophan aspartate-containing coat protein, leprae lipoarabinomannan, and phenolic glycolipid-1 on the failure of the phagolysosome process in macrophages of leprosy patients as a viability marker of Mycobacterium leprae.

PubMed

Prakoeswa, Cita Rosita Sigit; Wahyuni, Ratna; Iswahyudi; Adriaty, Dinar; Yusuf, Irawan; Sutjipto; Agusni, Indropo; Izumi, Shinzo

2016-06-01

Phagolysosome process in macrophage of leprosy patients' is important in the early phase of eliminating Mycobacterium leprae invasion. This study was to clarify the involvement of Rab5, Rab7, and trytophan aspartate-containing coat protein (TACO) from host macrophage and leprae lipoarabinomannan (Lep-LAM) and phenolic glycolipid-1 (PGL-1) from M. leprae cell wall as the reflection of phagolysosome process in relation to 16 subunit ribosomal RNA (16S rRNA) M. leprae as a marker of viability of M. leprae. Using a cross sectional design study, skin biopsies were obtained from 47 newly diagnosed, untreated leprosy at Dr Soetomo Hospital, Surabaya, Indonesia. RNA isolation and complementary DNA synthesis were performed. Samples were divided into two groups: 16S rRNA M. leprae-positive and 16S rRNA M. leprae-negative. The expressions of Rab5, Rab7, TACO, Lep-LAM, and PGL-1 were assessed with an immunohistochemistry technique. Using Mann-Whitney U analysis, a significant difference in the expression profile of Rab5, Rab7, Lep-LAM, and PGL-1 was found (p<.05), but there was no significant difference of TACO between the two groups (p>.05). Spearman analysis revealed that there was a significant correlation between the score of Rab5, Rab7, Lep-LAM, and PGL-1 and the score of 16S rRNA M. leprae (p<.05). In M. leprae infection, Rab5, Rab7, and Lep-LAM play important roles in the failure of phagolysosome process via a membrane trafficking pathway, while PGL-1 plays a role via blocking lysosomal activities. These inventions might be used for the development of an early diagnostic device in the future. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

Identification of Nucleolus-Associated Chromatin Domains Reveals a Role for the Nucleolus in 3D Organization of the A. thaliana Genome.

PubMed

Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Sáez-Vásquez, Julio

2016-08-09

The nucleolus is the site of rRNA gene transcription, rRNA processing, and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli using fluorescence-activated cell sorting (FACS) and identified nucleolus-associated chromatin domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions, and mostly inactive protein-coding genes. However, NADs also include active rRNA genes and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased, and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Expansion of the aminoglycoside-resistance 16S rRNA (m(1)A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin.

PubMed

Witek, Marta A; Conn, Graeme L

2014-09-01

The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.

Cyclin-dependent Kinase 9 Links RNA Polymerase II Transcription to Processing of Ribosomal RNA*

PubMed Central

Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

2013-01-01

Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3′ extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3′ processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3′ rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing. PMID:23744076

[Evaluation on stability of internal controls in human cardiac muscle by real-time RT-PCR during early postmortem interval].

PubMed

Zhang, Ping; Ma, Kai-Jun; Zhang, Heng; Wang, Hui-Jun; Shen, Yi-Wen; Chen, Long

2012-04-01

To explore the stability of internal controls in human cardiac muscle by real-time RT-PCR during early postmortem interval (PMI) in order to find the most stable marker. Ten individuals with similar environmental conditions (the average store temperature: 25 degrees C) and different PMI ranging from 4.3 to 22.3 h were selected. Total RNA was extracted from each sample and six commonly internal controls were used including beta-actin, GAPDH, B2M, U6, 18S rRNA and HSA-miR-1, and the expression was detected in cardiac muscle by real-time RT-PCR. The expression stability of internal controls was evaluated using genormPLUS software during early PMI. The internal control with the most stability was selected. The relationship between the most stable marker and its expression level affected by some other parameters such as age, gender and cause of death was also analyzed. The U6 showed the most stable expression during early PMI in cardiac muscle, and its expression level was not affected by those parameters including age, gender and cause of death (P > 0.05). U6 may be a valuable internal control for the study of relationship between PMI determination and degradation of nucleic acid in human cardiac muscle by real-time RT-PCR.

Validation of housekeeping genes as internal controls for studying biomarkers of endocrine-disrupting chemicals in disk abalone by real-time PCR.

PubMed

Wan, Qiang; Whang, Ilson; Choi, Cheol Young; Lee, Jae-Seong; Lee, Jehee

2011-04-01

Our experiments were designed to identify suitable housekeeping genes (HKGs) in disk abalone as internal controls to quantify biomarker expression following endocrine disrupting chemicals (EDCs). Relative expression levels of twelve candidate HKGs were examined by real-time reverse transcription PCR (qRT-PCR) in gill and hepatopancreas of abalone following a 7-day challenge with either tributyltin chloride (TBT) or 17β-estradiol (E2). The expression levels of several conventional HKGs, such as 18s rRNA, glyceraldehyde-3-phosphate dehydrogenase and β-actin, were significantly altered by the challenges, indicating that they might not be suitable internal controls. Instead, the geNorm analysis pinpointed ribosomal protein L-5/ elongation factor 1 and ribosomal protein L-5/ succinate dehydrogenase as the most stable HKGs under TBT and E2 challenges, respectively. Moreover, these three HKGs also showed the highest stabilities overall amongst different tissues, genders and EDC challenges. The expression of a biomarker gene, cytochrome P450 4B (CYP4), was also investigated and exhibited a significant increase after the challenges. Importantly, when unsuitable HKGs were used for normalization, the influence of two EDCs on CYP4 expression was imprecisely overestimated or underestimated, which strongly emphasized the importance of selecting appropriately validated HKGs as internal controls in biomarker studies. Copyright © 2010 Elsevier Inc. All rights reserved.

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

PubMed

Arbefeville, S; Harris, A; Ferrieri, P

2017-09-01

Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU rDNA Fungal Identification Kit was equivalent to the in-house developed ITS regions assay to identify fungi at the genus level. The MycoBank database gave a better curated database and thus allowed a better genus and species identification for both D2 region of the LSU rRNA gene and ITS regions. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

PubMed

Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

2015-03-01

Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription through Interaction with RNA Polymerase III[OPEN

PubMed Central

Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhiyong; Wu, Yongrui

2017-01-01

Maize (Zea mays) floury3 (fl3) is a classic semidominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence and zinc binding) protein. The mutation in fl3 resulted in an Asn-to-His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semidominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the downregulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses, and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. PMID:28874509

Microbiota and Metatranscriptome Changes Accompanying the Onset of Gingivitis

PubMed Central

2018-01-01

ABSTRACT Over half of adults experience gingivitis, a mild yet treatable form of periodontal disease caused by the overgrowth of oral microbes. Left untreated, gingivitis can progress to a more severe and irreversible disease, most commonly chronic periodontitis. While periodontal diseases are associated with a shift in the oral microbiota composition, it remains unclear how this shift impacts microbiota function early in disease progression. Here, we analyzed the transition from health to gingivitis through both 16S v4-v5 rRNA amplicon and metatranscriptome sequencing of subgingival plaque samples from individuals undergoing an experimental gingivitis treatment. Beta-diversity analysis of 16S rRNA reveals that samples cluster based on disease severity and patient but not by oral hygiene status. Significant shifts in the abundance of several genera occurred during disease transition, suggesting a dysbiosis due to development of gingivitis. Comparing taxonomic abundance with transcriptomic activity revealed concordance of bacterial diversity composition between the two quantification assays in samples originating from both healthy and diseased teeth. Metatranscriptome sequencing analysis indicates that during the early stages of transition to gingivitis, a number of virulence-related transcripts were significantly differentially expressed in individual and across pooled patient samples. Upregulated genes include those involved in proteolytic and nucleolytic processes, while expression levels of those involved in surface structure assembly and other general virulence functions leading to colonization or adaptation within the host are more dynamic. These findings help characterize the transition from health to periodontal disease and identify genes associated with early disease. PMID:29666288

Comparative analysis of 16S rRNA and amoA genes from archaea selected with organic and inorganic amendments in enrichment culture.

PubMed

Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M

2012-04-01

We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized.

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

A low molecular weight artificial RNA of unique size with multiple probe target regions

NASA Technical Reports Server (NTRS)

Pitulle, C.; Dsouza, L.; Fox, G. E.

1997-01-01

Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or translation factors, and areas related to translation fidelity, were found to undergo significant metal-induced conformational alterations, leading either to loosening of their structure or to more compact folding. These modifications were associated with parallel alterations in the translation process at multiple levels, a fact suggesting that structural perturbations in ribosomes, caused by metals, pose significant hurdles in translational efficiency and fidelity. Copyright © 2017 Elsevier B.V. All rights reserved.

Post-Weaning Diet Affects Faecal Microbial Composition but Not Selected Adipose Gene Expression in the Cat (Felis catus)

PubMed Central

Bermingham, Emma N.; Kittelmann, Sandra; Young, Wayne; Kerr, Katherine R.; Swanson, Kelly S.; Roy, Nicole C.; Thomas, David G.

2013-01-01

The effects of pre- (i.e., gestation and during lactation) and post-weaning diet on the composition of faecal bacterial communities and adipose expression of key genes in the glucose and insulin pathways were investigated in the cat. Queens were maintained on a moderate protein:fat:carbohydrate kibbled (“Diet A”; 35:20:28% DM; n  =  4) or high protein:fat:carbohydrate canned (“Diet B”; 45:37:2% DM; n = 3) diet throughout pregnancy and lactation. Offspring were weaned onto these diets in a nested design (n  =  5 per treatment). Faecal samples were collected at wk 8 and 17 of age. DNA was isolated from faeces and bacterial 16S rRNA gene amplicons were analysed by pyrosequencing. RNA was extracted from blood (wk 18) and adipose tissue and ovarian/testicular tissues (wk 24) and gene expression levels determined using RT-qPCR. Differences (P<0.05) in composition of faecal bacteria were observed between pregnant queens fed Diet A or B. However, pre-weaning diet had little effect on faecal bacterial composition in weaned kittens. In contrast, post-weaning diet altered bacterial population profiles in the kittens. Increased (P<0.05) abundance of Firmicutes (77% vs 52% of total reads) and Actinobacteria (0.8% vs 0.2% of total reads), and decreased (P<0.05) abundance of Fusobacteria (1.6% vs 18.4% of total reads) were observed for kittens fed the Diet A compared to those fed Diet B post-weaning. Feeding Diet B pre-weaning increased (P<0.05) the expression levels of INRS, LEPT, PAI-1 and tended to increase GLUT1, while the expression levels of IRS-1 in blood increased in kittens fed Diet A pre-weaning. Post-weaning diet had no effect on expression levels of target genes. Correlations between the expression levels of genes involved in glucose and insulin pathways and faecal Bacteriodetes and Firmicutes phyla were identified. The reasons for why post-weaning diet affects microbial populations and not gene expression levels are of interest. PMID:24312255

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

PubMed Central

Toh, Seok-Ming; Xiong, Liqun; Bae, Taeok; Mankin, Alexander S.

2008-01-01

A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. PMID:18025251

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

PubMed Central

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-01-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological advantage. PMID:16597926

rRNA and poly-beta-hydroxybutyrate dynamics in bioreactors subjected to feast and famine cycles.

PubMed

Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

2006-04-01

Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-beta-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological advantage.

How Changes in Anti-SD Sequences Would Affect SD Sequences in Escherichia coli and Bacillus subtilis.

PubMed

Abolbaghaei, Akram; Silke, Jordan R; Xia, Xuhua

2017-05-05

The 3' end of the small ribosomal RNAs (ssu rRNA) in bacteria is directly involved in the selection and binding of mRNA transcripts during translation initiation via well-documented interactions between a Shine-Dalgarno (SD) sequence located upstream of the initiation codon and an anti-SD (aSD) sequence at the 3' end of the ssu rRNA. Consequently, the 3' end of ssu rRNA (3'TAIL) is strongly conserved among bacterial species because a change in the region may impact the translation of many protein-coding genes. Escherichia coli and Bacillus subtilis differ in their 3' ends of ssu rRNA, being GAUC ACCUCCUUA 3' in E. coli and GAUC ACCUCCUU UCU3' or GAUC ACCUCCUU UCUA3' in B. subtilis Such differences in 3'TAIL lead to species-specific SDs (designated SD Ec for E. coli and SD Bs for B. subtilis ) that can form strong and well-positioned SD/aSD pairing in one species but not in the other. Selection mediated by the species-specific 3'TAIL is expected to favor SD Bs against SD Ec in B. subtilis , but favor SD Ec against SD Bs in E. coli Among well-positioned SDs, SD Ec is used more in E. coli than in B. subtilis , and SD Bs more in B. subtilis than in E. coli Highly expressed genes and genes of high translation efficiency tend to have longer SDs than lowly expressed genes and genes with low translation efficiency in both species, but more so in B. subtilis than in E. coli Both species overuse SDs matching the bolded part of the 3'TAIL shown above. The 3'TAIL difference contributes to the host specificity of phages. Copyright © 2017 Abolbaghaei et al.

Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

PubMed

Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

2017-11-01

Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In this work, we conclude that NTP and ppGpp concentrations can regulate synthesis of ribosomal proteins, but most of the effect of ppGpp is indirect as a consequence of translational feedback in response to changes in rRNA levels. Our results illustrate how effects of seemingly redundant regulatory mechanisms can be separated in time and that even when multiple mechanisms act concurrently their contributions are not necessarily equivalent. Copyright © 2017 American Society for Microbiology.

HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus.

PubMed

Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe

2006-01-01

Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.

Low-dose Norfloxacin-treated leptospires induce less IL-1β release in J774A.1 cells following discrepant leptospiral gene expression.

PubMed

Cao, Yongguo; Xie, Xufeng; Zhang, Wenlong; Wu, Dianjun; Tu, Changchun

2018-06-01

Currently, accumulating evidence is challenging subtherapeutic therapy. Low-dose Norfloxacin (Nor) has been reported to suppress the immune response and worsen leptospirosis. In this study, we investigated the influence of low-dose Nor (0.03 μg/ml, 0.06 μg/ml, 0.125 μg/ml) on leptospiral gene expression and analyzed the immunomodulatory effects of low-dose Nor-treated leptospires in J774A.1 cells. To study the expression profiles of low-dose Nor-treated leptospires, we chose LipL71/LipL21 as reference genes determined by the geNorm applet in this experiment. The results showed that low-dose Nor up-regulated the expression of FlaB and inhibited the expression of 16S rRNA, LipL32, LipL41, Loa22, KdpA, and KdpB compared with the untreated leptospires. These results indicated that low-dose Nor could regulate leptospiral gene expression. Using RT-PCR, the gene expression of IL-1β and TNF-α in J774A.1 cells was detected. Nor-treated leptospires induced higher expression levels of both IL-1β and TNF-α. However, when analyzed by ELISA, the release of mature IL-1β was reduced compared with that observed in cells induced with no Nor-treated leptospires, although the TNF-α protein level showed no significant change. Our study indicated that the gene expression of leptospires could be modulated by low-dose Nor, which induced less IL-1β release in J774A.1 cells. Copyright © 2018 Elsevier Ltd. All rights reserved.

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

A critical role for noncoding 5S rRNA in regulating Mdmx stability.

PubMed

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

Ribosomal RNA and ribosomal proteins in corynebacteria.

PubMed

Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

2003-09-04

Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

PubMed

Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

2014-01-01

Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

PubMed

Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

2015-04-01

Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

RNA polymerase I transcription in a Brassica interspecific hybrid and its progenitors: Tests of transcription factor involvement in nucleolar dominance.

PubMed Central

Frieman, M; Chen, Z J; Saez-Vasquez, J; Shen, L A; Pikaard, C S

1999-01-01

In interspecific hybrids or allopolyploids, often one parental set of ribosomal RNA genes is transcribed and the other is silent, an epigenetic phenomenon known as nucleolar dominance. Silencing is enforced by cytosine methylation and histone deacetylation, but the initial discrimination mechanism is unknown. One hypothesis is that a species-specific transcription factor is inactivated, thereby silencing one set of rRNA genes. Another is that dominant rRNA genes have higher binding affinities for limiting transcription factors. A third suggests that selective methylation of underdominant rRNA genes blocks transcription factor binding. We tested these hypotheses using Brassica napus (canola), an allotetraploid derived from B. rapa and B. oleracea in which only B. rapa rRNA genes are transcribed. B. oleracea and B. rapa rRNA genes were active when transfected into protoplasts of the other species, which argues against the species-specific transcription factor model. B. oleracea and B. rapa rRNA genes also competed equally for the pol I transcription machinery in vitro and in vivo. Cytosine methylation had no effect on rRNA gene transcription in vitro, which suggests that transcription factor binding was unimpaired. These data are inconsistent with the prevailing models and point to discrimination mechanisms that are likely to act at a chromosomal level. PMID:10224274

Presence of archaea and selected bacteria in infected root canal systems.

PubMed

Brzezińska-Błaszczyk, Ewa; Pawłowska, Elżbieta; Płoszaj, Tomasz; Witas, Henryk; Godzik, Urszula; Agier, Justyna

2018-05-01

Infections of the root canal have polymicrobial etiology. The main group of microflora in the infected pulp is bacteria. There is limited data that archaea may be present in infected pulp tissue. The aim of this study was to check the prevalence of archaea in necrotic root canal samples obtained from patients with primary or post-treatment infection. The prevalence of selected bacteria species (Prevotella intermedia, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Synergistes sp.) in necrotic samples was evaluated as well. Sixty-four samples from root canal were collected for DNA and RNA extraction. A PCR assay based on the 16S rRNA gene was used to determine the presence of archaea and selected bacteria. Of the 64 samples, 6 were analyzed by semiquantitative reverse transcription PCR to estimate expression profiles of 16S rRNA, and another 9 were selected for direct sequencing. Archaea were detected in 48.4% samples. Statistical analysis indicated a negative association in coexistence between archaea and Treponema denticola (P < 0.05; Pearson's χ 2 test). The main representative of the Archaea domain found in infected pulp tissue was Methanobrevibacter oralis. Archaea 16S rRNA gene expression was significantly lower than Synergistes sp., Porphyromonas gingivalis, and Tannerella forsythia (P < 0.05; Student's t test). Thus, it can be hypothesized that archaea may participate in the endodontic microbial community.

Regulatory Efficacy of Brown Seaweed Lessonia nigrescens Extract on the Gene Expression Profile and Intestinal Microflora in Type 2 Diabetic Mice.

PubMed

Zhao, Chao; Yang, Chengfeng; Chen, Mingjun; Lv, Xucong; Liu, Bin; Yi, Lunzhao; Cornara, Laura; Wei, Ming-Chi; Yang, Yu-Chiao; Tundis, Rosa; Xiao, Jianbo

2018-02-01

In this study, the antidiabetic activity of Lessonia nigrescens ethanolic extract (LNE) is investigated in streptozotocin (SZT)-induced type 2 diabetic mice fed with a high-sucrose/high-fat diet. Ultra high performance liquid chromatography coupled with photo-DAD and electospray ionization-mass spectrometry (ESI-MS) is employed to analyze the major compounds in LNE. The components of the intestinal microflora in type 2 diabetic mice are analyzed by high-throughput next-generation 16S rRNA gene sequencing. Fasting blood glucose levels in diabetic mice are significantly decreased after LNE administration. The histology reveals that LNE could protect the cellular architecture of liver and kidney. LNE treatment significantly increases Bacteroidetes and decreases Firmicutes populations in intestinal microflora. Specifically, It could selectively enrich the amounts of beneficial bacteria, Barnesiella, as well as reduce the abundances of Clostridium and Alistipes. The increased gene and protein expression levels of phosphatidylinositol 3-kinase (PI3K) in the liver are observed in LNE treatment groups, while the expressions of c-Jun N-terminal kinase (JNK) are significantly downregulated. The above findings suggest that LNE could be considered as a functional food for reducing blood glucose and regulating intestinal microflora. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

PubMed Central

Umaer, Khan; Ciganda, Martin

2014-01-01

Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

High level bacterial contamination of secondary school students' mobile phones.

PubMed

Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

2017-06-01

While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.

High level bacterial contamination of secondary school students’ mobile phones

PubMed Central

Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

2017-01-01

Introduction While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students’ mobile phones. Methods Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline (tetA, tetB, tetM), erythromycin (ermB) and sulphonamide (sul1) resistance genes was assessed. Results We found a high median bacterial count on secondary school students’ mobile phones (10.5 CFU/cm2) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes (Staphylococcus aureus, Acinetobacter spp., Pseudomonas spp., Bacillus cereus and Neisseria flavescens) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner’s gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Conclusion Quantitative study methods revealed high level bacterial contamination of secondary school students’ mobile phones. PMID:28626737

Identification of nucleolus-associated chromatin domains reveals the role of the nucleolus in the 3D organisation of the A. thaliana genome

PubMed Central

Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Saez-Vasquez, Julio

2017-01-01

The nucleolus is the site of ribosomal RNA (rRNA) gene transcription, rRNA processing and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli by Fluorescence Activated Cell Sorting (FACS) and identified Nucleolus-Associated Chromatin Domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein, NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions and mostly inactive protein-coding genes. However, NADs also include active ribosomal RNA genes, and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. PMID:27477271

Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

EPA Science Inventory

Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

Activity and interactions of methane seep microorganisms assessed by parallel transcription and FISH-NanoSIMS analyses

PubMed Central

Dekas, Anne E; Connon, Stephanie A; Chadwick, Grayson L; Trembath-Reichert, Elizabeth; Orphan, Victoria J

2016-01-01

To characterize the activity and interactions of methanotrophic archaea (ANME) and Deltaproteobacteria at a methane-seeping mud volcano, we used two complimentary measures of microbial activity: a community-level analysis of the transcription of four genes (16S rRNA, methyl coenzyme M reductase A (mcrA), adenosine-5′-phosphosulfate reductase α-subunit (aprA), dinitrogenase reductase (nifH)), and a single-cell-level analysis of anabolic activity using fluorescence in situ hybridization coupled to nanoscale secondary ion mass spectrometry (FISH-NanoSIMS). Transcript analysis revealed that members of the deltaproteobacterial groups Desulfosarcina/Desulfococcus (DSS) and Desulfobulbaceae (DSB) exhibit increased rRNA expression in incubations with methane, suggestive of ANME-coupled activity. Direct analysis of anabolic activity in DSS cells in consortia with ANME by FISH-NanoSIMS confirmed their dependence on methanotrophy, with no 15NH4+ assimilation detected without methane. In contrast, DSS and DSB cells found physically independent of ANME (i.e., single cells) were anabolically active in incubations both with and without methane. These single cells therefore comprise an active ‘free-living' population, and are not dependent on methane or ANME activity. We investigated the possibility of N2 fixation by seep Deltaproteobacteria and detected nifH transcripts closely related to those of cultured diazotrophic Deltaproteobacteria. However, nifH expression was methane-dependent. 15N2 incorporation was not observed in single DSS cells, but was detected in single DSB cells. Interestingly, 15N2 incorporation in single DSB cells was methane-dependent, raising the possibility that DSB cells acquired reduced 15N products from diazotrophic ANME while spatially coupled, and then subsequently dissociated. With this combined data set we address several outstanding questions in methane seep microbial ecosystems and highlight the benefit of measuring microbial activity in the context of spatial associations. PMID:26394007

Activity and interactions of methane seep microorganisms assessed by parallel transcription and FISH-NanoSIMS analyses

DOE PAGES

Dekas, Anne E.; Connon, Stephanie A.; Chadwick, Grayson L.; ...

2015-09-22

To characterize the activity and interactions of methanotrophic archaea (ANME) and Deltaproteo-bacteria at a methane-seeping mud volcano, we used two complimentary measures of microbial activity: a community-level analysis of the transcription of four genes (16S rRNA, methyl coenzyme M reductase A (mcrA), adenosine-5'-phosphosulfate reductase α-subunit (aprA), dinitrogenase reductase (nifH)), and a single-cell-level analysis of anabolic activity using fluorescence in situ hybridization coupled to nanoscale secondary ion mass spectrometry (FISH-NanoSIMS). Transcript analysis revealed that members of the deltaproteobacterial groups Desulfosarcina/Desulfococcus (DSS) and Desulfobulbaceae (DSB) exhibit increased rRNA expression in incubations with methane, suggestive of ANME-coupled activity. Direct analysis of anabolic activity in DSS cells in consortia with ANME by FISH-NanoSIMS confirmed their dependence on methanotrophy, with no 15NHmore » $$+\\atop{4}$$ assimilation detected without methane. In contrast, DSS and DSB cells found physically independent of ANME (i.e., single cells) were anabolically active in incubations both with and without methane. These single cells therefore comprise an active ‘free-living’ population, and are not dependent on methane or ANME activity. We investigated the possibility of N 2 fixation by seep Deltaproteobacteria and detected nifH transcripts closely related to those of cultured diazotrophic Deltaproteobacteria. However, nifH expression was methane-dependent. 15N 2 incorporation was not observed in single DSS cells, but was detected in single DSB cells. Interestingly, 15N 2 incorporation in single DSB cells was methane-dependent, raising the possibility that DSB cells acquired reduced 15N products from diazotrophic ANME while spatially coupled, and then subsequently dissociated. In conclusion, with this combined data set we address several outstanding questions in methane seep microbial ecosystems and highlight the benefit of measuring microbial activity in the context of spatial associations.« less

Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

NASA Astrophysics Data System (ADS)

Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

2015-07-01

This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

PubMed Central

Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-01-01

Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

PubMed

Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-11-01

Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

Relative gene expression of bile salt hydrolase and surface proteins in two putative indigenous Lactobacillus plantarum strains under in vitro gut conditions.

PubMed

Duary, Raj Kumar; Batish, Virender Kumar; Grover, Sunita

2012-03-01

Probiotic bacteria must overcome the toxicity of bile salts secreted in the gut and adhere to the epithelial cells to enable their better colonization with extended transit time. Expression of bile salt hydrolase and other proteins on the surface of probiotic bacteria can help in better survivability and optimal functionality in the gut. Two putative Lactobacillus plantarum isolates i.e., Lp9 and Lp91 along with standard strain CSCC5276 were used. A battery of six housekeeping genes viz. gapB, dnaG, gyrA, ldhD, rpoD and 16S rRNA were evaluated by using geNorm 3.4 excel based application for normalizing the expression of bile salt hydrolase (bsh), mucus-binding protein (mub), mucus adhesion promoting protein (mapA), and elongation factor thermo unstable (EF-Tu) in Lp9 and Lp91. The maximal level of relative bsh gene expression was recorded in Lp91 with 2.89 ± 0.14, 4.57 ± 0.37 and 6.38 ± 0.19 fold increase at 2% bile salt concentration after 1, 2 and 3 h, respectively. Similarly, mub and mapA genes were maximally expressed in Lp9 at the level of 20.07 ± 1.28 and 30.92 ± 1.51 fold, when MRS was supplemented with 0.05% mucin and 1% each of bile and pancreatin (pH 6.5). However, in case of EF-Tu, the maximal expression of 42.84 ± 5.64 fold was recorded in Lp91 in the presence of mucin alone (0.05%). Hence, the expression of bsh, mub, mapA and EF-Tu could be considered as prospective biomarkers for screening of novel probiotic lactobacillus strains for optimal functionality in the gut.

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Evaluation of Reference Genes for Gene Expression Analysis Using Quantitative RT-PCR in Azospirillum brasilense

PubMed Central

McMillan, Mary; Pereg, Lily

2014-01-01

Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data. PMID:24841066

Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

PubMed

McMillan, Mary; Pereg, Lily

2014-01-01

Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

PubMed

Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

2010-03-01

Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers.

Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

PubMed

Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J

2016-01-01

There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a clinical protocol.

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

Detection of a New cfr-Like Gene, cfr(B), in Enterococcus faecium Isolates Recovered from Human Specimens in the United States as Part of the SENTRY Antimicrobial Surveillance Program.

PubMed

Deshpande, Lalitagauri M; Ashcraft, Deborah S; Kahn, Heather P; Pankey, George; Jones, Ronald N; Farrell, David J; Mendes, Rodrigo E

2015-10-01

Two linezolid-resistant Enterococcus faecium isolates (MICs, 8 μg/ml) from unique patients of a medical center in New Orleans were included in this study. Isolates were initially investigated for the presence of mutations in the V domain of 23S rRNA genes and L3, L4, and L22 ribosomal proteins, as well as cfr. Isolates were subjected to pulsed-field gel electrophoresis (just one band difference), and one representative strain was submitted to whole-genome sequencing. Gene location was also determined by hybridization, and cfr genes were cloned and expressed in a Staphylococcus aureus background. The two isolates had one out of six 23S rRNA alleles mutated (G2576T), had wild-type L3, L4, and L22 sequences, and were positive for a cfr-like gene. The sequence of the protein encoded by the cfr-like gene was most similar (99.7%) to that found in Peptoclostridium difficile, which shared only 74.9% amino acid identity with the proteins encoded by genes previously identified in staphylococci and non-faecium enterococci and was, therefore, denominated Cfr(B). When expressed in S. aureus, the protein conferred a resistance profile similar to that of Cfr. Two copies of cfr(B) were chromosomally located and embedded in a Tn6218 similar to the cfr-carrying transposon described in P. difficile. This study reports the first detection of cfr genes in E. faecium clinical isolates in the United States and characterization of a new cfr variant, cfr(B). cfr(B) has been observed in mobile genetic elements in E. faecium and P. difficile, suggesting potential for dissemination. However, further analysis is necessary to access the resistance levels conferred by cfr(B) when expressed in enterococci. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Bacterial Diversity and Nitrogen Utilization Strategies in the Upper Layer of the Northwestern Pacific Ocean.

PubMed

Li, Yuan-Yuan; Chen, Xiao-Huang; Xie, Zhang-Xian; Li, Dong-Xu; Wu, Peng-Fei; Kong, Ling-Fen; Lin, Lin; Kao, Shuh-Ji; Wang, Da-Zhi

2018-01-01

Nitrogen (N) is a primary limiting nutrient for bacterial growth and productivity in the ocean. To better understand bacterial community and their N utilization strategy in different N regimes of the ocean, we examined bacterial diversity, diazotrophic diversity, and N utilization gene expressions in the northwestern Pacific Ocean (NWPO) using a combination of high-throughput sequencing and real-time qPCR methods. 521 and 204 different operational taxonomic units (OTUs) were identified in the 16s rRNA and nifH libraries from nine surface samples. Of the 16s rRNA gene OTUs, 11.9% were observed in all samples while 3.5 and 15.9% were detected only in N-sufficient and N-deficient samples. Proteobacteria, Cyanobacteria and Bacteroidetes dominated the bacterial community. Prochlorococcus and Pseudoalteromonas were the most abundant at the genus level in N-deficient regimes, while SAR86, Synechococcus and SAR92 were predominant in the Kuroshio-Oyashio confluence region. The distribution of the nifH gene presented great divergence among sampling stations: Cyanobacterium_UCYN-A dominated the N-deficient stations, while clusters related to the Alpha-, Beta- , and Gamma-Proteobacteria were abundant in other stations. Temperature was the main factor that determined bacterial community structure and diversity while concentration of NO X -N was significantly correlated with structure and distribution of N 2 -fixing microorganisms. Expression of the ammonium transporter was much higher than that of urea transporter subunit A ( urtA ) and ferredoxin-nitrate reductase , while urtA had an increased expression in N-deficient surface water. The predicted ammonium transporter and ammonium assimilation enzymes were most abundant in surface samples while urease and nitrogenase were more abundant in the N-deficient regions. These findings underscore the fact that marine bacteria have evolved diverse N utilization strategies to adapt to different N habitats, and that urea metabolism is of vital ecological importance in N-deficient regimes.

A HIGHLY SELECTIVE PCR PROTOCOL FOR DETECTING 16S RRNA GENES OF THE GENUS PSEUDOMONAS (SENSU STRICTO) IN ENVIRONMENTAL SAMPLES

EPA Science Inventory

Pseudomonas species are plant, animal, and human pathogens; exhibit plant pathogen-suppressing properties useful in biological control; or express metabolic versatilities valued in biotechnology and bioremediation. Specific detection of Pseudomonas species in the environment may ...

Mugilid Fish Are Sentinels of Exposure to Endocrine Disrupting Compounds in Coastal and Estuarine Environments

PubMed Central

Ortiz-Zarragoitia, Maren; Bizarro, Cristina; Rojo-Bartolomé, Iratxe; Diaz de Cerio, Oihane; Cajaraville, Miren P.; Cancio, Ibon

2014-01-01

Effects on fish reproduction can result from a variety of toxicity mechanisms first operating at the molecular level. Notably, the presence in the environment of some compounds termed endocrine disrupting chemicals (EDCs) can cause adverse effects on reproduction by interfering with the endocrine system. In some cases, exposure to EDCs leads to the animal feminization and male fish may develop oocytes in testis (intersex condition). Mugilid fish are well suited sentinel organisms to study the effects of reproductive EDCs in the monitoring of estuarine/marine environments. Up-regulation of aromatases and vitellogenins in males and juveniles and the presence of intersex individuals have been described in a wide array of mullet species worldwide. There is a need to develop new molecular markers to identify early feminization responses and intersex condition in fish populations, studying mechanisms that regulate gonad differentiation under exposure to xenoestrogens. Interestingly, an electrophoresis of gonad RNA, shows a strong expression of 5S rRNA in oocytes, indicating the potential of 5S rRNA and its regulating proteins to become useful molecular makers of oocyte presence in testis. Therefore, the use of these oocyte markers to sex and identify intersex mullets could constitute powerful molecular biomarkers to assess xenoestrogenicity in field conditions. PMID:25222666

Life cycle as a stable trait in the evaluation of diversity of Nostoc from biofilms in rivers.

PubMed

Mateo, Pilar; Perona, Elvira; Berrendero, Esther; Leganés, Francisco; Martín, Marta; Golubić, Stjepko

2011-05-01

The diversity within the genus Nostoc is still controversial and more studies are needed to clarify its heterogeneity. Macroscopic species have been extensively studied and discussed; however, the microscopic forms of the genus, especially those from running waters, are poorly known and likely represented by many more species than currently described. Nostoc isolates from biofilms of two Spanish calcareous rivers were characterized comparing the morphology and life cycle in two culture media with different levels of nutrients and also comparing the 16S rRNA gene sequences. The results showed that trichome shape and cellular dimensions varied considerably depending on the culture media used, whereas the characteristics expressed in the course of the life cycle remained stable for each strain independent of the culture conditions. Molecular phylogenetic analysis confirmed the distinction between the studied strains established on morphological grounds. A balanced approach to the evaluation of diversity of Nostoc in the service of autecological studies requires both genotypic information and the evaluation of stable traits. The results of this study show that 16S rRNA gene sequence similarity serves as an important criterion for characterizing Nostoc strains and is consistent with stable attributes, such as the life cycle. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Bacterial community structure in the rhizosphere of a Cry1Ac Bt-brinjal crop and comparison to its non-transgenic counterpart in the tropical soil.

PubMed

Singh, Amit Kishore; Rai, Govind Kumar; Singh, Major; Dubey, Suresh Kumar

2013-11-01

To elucidate whether the transgenic crop alters the rhizospheric bacterial community structure, a 2-year study was performed with Cry1Ac gene-inserted brinjal crop (Bt) and their near isogenic non-transformed trait (non-Bt). The event of Bt crop (VRBT-8) was screened using an insect bioassay and enzyme-linked immunosorbent assay. Soil moisture, NH4 (+)-N, NO3 (-)-N, and PO4 (-)-P level had non-significant variation. Quantitative polymerase chain reaction revealed that abundance of bacterial 16S rRNA gene copies were lower in soils associated with Bt brinjal. Microbial biomass carbon (MBC) showed slight reduction in Bt brinjal soils. Higher MBC values in the non-Bt crop soil may be attributed to increased root activity and availability of readily metabolizable carbon compounds. The restriction fragment length polymorphism of PCR-amplified rRNA gene fragments detected 13 different bacterial groups with the exclusive presence of β-Proteobacteria, Chloroflexus, Planctomycetes, and Fusobacteria in non-Bt, and Cyanobacteria and Bacteroidetes in Bt soils, respectively, reflecting minor changes in the community structure. Despite the detection of Cry1Ac protein in the rhizospheric soil, the overall impact of Cry1Ac expressing Bt brinjal was less compared to that due to seasonal changes.

Impact of a novel protein meal on the gastrointestinal microbiota and the host transcriptome of larval zebrafish Danio rerio

PubMed Central

Rurangwa, Eugene; Sipkema, Detmer; Kals, Jeroen; ter Veld, Menno; Forlenza, Maria; Bacanu, Gianina M.; Smidt, Hauke; Palstra, Arjan P.

2015-01-01

Larval zebrafish was subjected to a methodological exploration of the gastrointestinal microbiota and transcriptome. Assessed was the impact of two dietary inclusion levels of a novel protein meal (NPM) of animal origin (ragworm Nereis virens) on the gastrointestinal tract (GIT). Microbial development was assessed over the first 21 days post egg fertilization (dpf) through 16S rRNA gene-based microbial composition profiling by pyrosequencing. Differentially expressed genes in the GIT were demonstrated at 21 dpf by whole transcriptome sequencing (mRNAseq). Larval zebrafish showed rapid temporal changes in microbial colonization but domination occurred by one to three bacterial species generally belonging to Proteobacteria and Firmicutes. The high iron content of NPM may have led to an increased relative abundance of bacteria that were related to potential pathogens and bacteria with an increased iron metabolism. Functional classification of the 328 differentially expressed genes indicated that the GIT of larvae fed at higher NPM level was more active in transmembrane ion transport and protein synthesis. mRNAseq analysis did not reveal a major activation of genes involved in the immune response or indicating differences in iron uptake and homeostasis in zebrafish fed at the high inclusion level of NPM. PMID:25983694

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation

PubMed Central

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude

2015-01-01

Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

PubMed

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

2004-05-01

The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

Isolation and extreme sex-specific expression of cytochrome P450 genes in the bark beetle, Ips paraconfusus, following feeding on the phloem of host ponderosa pine, Pinus ponderosa.

PubMed

Huber, D P W; Erickson, M L; Leutenegger, C M; Bohlmann, J; Seybold, S J

2007-06-01

We have identified cDNAs and characterized the expression of 13 novel cytochrome P450 genes of potential importance in host colonization and reproduction by the California fivespined ips, Ips paraconfusus. Twelve are of the Cyp4 family and one is of the Cyp9 family. Following feeding on host Pinus ponderosa phloem, bark beetle transcript levels of several of the Cyp4 genes increased or decreased in males only or in both sexes. In one instance (IparaCyp4A5) transcript accumulated significantly in females, but declined significantly in males. The Cyp9 gene (Cyp9T1) transcript levels in males were > 85 000 x higher at 8 h and > 25 000 x higher at 24 h after feeding compared with nonfed controls. Transcript levels in females were approximately 150 x higher at 24 h compared with nonfed controls. Cyp4G27 transcript was present constitutively regardless of sex or feeding and served as a better housekeeping gene than beta-actin or 18S rRNA for the real-time TaqMan polymerase chain reaction analysis. The expression patterns of Cyp4AY1, Cyp4BG1, and, especially, Cyp9T1 in males suggest roles for these genes in male-specific aggregation pheromone production. The differential transcript accumulation patterns of these bark beetle P450s provide insight into ecological interactions of I. paraconfusus with its host pines.

Interleukin10-1082 A/G polymorphism: Allele frequency, correlation with disease markers, messenger RNA and serum levels in North Indian rheumatoid arthritis patients.

PubMed

Jahid, Mohd; Rehan-Ul-Haq; Avasthi, Rajnish; Ahmed, Rafat Sultana

2018-05-01

Rheumatoid arthritis (RA) is an autoimmune inflammatory disorder of unknown etiology. IL-10 stimulates B cell survival and is involved in antibody isotype switching. The serum IL-10 levels are increased in RA patients. Ethnicity influences polymorphisms in cytokine genes. Therefore, this study was designed to explore possible association, if any, between polymorphism of IL10-1082 A/G, serum cytokine levels, inflammatory markers and gene expression in RA patients of North India. A total of 187 RA patients classified according to American college of rheumatology 2010 criteria and 214 controls were included in the study. Levels of serum IL-10 and inflammatory markers were estimated by ELISA. PCR-RFLP was used to analyze IL10-1082 A/G polymorphism. Quantitative real time PCR was used to measure the mRNA expression of IL-10 gene. The serum inflammatory markers were significantly higher in RA patients. Circulating IL-10 levels were positively and significantly correlated with RF (r = 0.28), anti-CCP (r = 0.26), CRP (r = 0.17) and mRNA expression levels (r = 0.59) among RA patients. Homozygous mutant variant (GG) and heterozygous mutant variant (AG) were associated with patients of RA (OR = 2.87 and 1.55, p < 0.05) as compared to controls. The association still persisted when the heterozygous and homozygous mutants (AG + GG) were clubbed together (OR = 1.67, p < 0.05). The mRNA expression of IL-10 was found to be 3.63 folds higher (housekeeping gene, β-actin) and 2.42 folds higher (housekeeping gene, 18S rRNA) in RA patients as compared to controls. The results indicate that IL10-1082 A/G polymorphism is associated with genetic susceptibility/predisposition to RA in North Indian population. Copyright © 2018 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

PubMed

Ahuja, Richa; Kumar, Vijay

2017-07-01

RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

PubMed

Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

2002-04-01

The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

Variation of bacterial communities and expression of Toll-like receptor genes in the rumen of steers differing in susceptibility to subacute ruminal acidosis.

PubMed

Chen, Yanhong; Oba, Masahito; Guan, Le Luo

2012-10-12

In order to determine differences in the ruminal bacterial community and host Toll-like receptor (TLR) gene expression of beef cattle with different susceptibility to acidosis, rumen papillae and content were collected from acidosis-susceptible (AS, n=3) and acidosis-resistant (AR, n=3) steers. The ruminal bacterial community was characterized using PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and quantitative real time PCR (qRT-PCR) analysis. Global R analysis of bacterial profile similarity revealed that bacterial diversity was significantly different between AR and AS groups for both rumen content (P=0.001) and epithelial (P=0.002) communities. The copy number of total bacterial 16S rRNA genes in content of AS steers was 10-fold higher than that of AR steers, and the copy number of total 16S rRNA genes of epimural bacteria in AR steers was positively correlated with ruminal pH (r=0.59, P=0.04), and negatively correlated with total VFA concentration (r=-0.59, P=0.05). The expressions of host TLR2 and 4 genes were significantly higher in AR steers compared to those in AS steers. These findings enhance our understanding about the ruminal microbial ecology and host gene expression changes that may be useful in the prevention of ruminal acidosis. Copyright © 2012 Elsevier B.V. All rights reserved.

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Density-dependent enhancement of methane oxidation activity and growth of Methylocystis sp. by a non-methanotrophic bacterium Sphingopyxis sp.

PubMed

Jeong, So-Yeon; Cho, Kyung-Suk; Kim, Tae Gwan

2014-12-01

Methanotrophs are a biological resource as they degrade the greenhouse gas methane and various organic contaminants. Several non-methanotrophic bacteria have shown potential to stimulate growth of methanotrophs when co-cultured, and however, the ecology is largely unknown. Effects of Sphingopyxis sp. NM1 on methanotrophic activity and growth of Methylocystis sp. M6 were investigated in this study. M6 and NM1 were mixed at mixing ratios of 9:1, 1:1, and 1:9 (v/v), using cell suspensions of 7.5 × 10 11 cells L -1 . Methane oxidation of M6 was monitored, and M6 population was estimated using fluorescence in situ hybridization (FISH). Real-time PCR was applied to quantify rRNA and expression of transcripts for three enzymes involved in the methane oxidation pathway. NM1 had a positive effect on M6 growth at a 1:9 ratio ( p  < 0.05), while no significant effects were observed at 9:1 and 1:1 ratios. NM1 enhanced the methane oxidation 1.34-fold at the 1:9 ratio. NM1 increased the population density and relative rRNA level of M6 by 2.4-fold and 5.4-fold at the 1:9 ratio, indicating that NM1 stimulated the population growth of M6. NM1 increased the relative transcriptional expression of all mRNA targets only at the 1:9 ratio. These results demonstrated that NM1 enhanced the methanotrophic activity and growth of M6, which was dependent on the proportion of NM1 present in the culture. This stimulation can be used as management and enhancement strategies for methanotrophic biotechnological processes.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

PubMed Central

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-01-01

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

The wandering mood: psychological and neural determinants of rest-related negative affect.

PubMed

Gruberger, Michal; Maron-Katz, Adi; Sharon, Haggai; Hendler, Talma; Ben-Simon, Eti

2013-01-01

Rest related negative affect (RRNA) has gained scientific interest in the past decade. However, it is mostly studied within the context of mind-wandering (MW), and the relevance of other psychological and neural aspects of the resting state to its' occurrence has never been studied. Several indications associate RRNA with internally directed attention, yet the nature of this relation remains largely unknown. Moreover, the role of neural networks associated with rest related phenomenology - the default mode (DMN), executive (EXE), and salience (SAL) networks, has not been studied in this context. To this end, we explored two 5 (baseline) and 15-minute resting-state simultaneous fMRI-EEG scans of 29 participants. As vigilance has been shown to affect attention, and thus its availability for inward allocation, EEG-based vigilance levels were computed for each participant. Questionnaires for affective assessment were administered before and after scans, and retrospective reports of MW were additionally collected. Results revealed increased negative affect following rest, but only among participants who retained high vigilance levels. Among low-vigilance participants, changes in negative affect were negligible, despite reports of MW occurrence in both groups. In addition, in the high-vigilance group only, a significant increase in functional connectivity (FC) levels was found between the DMN-related ventral anterior cingulate cortex (ACC), associated with emotional processing, and the EXE-related dorsal ACC, associated with monitoring of self and other's behavior. These heightened FC levels further correlated with reported negative affect among this group. Taken together, these results demonstrate that, rather than an unavoidable outcome of the resting state, RRNA depends on internal allocation of attention at rest. Results are discussed in terms of two rest-related possible scenarios which defer in mental and neural processing, and subsequently, in the occurrence of RRNA.

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.

PubMed

Lynch, T; Gregson, D; Church, D L

2016-03-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene

PubMed Central

Gregson, D.; Church, D. L.

2016-01-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription

PubMed Central

Stefanovsky, Victor Y.; Tremblay, Michel G.; Lindsay, Helen; Robinson, Mark D.

2017-01-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes. PMID:28715449

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

PubMed

Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

2017-07-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes.

Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

PubMed Central

Ryals, J; Little, R; Bremer, H

1982-01-01

The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

Alternative reverse genetics system for influenza viruses based on a synthesized swine 45S rRNA promoter.

PubMed

Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun

2017-08-01

We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.

The endocrine disruptor bisphenol A increases the expression of HSP70 and ecdysone receptor genes in the aquatic larvae of Chironomus riparius.

PubMed

Planelló, R; Martínez-Guitarte, J L; Morcillo, G

2008-05-01

Bisphenol A (BPA) is an endocrine disruptor that can mimic the action of estrogens by interacting with hormone receptors and is, therefore, potentially able to influence reproductive functions in vertebrates. Although information about the interaction with the endocrine systems in invertebrates is limited, it has also been shown its effect on reproductive and developmental parameters in these organisms. As little is known about its mechanism of action in aquatic invertebrates, we have examined the effects of BPA on the expression of some selected genes, including housekeeping, stress-induced and hormone-related genes in Chironomus riparius larvae, a widely used organism in aquatic ecotoxicology. The levels of different gene transcripts were measured by Northern blot or by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Exposure to BPA (3 mgl(-1), 12-24h) did not affect the levels of rRNA or those of mRNAs for both L11 or L13 ribosomal proteins, selected as examples of housekeeping genes involved in ribosome biogenesis. Nevertheless, BPA treatment induced the expression of the HSP70 gene. Interestingly, it was found that BPA significantly increases the mRNA level of the ecdysone receptor (EcR). These results show for the first time that exposure to endocrine disrupting chemicals, such as BPA, can selectively affect the expression of the ecdysone receptor gene suggesting a direct interaction with the insect endocrine system. Furthermore, this finding suggests a common way of BPA action, shared by vertebrates and invertebrates, through interaction with steroid hormone receptors. Our study adds a new element, the EcR, which may be a useful tool for the screening of environmental xenoestrogens in insects.

Methane production and methanogen levels in steers that differ in residual gain.

PubMed

Freetly, H C; Lindholm-Perry, A K; Hales, K E; Brown-Brandl, T M; Kim, M; Myer, P R; Wells, J E

2015-05-01

Methane (CH4) gas released by cattle isa product of fermentation in the digestive tract. The 2 primary sites of CH4 production in ruminants are the reticulum-rumen complex and the cecum. Methane release from cattle represents a 2% to 12% loss of the energy intake. Reducing the proportion of feed energy lost as CH4 has the potential of improving feed efficiency as well as decreasing the contribution of cattle to greenhouse gas production. Feed intake and growth were measured on 132 fall-born steers for 70 d. Seven steers with extreme positive residual gain (RG) and 7 steers with extreme negative RG whose DMI was within 0.32 SD of the mean intake were selected for subsequent measurements. Enteric CH4 production was measured via indirect calorimetry. Rumen, cecum, and rectal contents were obtained from steers at slaughter for measurement of in vitro CH4 production and methanogen 16S rRNA levels. Enteric CH4 production did not differ (P = 0.11) between the positive RG (112 ± 13 L/d)and the negative RG (74 ± 13 L/d) steers. In vitro rumen methane production did not differ between positive RG(64.26 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (61.49 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1)DM∙min(-1); P = 0.86). In vitro cecum methane production did not differ between positive RG (4.24 ×10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (4.35 × 10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1); P = 0.97). Methanogen 16S rRNA as a percentage of the total bacteria16S rRNA did not differ between RG groups (P = 0.18). The methanogen 16S rRNA as a percentage of rumen fluid total bacteria 16S rRNA (5.3% ±3.1%) did not differ from the methanogen 16S rRNA asa percentage of cecum content total bacteria 16S rRNA(11.8% ± 3.1%; P = 0.14). The methanogen 16S rRNA as a percentage of the rectum content total bacteria 16SrRNA (0.7% ± 3.1%) was not different from the rumen content (P = 0.29) but was less than the cecum content(P = 0.01). Methanomicrobiales 16S rRNA as a percentage of total methanogen 16S rRNA did not differ across sample sites (P = 0.81); however, steers with positive RG (10.5% ± 1.6%) were more numerous than steers with negative RG (5.1% ± 1.6%; P = 0.02). Cattle that differ in RG at the same DMI do not differ in characteristics associated with CH4 production.

Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

PubMed

Wolfe, C J; Haygood, M G

1991-08-01

Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

Inhibition effect of isopropanol on acetyl-CoA synthetase expression level of acetoclastic methanogen, Methanosaeta concilii.

PubMed

Ince, Bahar; Koksel, Gozde; Cetecioglu, Zeynep; Oz, Nilgun Ayman; Coban, Halil; Ince, Orhan

2011-11-10

Isopropanol is a widely found solvent in industrial wastewaters, which have commonly been treated using anaerobic systems. In this study, inhibitory effect of isopropanol on the key microbial group in anaerobic bioreactors, acetoclastic methanogens, was investigated. Anaerobic sludges in serum bottles were repeatedly fed with acetate and isopropanol; and quantitative real-time PCR was used for determining effect of isopropanol on the expression level of a key enzyme in acetoclastic methane production, acetyl-CoA synthetase of Methanosaeta concilii. Active Methanosaeta spp. cells were also quantified using Fluorescent in situ hybridization (FISH). Transcript abundance of acetyl-CoA synthetase was 1.23±0.62×10(6) mRNAs/mL in the uninhibited reactors with 222 mL cumulative methane production. First exposure to isopropanol resulted in 71.2%, 84.7%, 89.2% and 94.6% decrease in mRNA level and 35.0%, 65.0%, 91.5% and 100.0% reduction in methane production for isopropanol concentrations of 0.1 M, 0.5 M, 1.0 M and 2.0 M, respectively. Repeated exposures resulted in higher inhibitions; and at the end of test, fluorescent intensities of active Methanosaeta cells were significantly decreased due to isopropanol. The overall results indicated that isopropanol has an inhibitory effect on acetoclastic methanogenesis; and the inhibition can be detected by monitoring level of acetyl-CoA transcripts and rRNA level. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification of microbial populations driving biopolymer degradation in acidic peatlands by metatranscriptomic analysis.

PubMed

Ivanova, Anastasia A; Wegner, Carl-Eric; Kim, Yongkyu; Liesack, Werner; Dedysh, Svetlana N

2016-10-01

Northern peatlands play a crucial role in the global carbon balance, serving as a persistent sink for atmospheric CO2 and a global carbon store. Their most extensive type, Sphagnum-dominated acidic peatlands, is inhabited by microorganisms with poorly understood degradation capabilities. Here, we applied a combination of barcoded pyrosequencing of SSU rRNA genes and Illumina RNA-Seq of total RNA (metatranscriptomics) to identify microbial populations and enzymes involved in degrading the major components of Sphagnum-derived litter and exoskeletons of peat-inhabiting arthropods: cellulose, xylan, pectin and chitin. Biopolymer addition to peat induced a threefold to fivefold increase in bacterial cell numbers. Functional community profiles of assembled mRNA differed between experimental treatments. In particular, pectin and xylan triggered increased transcript abundance of genes involved in energy metabolism and central carbon metabolism, such as glycolysis and TCA cycle. Concurrently, the substrate-induced activity of bacteria on these two biopolymers stimulated grazing of peat-inhabiting protozoa. Alveolata (ciliates) was the most responsive protozoa group as confirmed by analysis of both SSU rRNA genes and SSU rRNA. A stimulation of alphaproteobacterial methanotrophs on pectin was consistently shown by rRNA and mRNA data. Most likely, their significant enrichment was due to the utilization of methanol released during the degradation of pectin. Analysis of SSU rRNA and total mRNA revealed a specific response of Acidobacteria and Actinobacteria to chitin and pectin, respectively. Relatives of Telmatobacter bradus were most responsive among the Acidobacteria, while the actinobacterial response was primarily affiliated with Frankiales and Propionibacteriales. The expression of a wide repertoire of carbohydrate-active enzymes (CAZymes) corresponded well to the detection of a highly diverse peat-inhabiting microbial community, which is dominated by yet uncultivated bacteria. © 2016 John Wiley & Sons Ltd.

Population genetic analysis reveals a low level of genetic diversity of 'Candidatus Phytoplasma aurantifolia' causing witches' broom disease in lime.

PubMed

Al-Abadi, Shaikha Y; Al-Sadi, Abdullah M; Dickinson, Matthew; Al-Hammadi, Mohammed S; Al-Shariqi, Rashid; Al-Yahyai, Rashid A; Kazerooni, Elham A; Bertaccini, Assunta

2016-01-01

Witches' broom disease of lime (WBDL) is a serious phytoplasma disease of acid lime in Oman, the UAE and Iran. Despite efforts to study it, no systemic study attempted to characterize the relationship among the associated phytoplasma, ' Candidatus Phytoplasma aurantifolia', from the three countries. This study utilized sequences of the 16S rRNA, imp and secA genes to characterize 57 strains collected from Oman (38), the UAE (9) and Iran (10). Phylogenetic analysis based on the 16S rRNA gene showed that the 57 strains shared 98.5-100 % nucleotide similarity to each other and to strains of ' Ca . P. aurantifolia' available in GenBank. The level of genetic diversity was low based on the 16S rRNA (0-0.011), imp (0-0.002) and secA genes (0-0.015). The presence of low level of diversity among phytoplasma strains from Oman, the UAE and Iran can be explained by the movement of infected lime seedlings from one country to another through trading and exchange of infected plants. The study discusses implication of the findings on WBDL spread and management.

Microbial community structures in foaming and nonfoaming full-scale wastewater treatment plants.

PubMed

de los Reyes, Francis L; Rothauszky, Dagmar; Raskin, Lutgarde

2002-01-01

A survey of full-scale activated-sludge plants in Illinois revealed that filamentous foaming is a widespread problem in the state, and that the causes and consequences of foaming control strategies are not fully understood. To link microbial community structure to foam occurrence, microbial populations in eight foaming and nine nonfoaming full-scale activated-sludge systems were quantified using oligonucleotide hybridization probes targeting the ribosomal RNA (rRNA) of the mycolata; Gordonia spp.; Gordonia amarae; "Candidatus Microthrix parvicella"; the alpha-, beta-, and gamma-subclasses of the Proteobacteria, and members of the Cytophaga-Flavobacteria. Parallel measurements of microbial population abundance using hybridization of extracted RNA and fluorescence in situ hybridization (FISH) showed that the levels of mycolata, particularly Gordonia spp., were higher in most foaming systems compared with nonfoaming systems. Fluorescence in situ hybridization and microscopy suggested the involvement of "Candidatus Microthrix parvicella" and Skermania piniformis in foam formation in other plants. Finally, high numbers of "Candidatus Microthrix parvicella" were detected by FISH in foam and mixed liquor samples of one plant, whereas the corresponding levels of rRNA were low. This finding implies that inactive "Candidatus Microthrix parvicella" cells (i.e., cells with low rRNA levels) can cause foaming.

Differential in vivo gene expression of major Leptospira proteins in resistant or susceptible animal models.

PubMed

Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille

2012-09-01

Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.

Defining the bacteroides ribosomal binding site.

PubMed

Wegmann, Udo; Horn, Nikki; Carding, Simon R

2013-03-01

The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

Microbial expression profiles in the rhizosphere of willows depend on soil contamination

PubMed Central

Yergeau, Etienne; Sanschagrin, Sylvie; Maynard, Christine; St-Arnaud, Marc; Greer, Charles W

2014-01-01

The goal of phytoremediation is to use plants to immobilize, extract or degrade organic and inorganic pollutants. In the case of organic contaminants, plants essentially act indirectly through the stimulation of rhizosphere microorganisms. A detailed understanding of the effect plants have on the activities of rhizosphere microorganisms could help optimize phytoremediation systems and enhance their use. In this study, willows were planted in contaminated and non-contaminated soils in a greenhouse, and the active microbial communities and the expression of functional genes in the rhizosphere and bulk soil were compared. Ion Torrent sequencing of 16S rRNA and Illumina sequencing of mRNA were performed. Genes related to carbon and amino-acid uptake and utilization were upregulated in the willow rhizosphere, providing indirect evidence of the compositional content of the root exudates. Related to this increased nutrient input, several microbial taxa showed a significant increase in activity in the rhizosphere. The extent of the rhizosphere stimulation varied markedly with soil contamination levels. The combined selective pressure of contaminants and rhizosphere resulted in higher expression of genes related to competition (antibiotic resistance and biofilm formation) in the contaminated rhizosphere. Genes related to hydrocarbon degradation were generally more expressed in contaminated soils, but the exact complement of genes induced was different for bulk and rhizosphere soils. Together, these results provide an unprecedented view of microbial gene expression in the plant rhizosphere during phytoremediation. PMID:24067257

Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

PubMed

Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

2013-09-15

Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

PubMed

Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

2013-05-01

The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Rapid detection of rRNA group I pseudomonads in contaminated metalworking fluids and biofilm formation by fluorescent in situ hybridization.

PubMed

Saha, Ratul; Donofrio, Robert S; Goeres, Darla M; Bagley, Susan T

2012-05-01

Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads.

Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

PubMed

Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

2018-05-01

Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

PubMed Central

Gaal, T; Gourse, R L

1990-01-01

rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

PubMed

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-10-15

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Nucleolar evolution and coiled bodies during meiotic prophase in Olea europaea: differential localization of nucleic acids.

PubMed

Olmedilla, A; de Dios Alché, J; Rodríguez-García, M I

1997-10-01

We studied the ultrastructural evolution of the nucleolus during meiotic prophase in olive microsporocytes. During prophase, nuclear bodies morphologically similar to coiled bodies were observed. The nucleic acid composition of these bodies was examined in microsporocytes using electron microscopic techniques with EDTA preferential ribonucleoprotein staining, anti-DNA immunolabeling, the in situ terminal deoxynucleotidyl transferase-immunogold technique, and in situ hybridization with 18S rRNA and U3 snoRNA digoxigenin-labeled probes. The ultrastructural appearance of the meiocyte nucleolus indicated a low level of activity from the early prophase stage: the granular component was practically absent and nucleoli were constituted almost exclusively by dense fibrillar component containing large fibrillar centers that lacked chromatin inclusions. However, the appearance of reactivation vacuoles in the nucleolus during zygotene and high levels of rRNA in the nucleoplasm during pachytene support the presence of a peak in rRNA synthesis. Our results also show that the nuclear bodies that appear during prophase I are ribonucleoproteinaceous in nature; neither DNA nor ribosomal RNA were detected. The presence of U3 snoRNA, as shown by in situ hybridization in nuclear bodies from plant material, is also evidence that these structures are coiled bodies. We suggest that coiled bodies are involved not only in pre- and post-splicing events but also in the storage, transport or recycling of rRNA maturation elements.

Stability of a biogas-producing bacterial, archaeal and fungal community degrading food residues.

PubMed

Bengelsdorf, Frank R; Gerischer, Ulrike; Langer, Susanne; Zak, Manuel; Kazda, Marian

2013-04-01

The resident microbiota was analyzed in a mesophilic, continuously operating biogas plant predominantly utilizing food residues, stale bread, and other waste cosubstrates together with pig manure and maize silage. The dominating bacterial, archaeal, and eukaryotic community members were characterized by two different 16S/18S rRNA gene culture-independent approaches. Prokaryotic 16S rRNA gene and eukaryotic 18S rRNA gene clone libraries were constructed and further analyzed by restriction fragment length polymorphism (RFLP), 16S/18S rRNA gene sequencing, and phylogenetic tree reconstruction. The most dominant bacteria belonged to the phyla Bacteriodetes, Chloroflexus, and Firmicutes. On the family level, the bacterial composition confirmed high differences among biogas plants studied so fare. In contrast, the methanogenic archaeal community was similar to that of other studied biogas plants. Furthermore, it was possible to identify fungi at the genus level, namely Saccharomyces and Mucor. Both genera, which are important for microbial degradation of complex compounds, were up to now not found in biogas plants. The results revealed their long-term presence as indicated by denaturating gradient gel electrophoresis (DGGE). The DGGE method confirmed that the main members of the microbial community were constantly present over more than one-year period. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

High-resolution phylogenetic microbial community profiling

DOE PAGES

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

2016-02-09

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

PubMed

Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

2017-02-01

To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

Matrix-Assisted Laser Desorption Ionization (MALDI)-Time of Flight Mass Spectrometry- and MALDI Biotyper-Based Identification of Cultured Biphenyl-Metabolizing Bacteria from Contaminated Horseradish Rhizosphere Soil▿

PubMed Central

Uhlik, Ondrej; Strejcek, Michal; Junkova, Petra; Sanda, Miloslav; Hroudova, Miluse; Vlcek, Cestmir; Mackova, Martina; Macek, Tomas

2011-01-01

Bacteria that are able to utilize biphenyl as a sole source of carbon were extracted and isolated from polychlorinated biphenyl (PCB)-contaminated soil vegetated by horseradish. Isolates were identified using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The usage of MALDI Biotyper for the classification of isolates was evaluated and compared to 16S rRNA gene sequence analysis. A wide spectrum of bacteria was isolated, with Arthrobacter, Serratia, Rhodococcus, and Rhizobium being predominant. Arthrobacter isolates also represented the most diverse group. The use of MALDI Biotyper in many cases permitted the identification at the level of species, which was not achieved by 16S rRNA gene sequence analyses. However, some isolates had to be identified by 16S rRNA gene analyses if MALDI Biotyper-based identification was at the level of probable or not reliable identification, usually due to a lack of reference spectra included in the database. Overall, this study shows the possibility of using MALDI-TOF MS and MALDI Biotyper for the fast and relatively nonlaborious identification/classification of soil isolates. At the same time, it demonstrates the dominant role of employing 16S rRNA gene analyses for the identification of recently isolated strains that can later fill the gaps in the protein-based identification databases. PMID:21821747

Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

PubMed

Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

2017-12-30

Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

Identification of Circular RNAs from the Parental Genes Involved in Multiple Aspects of Cellular Metabolism in Barley

PubMed Central

Darbani, Behrooz; Noeparvar, Shahin; Borg, Søren

2016-01-01

RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts. PMID:27375638

Analysis of sequence variation among smeDEF multi drug efflux pump genes and flanking DNA from defined 16S rRNA subgroups of clinical Stenotrophomonas maltophilia isolates.

PubMed

Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B

2004-08-01

To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

PubMed

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

Quantitative Interaction Effects of Carbon Dioxide, Sodium Chloride, and Sodium Nitrite on Neurotoxin Gene Expression in Nonproteolytic Clostridium botulinum Type B

PubMed Central

Lövenklev, Maria; Artin, Ingrid; Hagberg, Oskar; Borch, Elisabeth; Holst, Elisabet; Rådström, Peter

2004-01-01

The effects of carbon dioxide, sodium chloride, and sodium nitrite on type B botulinum neurotoxin (BoNT/B) gene (cntB) expression in nonproteolytic Clostridium botulinum were investigated in a tryptone-peptone-yeast extract (TPY) medium. Various concentrations of these selected food preservatives were studied by using a complete factorial design in order to quantitatively study interaction effects, as well as main effects, on the following responses: lag phase duration (LPD), growth rate, relative cntB expression, and extracellular BoNT/B production. Multiple linear regression was used to set up six statistical models to quantify and predict these responses. All combinations of NaCl and NaNO2 in the growth medium resulted in a prolonged lag phase duration and in a reduction in the specific growth rate. In contrast, the relative BoNT/B gene expression was unchanged, as determined by the cntB-specific quantitative reverse transcription-PCR method. This was confirmed when we measured the extracellular BoNT/B concentration by an enzyme-linked immunosorbent assay. CO2 was found to have a major effect on gene expression when the cntB mRNA levels were monitored in the mid-exponential, late exponential, and late stationary growth phases. The expression of cntB relative to the expression of the 16S rRNA gene was stimulated by an elevated CO2 concentration; the cntB mRNA level was fivefold greater in a 70% CO2 atmosphere than in a 10% CO2 atmosphere. These findings were also confirmed when we analyzed the extracellular BoNT/B concentration; we found that the concentrations were 27 ng · ml−1 · unit of optical density−1 in the 10% CO2 atmosphere and 126 ng · ml−1 · unit of optical density−1 in the 70% CO2 atmosphere. PMID:15128553

Differential In Vivo Gene Expression of Major Leptospira Proteins in Resistant or Susceptible Animal Models

PubMed Central

Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme

2012-01-01

Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals. PMID:22729538

Supplemental feeding of a gut microbial metabolite of linoleic acid, 10-hydroxy-cis-12-octadecenoic acid, alleviates spontaneous atopic dermatitis and modulates intestinal microbiota in NC/nga mice.

PubMed

Kaikiri, Hiroko; Miyamoto, Junki; Kawakami, Takahiro; Park, Si-Bum; Kitamura, Nahoko; Kishino, Shigenobu; Yonejima, Yasunori; Hisa, Keiko; Watanabe, Jun; Ogita, Tasuku; Ogawa, Jun; Tanabe, Soichi; Suzuki, Takuya

2017-12-01

The present study investigated the antiallergic and anti-inflammatory effects of 10-hydroxy-cis-12-octadecenoic acid (HYA), a novel gut microbial metabolite of linoleic acid, in NC/Nga mice, a model of atopic dermatitis (AD). Feeding HYA decreased the plasma immunoglobulin E level and skin infiltration of mast cells with a concomitant decrease in dermatitis score. HYA feeding decreased TNF-α and increased claudin-1, a tight junction protein, levels in the mouse skin. Cytokine expression levels in the skin and intestinal Peyer's patches cells suggested that HYA improved the Th1/Th2 balance in mice. Immunoglobulin A concentration in the feces of the HYA-fed mice was approximately four times higher than that in the control mice. Finally, denaturing gradient gel electrophoresis of the PCR-amplified 16 S rRNA gene of fecal microbes indicated the modification of microbiota by HYA. Taken together, the alterations in the intestinal microbiota might be, at least in part, associated with the antiallergic effect of HYA.

Nucleolar Reorganization Upon Site-Specific Double-Strand Break Induction.

PubMed

Franek, Michal; Kovaříková, Alena; Bártová, Eva; Kozubek, Stanislav

2016-11-01

DNA damage response (DDR) in ribosomal genes and mechanisms of DNA repair in embryonic stem cells (ESCs) are less explored nuclear events. DDR in ESCs should be unique due to their high proliferation rate, expression of pluripotency factors, and specific chromatin signature. Given short population doubling time and fast progress through G1 phase, ESCs require a sustained production of rRNA, which leads to the formation of large and prominent nucleoli. Although transcription of rRNA in the nucleolus is relatively well understood, little is known about DDR in this nuclear compartment. Here, we directed formation of double-strand breaks in rRNA genes with I- PpoI endonuclease, and we studied nucleolar morphology, DDR, and chromatin modifications. We observed a pronounced formation of I- PpoI-induced nucleolar caps, positive on BRCA1, NBS1, MDC1, γH2AX, and UBF1 proteins. We showed interaction of nucleolar protein TCOF1 with HDAC1 and TCOF1 with CARM1 after DNA injury. Moreover, H3R17me2a modification mediated by CARM1 was found in I- PpoI-induced nucleolar caps. Finally, we report that heterochromatin protein 1 is not involved in DNA repair of nucleolar caps.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

PubMed Central

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

2013-01-01

SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

Differential enrichment of TTF-I and Tip5 in the T-like promoter structures of the rDNA contribute to the epigenetic response of Cyprinus carpio during environmental adaptation.

PubMed

Nardocci, Gino; Simonet, Nicolas G; Navarro, Cristina; Längst, Gernot; Alvarez, Marco

2016-08-01

To ensure homeostasis, ectothermic organisms adapt to environmental variations through molecular mechanisms. We previously reported that during the seasonal acclimatization of the common carp Cyprinus carpio, molecular and cellular functions are reprogrammed, resulting in distinctive traits. Importantly, the carp undergoes a drastic rearrangement of nucleolar components during adaptation. This ultrastructural feature reflects a fine modulation of rRNA gene transcription. Specifically, we identified the involvement of the transcription termination factor I (TTF-I) and Tip-5 (member of nucleolar remodeling complex, NoRC) in the control of rRNA transcription. Our results suggest that differential Tip5 enrichment is essential for silencing carp ribosomal genes and that the T0 element is key for regulating the ribosomal gene during the acclimatization process. Interestingly, the expression and content of Tip5 were significantly higher in winter than in summer. Since carp ribosomal gene expression is lower in the winter than in summer, and considering that expression concomitantly occurs with nucleolar ultrastructural changes of the acclimatization process, these results indicate that Tip5 importantly contributes to silencing the ribosomal genes. In conclusion, the current study provides novel evidence on the contributions of TTF-I and NoRC in the environmental reprogramming of ribosomal genes during the seasonal adaptation process in carp.

How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys

PubMed Central

Berney, Cédric; Fahrni, José; Pawlowski, Jan

2004-01-01

Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

PubMed Central

Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

2014-01-01

Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with the sea slug Elysia chlorotica.

PubMed

Mujer, C V; Andrews, D L; Manhart, J R; Pierce, S K; Rumpho, M E

1996-10-29

The marine slug Elysia chlorotica (Gould) forms an intracellular symbiosis with photosynthetically active chloroplasts from the chromophytic alga Vaucheria litorea (C. Agardh). This symbiotic association was characterized over a period of 8 months during which E. chlorotica was deprived of V. litorea but provided with light and CO2. The fine structure of the symbiotic chloroplasts remained intact in E. chlorotica even after 8 months of starvation as revealed by electron microscopy. Southern blot analysis of total DNA from E. chlorotica indicated that algal genes, i.e., rbcL, rbcS, psaB, psbA, and 16S rRNA are present in the animal. These genes are typically localized to the plastid genome in higher plants and algae except rbcS, which is nuclear-encoded in higher plants and green (chlorophyll a/b) algae. Our analysis suggests, however, that similar to the few other chromophytes (chlorophyll a/c) examined, rbcS is chloroplast encoded in V. litorea. Levels of psbA transcripts remained constant in E. chlorotica starved for 2 and 3 months and then gradually declined over the next 5 months corresponding with senescence of the animal in culture and in nature. The RNA synthesis inhibitor 6-methylpurine reduced the accumulation of psbA transcripts confirming active transcription. In contrast to psbA, levels of 16S rRNA transcripts remained constant throughout the starvation period. The levels of the photosystem II proteins, D1 and CP43, were high at 2 and 4 months of starvation and remained constant at a lower steady-state level after 6 months. In contrast, D2 protein levels, although high at 2 and 4 months, were very low at all other periods of starvation. At 8 months, de novo synthesis of several thylakoid membrane-enriched proteins, including D1, still occurred. To our knowledge, these results represent the first molecular evidence for active transcription and translation of algal chloroplast genes in an animal host and are discussed in relation to the endosymbiotic theory of eukaryote origins.

Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with the sea slug Elysia chlorotica.

PubMed Central

Mujer, C V; Andrews, D L; Manhart, J R; Pierce, S K; Rumpho, M E

1996-01-01

The marine slug Elysia chlorotica (Gould) forms an intracellular symbiosis with photosynthetically active chloroplasts from the chromophytic alga Vaucheria litorea (C. Agardh). This symbiotic association was characterized over a period of 8 months during which E. chlorotica was deprived of V. litorea but provided with light and CO2. The fine structure of the symbiotic chloroplasts remained intact in E. chlorotica even after 8 months of starvation as revealed by electron microscopy. Southern blot analysis of total DNA from E. chlorotica indicated that algal genes, i.e., rbcL, rbcS, psaB, psbA, and 16S rRNA are present in the animal. These genes are typically localized to the plastid genome in higher plants and algae except rbcS, which is nuclear-encoded in higher plants and green (chlorophyll a/b) algae. Our analysis suggests, however, that similar to the few other chromophytes (chlorophyll a/c) examined, rbcS is chloroplast encoded in V. litorea. Levels of psbA transcripts remained constant in E. chlorotica starved for 2 and 3 months and then gradually declined over the next 5 months corresponding with senescence of the animal in culture and in nature. The RNA synthesis inhibitor 6-methylpurine reduced the accumulation of psbA transcripts confirming active transcription. In contrast to psbA, levels of 16S rRNA transcripts remained constant throughout the starvation period. The levels of the photosystem II proteins, D1 and CP43, were high at 2 and 4 months of starvation and remained constant at a lower steady-state level after 6 months. In contrast, D2 protein levels, although high at 2 and 4 months, were very low at all other periods of starvation. At 8 months, de novo synthesis of several thylakoid membrane-enriched proteins, including D1, still occurred. To our knowledge, these results represent the first molecular evidence for active transcription and translation of algal chloroplast genes in an animal host and are discussed in relation to the endosymbiotic theory of eukaryote origins. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8901581

Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

PubMed Central

Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

2017-01-01

The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the periphery of nucleoli. PMID:29190286

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

PubMed

Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

2007-06-01

Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

Prevalence of 16S rRNA methylase genes in Klebsiella pneumoniae isolates from a Chinese teaching hospital: coexistence of rmtB and armA genes in the same isolate.

PubMed

Yu, Fangyou; Wang, Liangxing; Pan, Jingye; Yao, Dan; Chen, Chan; Zhu, Tao; Lou, Qiang; Hu, Jian; Wu, Yang; Zhang, Xueqing; Chen, Zengqiang; Qu, Di

2009-05-01

16S rRNA methylase-mediated high-level resistance to aminoglycosides has been reported recently in clinical isolates of Gram-negative bacilli from several countries. Twenty-one (6.2%, 21/337) of 337 isolates of Klebsiella pneumoniae from a teaching hospital in Wenzhou, China, were positive for 16S rRNA methylase genes (3 for armA, 13 for rmtB, 5 for both armA and rmtB) and highly resistant to gentamicin, amikacin, and tobramycin (MICs, > or =256 microg/mL). Nineteen of 21 isolates harboring 16S rRNA methyalse genes were extended-spectrum beta-lactamase (ESBL) producers. The plasmids harboring 16S rRNA methylase genes from 14 of 21 donors were transferred into the recipients, Escherichia coli J53. The armA and the rmtB usually coexisted with ESBL genes in the same isolate in clinical isolates and cotransferred with ESBL genes on a self-transmissible conjugative plasmid to the recipients. Among 5 isolates harboring both armA and rmtB, the armA genes were located on the chromosomes, and the rmtB genes were located on the plasmids, as determined by Southern hybridization. The result of pulsed-field gel electrophoresis showed that horizontal gene transfer and clonal spread were responsible for the dissemination of the rmtB and the armA genes. 16S rRNA methylase-producing isolates of Klebsiella pneumoniae were commonly identified in the Chinese teaching hospital with coexistence of rmtB and armA genes in the same isolate.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

PubMed

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Microbiota-inducible Innate Immune, Siderophore Binding Protein Lipocalin 2 is Critical for Intestinal Homeostasis.

PubMed

Singh, Vishal; Yeoh, Beng San; Chassaing, Benoit; Zhang, Benyue; Saha, Piu; Xiao, Xia; Awasthi, Deepika; Shashidharamurthy, Rangaiah; Dikshit, Madhu; Gewirtz, Andrew; Vijay-Kumar, Matam

2016-07-01

Lipocalin 2 (Lcn2) is a multifunctional innate immune protein whose expression closely correlates with extent of intestinal inflammation. However, whether Lcn2 plays a role in the pathogenesis of gut inflammation is unknown. Herein, we investigated the extent to which Lcn2 regulates inflammation and gut bacterial dysbiosis in mouse models of IBD. Lcn2 expression was monitored in murine colitis models and upon microbiota ablation/restoration. WT and Lcn2 knockout ( Lcn2 KO) mice were analyzed for gut bacterial load, composition by 16S rRNA gene pyrosequencing and, their colitogenic potential by co-housing with Il-10 KO mice. Acute (dextran sodium sulfate) and chronic (IL-10R neutralization and T-cell adoptive transfer) colitis was induced in WT and Lcn2 KO mice with or without antibiotics. Lcn2 expression was dramatically induced upon inflammation and was dependent upon presence of a gut microbiota and MyD88 signaling. Use of bone-marrow chimeric mice revealed non-immune cells are the major contributors of circulating Lcn2. Lcn2 KO mice exhibited elevated levels of entA -expressing gut bacteria burden and, moreover, a broadly distinct bacterial community relative to WT littermates. Lcn2 KO mice developed highly colitogenic T-cells and exhibited exacerbated colitis upon exposure to DSS or neutralization of IL-10. Such exacerbated colitis could be prevented by antibiotic treatment. Moreover, exposure to the microbiota of Lcn2 KO mice, via cohousing, resulted in severe colitis in Il-10 KO mice. Lcn2 is a bacterially-induced, MyD88-dependent, protein that play an important role in gut homeostasis and a pivotal role upon challenge. Hence, therapeutic manipulation of Lcn2 levels may provide a strategy to help manage diseases driven by alteration of the gut microbiota.

The green impact: bacterioplankton response toward a phytoplankton spring bloom in the southern North Sea assessed by comparative metagenomic and metatranscriptomic approaches

PubMed Central

Wemheuer, Bernd; Wemheuer, Franziska; Hollensteiner, Jacqueline; Meyer, Frauke-Dorothee; Voget, Sonja; Daniel, Rolf

2015-01-01

Phytoplankton blooms exhibit a severe impact on bacterioplankton communities as they change nutrient availabilities and other environmental factors. In the current study, the response of a bacterioplankton community to a Phaeocystis globosa spring bloom was investigated in the southern North Sea. For this purpose, water samples were taken inside and reference samples outside of an algal spring bloom. Structural changes of the bacterioplankton community were assessed by amplicon-based analysis of 16S rRNA genes and transcripts generated from environmental DNA and RNA, respectively. Several marine groups responded to bloom presence. The abundance of the Roseobacter RCA cluster and the SAR92 clade significantly increased in bloom presence in the total and active fraction of the bacterial community. Functional changes were investigated by direct sequencing of environmental DNA and mRNA. The corresponding datasets comprised more than 500 million sequences across all samples. Metatranscriptomic data sets were mapped on representative genomes of abundant marine groups present in the samples and on assembled metagenomic and metatranscriptomic datasets. Differences in gene expression profiles between non-bloom and bloom samples were recorded. The genome-wide gene expression level of Planktomarina temperata, an abundant member of the Roseobacter RCA cluster, was higher inside the bloom. Genes that were differently expressed included transposases, which showed increased expression levels inside the bloom. This might contribute to the adaptation of this organism toward environmental stresses through genome reorganization. In addition, several genes affiliated to the SAR92 clade were significantly upregulated inside the bloom including genes encoding for proteins involved in isoleucine and leucine incorporation. Obtained results provide novel insights into compositional and functional variations of marine bacterioplankton communities as response to a phytoplankton bloom. PMID:26322028

Reference gene stability of a synanthropic fly, Chrysomya megacephala.

PubMed

Wang, Xiaoyun; Xiong, Mei; Wang, Jialu; Lei, Chaoliang; Zhu, Fen

2015-10-29

Stable reference genes are essential for accurate normalization in gene expression studies with reverse transcription quantitative polymerase chain reaction (qPCR). A synanthropic fly, Chrysomya megacephala, is a well known medical vector and forensic indicator. Unfortunately, previous studies did not look at the stability of reference genes used in C. megacephala. In this study, the expression level of Actin, ribosomal protein L8 (Rpl8), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor 1α (EF1), α-tubulin (α-TUB), β-tubulin (β-TUB), TATA binding box (TBP), 18S rRNA (18S) and ribosomal protein S7 (Rps7) were evaluated for their stability using online software RefFinder, which combines the normal software of the ΔCt method, BestKeeper, Normfinder, and geNorm. Moreover the number of suitable reference gene pairs was also suggested by Excel-based geNorm. The expression levels of these reference genes were evaluated under different experimental conditions with special perspectives of forensic applications: developmental stages (eggs, first, second and third instar larvae, pupae and adults); food sources of larvae (pork, fish and chicken); feeding larvae with drugs (untreated control, Estazolam and Marvelon); feeding larvae with heavy metals (untreated control, cadmium and zinc); tissues of adults (head, thorax, abdomen, legs and wings). According to RefFinder, EF1 was the most suitable reference gene of developmental stages, food and tissues; 18S and GAPDH were the most suitable reference genes for drugs and heavy metals, respectively, which could be widely used for quantification of target gene expression with qPCR in C. megacephala. Suitable reference gene pairs were also suggested by geNorm. This fundamental but vital work should facilitate the gene studies of related biological processes and deepen the understanding in physiology, toxicology, and especially medical and forensic entomology of C. megacephala.

Bacterial community and arsenic functional genes diversity in arsenic contaminated soils from different geographic locations

PubMed Central

Gu, Yunfu; D. Van Nostrand, Joy; Wu, Liyou; He, Zhili; Qin, Yujia; Zhao, Fang-Jie; Zhou, Jizhong

2017-01-01

To understand how soil microbial communities and arsenic (As) functional genes respond to soil arsenic (As) contamination, five soils contaminated with As at different levels were collected from diverse geographic locations, incubated for 54 days under flooded conditions, and examined by both MiSeq sequencing of 16S rRNA gene amplicons and functional gene microarray (GeoChip 4.0). The results showed that both bacterial community structure and As functional gene structure differed among geographical locations. The diversity of As functional genes correlated positively with the diversity of 16S rRNA genes (P< 0.05). Higher diversities of As functional genes and 16S rRNA genes were observed in the soils with higher available As. Soil pH, phosphate-extractable As, and amorphous Fe content were the most important factors in shaping the bacterial community structure and As transformation functional genes. Geographic location was also important in controlling both the bacterial community and As transformation functional potential. These findings provide insights into the variation of As transformation functional genes in soils contaminated with different levels of As at different geographic locations, and the impact of environmental As contamination on the soil bacterial community. PMID:28475654

Use of 16S-23S rRNA spacer-region (SR)-PCR for identification of intestinal clostridia.

PubMed

Song, Yuli; Liu, Chengxu; Molitoris, Denise; Tomzynski, Thomas J; Mc Teague, Maureen; Read, Erik; Finegold, Sydney M

2002-12-01

The suitability of a species identification technique based on PCR analysis of 16S-23S rRNA spacer region (SR) polymorphism for human intestinal Clostridium species was evaluated. This SR-PCR based technique is highly reproducible and successfully differentiated the strains tested, which included 17 ATCC type strains of Clostridium and 152 human stool Clostridium isolates, at the species or intraspecies level. Ninety-eight of 152 stool isolates, including C. bifermentans, C. butyricum, C. cadaveris, C. orbiscindens, C. paraputrificum, C. pefringens, C. ramosum, C. scindens, C. spiroforme, C. symbiosum and C. tertium, were identified to species level by SR-PCR patterns that were identical to those of their corresponding ATCC type strains. The other 54 stool isolates distributed among ten SR-PCR patterns that are unique and possibly represent ten novel Clostridium species or subspecies. The species identification obtained by SR-PCR pattern analysis completely agreed with that obtained by 16S rRNA sequencing, and led to identification that clearly differed from that obtained by cellular fatty acid analysis for 23/152 strains (15%). These results indicate that SR-PCR provides an accurate and rapid molecular method for the identification of human intestinal Clostridium species.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

RNA content in the nucleolus alters p53 acetylation via MYBBP1A

PubMed Central

Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn

2011-01-01

A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583

Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea)

PubMed Central

Vd’ačný, Peter; Bourland, William A.; Orsi, William; Epstein, Slava S.; Foissner, Wilhelm

2012-01-01

The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria + Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763

Genealogical analyses of multiple loci of litostomatean ciliates (Protista, Ciliophora, Litostomatea).

PubMed

Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm

2012-11-01

The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria+Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. Copyright © 2012 Elsevier Inc. All rights reserved.

Impact of resistance exercise on ribosome biogenesis is acutely regulated by post-exercise recovery strategies.

PubMed

Figueiredo, Vandré C; Roberts, Llion A; Markworth, James F; Barnett, Matthew P G; Coombes, Jeff S; Raastad, Truls; Peake, Jonathan M; Cameron-Smith, David

2016-02-01

Muscle hypertrophy occurs following increased protein synthesis, which requires activation of the ribosomal complex. Additionally, increased translational capacity via elevated ribosomal RNA (rRNA) synthesis has also been implicated in resistance training-induced skeletal muscle hypertrophy. The time course of ribosome biogenesis following resistance exercise (RE) and the impact exerted by differing recovery strategies remains unknown. In the present study, the activation of transcriptional regulators, the expression levels of pre-rRNA, and mature rRNA components were measured through 48 h after a single-bout RE. In addition, the effects of either low-intensity cycling (active recovery, ACT) or a cold-water immersion (CWI) recovery strategy were compared. Nine male subjects performed two bouts of high-load RE randomized to be followed by 10 min of either ACT or CWI. Muscle biopsies were collected before RE and at 2, 24, and 48 h after RE. RE increased the phosphorylation of the p38-MNK1-eIF4E axis, an effect only evident with ACT recovery. Downstream, cyclin D1 protein, total eIF4E, upstream binding factor 1 (UBF1), and c-Myc proteins were all increased only after RE with ACT. This corresponded with elevated abundance of the pre-rRNAs (45S, ITS-28S, ITS-5.8S, and ETS-18S) from 24 h after RE with ACT. In conclusion, coordinated upstream signaling and activation of transcriptional factors stimulated pre-rRNA expression after RE. CWI, as a recovery strategy, markedly blunted these events, suggesting that suppressed ribosome biogenesis may be one factor contributing to the impaired hypertrophic response observed when CWI is used regularly after exercise. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Removing the needle from the haystack: Enrichment of Wolbachia endosymbiont transcripts from host nematode RNA by Cappable-seq™.

PubMed

Luck, Ashley N; Slatko, Barton E; Foster, Jeremy M

2017-01-01

Efficient transcriptomic sequencing of microbial mRNA derived from host-microbe associations is often compromised by the much lower relative abundance of microbial RNA in the mixed total RNA sample. One solution to this problem is to perform extensive sequencing until an acceptable level of transcriptome coverage is obtained. More cost-effective methods include use of prokaryotic and/or eukaryotic rRNA depletion strategies, sometimes in conjunction with depletion of polyadenylated eukaryotic mRNA. Here, we report use of Cappable-seq™ to specifically enrich, in a single step, Wolbachia endobacterial mRNA transcripts from total RNA prepared from the parasitic filarial nematode, Brugia malayi. The obligate Wolbachia endosymbiont is a proven drug target for many human filarial infections, yet the precise nature of its symbiosis with the nematode host is poorly understood. Insightful analysis of the expression levels of Wolbachia genes predicted to underpin the mutualistic association and of known drug target genes at different life cycle stages or in response to drug treatments is typically challenged by low transcriptomic coverage. Cappable-seq resulted in up to ~ 5-fold increase in the number of reads mapping to Wolbachia. On average, coverage of Wolbachia transcripts from B. malayi microfilariae was enriched ~40-fold by Cappable-seq. Additionally, this method has an additional benefit of selectively removing abundant prokaryotic ribosomal RNAs.The deeper microbial transcriptome sequencing afforded by Cappable-seq facilitates more detailed characterization of gene expression levels of pathogens and symbionts present in animal tissues.

Maternal consumption of fructo-oligosaccharide diminishes the severity of skin inflammation in offspring of NC/Nga mice.

PubMed

Fujiwara, Reiko; Takemura, Naoki; Watanabe, Jun; Sonoyama, Kei

2010-02-01

Strategies to manipulate the gut microbiota in infancy have been considered to prevent the development of allergic diseases later in life. We aimed to elucidate the effects of maternal dietary supplementation with a prebiotic oligosaccharide on gut microbiota and spontaneously developing atopic dermatitis-like skin lesions in the offspring of NC/Nga mice. Female NC/Nga mice were fed diets either with or without fructo-oligosaccharide supplementation during pregnancy and lactation. After weaning, offspring were fed the diets supplemented with or without fructo-oligosaccharide for 11 weeks in an air-uncontrolled conventional room. Changes in gut microbiota were assessed by denaturing gradient gel electrophoresis of the PCR-amplified 16S rRNA gene. Skin lesions were evaluated by a clinical score and scratching behaviour. Serum antibody levels were measured by ELISA, and expression levels of cytokines and chemokines in lesional tissue were evaluated by quantitative RT-PCR. Maternal supplementation with fructo-oligosaccharide modulated the gut microbiota in sucklings. Although maternal supplementation with fructo-oligosaccharide suppressed the increase in clinical skin severity score and scratching behaviour in offspring, dietary fructo-oligosaccharide after weaning was less effective. The diminution of skin lesions was accompanied by lower serum concentrations of total IgG1 and lower expression levels of TNF-alpha in the lesional tissue. These data suggest that maternal consumption of fructo-oligosaccharide diminishes the severity of atopic dermatitis-like skin lesions in the offspring of NC/Nga mice.

Genetic and Epigenetic Changes in Oilseed Rape (Brassica napus L.) Extracted from Intergeneric Allopolyploid and Additions with Orychophragmus.

PubMed

Gautam, Mayank; Dang, Yanwei; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

2016-01-01

Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n = 38, genomes AACC) was extracted from its intergeneric allohexaploid (2n = 62, genomes AACCOO) with another crucifer Orychophragmus violaceus (2n = 24, genome OO), by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism, sequence-specific amplified polymorphism, and methylation-sensitive amplified polymorphism. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments) and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent.

Genetic and Epigenetic Changes in Oilseed Rape (Brassica napus L.) Extracted from Intergeneric Allopolyploid and Additions with Orychophragmus

PubMed Central

Gautam, Mayank; Dang, Yanwei; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

2016-01-01

Allopolyploidization with the merger of the genomes from different species has been shown to be associated with genetic and epigenetic changes. But the maintenance of such alterations related to one parental species after the genome is extracted from the allopolyploid remains to be detected. In this study, the genome of Brassica napus L. (2n = 38, genomes AACC) was extracted from its intergeneric allohexaploid (2n = 62, genomes AACCOO) with another crucifer Orychophragmus violaceus (2n = 24, genome OO), by backcrossing and development of alien addition lines. B. napus-type plants identified in the self-pollinated progenies of nine monosomic additions were analyzed by the methods of amplified fragment length polymorphism, sequence-specific amplified polymorphism, and methylation-sensitive amplified polymorphism. They showed modifications to certain extents in genomic components (loss and gain of DNA segments and transposons, introgression of alien DNA segments) and DNA methylation, compared with B. napus donor. The significant differences in the changes between the B. napus types extracted from these additions likely resulted from the different effects of individual alien chromosomes. Particularly, the additions which harbored the O. violaceus chromosome carrying dominant rRNA genes over those of B. napus tended to result in the development of plants which showed fewer changes, suggesting a role of the expression levels of alien rRNA genes in genomic stability. These results provided new cues for the genetic alterations in one parental genome that are maintained even after the genome becomes independent. PMID:27148282

TIF-IA and Ebp1 regulate RNA synthesis in T cells.

PubMed

Saudemont, Aurore

2015-04-16

In this issue of Blood, Nguyen et al show that mycophenolic acid (MPA) induces GTP depletion, which inhibits the function of transcription initiation factor I (TIF-IA) and impacts the interaction of TIF-IA with ErbB3-binding protein 1 (Ebp1), a key in regulating proliferating cell nuclear antigen (PCNA) expression and ribosomal RNA (rRNA) synthesis in T cells during activation.

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

PubMed

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

Nucleolar Reorganization Upon Site-Specific Double-Strand Break Induction

PubMed Central

Franek, Michal; Kovaříková, Alena; Bártová, Eva; Kozubek, Stanislav

2016-01-01

DNA damage response (DDR) in ribosomal genes and mechanisms of DNA repair in embryonic stem cells (ESCs) are less explored nuclear events. DDR in ESCs should be unique due to their high proliferation rate, expression of pluripotency factors, and specific chromatin signature. Given short population doubling time and fast progress through G1 phase, ESCs require a sustained production of rRNA, which leads to the formation of large and prominent nucleoli. Although transcription of rRNA in the nucleolus is relatively well understood, little is known about DDR in this nuclear compartment. Here, we directed formation of double-strand breaks in rRNA genes with I-PpoI endonuclease, and we studied nucleolar morphology, DDR, and chromatin modifications. We observed a pronounced formation of I-PpoI-induced nucleolar caps, positive on BRCA1, NBS1, MDC1, γH2AX, and UBF1 proteins. We showed interaction of nucleolar protein TCOF1 with HDAC1 and TCOF1 with CARM1 after DNA injury. Moreover, H3R17me2a modification mediated by CARM1 was found in I-PpoI-induced nucleolar caps. Finally, we report that heterochromatin protein 1 is not involved in DNA repair of nucleolar caps. PMID:27680669

Evaluation and Validation of Reference Genes for qRT-PCR Normalization in Frankliniella occidentalis (Thysanoptera:Thripidae)

PubMed Central

Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou

2014-01-01

Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects. PMID:25356721

Evaluation and validation of reference genes for qRT-PCR normalization in Frankliniella occidentalis (Thysanoptera: Thripidae).

PubMed

Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou

2014-01-01

Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects.

Methods for understanding microbial community structures and functions in microbial fuel cells: a review.

PubMed

Zhi, Wei; Ge, Zheng; He, Zhen; Zhang, Husen

2014-11-01

Microbial fuel cells (MFCs) employ microorganisms to recover electric energy from organic matter. However, fundamental knowledge of electrochemically active bacteria is still required to maximize MFCs power output for practical applications. This review presents microbiological and electrochemical techniques to help researchers choose the appropriate methods for the MFCs study. Pre-genomic and genomic techniques such as 16S rRNA based phylogeny and metagenomics have provided important information in the structure and genetic potential of electrode-colonizing microbial communities. Post-genomic techniques such as metatranscriptomics allow functional characterizations of electrode biofilm communities by quantifying gene expression levels. Isotope-assisted phylogenetic analysis can further link taxonomic information to microbial metabolisms. A combination of electrochemical, phylogenetic, metagenomic, and post-metagenomic techniques offers opportunities to a better understanding of the extracellular electron transfer process, which in turn can lead to process optimization for power output. Copyright © 2014 Elsevier Ltd. All rights reserved.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

PubMed Central

Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

2005-01-01

Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Dietary Fat Content and Fiber Type Modulate Hind Gut Microbial Community and Metabolic Markers in the Pig

PubMed Central

Yan, Hui; Potu, Ramesh; Lu, Hang; Vezzoni de Almeida, Vivian; Stewart, Terry; Ragland, Darryl; Armstrong, Arthur; Adeola, Olayiwola; Nakatsu, Cindy H.; Ajuwon, Kolapo M.

2013-01-01

Obesity leads to changes in the gut microbial community which contribute to the metabolic dysregulation in obesity. Dietary fat and fiber affect the caloric density of foods. The impact of dietary fat content and fiber type on the microbial community in the hind gut is unknown. Effect of dietary fat level and fiber type on hindgut microbiota and volatile fatty acid (VFA) profiles was investigated. Expression of metabolic marker genes in the gut, adipose tissue and liver was determined. A 2×2 experiment was conducted in pigs fed at two dietary fat levels (5% or 17.5% swine grease) and two fiber types (4% inulin, fermentable fructo-oligosaccharide or 4% solka floc, non-fermentable cellulose). High fat diets (HFD) resulted in a higher (P<0.05) total body weight gain, feed efficiency and back fat accumulation than the low fat diet. Feeding of inulin, but not solka floc, attenuated (P<0.05) the HFD-induced higher body weight gain and fat mass accumulation. Inulin feeding tended to lead to higher total VFA production in the cecum and resulted in a higher (P<0.05) expression of acyl coA oxidase (ACO), a marker of peroxisomal β-oxidation. Inulin feeding also resulted in lower expression of sterol regulatory element binding protein 1c (SREBP-1c), a marker of lipid anabolism. Bacteria community structure characterized by DGGE analysis of PCR amplified 16S rRNA gene fragments showed that inulin feeding resulted in greater bacterial population richness than solka floc feeding. Cluster analysis of pairwise Dice similarity comparisons of the DGGE profiles showed grouping by fiber type but not the level of dietary fat. Canonical correspondence analysis (CCA) of PCR- DGGE profiles showed that inulin feeding negatively correlated with back fat thickness. This study suggests a strong interplay between dietary fat level and fiber type in determining susceptibility to obesity. PMID:23573202

Phylogenetic and gene expression analysis of cyanobacteria and diatoms in the twilight waters of the temperate northeast Pacific Ocean.

PubMed

Gao, Weimin; Shi, Xu; Wu, Jieying; Jin, Yuguang; Zhang, Weiwen; Meldrum, Deirdre R

2011-11-01

In this study, to explore the microbial community structure and its functionality in the deep-sea environments, we initially performed a 16S ribosomal RNA (rRNA)-based community structure analyses for microbial communities in the sea water collected from sites of 765-790 m in depth in the Pacific Ocean. Interestingly, in the clone library we detected the presence of both photoautotrophic bacteria such as cyanobacteria and photoheterotrophic bacteria, such as Chloroflexus sp. To further explore the existence and diversity of possible light-utilizing microorganisms, we then constructed and analyzed a 23S rRNA plastid gene cloning library. The results showed that the majority of this cloning library was occupied by oxygenic photoautotrophic organisms, such as diatoms Thalassiosira spp. and cyanobacterium Synechococcus sp. In addition, the diversity of these oxygenic photoautotrophic organisms was very limited. Moreover, both reverse-transcription PCR and quantitative reverse-transcription PCR approaches had been employed to detect expression of the genes involved in protein synthesis and photosynthesis of photoautotrophic organisms, and the positive results were obtained. The possible mechanisms underlying the existence of very limited diversity of photosynthetic organisms at this depth of ocean, as well as the positive detection of rRNA and mRNA of diatom and cyanobacteria, were discussed.

Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis.

PubMed

Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M

2018-06-20

In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor.

PubMed

Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K

2001-12-21

Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.

Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

PubMed Central

Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

2012-01-01

Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

PubMed

Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

2003-12-06

Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

PubMed Central

Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

2013-01-01

Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

Phylogenetic comparison of the methanogenic communities from an acidic, oligotrophic fen and an anaerobic digester treating municipal wastewater sludge.

PubMed

Steinberg, Lisa M; Regan, John M

2008-11-01

Methanogens play a critical role in the decomposition of organics under anaerobic conditions. The methanogenic consortia in saturated wetland soils are often subjected to large temperature fluctuations and acidic conditions, imposing a selective pressure for psychro- and acidotolerant community members; however, methanogenic communities in engineered digesters are frequently maintained within a narrow range of mesophilic and circumneutral conditions to retain system stability. To investigate the hypothesis that these two disparate environments have distinct methanogenic communities, the methanogens in an oligotrophic acidic fen and a mesophilic anaerobic digester treating municipal wastewater sludge were characterized by creating clone libraries for the 16S rRNA and methyl coenzyme M reductase alpha subunit (mcrA) genes. A quantitative framework was developed to assess the differences between these two communities by calculating the average sequence similarity for 16S rRNA genes and mcrA within a genus and family using sequences of isolated and characterized methanogens within the approved methanogen taxonomy. The average sequence similarities for 16S rRNA genes within a genus and family were 96.0 and 93.5%, respectively, and the average sequence similarities for mcrA within a genus and family were 88.9 and 79%, respectively. The clone libraries of the bog and digester environments showed no overlap at the species level and almost no overlap at the family level. Both libraries were dominated by clones related to uncultured methanogen groups within the Methanomicrobiales, although members of the Methanosarcinales and Methanobacteriales were also found in both libraries. Diversity indices for the 16S rRNA gene library of the bog and both mcrA libraries were similar, but these indices indicated much lower diversity in the 16S digester library than in the other three libraries.

Rare but active taxa contribute to community dynamics of benthic biofilms in glacier-fed streams.

PubMed

Wilhelm, Linda; Besemer, Katharina; Fasching, Christina; Urich, Tim; Singer, Gabriel A; Quince, Christopher; Battin, Tom J

2014-08-01

Glaciers harbour diverse microorganisms, which upon ice melt can be released downstream. In glacier-fed streams microorganisms can attach to stones or sediments to form benthic biofilms. We used 454-pyrosequencing to explore the bulk (16S rDNA) and putatively active (16S rRNA) microbial communities of stone and sediment biofilms across 26 glacier-fed streams. We found differences in community composition between bulk and active communities among streams and a stronger congruence between biofilm types. Relative abundances of rRNA and rDNA were positively correlated across different taxa and taxonomic levels, but at lower taxonomic levels, the higher abundance in either the active or the bulk communities became more apparent. Here, environmental variables played a minor role in structuring active communities. However, we found a large number of rare taxa with higher relative abundances in rRNA compared with rDNA. This suggests that rare taxa contribute disproportionately to microbial community dynamics in glacier-fed streams. Our findings propose that high community turnover, where taxa repeatedly enter and leave the 'seed bank', contributes to the maintenance of microbial biodiversity in harsh ecosystems with continuous environmental perturbations, such as glacier-fed streams. © 2014 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Identification of Reference Genes for Quantitative Gene Expression Studies in a Non-Model Tree Pistachio (Pistacia vera L.)

PubMed Central

Moazzam Jazi, Maryam; Ghadirzadeh Khorzoghi, Effat; Botanga, Christopher; Seyedi, Seyed Mahdi

2016-01-01

The tree species, Pistacia vera (P. vera) is an important commercial product that is salt-tolerant and long-lived, with a possible lifespan of over one thousand years. Gene expression analysis is an efficient method to explore the possible regulatory mechanisms underlying these characteristics. Therefore, having the most suitable set of reference genes is required for transcript level normalization under different conditions in P. vera. In the present study, we selected eight widely used reference genes, ACT, EF1α, α-TUB, β-TUB, GAPDH, CYP2, UBQ10, and 18S rRNA. Using qRT-PCR their expression was assessed in 54 different samples of three cultivars of P. vera. The samples were collected from different organs under various abiotic treatments (cold, drought, and salt) across three time points. Several statistical programs (geNorm, NormFinder, and BestKeeper) were applied to estimate the expression stability of candidate reference genes. Results obtained from the statistical analysis were then exposed to Rank aggregation package to generate a consensus gene rank. Based on our results, EF1α was found to be the superior reference gene in all samples under all abiotic treatments. In addition to EF1α, ACT and β-TUB were the second best reference genes for gene expression analysis in leaf and root. We recommended β-TUB as the second most stable gene for samples under the cold and drought treatments, while ACT holds the same position in samples analyzed under salt treatment. This report will benefit future research on the expression profiling of P. vera and other members of the Anacardiaceae family. PMID:27308855

Identification of Reference Genes for Quantitative Gene Expression Studies in a Non-Model Tree Pistachio (Pistacia vera L.).

PubMed

Moazzam Jazi, Maryam; Ghadirzadeh Khorzoghi, Effat; Botanga, Christopher; Seyedi, Seyed Mahdi

2016-01-01

The tree species, Pistacia vera (P. vera) is an important commercial product that is salt-tolerant and long-lived, with a possible lifespan of over one thousand years. Gene expression analysis is an efficient method to explore the possible regulatory mechanisms underlying these characteristics. Therefore, having the most suitable set of reference genes is required for transcript level normalization under different conditions in P. vera. In the present study, we selected eight widely used reference genes, ACT, EF1α, α-TUB, β-TUB, GAPDH, CYP2, UBQ10, and 18S rRNA. Using qRT-PCR their expression was assessed in 54 different samples of three cultivars of P. vera. The samples were collected from different organs under various abiotic treatments (cold, drought, and salt) across three time points. Several statistical programs (geNorm, NormFinder, and BestKeeper) were applied to estimate the expression stability of candidate reference genes. Results obtained from the statistical analysis were then exposed to Rank aggregation package to generate a consensus gene rank. Based on our results, EF1α was found to be the superior reference gene in all samples under all abiotic treatments. In addition to EF1α, ACT and β-TUB were the second best reference genes for gene expression analysis in leaf and root. We recommended β-TUB as the second most stable gene for samples under the cold and drought treatments, while ACT holds the same position in samples analyzed under salt treatment. This report will benefit future research on the expression profiling of P. vera and other members of the Anacardiaceae family.

Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

PubMed

Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

2016-01-01

Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.

Diversity of cultured photosynthetic flagellates in the North East Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-06-01

During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Identification of the bacterial endosymbionts of the marine ciliate Euplotes magnicirratus (Ciliophora, Hypotrichia) and proposal of 'Candidatus Devosia euplotis'.

PubMed

Vannini, Claudia; Rosati, Giovanna; Verni, Franco; Petroni, Giulio

2004-07-01

This paper reports the identification of bacterial endosymbionts that inhabit the cytoplasm of the marine ciliated protozoon Euplotes magnicirratus. Ultrastructural and full-cycle rRNA approaches were used to reveal the identity of these bacteria. Based on analysis of 16S rRNA gene sequences, evolutionary trees were constructed; these placed the endosymbiont in the genus Devosia in the alpha-Proteobacteria. The validity of this finding was also shown by fluorescence in situ hybridization with a Devosia-specific oligonucleotide probe. Differences at the 16S rRNA gene level (which allowed the construction of a species-specific oligonucleotide probe) and the peculiar habitat indicate that the endosymbiont represents a novel species. As its cultivation has not been successful to date, the provisional name 'Candidatus Devosia euplotis' is proposed. The species- and group-specific probes designed in this study could represent convenient tools for the detection of 'Candidatus Devosia euplotis' and Devosia-like bacteria in the environment.

Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

PubMed

Li, X; De Boer, S H

1995-10-01

Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

N6-Methylation Assessment in Escherichia coli 23S rRNA Utilizing a Bulge Loop in an RNA-DNA Hybrid.

PubMed

Yoshioka, Kyoko; Kurita, Ryoji

2018-06-07

We propose a sequence-selective assay of N6-methyl-adenosine (m6A) in RNA without PCR or reverse transcription, by employing a hybridization assay with a DNA probe designed to form a bulge loop at the position of a target modified nucleotide. The m6A in the bulge in the RNA-DNA hybrid was assumed to be sufficiently mobile to be selectively recognized by an anti-m6A antibody with a high affinity. By employing a surface-plasmon-resonance measurement or using a microtiter-plate immunoassay method, a specific m6A in the Escherichia coli 23S rRNA sequence could be detected at the nanomolar level when synthesized and purified oligo-RNA fragments were used for measurement. We have successfully achieved the first selective detection of m6A 2030 specifically in 23S rRNA from real samples of E. coli total RNA by using our immunochemical approach.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

PubMed

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Bacterial communities in the phylloplane of Prunus species.

PubMed

Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong

2015-04-01

Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A retrospective pilot study to determine whether the reproductive tract microbiota differs between women with a history of infertility and fertile women.

PubMed

Wee, Bryan A; Thomas, Mark; Sweeney, Emma Louise; Frentiu, Francesca D; Samios, Melanie; Ravel, Jacques; Gajer, Pawel; Myers, Garry; Timms, Peter; Allan, John A; Huston, Wilhelmina M

2018-06-01

We know very little about the microbiota inhabiting the upper female reproductive tract and how it impacts on fertility. This pilot study aimed to examine the vaginal, cervical and endometrial microbiota for women with a history of infertility compared to women with a history of fertility. Using a retrospective case-control study design, women were recruited for collection of vaginal, cervical and endometrial samples. The microbiota composition was analysed by 16S ribosomal RNA (rRNA) gene amplification and endometrial expression of selected human genes by quantitative reverse transcription polymerase chain reaction. Sixty-five specimens from the reproductive tract of 31 women were successfully analysed using 16S rRNA gene amplicon sequencing (16 controls and 15 cases). The dominant microbial community members were consistent in the vagina and cervix, and generally consistent with the endometrium although the relative proportions varied. We detected three major microbiota clusters that did not group by tissue location or case-control status. There was a trend that infertile women more often had Ureaplasma in the vagina and Gardnerella in the cervix. Testing for the expression of selected genes in the endometrium did not show evidence of correlation with case-control status, or with microbial community composition, although Tenascin-C expression correlated with a history of miscarriage. There is a need for further exploration of the endometrial microbiota, and how the microbiota members or profile interplays with fertility or assisted reproductive technologies. © 2017 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Multicolor microRNA FISH effectively differentiates tumor types

PubMed Central

Renwick, Neil; Cekan, Pavol; Masry, Paul A.; McGeary, Sean E.; Miller, Jason B.; Hafner, Markus; Li, Zhen; Mihailovic, Aleksandra; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Mobin, Mehrpouya B.; Snorrason, Einar L.; Feilotter, Harriet E.; Zhang, Xiao; Perlis, Clifford S.; Wu, Hong; Suárez-Fariñas, Mayte; Feng, Huichen; Shuda, Masahiro; Moore, Patrick S.; Tron, Victor A.; Chang, Yuan; Tuschl, Thomas

2013-01-01

MicroRNAs (miRNAs) are excellent tumor biomarkers because of their cell-type specificity and abundance. However, many miRNA detection methods, such as real-time PCR, obliterate valuable visuospatial information in tissue samples. To enable miRNA visualization in formalin-fixed paraffin-embedded (FFPE) tissues, we developed multicolor miRNA FISH. As a proof of concept, we used this method to differentiate two skin tumors, basal cell carcinoma (BCC) and Merkel cell carcinoma (MCC), with overlapping histologic features but distinct cellular origins. Using sequencing-based miRNA profiling and discriminant analysis, we identified the tumor-specific miRNAs miR-205 and miR-375 in BCC and MCC, respectively. We addressed three major shortcomings in miRNA FISH, identifying optimal conditions for miRNA fixation and ribosomal RNA (rRNA) retention using model compounds and high-pressure liquid chromatography (HPLC) analyses, enhancing signal amplification and detection by increasing probe-hapten linker lengths, and improving probe specificity using shortened probes with minimal rRNA sequence complementarity. We validated our method on 4 BCC and 12 MCC tumors. Amplified miR-205 and miR-375 signals were normalized against directly detectable reference rRNA signals. Tumors were classified using predefined cutoff values, and all were correctly identified in blinded analysis. Our study establishes a reliable miRNA FISH technique for parallel visualization of differentially expressed miRNAs in FFPE tumor tissues. PMID:23728175

The sRNAome mining revealed existence of unique signature small RNAs derived from 5.8SrRNA from Piper nigrum and other plant lineages.

PubMed

Asha, Srinivasan; Soniya, E V

2017-02-01

Small RNAs derived from ribosomal RNAs (srRNAs) are rarely explored in the high-throughput data of plant systems. Here, we analyzed srRNAs from the deep-sequenced small RNA libraries of Piper nigrum, a unique magnoliid plant. The 5' end of the putative long form of 5.8S rRNA (5.8S L rRNA) was identified as the site for biogenesis of highly abundant srRNAs that are unique among the Piperaceae family of plants. A subsequent comparative analysis of the ninety-seven sRNAomes of diverse plants successfully uncovered the abundant existence and precise cleavage of unique rRF signature small RNAs upstream of a novel 5' consensus sequence of the 5.8S rRNA. The major cleavage process mapped identically among the different tissues of the same plant. The differential expression and cleavage of 5'5.8S srRNAs in Phytophthora capsici infected P. nigrum tissues indicated the critical biological functions of these srRNAs during stress response. The non-canonical short hairpin precursor structure, the association with Argonaute proteins, and the potential targets of 5'5.8S srRNAs reinforced their regulatory role in the RNAi pathway in plants. In addition, this novel lineage specific small RNAs may have tremendous biological potential in the taxonomic profiling of plants.

Rrp5p, Noc1p and Noc2p form a protein module which is part of early large ribosomal subunit precursors in S. cerevisiae

PubMed Central

Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert

2013-01-01

Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026

Ubiquitous Gammaproteobacteria dominate dark carbon fixation in coastal sediments.

PubMed

Dyksma, Stefan; Bischof, Kerstin; Fuchs, Bernhard M; Hoffmann, Katy; Meier, Dimitri; Meyerdierks, Anke; Pjevac, Petra; Probandt, David; Richter, Michael; Stepanauskas, Ramunas; Mußmann, Marc

2016-08-01

Marine sediments are the largest carbon sink on earth. Nearly half of dark carbon fixation in the oceans occurs in coastal sediments, but the microorganisms responsible are largely unknown. By integrating the 16S rRNA approach, single-cell genomics, metagenomics and transcriptomics with (14)C-carbon assimilation experiments, we show that uncultured Gammaproteobacteria account for 70-86% of dark carbon fixation in coastal sediments. First, we surveyed the bacterial 16S rRNA gene diversity of 13 tidal and sublittoral sediments across Europe and Australia to identify ubiquitous core groups of Gammaproteobacteria mainly affiliating with sulfur-oxidizing bacteria. These also accounted for a substantial fraction of the microbial community in anoxic, 490-cm-deep subsurface sediments. We then quantified dark carbon fixation by scintillography of specific microbial populations extracted and flow-sorted from sediments that were short-term incubated with (14)C-bicarbonate. We identified three distinct gammaproteobacterial clades covering diversity ranges on family to order level (the Acidiferrobacter, JTB255 and SSr clades) that made up >50% of dark carbon fixation in a tidal sediment. Consistent with these activity measurements, environmental transcripts of sulfur oxidation and carbon fixation genes mainly affiliated with those of sulfur-oxidizing Gammaproteobacteria. The co-localization of key genes of sulfur and hydrogen oxidation pathways and their expression in genomes of uncultured Gammaproteobacteria illustrates an unknown metabolic plasticity for sulfur oxidizers in marine sediments. Given their global distribution and high abundance, we propose that a stable assemblage of metabolically flexible Gammaproteobacteria drives important parts of marine carbon and sulfur cycles.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

RNA helicase, DDX27 regulates skeletal muscle growth and regeneration by modulation of translational processes

PubMed Central

Gundry, Stacey R.; Chan, Aye T.; Widrick, Jeffrey; Draper, Isabelle; Chakraborty, Anirban; Zhou, Yi; Zon, Leonard I.; Gleizes, Pierre-Emmanuel

2018-01-01

Gene expression in a tissue-specific context depends on the combined efforts of epigenetic, transcriptional and post-transcriptional processes that lead to the production of specific proteins that are important determinants of cellular identity. Ribosomes are a central component of the protein biosynthesis machinery in cells; however, their regulatory roles in the translational control of gene expression in skeletal muscle remain to be defined. In a genetic screen to identify critical regulators of myogenesis, we identified a DEAD-Box RNA helicase, DDX27, that is required for skeletal muscle growth and regeneration. We demonstrate that DDX27 regulates ribosomal RNA (rRNA) maturation, and thereby the ribosome biogenesis and the translation of specific transcripts during myogenesis. These findings provide insight into the translational regulation of gene expression in myogenesis and suggest novel functions for ribosomes in regulating gene expression in skeletal muscles. PMID:29518074

Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

DOE PAGES

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

2015-02-06

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

PubMed Central

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

2015-01-01

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

Helicobacter pylori: a Eubacterium Lacking the Stringent Response

PubMed Central

Scoarughi, Gian Luca; Cimmino, Carmen; Donini, Pierluigi

1999-01-01

Accumulation of 16S rRNA and production of guanosine polyphosphates (pppGpp and ppGpp) were studied during amino acid starvation in three wild-type strains of Helicobacter pylori. All strains exhibit a relaxed phenotype with respect to accumulation of 16S rRNA. This constitutes the first example of a wild-type eubacterium showing a relaxed phenotype. The guanosine polyphosphate levels do not rise as a result of amino acid starvation, as expected for relaxed organisms. However, in both growing and starved cells, basal levels of the two polyphosphates appeared to be present, demonstrating that the enzymatic machinery for guanosine polyphosphate production is present in this organism. These findings are discussed within the framework of the hypothesis that stringent control is a physiological control mechanism more important for the fitness of prokaryotes growing in the general environment than for those that inhabit protected niches. PMID:9882669

Elevated levels of Era GTPase improve growth, 16S rRNA processing, and 70S ribosome assembly of Escherichia coli lacking highly conserved multifunctional YbeY endoribonuclease.

PubMed

Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C

2018-06-18

YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.

Gene copy number variation and its significance in cyanobacterial phylogeny

PubMed Central

2012-01-01

Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological characteristics of cyanobacteria. PMID:22894826

Streptococcus bovimastitidis sp. nov., isolated from a dairy cow with mastitis.

PubMed

de Vries, Stefan P W; Hadjirin, Nazreen F; Lay, Elizabeth M; Zadoks, Ruth N; Peacock, Sharon J; Parkhill, Julian; Grant, Andrew J; McDougall, Scott; Holmes, Mark A

2018-01-01

Here we describe a new species of the genus Streptococcus that was isolated from a dairy cow with mastitis in New Zealand. Strain NZ1587 T was Gram-positive, coccus-shaped and arranged as chains, catalase and coagulase negative, γ-haemolytic and negative for Lancefield carbohydrates (A-D, F and G). The 16S rRNA sequence did not match sequences in the NCBI 16S rRNA or GreenGenes databases. Taxonomic classification of strain NZ1587 T was investigated using 16S rRNA and core genome phylogeny, genome-wide average nucleotide identity (ANI) and predicted DNA-DNA hybridisation (DDH) analyses. Phylogeny based on 16S rRNA was unable to resolve the taxonomic position of strain NZ1587 T , however NZ1587 T shared 99.4 % identity at the 16S rRNA level with a distinct branch of S. pseudoporcinus. Importantly, core genome phylogeny demonstrated that NZ1587 T grouped amongst the 'pyogenic' streptococcal species and formed a distinct branch supported by a 100 % bootstrap value. In addition, average nucleotide identity and inferred DNA-DNA hybridisation analyses showed that NZ1587 T represents a novel species. Biochemical profiling using the rapid ID 32 strep identification test enabled differentiation of strain NZ1587 T from closely related streptococcal species. In conclusion, strain NZ1587 T can be classified as a novel species, and we propose a novel taxon named Streptococcus bovimastitidis sp. nov.; the type strain is NZ1587 T . NZ1587 T has been deposited in the Culture Collection University of Gothenburg (CCUG 69277 T ) and the Belgian Co-ordinated Collections of Micro-organisms/LMG (LMG 29747).

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

PubMed

Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

2015-09-01

Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

PubMed

Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

2000-06-15

Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

Single 23S rRNA mutations at the ribosomal peptidyl transferase centre confer resistance to valnemulin and other antibiotics in Mycobacterium smegmatis by perturbation of the drug binding pocket.

PubMed

Long, Katherine S; Poehlsgaard, Jacob; Hansen, Lykke H; Hobbie, Sven N; Böttger, Erik C; Vester, Birte

2009-03-01

Tiamulin and valnemulin target the peptidyl transferase centre (PTC) on the bacterial ribosome. They are used in veterinary medicine to treat infections caused by a variety of bacterial pathogens, including the intestinal spirochetes Brachyspira spp. Mutations in ribosomal protein L3 and 23S rRNA have previously been associated with tiamulin resistance in Brachyspira spp. isolates, but as multiple mutations were isolated together, the roles of the individual mutations are unclear. In this work, individual 23S rRNA mutations associated with pleuromutilin resistance at positions 2055, 2447, 2504 and 2572 (Escherichia coli numbering) are introduced into a Mycobacterium smegmatis strain with a single rRNA operon. The single mutations each confer a significant and similar degree of valnemulin resistance and those at 2447 and 2504 also confer cross-resistance to other antibiotics that bind to the PTC in M. smegmatis. Antibiotic footprinting experiments on mutant ribosomes show that the introduced mutations cause structural perturbations at the PTC and reduced binding of pleuromutilin antibiotics. This work underscores the fact that mutations at nucleotides distant from the pleuromutilin binding site can confer the same level of valnemulin resistance as those at nucleotides abutting the bound drug, and suggests that the former function indirectly by altering local structure and flexibility at the drug binding pocket.

Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

NASA Astrophysics Data System (ADS)

Hidayat, Habibi

2017-03-01

16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

Bacterial flora analysis of coliforms in sewage, river water, and ground water using MALDI-TOF mass spectrometry.

PubMed

Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi

2018-01-28

The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.

Response of estuarine biofilm microbial community development to changes in dissolved oxygen and nutrient concentrations.

PubMed

Nocker, Andreas; Lepo, Joe Eugene; Martin, Linda Lin; Snyder, Richard Allan

2007-10-01

The information content and responsiveness of microbial biofilm community structure, as an integrative indicator of water quality, was assessed against short-term changes in oxygen and nutrient loading in an open-water estuarine setting. Biofilms were grown for 7-day periods on artificial substrates in the Pensacola Bay estuary, Florida, in the vicinity of a wastewater treatment plant (WWTP) outfall and a nearby reference site. Substrates were deployed floating at the surface and near the benthos in 5.4 m of water. Three sampling events covered a 1-month period coincident with declining seasonal WWTP flow and increasing dissolved oxygen (DO) levels in the bottom waters. Biomass accumulation in benthic biofilms appeared to be controlled by oxygen rather than nutrients. The overriding effect of DO was also seen in DNA fingerprints of community structure by terminal restriction fragment length polymorphism (T-RFLP) of amplified 16S rRNA genes. Ribotype diversity in benthic biofilms at both sites dramatically increased during the transition from hypoxic to normoxic. Terminal restriction fragment length polymorphism patterns showed pronounced differences between benthic and surface biofilm communities from the same site in terms of signal type, strength, and diversity, but minor differences between sites. Sequencing of 16S rRNA gene clone libraries from benthic biofilms at the WWTP site suggested that low DO levels favored sulfate-reducing prokaryotes (SRP), which decreased with rising oxygen levels and increasing overall diversity. A 91-bp ribotype in the CfoI-restricted 16S rRNA gene T-RFLP profiles, indicative of SRP, tracked the decrease in relative SRP abundance over time.

Construction and Validation of the Rhodobacter sphaeroides 2.4.1 DNA Microarray: Transcriptome Flexibility at Diverse Growth Modes

PubMed Central

Pappas, Christopher T.; Sram, Jakub; Moskvin, Oleg V.; Ivanov, Pavel S.; Mackenzie, R. Christopher; Choudhary, Madhusudan; Land, Miriam L.; Larimer, Frank W.; Kaplan, Samuel; Gomelsky, Mark

2004-01-01

A high-density oligonucleotide DNA microarray, a genechip, representing the 4.6-Mb genome of the facultative phototrophic proteobacterium, Rhodobacter sphaeroides 2.4.1, was custom-designed and manufactured by Affymetrix, Santa Clara, Calif. The genechip contains probe sets for 4,292 open reading frames (ORFs), 47 rRNA and tRNA genes, and 394 intergenic regions. The probe set sequences were derived from the genome annotation generated by Oak Ridge National Laboratory after extensive revision, which was based primarily upon codon usage characteristic of this GC-rich bacterium. As a result of the revision, numerous missing ORFs were uncovered, nonexistent ORFs were deleted, and misidentified start codons were corrected. To evaluate R. sphaeroides transcriptome flexibility, expression profiles for three diverse growth modes—aerobic respiration, anaerobic respiration in the dark, and anaerobic photosynthesis—were generated. Expression levels of one-fifth to one-third of the R. sphaeroides ORFs were significantly different in cells under any two growth modes. Pathways involved in energy generation and redox balance maintenance under three growth modes were reconstructed. Expression patterns of genes involved in these pathways mirrored known functional changes, suggesting that massive changes in gene expression are the major means used by R. sphaeroides in adaptation to diverse conditions. Differential expression was observed for genes encoding putative new participants in these pathways (additional photosystem genes, duplicate NADH dehydrogenase, ATP synthases), whose functionality has yet to be investigated. The DNA microarray data correlated well with data derived from quantitative reverse transcription-PCR, as well as with data from the literature, thus validating the R. sphaeroides genechip as a powerful and reliable tool for studying unprecedented metabolic versatility of this bacterium. PMID:15231807

Microbiome symbionts and diet diversity incur costs on the immune system of insect larvae.

PubMed

Krams, Indrikis A; Kecko, Sanita; Jõers, Priit; Trakimas, Giedrius; Elferts, Didzis; Krams, Ronalds; Luoto, Severi; Rantala, Markus J; Inashkina, Inna; Gudrā, Dita; Fridmanis, Dāvids; Contreras-Garduño, Jorge; Grantiņa-Ieviņa, Lelde; Krama, Tatjana

2017-11-15

Communities of symbiotic microorganisms that colonize the gastrointestinal tract play an important role in food digestion and protection against opportunistic microbes. Diet diversity increases the number of symbionts in the intestines, a benefit that is considered to impose no cost for the host organism. However, less is known about the possible immunological investments that hosts have to make in order to control the infections caused by symbiont populations that increase because of diet diversity. Using taxonomical composition analysis of the 16S rRNA V3 region, we show that enterococci are the dominating group of bacteria in the midgut of the larvae of the greater wax moth ( Galleria mellonella ). We found that the number of colony-forming units of enterococci and expressions of certain immunity-related antimicrobial peptide (AMP) genes such as Gallerimycin , Gloverin , 6-tox , Cecropin-D and Galiomicin increased in response to a more diverse diet, which in turn decreased the encapsulation response of the larvae. Treatment with antibiotics significantly lowered the expression of all AMP genes. Diet and antibiotic treatment interaction did not affect the expression of Gloverin and Galiomicin AMP genes, but significantly influenced the expression of Gallerimycin , 6-tox and Cecropin-D Taken together, our results suggest that diet diversity influences microbiome diversity and AMP gene expression, ultimately affecting an organism's capacity to mount an immune response. Elevated basal levels of immunity-related genes ( Gloverin and Galiomicin ) might act as a prophylactic against opportunistic infections and as a mechanism that controls the gut symbionts. This would indicate that a diverse diet imposes higher immunity costs on organisms. © 2017. Published by The Company of Biologists Ltd.

Prediction of functional profiles of gut microbiota from 16S rRNA metagenomic data provides a more robust evaluation of gut dysbiosis occurring in Japanese type 2 diabetic patients.

PubMed

Inoue, Ryo; Ohue-Kitano, Ryuji; Tsukahara, Takamitsu; Tanaka, Masashi; Masuda, Shinya; Inoue, Takayuki; Yamakage, Hajime; Kusakabe, Toru; Hasegawa, Koji; Shimatsu, Akira; Satoh-Asahara, Noriko

2017-11-01

We assessed whether gut microbial functional profiles predicted from 16S rRNA metagenomics differed in Japanese type 2 diabetic patients. A total of 22 Japanese subjects were recruited from our outpatient clinic in an observational study. Fecal samples were obtained from 12 control and 10 type 2 diabetic subjects. 16S rRNA metagenomic data were generated and functional profiles predicted using "Phylogenetic Investigation of Communities by Reconstruction of Unobserved States" software. We measured the parameters of glucose metabolism, gut bacterial taxonomy and functional profile, and examined the associations in a cross-sectional manner. Eleven of 288 "Kyoto Encyclopedia of Genes and Genomes" pathways were significantly enriched in diabetic patients compared with control subjects ( p <0.05, q<0.1). The relative abundance of almost all pathways, including the Insulin signaling pathway and Glycolysis/Gluconeogenesis , showed strong, positive correlations with hemoglobin A 1c (HbA 1c ) and fasting plasma glucose (FPG) levels. Bacterial taxonomic analysis showed that genus Blautia significantly differed between groups and had negative correlations with HbA 1c and FPG levels. Our findings suggest a novel pathophysiological relationship between gut microbial communities and diabetes, further highlighting the significance and utility of combining prediction of functional profiles with ordinal bacterial taxonomic analysis (UMIN Clinical Trails Registry number: UMIN000026592).

Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

PubMed

Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

2009-04-01

Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Characterization of reference genes for qPCR analysis in various tissues of the Fujian oyster Crassostrea angulata

NASA Astrophysics Data System (ADS)

Pu, Fei; Yang, Bingye; Ke, Caihuan

2015-07-01

Accurate quantification of transcripts using quantitative real-time polymerase chain reaction (qPCR) depends on the identification of reliable reference genes for normalization. This study aimed to identify and validate seven reference genes, including actin-2 ( ACT-2), elongation factor 1 alpha ( EF-1α), elongation factor 1 beta ( EF-1β), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH), ubiquitin ( UBQ), β-tubulin ( β-TUB), and 18S ribosomal RNA, from Crassostrea angulata, a valuable marine bivalve cultured worldwide. Transcript levels of the candidate reference genes were examined using qPCR analysis and showed differential expression patterns in the mantle, gill, adductor muscle, labial palp, visceral mass, hemolymph and gonad tissues. Quantitative data were analyzed using the geNorm software to assess the expression stability of the candidate reference genes, revealing that β-TUB and UBQ were the most stable genes. The commonly used GAPDH and 18S rRNA showed low stability, making them unsuitable candidates in this system. The expression pattern of the G protein β-subunit gene ( Gβ) across tissue types was also examined and normalized to the expression of each or both of UBQ and β-TUB as internal controls. This revealed consistent trends with all three normalization approaches, thus validating the reliability of UBQ and β-TUB as optimal internal controls. The study provides the first validated reference genes for accurate data normalization in transcript profiling in Crassostrea angulata, which will be indispensable for further functional genomics studies in this economically valuable marine bivalve.

Tumour-associated and non-tumour-associated microbiota in colorectal cancer

PubMed Central

Flemer, Burkhardt; Lynch, Denise B; Brown, Jillian M R; Jeffery, Ian B; Ryan, Feargal J; Claesson, Marcus J; O'Riordain, Micheal; Shanahan, Fergus; O'Toole, Paul W

2017-01-01

Objective A signature that unifies the colorectal cancer (CRC) microbiota across multiple studies has not been identified. In addition to methodological variance, heterogeneity may be caused by both microbial and host response differences, which was addressed in this study. Design We prospectively studied the colonic microbiota and the expression of specific host response genes using faecal and mucosal samples (‘ON’ and ‘OFF’ the tumour, proximal and distal) from 59 patients undergoing surgery for CRC, 21 individuals with polyps and 56 healthy controls. Microbiota composition was determined by 16S rRNA amplicon sequencing; expression of host genes involved in CRC progression and immune response was quantified by real-time quantitative PCR. Results The microbiota of patients with CRC differed from that of controls, but alterations were not restricted to the cancerous tissue. Differences between distal and proximal cancers were detected and faecal microbiota only partially reflected mucosal microbiota in CRC. Patients with CRC can be stratified based on higher level structures of mucosal-associated bacterial co-abundance groups (CAGs) that resemble the previously formulated concept of enterotypes. Of these, Bacteroidetes Cluster 1 and Firmicutes Cluster 1 were in decreased abundance in CRC mucosa, whereas Bacteroidetes Cluster 2, Firmicutes Cluster 2, Pathogen Cluster and Prevotella Cluster showed increased abundance in CRC mucosa. CRC-associated CAGs were differentially correlated with the expression of host immunoinflammatory response genes. Conclusions CRC-associated microbiota profiles differ from those in healthy subjects and are linked with distinct mucosal gene-expression profiles. Compositional alterations in the microbiota are not restricted to cancerous tissue and differ between distal and proximal cancers. PMID:26992426

Assessment of reference gene stability influenced by extremely divergent disease symptoms in Solanum lycopersicum L.

PubMed

Wieczorek, Przemysław; Wrzesińska, Barbara; Obrępalska-Stęplowska, Aleksandra

2013-12-01

Tomato (Solanum lycopersicum L.) is one of the most important vegetables of great worldwide economic value. The scientific importance of the vegetable results from the fact that the genome of S. lycopersicum has been sequenced. This allows researchers to study fundamental mechanisms playing an essential role during tomato development and response to environmental factors contributing significantly to cell metabolism alterations. Parallel with the development of contemporary genetics and the constant increase in sequencing data, progress has to be aligned with improvement of experimental methods used for studying genes functions and gene expression levels, of which the quantitative polymerase chain reaction (qPCR) is still the most reliable. As well as with other nucleic acid-based methods used for comparison of the abundance of specific RNAs, the RT-qPCR data have to be normalised to the levels of RNAs represented stably in a cell. To achieve the goal, the so-called housekeeping genes (i.e., RNAs encoding, for instance, proteins playing an important role in the cell metabolism or structure maintenance), are used for normalisation of the target gene expression data. However, a number of studies have indicated the transcriptional instability of commonly used reference genes analysed in different situations or conditions; for instance, the origin of cells, tissue types, or environmental or other experimental conditions. The expression of ten common housekeeping genes of S. lycopersicum, namely EF1α, TUB, CAC, EXP, RPL8, GAPDH, TBP, ACT, SAND and 18S rRNA were examined during viral infections of tomato. Changes in the expression levels of the genes were estimated by comparison of the non-inoculated tomato plants with those infected with commonly known tomato viral pathogens, Tomato torrado virus, Cucumber mosaic virus, Tobacco mosaic virus and Pepino mosaic virus, inducing a diverse range of disease symptoms on the common host, ranging from mild leaves chlorosis to very severe stem necrosis. It is emphasised that despite the wide range of diverse disease symptoms it is concluded that ACT, CAC and EF1α could be used as the most suitable reference genes in studies of host-virus interactions in tomato. Copyright © 2013 Elsevier B.V. All rights reserved.

Fermented Milk Containing Lactobacillus casei Strain Shirota Preserves the Diversity of the Gut Microbiota and Relieves Abdominal Dysfunction in Healthy Medical Students Exposed to Academic Stress.

PubMed

Kato-Kataoka, Akito; Nishida, Kensei; Takada, Mai; Kawai, Mitsuhisa; Kikuchi-Hayakawa, Hiroko; Suda, Kazunori; Ishikawa, Hiroshi; Gondo, Yusuke; Shimizu, Kensuke; Matsuki, Takahiro; Kushiro, Akira; Hoshi, Ryoutaro; Watanabe, Osamu; Igarashi, Tomoki; Miyazaki, Kouji; Kuwano, Yuki; Rokutan, Kazuhito

2016-06-15

Stress-induced abdominal dysfunction is an attractive target for probiotics. To investigate the effects of the probiotic Lactobacillus casei strain Shirota on abdominal dysfunction, a double-blind, placebo-controlled trial was conducted with healthy medical students undertaking an authorized nationwide examination for academic advancement. For 8 weeks, until the day before the examination, 23 and 24 subjects consumed an L. casei strain Shirota-fermented milk and a placebo milk daily, respectively. In addition to assessments of abdominal symptoms, psychophysical state, and salivary stress markers, gene expression changes in peripheral blood leukocytes and composition of the gut microbiota were analyzed using DNA microarray analysis and 16S rRNA gene amplicon sequence analysis, respectively, before and after the intervention. Stress-induced increases in a visual analog scale measuring feelings of stress, the total score of abdominal dysfunction, and the number of genes with changes in expression of more than 2-fold in leukocytes were significantly suppressed in the L. casei strain Shirota group compared with those in the placebo group. A significant increase in salivary cortisol levels before the examination was observed only in the placebo group. The administration of L. casei strain Shirota, but not placebo, significantly reduced gastrointestinal symptoms. Moreover, 16S rRNA gene amplicon sequencing demonstrated that the L. casei strain Shirota group had significantly higher numbers of species, a marker of the alpha-diversity index, in their gut microbiota and a significantly lower percentage of Bacteroidaceae than the placebo group. Our findings indicate that the daily consumption of probiotics, such as L. casei strain Shirota, preserves the diversity of the gut microbiota and may relieve stress-associated responses of abdominal dysfunction in healthy subjects exposed to stressful situations. A novel clinical trial was conducted with healthy medical students under examination stress conditions. It was demonstrated that the daily consumption of lactic acid bacteria provided health benefits to prevent the onset of stress-associated abdominal symptoms and a good change of gut microbiota in healthy medical students. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Amniotic Fluid Protein Profiles of Intraamniotic Inflammatory Response to Ureaplasma spp. and Other Bacteria

PubMed Central

Kacerovsky, Marian; Celec, Peter; Vlkova, Barbora; Skogstrand, Kristin; Hougaard, David M.; Cobo, Teresa; Jacobsson, Bo

2013-01-01

Objective This study aimed to evaluate the amniotic fluid protein profiles and the intensity of intraamniotic inflammatory response to Ureaplasma spp. and other bacteria, using the multiplex xMAP technology. Methods A retrospective cohort study was undertaken in the Department of Obstetrics and Gynecology, University Hospital Hradec Kralove, Czech Republic. A total of 145 pregnant women with preterm prelabor rupture of membranes between gestational age 24+0 and 36+6 weeks were included in the study. Amniocenteses were performed. The presence of Ureaplasma spp. and other bacteria was evaluated using 16S rRNA gene sequencing. The levels of specific proteins were determined using multiplex xMAP technology. Results The presence of Ureaplasma spp. and other bacteria in the amniotic fluid was associated with increased levels of interleukin (IL)-6, IL-8, IL-10, brain-derived neurotropic factor, granulocyte macrophage colony stimulating factor, monocyte chemotactic protein-1, macrophage inflammatory protein-1, and matrix metalloproteinasis-9. Ureaplasma spp. were also associated with increased levels of neurotropin-3 and triggering receptor expressed on myeloid cells-1. Conclusions The presence of Ureaplasma spp. in the amniotic fluid is associated with a slightly different protein profile of inflammatory response, but the intensity of inflammatory response to Ureaplasma spp. is comparable with the inflammatory response to other bacteria. PMID:23555967

Amniotic fluid protein profiles of intraamniotic inflammatory response to Ureaplasma spp. and other bacteria.

PubMed

Kacerovsky, Marian; Celec, Peter; Vlkova, Barbora; Skogstrand, Kristin; Hougaard, David M; Cobo, Teresa; Jacobsson, Bo

2013-01-01

This study aimed to evaluate the amniotic fluid protein profiles and the intensity of intraamniotic inflammatory response to Ureaplasma spp. and other bacteria, using the multiplex xMAP technology. A retrospective cohort study was undertaken in the Department of Obstetrics and Gynecology, University Hospital Hradec Kralove, Czech Republic. A total of 145 pregnant women with preterm prelabor rupture of membranes between gestational age 24+0 and 36+6 weeks were included in the study. Amniocenteses were performed. The presence of Ureaplasma spp. and other bacteria was evaluated using 16S rRNA gene sequencing. The levels of specific proteins were determined using multiplex xMAP technology. The presence of Ureaplasma spp. and other bacteria in the amniotic fluid was associated with increased levels of interleukin (IL)-6, IL-8, IL-10, brain-derived neurotropic factor, granulocyte macrophage colony stimulating factor, monocyte chemotactic protein-1, macrophage inflammatory protein-1, and matrix metalloproteinasis-9. Ureaplasma spp. were also associated with increased levels of neurotropin-3 and triggering receptor expressed on myeloid cells-1. The presence of Ureaplasma spp. in the amniotic fluid is associated with a slightly different protein profile of inflammatory response, but the intensity of inflammatory response to Ureaplasma spp. is comparable with the inflammatory response to other bacteria.

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Structure of the initiation-competent RNA polymerase I and its implication for transcription

NASA Astrophysics Data System (ADS)

Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick

2016-07-01

Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

PubMed Central

Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.

2012-01-01

Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Defining the RNA-Protein Interactions in the Trypanosome Preribosomal Complex

PubMed Central

Wang, Lei; Ciganda, Martin

2013-01-01

In eukaryotes, 5S rRNA is transcribed in the nucleoplasm and requires the ribosomal protein L5 to deliver it to the nucleolus for ribosomal assembly. The trypanosome-specific proteins P34 and P37 form a novel preribosomal complex with the eukaryotic conserved L5-5S rRNA complex in the nucleoplasm. Previous results suggested that P34 acts together with L5 to bridge the interaction with 5S rRNA and thus to stabilize 5S rRNA, an important role in the early steps of ribosomal biogenesis. Here, we have delineated the domains of the two protein components, L5 and P34, and regions of the RNA partner, 5S rRNA, that are critical for protein-RNA interactions within the complex. We found that the L18 domain of L5 and the N terminus and RNA recognition motif of P34 bind 5S rRNA. We showed that Trypanosoma brucei L5 binds the β arm of 5S rRNA, while P34 binds loop A/stem V of 5S rRNA. We demonstrated that 5S rRNA is able to enhance the association between the protein components of the complex, L5 and P34. Both loop A/stem V and the β arm of 5S rRNA can separately enhance the protein-protein association, but their effects are neither additive nor synergistic. Domains in the two proteins for protein-protein and protein-RNA interactions overlap or are close to each other. This suggests that 5S rRNA binding might cause conformational changes in L5 and P34 and might also bridge the interactions, thus enhancing binding between the protein partners of this novel complex. PMID:23397568

Endogenous siRNAs and noncoding RNA-derived small RNAs are expressed in adult mouse hippocampus and are up-regulated in olfactory discrimination training.

PubMed

Smalheiser, Neil R; Lugli, Giovanni; Thimmapuram, Jyothi; Cook, Edwin H; Larson, John

2011-01-01

We previously proposed that endogenous siRNAs may regulate synaptic plasticity and long-term gene expression in the mammalian brain. Here, a hippocampal-dependent task was employed in which adult mice were trained to execute a nose-poke in a port containing one of two simultaneously present odors in order to obtain a reward. Mice demonstrating olfactory discrimination training were compared to pseudo-training and nose-poke control groups; size-selected hippocampal RNA was subjected to Illumina deep sequencing. Sequences that aligned uniquely and exactly to the genome without uncertain nucleotide assignments, within exons or introns of MGI annotated genes, were examined further. The data confirm that small RNAs having features of endogenous siRNAs are expressed in brain; that many of them derive from genes that regulate synaptic plasticity (and have been implicated in neuropsychiatric diseases); and that hairpin-derived endo-siRNAs and the 20- to 23-nt size class of small RNAs show a significant increase during an early stage of training. The most abundant putative siRNAs arose from an intronic inverted repeat within the SynGAP1 locus; this inverted repeat was a substrate for dicer in vitro, and SynGAP1 siRNA was specifically associated with Argonaute proteins in vivo. Unexpectedly, a dramatic increase with training (more than 100-fold) was observed for a class of 25- to 30-nt small RNAs derived from specific sites within snoRNAs and abundant noncoding RNAs (Y1 RNA, RNA component of mitochondrial RNAse P, 28S rRNA, and 18S rRNA). Further studies are warranted to characterize the role(s) played by endogenous siRNAs and noncoding RNA-derived small RNAs in learning and memory.

Broad genomic and transcriptional analysis reveals a highly derived genome in dinoflagellate mitochondria

PubMed Central

Jackson, Christopher J; Norman, John E; Schnare, Murray N; Gray, Michael W; Keeling, Patrick J; Waller, Ross F

2007-01-01

Background Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs) within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest some similarities with apicomplexan mitochondrial genomes but an even more radical type of genomic organization. Here, we investigate structure, content and expression of dinoflagellate mitochondrial genomes. Results From two dinoflagellates, Crypthecodinium cohnii and Karlodinium micrum, we generated over 42 kb of mitochondrial genomic data that indicate a reduced gene content paralleling that of mitochondrial genomes in apicomplexans, i.e., only three protein-encoding genes and at least eight conserved components of the highly fragmented large and small subunit rRNAs. Unlike in apicomplexans, dinoflagellate mitochondrial genes occur in multiple copies, often as gene fragments, and in numerous genomic contexts. Analysis of cDNAs suggests several novel aspects of dinoflagellate mitochondrial gene expression. Polycistronic transcripts were found, standard start codons are absent, and oligoadenylation occurs upstream of stop codons, resulting in the absence of termination codons. Transcripts of at least one gene, cox3, are apparently trans-spliced to generate full-length mRNAs. RNA substitutional editing, a process previously identified for mRNAs in dinoflagellate mitochondria, is also implicated in rRNA expression. Conclusion The dinoflagellate mitochondrial genome shares the same gene complement and fragmentation of rRNA genes with its apicomplexan counterpart. However, it also exhibits several unique characteristics. Most notable are the expansion of gene copy numbers and their arrangements within the genome, RNA editing, loss of stop codons, and use of trans-splicing. PMID:17897476

Mechanisms for ribotoxin-induced ribosomal RNA cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren

The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via activation of p53, caspases and cathepsins. ► DON- and anisomycin-triggered rRNA cleavage is p38-dependent. ► SG- and ricin-induced rRNA cleavage is p38-independent.« less

Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization

PubMed Central

Cavaillé, Jérôme; Buiting, Karin; Kiefmann, Martin; Lalande, Marc; Brannan, Camilynn I.; Horsthemke, Bernhard; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

2000-01-01

We have identified three C/D-box small nucleolar RNAs (snoRNAs) and one H/ACA-box snoRNA in mouse and human. In mice, all four snoRNAs (MBII-13, MBII-52, MBII-85, and MBI-36) are exclusively expressed in the brain, unlike all other known snoRNAs. Two of the human RNA orthologues (HBII-52 and HBI-36) share this expression pattern, and the remainder, HBII-13 and HBII-85, are prevalently expressed in that tissue. In mice and humans, the brain-specific H/ACA box snoRNA (MBI-36 and HBI-36, respectively) is intron-encoded in the brain-specific serotonin 2C receptor gene. The three human C/D box snoRNAs map to chromosome 15q11–q13, within a region implicated in the Prader–Willi syndrome (PWS), which is a neurogenetic disease resulting from a deficiency of paternal gene expression. Unlike other C/D box snoRNAs, two snoRNAs, HBII-52 and HBII-85, are encoded in a tandemly repeated array of 47 or 24 units, respectively. In mouse the homologue of HBII-52 is processed from intronic portions of the tandem repeats. Interestingly, these snoRNAs were absent from the cortex of a patient with PWS and from a PWS mouse model, demonstrating their paternal imprinting status and pointing to their potential role in the etiology of PWS. Despite displaying hallmarks of the two families of ubiquitous snoRNAs that guide 2′-O-ribose methylation and pseudouridylation of rRNA, respectively, they lack any telltale rRNA complementarity. Instead, brain-specific C/D box snoRNA HBII-52 has an 18-nt phylogenetically conserved complementarity to a critical segment of serotonin 2C receptor mRNA, pointing to a potential role in the processing of this mRNA. PMID:11106375

Apigenin Impacts the Growth of the Gut Microbiota and Alters the Gene Expression of Enterococcus.

PubMed

Wang, Minqian; Firrman, Jenni; Zhang, Liqing; Arango-Argoty, Gustavo; Tomasula, Peggy; Liu, LinShu; Xiao, Weidong; Yam, Kit

2017-08-03

Apigenin is a major dietary flavonoid with many bioactivities, widely distributed in plants. Apigenin reaches the colon region intact and interacts there with the human gut microbiota, however there is little research on how apigenin affects the gut bacteria. This study investigated the effect of pure apigenin on human gut bacteria, at both the single strain and community levels. The effect of apigenin on the single gut bacteria strains Bacteroides galacturonicus , Bifidobacterium catenulatum , Lactobacillus rhamnosus GG, and Enterococcus caccae , was examined by measuring their anaerobic growth profiles. The effect of apigenin on a gut microbiota community was studied by culturing a fecal inoculum under in vitro conditions simulating the human ascending colon. 16S rRNA gene sequencing and GC-MS analysis quantified changes in the community structure. Single molecule RNA sequencing was used to reveal the response of Enterococcus caccae to apigenin. Enterococcus caccae was effectively inhibited by apigenin when cultured alone, however, the genus Enterococcus was enhanced when tested in a community setting. Single molecule RNA sequencing found that Enterococcus caccae responded to apigenin by up-regulating genes involved in DNA repair, stress response, cell wall synthesis, and protein folding. Taken together, these results demonstrate that apigenin affects both the growth and gene expression of Enterococcus caccae .

Metatranscriptomics and Amplicon Sequencing Reveal Mutualisms in Seagrass Microbiomes

PubMed Central

Crump, Byron C.; Wojahn, John M.; Tomas, Fiona; Mueller, Ryan S.

2018-01-01

Terrestrial plants benefit from many well-understood mutualistic relationships with root- and leaf-associated microbiomes, but relatively little is known about these relationships for seagrass and other aquatic plants. We used 16S rRNA gene amplicon sequencing and metatranscriptomics to assess potential mutualisms between microorganisms and the seagrasses Zostera marina and Zostera japonica collected from mixed beds in Netarts Bay, OR, United States. The phylogenetic composition of leaf-, root-, and water column-associated bacterial communities were strikingly different, but these communities were not significantly different between plant species. Many taxa present on leaves were related to organisms capable of consuming the common plant metabolic waste product methanol, and of producing agarases, which can limit the growth of epiphytic algae. Taxa present on roots were related to organisms capable of oxidizing toxic sulfur compounds and of fixing nitrogen. Metatranscriptomic sequencing identified expression of genes involved in all of these microbial metabolic processes at levels greater than typical water column bacterioplankton, and also identified expression of genes involved in denitrification and in bacterial synthesis of the plant growth hormone indole-3-acetate. These results provide the first evidence using metatranscriptomics that seagrass microbiomes carry out a broad range of functions that may benefit their hosts, and imply that microbe–plant mutualisms support the health and growth of aquatic plants. PMID:29599758

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing

PubMed Central

Goldfarb, Katherine C.; Cech, Thomas R.

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR–Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor—analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing—implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. PMID:28115465

Carbendazim induces a temporary change in soil bacterial community structure.

PubMed

Wang, Xiuguo; Song, Min; Gao, Chunming; Dong, Bin; Zhang, Qun; Fang, Hua; Yu, Yunlong

2009-01-01

The effect of carbendazim applications on the diversity and structure of a soil bacterial community was studied under field conditions using temperature gradient gel electrophoresis (TGGE) and partial sequence analysis of PCR-amplified 16S rRNA gene. After four successive introductions of carbendazim at a level of 0.94 kg active ingredient (a.i.)/ha, the genetic diversity (expressed as Shannon index, H') decreased from 1.43 in the control to 1.29 in treated soil. This harmful effect seems to increase with the concentration of carbendazim. The value of H' in the soil treated with carbendazim at 4.70 kg a.i./ha was reduced to 1.05 (P < or = 0.05). The structure of soil bacterial community was also affected after four repeated applications of carbendazim at levels of 0.94, 1.88 and 4.70 kg a.i./ha, as seen in the relative intensities of the individual band. However, the bacterial community in carbendazim-treated soil recovered to that in the control 360 d after the first treatment. The results indicated that repeated applications of carbendazim could reduce soil microbial diversity and alter the bacterial community structure temporarily.

The Resilience of Microbial Community under Drying and Rewetting Cycles of Three Forest Soils.

PubMed

Zhou, Xue; Fornara, Dario; Ikenaga, Makoto; Akagi, Isao; Zhang, Ruifu; Jia, Zhongjun

2016-01-01

Forest soil ecosystems are associated with large pools and fluxes of carbon (C) and nitrogen (N), which could be strongly affected by variation in rainfall events under current climate change. Understanding how dry and wet cycle events might influence the metabolic state of indigenous soil microbes is crucial for predicting forest soil responses to environmental change. We used 454 pyrosequencing and quantitative PCR to address how present (DNA-based) and potentially active (RNA-based) soil bacterial communities might response to the changes in water availability across three different forest types located in two continents (Africa and Asia) under controlled drying and rewetting cycles. Sequencing of rRNA gene and transcript indicated that Proteobacteria, Actinobacteria, and Acidobacteria were the most responsive phyla to changes in water availability. We defined the ratio of rRNA transcript to rRNA gene abundance as a key indicator of potential microbial activity and we found that this ratio was increased following soil dry-down process whereas it decreased after soil rewetting. Following rewetting Crenarchaeota-like 16S rRNA gene transcript increased in some forest soils and this was linked to increases in soil nitrate levels suggesting greater nitrification rates under higher soil water availability. Changes in the relative abundance of (1) different microbial phyla and classes, and (2) 16S and amoA genes were found to be site- and taxa-specific and might have been driven by different life-strategies. Overall, we found that, after rewetting, the structure of the present and potentially active bacterial community structure as well as the abundance of bacterial (16S), archaeal (16S) and ammonia oxidizers (amoA), all returned to pre-dry-down levels. This suggests that microbial taxa have the ability to recover from desiccation, a critical response, which will contribute to maintaining microbial biodiversity in harsh ecosystems under environmental perturbations, such as significant changes in water availability.

The Resilience of Microbial Community under Drying and Rewetting Cycles of Three Forest Soils

PubMed Central

Zhou, Xue; Fornara, Dario; Ikenaga, Makoto; Akagi, Isao; Zhang, Ruifu; Jia, Zhongjun

2016-01-01

Forest soil ecosystems are associated with large pools and fluxes of carbon (C) and nitrogen (N), which could be strongly affected by variation in rainfall events under current climate change. Understanding how dry and wet cycle events might influence the metabolic state of indigenous soil microbes is crucial for predicting forest soil responses to environmental change. We used 454 pyrosequencing and quantitative PCR to address how present (DNA-based) and potentially active (RNA-based) soil bacterial communities might response to the changes in water availability across three different forest types located in two continents (Africa and Asia) under controlled drying and rewetting cycles. Sequencing of rRNA gene and transcript indicated that Proteobacteria, Actinobacteria, and Acidobacteria were the most responsive phyla to changes in water availability. We defined the ratio of rRNA transcript to rRNA gene abundance as a key indicator of potential microbial activity and we found that this ratio was increased following soil dry-down process whereas it decreased after soil rewetting. Following rewetting Crenarchaeota-like 16S rRNA gene transcript increased in some forest soils and this was linked to increases in soil nitrate levels suggesting greater nitrification rates under higher soil water availability. Changes in the relative abundance of (1) different microbial phyla and classes, and (2) 16S and amoA genes were found to be site- and taxa-specific and might have been driven by different life-strategies. Overall, we found that, after rewetting, the structure of the present and potentially active bacterial community structure as well as the abundance of bacterial (16S), archaeal (16S) and ammonia oxidizers (amoA), all returned to pre-dry-down levels. This suggests that microbial taxa have the ability to recover from desiccation, a critical response, which will contribute to maintaining microbial biodiversity in harsh ecosystems under environmental perturbations, such as significant changes in water availability. PMID:27486444

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

PubMed

Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

2016-01-01

With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

Urea transporter UT-B deletion induces DNA damage and apoptosis in mouse bladder urothelium.

PubMed

Dong, Zixun; Ran, Jianhua; Zhou, Hong; Chen, Jihui; Lei, Tianluo; Wang, Weiling; Sun, Yi; Lin, Guiting; Bankir, Lise; Yang, Baoxue

2013-01-01

Previous studies found that urea transporter UT-B is abundantly expressed in bladder urothelium. However, the dynamic role of UT-B in bladder urothelial cells remains unclear. The objective of this study is to evaluate the physiological roles of UT-B in bladder urothelium using UT-B knockout mouse model and T24 cell line. Urea and NO measurement, mRNA expression micro-array analysis, light and transmission electron microscopy, apoptosis assays, DNA damage and repair determination, and intracellular signaling examination were performed in UT-B null bladders vs wild-type bladders and in vitro T24 epithelial cells. UT-B was highly expressed in mouse bladder urothelium. The genes, Dcaf11, MCM2-4, Uch-L1, Bnip3 and 45 S pre rRNA, related to DNA damage and apoptosis were significantly regulated in UT-B null urothelium. DNA damage and apoptosis highly occurred in UT-B null urothelium. Urea and NO levels were significantly higher in UT-B null urothelium than that in wild-type, which may affect L-arginine metabolism and the intracellular signals related to DNA damage and apoptosis. These findings were consistent with the in vitro study in T24 cells that, after urea loading, exhibited cell cycle delay and apoptosis. UT-B may play an important role in protecting bladder urothelium by balancing intracellular urea concentration. Disruption of UT-B function induces DNA damage and apoptosis in bladder, which can result in bladder disorders.

The coral immune response facilitates protection against microbes during tissue regeneration.

PubMed

van de Water, Jeroen A J M; Ainsworth, Tracy D; Leggat, William; Bourne, David G; Willis, Bette L; van Oppen, Madeleine J H

2015-07-01

Increasing physical damage on coral reefs from predation, storms and anthropogenic disturbances highlights the need to understand the impact of injury on the coral immune system. In this study, we examined the regulation of the coral immune response over 10 days following physical trauma artificially inflicted on in situ colonies of the coral Acropora aspera, simultaneously with bacterial colonization of the lesions. Corals responded to injury by increasing the expression of immune system-related genes involved in the Toll-like and NOD-like receptor signalling pathways and the lectin-complement system in three phases (<2, 4 and 10 days post-injury). Phenoloxidase activity was also significantly upregulated in two phases (<3 and 10 days post-injury), as were levels of non-fluorescent chromoprotein. In addition, green fluorescent protein expression was upregulated in response to injury from 4 days post-injury, while cyan fluorescent protein expression was reduced. No shifts in the composition of coral-associated bacterial communities were evident following injury based on 16S rRNA gene amplicon pyrosequencing. Bacteria-specific fluorescence in situ hybridization also showed no evidence of bacterial colonization of the wound or regenerating tissues. Coral tissues showed near-complete regeneration of lesions within 10 days. This study demonstrates that corals exhibit immune responses that support rapid recovery following physical injury, maintain coral microbial homeostasis and prevent bacterial infestation that may compromise coral fitness. © 2015 John Wiley & Sons Ltd.

Urea Transporter UT-B Deletion Induces DNA Damage and Apoptosis in Mouse Bladder Urothelium

PubMed Central

Zhou, Hong; Chen, Jihui; Lei, Tianluo; Wang, Weiling; Sun, Yi; Lin, Guiting; Bankir, Lise; Yang, Baoxue

2013-01-01

Background Previous studies found that urea transporter UT-B is abundantly expressed in bladder urothelium. However, the dynamic role of UT-B in bladder urothelial cells remains unclear. The objective of this study is to evaluate the physiological roles of UT-B in bladder urothelium using UT-B knockout mouse model and T24 cell line. Methodology/Principal Findings Urea and NO measurement, mRNA expression micro-array analysis, light and transmission electron microscopy, apoptosis assays, DNA damage and repair determination, and intracellular signaling examination were performed in UT-B null bladders vs wild-type bladders and in vitro T24 epithelial cells. UT-B was highly expressed in mouse bladder urothelium. The genes, Dcaf11, MCM2-4, Uch-L1, Bnip3 and 45 S pre rRNA, related to DNA damage and apoptosis were significantly regulated in UT-B null urothelium. DNA damage and apoptosis highly occurred in UT-B null urothelium. Urea and NO levels were significantly higher in UT-B null urothelium than that in wild-type, which may affect L-arginine metabolism and the intracellular signals related to DNA damage and apoptosis. These findings were consistent with the in vitro study in T24 cells that, after urea loading, exhibited cell cycle delay and apoptosis. Conclusions/Significance UT-B may play an important role in protecting bladder urothelium by balancing intracellular urea concentration. Disruption of UT-B function induces DNA damage and apoptosis in bladder, which can result in bladder disorders. PMID:24204711

Tuning Gene Activity by Inducible and Targeted Regulation of Gene Expression in Minimal Bacterial Cells.

PubMed

Mariscal, Ana M; Kakizawa, Shigeyuki; Hsu, Jonathan Y; Tanaka, Kazuki; González-González, Luis; Broto, Alicia; Querol, Enrique; Lluch-Senar, Maria; Piñero-Lambea, Carlos; Sun, Lijie; Weyman, Philip D; Wise, Kim S; Merryman, Chuck; Tse, Gavin; Moore, Adam J; Hutchison, Clyde A; Smith, Hamilton O; Tomita, Masaru; Venter, J Craig; Glass, John I; Piñol, Jaume; Suzuki, Yo

2018-05-22

Functional genomics studies in minimal mycoplasma cells enable unobstructed access to some of the most fundamental processes in biology. Conventional transposon bombardment and gene knockout approaches often fail to reveal functions of genes that are essential for viability, where lethality precludes phenotypic characterization. Conditional inactivation of genes is effective for characterizing functions central to cell growth and division, but tools are limited for this purpose in mycoplasmas. Here we demonstrate systems for inducible repression of gene expression based on clustered regularly interspaced short palindromic repeats-mediated interference (CRISPRi) in Mycoplasma pneumoniae and synthetic Mycoplasma mycoides, two organisms with reduced genomes actively used in systems biology studies. In the synthetic cell, we also demonstrate inducible gene expression for the first time. Time-course data suggest rapid kinetics and reversible engagement of CRISPRi. Targeting of six selected endogenous genes with this system results in lowered transcript levels or reduced growth rates that agree with lack or shortage of data in previous transposon bombardment studies, and now produces actual cells to analyze. The ksgA gene encodes a methylase that modifies 16S rRNA, rendering it vulnerable to inhibition by the antibiotic kasugamycin. Targeting the ksgA gene with CRISPRi removes the lethal effect of kasugamycin and enables cell growth, thereby establishing specific and effective gene modulation with our system. The facile methods for conditional gene activation and inactivation in mycoplasmas open the door to systematic dissection of genetic programs at the core of cellular life.

Microbial Community Responses to Glycine Addition in Kansas Prairie Soils

NASA Astrophysics Data System (ADS)

Bottos, E.; Roy Chowdhury, T.; White, R. A., III; Brislawn, C.; Fansler, S.; Kim, Y. M.; Metz, T. O.; McCue, L. A.; Jansson, J.

2015-12-01

Advances in sequencing technologies are rapidly expanding our abilities to unravel aspects of microbial community structure and function in complex systems like soil; however, characterizing the highly diverse communities is problematic, due primarily to challenges in data analysis. To tackle this problem, we aimed to constrain the microbial diversity in a soil by enriching for particular functional groups within a community through addition of "trigger substrates". Such trigger substrates, characterized by low molecular weight, readily soluble and diffusible in soil solution, representative of soil organic matter derivatives, would also be rapidly degradable. A relatively small energy investment to maintain the cell in a state of metabolic alertness for such substrates would be a better evolutionary strategy and presumably select for a cohort of microorganisms with the energetics and cellular machinery for utilization and growth. We chose glycine, a free amino acid (AA) known to have short turnover times (in the range of hours) in soil. As such, AAs are a good source of nitrogen and easily degradable, and can serve as building blocks for microbial proteins and other biomass components. We hypothesized that the addition of glycine as a trigger substrate will decrease microbial diversity and evenness, as taxa capable of metabolizing it are enriched in relation to those that are not. We tested this hypothesis by incubating three Kansas native prairie soils with glycine for 24 hours at 21 degree Celsius, and measured community level responses by 16S rRNA gene sequencing, metagenomics, and metatranscriptomics. Preliminary evaluation of 16S rRNA gene sequences revealed minor changes in bacterial community composition in response to glycine addition. We will also present data on functional gene abundance and expression. The results of these analyses will be useful in designing sequencing strategies aimed at dissecting and deciphering complex microbial communities.

A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

PubMed

Crossland, Hannah; Timmons, James A; Atherton, Philip J

2017-12-01

Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P < 0.001) and total RNA content (-16 ± 2% vs. IGF-1; P < 0.001) in IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P < 0.05 vs. control) and total protein (+20 ± 2%; P < 0.001 vs. control) were not prevented by CX treatment. Suppression of rRNA synthesis during IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P < 0.001) and p70 S6K1 (269 ± 41% vs. CX; P < 0.001) phosphorylation. Despite robust inhibition of the dynamic ribosomal biogenesis response to IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

Influence of Starvation on Potential Ammonia-Oxidizing Activity and amoA mRNA Levels of Nitrosospira briensis

PubMed Central

Bollmann, Annette; Schmidt, Ingo; Saunders, Aaron M.; Nicolaisen, Mette H.

2005-01-01

The effect of short-term ammonia starvation on Nitrosospira briensis was investigated. The ammonia-oxidizing activity was determined in a concentrated cell suspension with a NOx biosensor. The apparent half-saturation constant [Km(app)] value of the NH3 oxidation of N. briensis was 3 μM NH3 for cultures grown both in continuous and batch cultures as determined by a NOx biosensor. Cells grown on the wall of the vessel had a lower Km(app) value of 1.8 μM NH3. Nonstarving cultures of N. briensis showed potential ammonia-oxidizing activities of between 200 to 250 μM N h−1, and this activity decreased only slowly during starvation up to 10 days. Within 10 min after the addition of fresh NH4+, 100% activity was regained. Parallel with activity measurements, amoA mRNA and 16S rRNA were investigated. No changes were observed in the 16S rRNA, but a relative decrease of amoA mRNA was observed during the starvation period. During resuscitation, an increase in amoA mRNA expression was detected simultaneously. The patterns of the soluble protein fraction of a 2-week-starved culture of N. briensis showed only small differences in comparison to a nonstarved control. From these results we conclude that N. briensis cells remain in a state allowing fast recovery of ammonia-oxidizing activity after addition of NH4+ to a starved culture. Maintaining cells in this kind of active state could be the survival strategy of ammonia-oxidizing bacteria in nature under fluctuating NH4+ availability. PMID:15746329

Benzene Degradation by a Variovorax Species within a Coal Tar-Contaminated Groundwater Microbial Community.

PubMed

Posman, Kevin M; DeRito, Christopher M; Madsen, Eugene L

2017-02-15

Investigations of environmental microbial communities are crucial for the discovery of populations capable of degrading hazardous compounds and may lead to improved bioremediation strategies. The goal of this study was to identify microorganisms responsible for aerobic benzene degradation in coal tar-contaminated groundwater. Benzene degradation was monitored in laboratory incubations of well waters using gas chromatography mass spectrometry (GC-MS). Stable isotope probing (SIP) experiments using [ 13 C]benzene enabled us to obtain 13 C-labled community DNA. From this, 16S rRNA clone libraries identified Gammaproteobacteria and Betaproteobacteria as the active benzene-metabolizing microbial populations. Subsequent cultivation experiments yielded nine bacterial isolates that grew in the presence of benzene; five were confirmed in laboratory cultures to grow on benzene. The isolated benzene-degrading organisms were genotypically similar (>97% 16S rRNA gene nucleotide identities) to the organisms identified in SIP experiments. One isolate, Variovorax MAK3, was further investigated for the expression of a putative aromatic ring-hydroxylating dioxygenase (RHD) hypothesized to be involved in benzene degradation. Microcosm experiments using Variovorax MAK3 revealed a 10-fold increase in RHD (Vapar_5383) expression, establishing a link between this gene and benzene degradation. Furthermore, the addition of Variovorax MAK3 to microcosms prepared from site waters accelerated community benzene degradation and correspondingly increased RHD gene expression. In microcosms using uninoculated groundwater, quantitative (q)PCR assays (with 16S rRNA and RDH genes) showed that Variovorax was present and responsive to added benzene. These data demonstrate how the convergence of cultivation-dependent and -independent techniques can boost understandings of active populations and functional genes in complex benzene-degrading microbial communities. Benzene is a human carcinogen whose presence in contaminated groundwater drives environmental cleanup efforts. Although the aerobic biodegradation of benzene has long been established, knowledge of the identity of the microorganisms in complex naturally occurring microbial communities responsible for benzene biodegradation has evaded scientific inquiry for many decades. Here, we applied a molecular biology technique known as stable isotope probing (SIP) to the microbial communities residing in contaminated groundwater samples to identify the community members active in benzene biodegradation. We complemented this approach by isolating and growing in the laboratory a bacterium representative of the bacteria found using SIP. Further characterization of the isolated bacterium enabled us to track the expression of a key gene that attacks benzene both in pure cultures of the bacterium and in the naturally occurring groundwater microbial community. This work advances information regarding the documentation of microbial processes, especially the populations and genes that contribute to bioremediation. Copyright © 2017 American Society for Microbiology.

Benzene Degradation by a Variovorax Species within a Coal Tar-Contaminated Groundwater Microbial Community

PubMed Central

Posman, Kevin M.; DeRito, Christopher M.

2016-01-01

ABSTRACT Investigations of environmental microbial communities are crucial for the discovery of populations capable of degrading hazardous compounds and may lead to improved bioremediation strategies. The goal of this study was to identify microorganisms responsible for aerobic benzene degradation in coal tar-contaminated groundwater. Benzene degradation was monitored in laboratory incubations of well waters using gas chromatography mass spectrometry (GC-MS). Stable isotope probing (SIP) experiments using [13C]benzene enabled us to obtain 13C-labled community DNA. From this, 16S rRNA clone libraries identified Gammaproteobacteria and Betaproteobacteria as the active benzene-metabolizing microbial populations. Subsequent cultivation experiments yielded nine bacterial isolates that grew in the presence of benzene; five were confirmed in laboratory cultures to grow on benzene. The isolated benzene-degrading organisms were genotypically similar (>97% 16S rRNA gene nucleotide identities) to the organisms identified in SIP experiments. One isolate, Variovorax MAK3, was further investigated for the expression of a putative aromatic ring-hydroxylating dioxygenase (RHD) hypothesized to be involved in benzene degradation. Microcosm experiments using Variovorax MAK3 revealed a 10-fold increase in RHD (Vapar_5383) expression, establishing a link between this gene and benzene degradation. Furthermore, the addition of Variovorax MAK3 to microcosms prepared from site waters accelerated community benzene degradation and correspondingly increased RHD gene expression. In microcosms using uninoculated groundwater, quantitative (q)PCR assays (with 16S rRNA and RDH genes) showed that Variovorax was present and responsive to added benzene. These data demonstrate how the convergence of cultivation-dependent and -independent techniques can boost understandings of active populations and functional genes in complex benzene-degrading microbial communities. IMPORTANCE Benzene is a human carcinogen whose presence in contaminated groundwater drives environmental cleanup efforts. Although the aerobic biodegradation of benzene has long been established, knowledge of the identity of the microorganisms in complex naturally occurring microbial communities responsible for benzene biodegradation has evaded scientific inquiry for many decades. Here, we applied a molecular biology technique known as stable isotope probing (SIP) to the microbial communities residing in contaminated groundwater samples to identify the community members active in benzene biodegradation. We complemented this approach by isolating and growing in the laboratory a bacterium representative of the bacteria found using SIP. Further characterization of the isolated bacterium enabled us to track the expression of a key gene that attacks benzene both in pure cultures of the bacterium and in the naturally occurring groundwater microbial community. This work advances information regarding the documentation of microbial processes, especially the populations and genes that contribute to bioremediation. PMID:27913419

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

Clostridium sphenoides Chronic Osteomyelitis Diagnosed Via Matrix-Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry, Conflicting With 16S rRNA Sequencing but Confirmed by Whole Genome Sequencing.

PubMed

Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A

2017-01-01

We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.

High-resolution microbiome profiling uncovers Fusobacterium nucleatum, Lactobacillus gasseri/johnsonii, and Lactobacillus vaginalis associated to oral and oropharyngeal cancer in saliva from HPV positive and HPV negative patients treated with surgery and chemo-radiation

PubMed Central

Guerrero-Preston, Rafael; White, James Robert; Godoy-Vitorino, Filipa; Rodríguez-Hilario, Arnold; Navarro, Kelvin; González, Herminio; Michailidi, Christina; Jedlicka, Anne; Canapp, Sierra; Bondy, Jessica; Dziedzic, Amanda; Mora-Lagos, Barbara; Rivera-Alvarez, Gustavo; Ili-Gangas, Carmen; Brebi-Mieville, Priscilla; Westra, William; Koch, Wayne; Kang, Hyunseok; Marchionni, Luigi; Kim, Young; Sidransky, David

2017-01-01

Microbiome studies show altered microbiota in head and neck squamous cell carcinoma (HNSCC), both in terms of taxonomic composition and metabolic capacity. These studies utilized a traditional bioinformatics methodology, which allows for accurate taxonomic assignment down to the genus level, but cannot accurately resolve species level membership. We applied Resphera Insight, a high-resolution methodology for 16S rRNA taxonomic assignment that is able to provide species-level context in its assignments of 16S rRNA next generation sequencing (NGS) data. Resphera Insight applied to saliva samples from HNSCC patients and healthy controls led to the discovery that a subset of HNSCC saliva samples is significantly enriched with commensal species from the vaginal flora, including Lactobacillus gasseri/johnsonii (710x higher in saliva) and Lactobacillus vaginalis (52x higher in saliva). These species were not observed in normal saliva from Johns Hopkins patients, nor in 16S rRNA NGS saliva samples from the Human Microbiome Project (HMP). Interestingly, both species were only observed in saliva from Human Papilloma Virus (HPV) positive and HPV negative oropharyngeal cancer patients. We confirmed the representation of both species in HMP data obtained from mid-vagina (n=128) and vaginal introitus (n=121) samples. Resphera Insight also led to the discovery that Fusobacterium nucleatum, an oral cavity flora commensal bacterium linked to colon cancer, is enriched (600x higher) in saliva from a subset of HNSCC patients with advanced tumors stages. Together, these high-resolution analyses on 583 samples suggest a possible role for bacterial species in the therapeutic outcome of HPV positive and HPV negative HNSCC patients. PMID:29340028

High-resolution microbiome profiling uncovers Fusobacterium nucleatum, Lactobacillus gasseri/johnsonii, and Lactobacillus vaginalis associated to oral and oropharyngeal cancer in saliva from HPV positive and HPV negative patients treated with surgery and chemo-radiation.

PubMed

Guerrero-Preston, Rafael; White, James Robert; Godoy-Vitorino, Filipa; Rodríguez-Hilario, Arnold; Navarro, Kelvin; González, Herminio; Michailidi, Christina; Jedlicka, Anne; Canapp, Sierra; Bondy, Jessica; Dziedzic, Amanda; Mora-Lagos, Barbara; Rivera-Alvarez, Gustavo; Ili-Gangas, Carmen; Brebi-Mieville, Priscilla; Westra, William; Koch, Wayne; Kang, Hyunseok; Marchionni, Luigi; Kim, Young; Sidransky, David

2017-12-19

Microbiome studies show altered microbiota in head and neck squamous cell carcinoma (HNSCC), both in terms of taxonomic composition and metabolic capacity. These studies utilized a traditional bioinformatics methodology, which allows for accurate taxonomic assignment down to the genus level, but cannot accurately resolve species level membership. We applied Resphera Insight, a high-resolution methodology for 16S rRNA taxonomic assignment that is able to provide species-level context in its assignments of 16S rRNA next generation sequencing (NGS) data. Resphera Insight applied to saliva samples from HNSCC patients and healthy controls led to the discovery that a subset of HNSCC saliva samples is significantly enriched with commensal species from the vaginal flora, including Lactobacillus gasseri/johnsonii (710x higher in saliva) and Lactobacillus vaginalis (52x higher in saliva). These species were not observed in normal saliva from Johns Hopkins patients, nor in 16S rRNA NGS saliva samples from the Human Microbiome Project (HMP). Interestingly, both species were only observed in saliva from Human Papilloma Virus (HPV) positive and HPV negative oropharyngeal cancer patients. We confirmed the representation of both species in HMP data obtained from mid-vagina (n=128) and vaginal introitus (n=121) samples. Resphera Insight also led to the discovery that Fusobacterium nucleatum , an oral cavity flora commensal bacterium linked to colon cancer, is enriched (600x higher) in saliva from a subset of HNSCC patients with advanced tumors stages. Together, these high-resolution analyses on 583 samples suggest a possible role for bacterial species in the therapeutic outcome of HPV positive and HPV negative HNSCC patients.

Toward an Understanding of Changes in Diversity Associated with Fecal Microbiome Transplantation Based on 16S rRNA Gene Deep Sequencing

PubMed Central

Shahinas, Dea; Silverman, Michael; Sittler, Taylor; Chiu, Charles; Kim, Peter; Allen-Vercoe, Emma; Weese, Scott; Wong, Andrew; Low, Donald E.; Pillai, Dylan R.

2012-01-01

ABSTRACT Fecal microbiome transplantation by low-volume enema is an effective, safe, and inexpensive alternative to antibiotic therapy for patients with chronic relapsing Clostridium difficile infection (CDI). We explored the microbial diversity of pre- and posttransplant stool specimens from CDI patients (n = 6) using deep sequencing of the 16S rRNA gene. While interindividual variability in microbiota change occurs with fecal transplantation and vancomycin exposure, in this pilot study we note that clinical cure of CDI is associated with an increase in diversity and richness. Genus- and species-level analysis may reveal a cocktail of microorganisms or products thereof that will ultimately be used as a probiotic to treat CDI. PMID:23093385

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches in the expansion segments 7, 15, and 27 of human 28S rRNA appear as candidates for general interaction with mRNAs, especially those associated with intracellular matrices such as the endoplasmic reticulum. PMID:29563925

Culturing Heterotrophic Protists from the Baltic Sea: Mostly the "Usual Suspects" but a Few Novelties as Well.

PubMed

Weber, Felix; Mylnikov, Alexander P; Jürgens, Klaus; Wylezich, Claudia

2017-03-01

The study of cultured strains has a long tradition in protistological research and has greatly contributed to establishing the morphology, taxonomy, and ecology of many protist species. However, cultivation-independent techniques, based on 18S rRNA gene sequences, have demonstrated that natural protistan assemblages mainly consist of hitherto uncultured protist lineages. This mismatch impedes the linkage of environmental diversity data with the biological features of cultured strains. Thus, novel taxa need to be obtained in culture to close this knowledge gap. In this study, traditional cultivation techniques were applied to samples from coastal surface waters and from deep oxygen-depleted waters of the Baltic Sea. Based on 18S rRNA gene sequencing, 126 monoclonal cultures of heterotrophic protists were identified. The majority of the isolated strains were affiliated with already cultured and described taxa, mainly chrysophytes and bodonids. This was likely due to "culturing bias" but also to the eutrophic nature of the Baltic Sea. Nonetheless, ~ 12% of the isolates in our culture collection showed highly divergent 18S rRNA gene sequences compared to those of known organisms and thus may represent novel taxa, either at the species level or at the genus level. Moreover, we also obtained evidence that some of the isolated taxa are ecologically relevant, under certain conditions, in the Baltic Sea. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

PubMed

Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S

2016-08-01

Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site.

Response of soybean rhizosphere communities to human hygiene water addition as determined by community level physiological profiling (CLPP) and terminal restriction fragment length polymorphism (TRFLP) analysis

NASA Technical Reports Server (NTRS)

Kerkhof, L.; Santoro, M.; Garland, J.

2000-01-01

In this report, we describe an experiment conducted at Kennedy Space Center in the biomass production chamber (BPC) using soybean plants for purification and processing of human hygiene water. Specifically, we tested whether it was possible to detect changes in the root-associated bacterial assemblage of the plants and ultimately to identify the specific microorganism(s) which differed when plants were exposed to hygiene water and other hydroponic media. Plants were grown in hydroponics media corresponding to four different treatments: control (Hoagland's solution), artificial gray water (Hoagland's+surfactant), filtered gray water collected from human subjects on site, and unfiltered gray water. Differences in rhizosphere microbial populations in all experimental treatments were observed when compared to the control treatment using both community level physiological profiles (BIOLOG) and molecular fingerprinting of 16S rRNA genes by terminal restriction fragment length polymorphism analysis (TRFLP). Furthermore, screening of a clonal library of 16S rRNA genes by TRFLP yielded nearly full length SSU genes associated with the various treatments. Most 16S rRNA genes were affiliated with the Klebsiella, Pseudomonas, Variovorax, Burkholderia, Bordetella and Isosphaera groups. This molecular approach demonstrated the ability to rapidly detect and identify microorganisms unique to experimental treatments and provides a means to fingerprint microbial communities in the biosystems being developed at NASA for optimizing advanced life support operations.

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing

PubMed Central

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

ABSTRACT Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

PubMed

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Fecal microbes, short chain fatty acids, and colorectal cancer across racial/ethnic groups.

PubMed

Hester, Christina M; Jala, Venkatakrishna R; Langille, Morgan Gi; Umar, Shahid; Greiner, K Allen; Haribabu, Bodduluri

2015-03-07

To investigate differences in microbes and short chain fatty acid (SCFA) levels in stool samples from Hispanic and non-Hispanic African American, American Indian, and White participants. Stool samples from twenty participants were subjected to analysis for relative levels of viable bacteria and for SCFA levels. Additionally, the samples were subjected to 16S rRNA gene pyrosequencing for identification of bacteria present in the stool. We used a metagenome functional prediction technique to analyze genome copy numbers and estimate the abundance of butyrate kinase in all samples. We found that African Americans had significantly lower levels of acetate, butyrate, and total SCFAs than all other racial/ethnic groups. We also found that participant microbial profiles differed by racial/ethnic group. African Americans had significantly more Firmicutes than Whites, with enriched Ruminococcaceae. The Firmicutes/Bacteroidetes ratio was also significantly higher for African Americans than for Whites (P = 0.049). We found Clostridium levels to be significantly and inversely related to total SCFA levels (P = 0.019) and we found Bacteroides to be positively associated (P = 0.027) and Clostridium to be negatively associated (P = 0.012) with levels of butyrate. We also identified a correlation between copy number for a butyrate kinase predicted from 16S rRNA gene abundance and levels of butyrate in stool. The identified differences in gut flora and SCFA levels may relate to colorectal cancer mortality differentials and may be useful as targets for future clinical and behavioral interventions.

Fecal microbes, short chain fatty acids, and colorectal cancer across racial/ethnic groups

PubMed Central

Hester, Christina M; Jala, Venkatakrishna R; Langille, Morgan GI; Umar, Shahid; Greiner, K Allen; Haribabu, Bodduluri

2015-01-01

AIM: To investigate differences in microbes and short chain fatty acid (SCFA) levels in stool samples from Hispanic and non-Hispanic African American, American Indian, and White participants. METHODS: Stool samples from twenty participants were subjected to analysis for relative levels of viable bacteria and for SCFA levels. Additionally, the samples were subjected to 16S rRNA gene pyrosequencing for identification of bacteria present in the stool. We used a metagenome functional prediction technique to analyze genome copy numbers and estimate the abundance of butyrate kinase in all samples. RESULTS: We found that African Americans had significantly lower levels of acetate, butyrate, and total SCFAs than all other racial/ethnic groups. We also found that participant microbial profiles differed by racial/ethnic group. African Americans had significantly more Firmicutes than Whites, with enriched Ruminococcaceae. The Firmicutes/Bacteroidetes ratio was also significantly higher for African Americans than for Whites (P = 0.049). We found Clostridium levels to be significantly and inversely related to total SCFA levels (P = 0.019) and we found Bacteroides to be positively associated (P = 0.027) and Clostridium to be negatively associated (P = 0.012) with levels of butyrate. We also identified a correlation between copy number for a butyrate kinase predicted from 16S rRNA gene abundance and levels of butyrate in stool. CONCLUSION: The identified differences in gut flora and SCFA levels may relate to colorectal cancer mortality differentials and may be useful as targets for future clinical and behavioral interventions. PMID:25759547

A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR.

PubMed

Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine

2015-01-01

A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.

Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)

NASA Astrophysics Data System (ADS)

Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina

2014-09-01

Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.

Maize Iranian mosaic virus shows a descending transcript accumulation order in plant and insect hosts.

PubMed

Hortamani, Mozhgan; Massah, Amir; Izadpanah, Keramat

2018-04-01

Maize Iranian mosaic virus (MIMV) is a distinct member of the genus Nucleorhabdovirus. In this study, expression of all MIMV genes in maize for four weeks after inoculation and in inoculative planthoppers was examined using a quantitative RT-PCR (RT-qPCR) assay. Accumulation of MIMV P, gene 3, M, G and L transcripts relative to N transcripts was measured and normalized to 18S rRNA in maize plants and to the ribosomal protein S13 gene (RPS13) in planthoppers using the comparative C T method. In plants, higher levels of MIMV N transcripts were found relative to other transcripts, while MIMV L transcripts were at the lowest levels. The highest accumulation of MIMV transcripts was found at 14 days postinoculation (dpi). At 21 dpi, we found the lowest transcript levels for all genes, which increased again at 28 dpi, although in lower amounts than at 14 dpi. In Laodelphax striatellus, MIMV M, G and L transcripts accumulated at lower levels than other transcripts. The gene 3 transcript level was high in both plants and planthoppers. Our results showed that transcript accumulation for the MIMV genes was similar in both hosts and followed the pattern of sequential transcriptional attenuation from the 3' to the 5' end of the genome, similar to vertebrate rhabdoviruses. These results indicate that the regulation of virus gene transcription for this plant-infecting rhabdovirus is similar to that of some vertebrate-infecting rhabdoviruses.

Selection of Reference Genes for Normalization of MicroRNA Expression by RT-qPCR in Sugarcane Buds under Cold Stress

PubMed Central

Yang, Yuting; Zhang, Xu; Chen, Yun; Guo, Jinlong; Ling, Hui; Gao, Shiwu; Su, Yachun; Que, Youxiong; Xu, Liping

2016-01-01

Sugarcane, accounting for 80% of world's sugar, originates in the tropics but is cultivated mainly in the subtropics. Therefore, chilling injury frequently occurs and results in serious losses. Recent studies in various plant species have established microRNAs as key elements in the post-transcriptional regulation of response to biotic and abiotic stresses including cold stress. Though, its accuracy is largely influenced by the use of reference gene for normalization, quantitative PCR is undoubtedly a popular method used for identification of microRNAs. For identifying the most suitable reference genes for normalizing miRNAs expression in sugarcane under cold stress, 13 candidates among 17 were investigated using four algorithms: geNorm, NormFinder, deltaCt, and Bestkeeper, and four candidates were excluded because of unsatisfactory efficiency and specificity. Verification was carried out using cold-related genes miR319 and miR393 in cold-tolerant and sensitive cultivars. The results suggested that miR171/18S rRNA and miR171/miR5059 were the best reference gene sets for normalization for miRNA RT-qPCR, followed by the single miR171 and 18S rRNA. These results can aid research on miRNA responses during sugarcane stress, and the development of sugarcane tolerant to cold stress. This study is the first report concerning the reference gene selection of miRNA RT-qPCR in sugarcane. PMID:26904058

Characterisation of the bacterial community in expressed prostatic secretions from patients with chronic prostatitis/chronic pelvic pain syndrome and infertile men: a preliminary investigation

PubMed Central

Hou, Dong-Sheng; Long, Wen-Min; Shen, Jian; Zhao, Li-Ping; Pang, Xiao-Yan; Xu, Chen

2012-01-01

The expressed prostatic secretions (EPSs) of men with chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS), infertile men and normal men were subjected to microbiological study. EPSs were collected from the subjects, which included 26 normal men, 11 infertile patients and 51 CP/CPPS patients. DNA was extracted from each specimen, and the V3 regions of the 16S rRNA genes were amplified using universal bacterial primers. The results showed that the EPS 16S rRNA gene-positive rate in the CP/CPPS and infertile patients was much higher than in the normal men, but without any difference among the three patient groups. The denaturing gradient gel electrophoresis (DGGE) method was used to characterize the EPS bacterial community structure of the prostate fluid from patients with CP/CPPS or infertility issues. Principal component analysis (PCA) and partial least squares (PLS) analyses of PCR-DGGE profiles revealed that the EPS bacterial community structure differed among the three groups. Three bands were identified as the key factors responsible for the discrepancy between CP/CPPS patients and infertile patients (P<0.05). Two bands were identified as priority factors in the discrepancy of category IIIA and category IIIB prostatitis patients (P<0.05). According to this research, the ecological balance of the prostate and low urethra tract, when considered as a microenvironment, might play an important role in the maintenance of a healthy male reproductive tract. PMID:22635162

Genetic transformation of novel isolates of chicken Lactobacillus bearing probiotic features for expression of heterologous proteins: a tool to develop live oral vaccines

PubMed Central

Mota, Rodrigo M; Moreira, João Luiz S; Souza, Marcelo R; Fátima Horta, M; Teixeira, Santuza MR; Neumann, Elisabeth; Nicoli, Jacques R; Nunes, Álvaro C

2006-01-01

Background The use of lactic acid bacteria as vehicles to delivery antigens to immunize animals is a promising issue. When genetically modified, these bacteria can induce a specific local and systemic immune response against selected pathogens. Gastric acid and bile salts tolerance, production of antagonistic substances against pathogenic microorganisms, and adhesive ability to gut epithelium are other important characteristics that make these bacteria useful for oral immunization. Results Bacteria isolated on de Man, Rogosa and Sharpe medium (MRS) from different gastrointestinal portions of broiler chicks were evaluated for their resistance to artificial gastric acid and bile salts, production of hydrogen peroxide, and cell surface hydrophobicity. Thirty-eight isolates were first typed at species level by PCR amplification of 16S-23S rRNA intergenic spacers using universal primers that anneal within 16S and 23S genes, followed by restriction digestion analyses of PCR amplicons (PCR-ARDRA). An expression cassette was assembled onto the pCR2.1-Topo vector by cloning the promoter, leader peptide, cell wall anchor and terminator sequences derived from the laminin binding S-layer protein gene of L. crispatus strain F5.7 (lbs gene). A sequence encoding the green fluorescent protein (GFP) was inserted as reporter gene, and an erythromycin resistance gene was added as selective marker. All constructs were able to express GFP in the cloning host E. coli XL1-Blue and different Lactobacillus strains as verified by FACS and laser scanning confocal microscopy. Conclusion Lactobacillus isolated from gastrointestinal tract of broiler chickens and selected for probiotic characteristics can be genetically modified by introducing an expression cassette into the lbs locus. The transformed bacteria expressed on its cell wall surface different fluorescent proteins used as reporters of promoter function. It is possible then that similar bacterial model expressing pathogen antigens can be used as live oral vaccines to immunize broilers against infectious diseases. PMID:16396687

Phytoplankton IF-FISH: Species-specific labeling of cellular proteins by immunofluorescence (IF) with simultaneous species identification by fluorescence immunohybridization (FISH).

PubMed

Meek, Megan E; Van Dolah, Frances M

2016-05-01

Phytoplankton rarely occur as unialgal populations. Therefore, to study species-specific protein expression, indicative of physiological status in natural populations, methods are needed that will both assay for a protein of interest and identify the species expressing it. Here we describe a protocol for IF-FISH, a dual labeling procedure using immunofluorescence (IF) labeling of a protein of interest followed by fluorescence in situ hybridization (FISH) to identify the species expressing that protein. The protocol was developed to monitor expression of the cell cycle marker proliferating cell nuclear antigen (PCNA) in the red tide dinoflagellate, Karenia brevis, using a large subunit (LSU) rRNA probe to identify K. brevis in a mixed population of morphologically similar Karenia species. We present this protocol as proof of concept that IF-FISH can be successfully applied to phytoplankton cells. This method is widely applicable for the analysis of single-cell protein expression of any protein of interest within phytoplankton communities. Copyright © 2016 Elsevier B.V. All rights reserved.

Microbiota and Metatranscriptome Changes Accompanying the Onset of Gingivitis.

PubMed

Nowicki, Emily M; Shroff, Raghav; Singleton, Jacqueline A; Renaud, Diane E; Wallace, Debra; Drury, Julie; Zirnheld, Jolene; Colleti, Brock; Ellington, Andrew D; Lamont, Richard J; Scott, David A; Whiteley, Marvin

2018-04-17

Over half of adults experience gingivitis, a mild yet treatable form of periodontal disease caused by the overgrowth of oral microbes. Left untreated, gingivitis can progress to a more severe and irreversible disease, most commonly chronic periodontitis. While periodontal diseases are associated with a shift in the oral microbiota composition, it remains unclear how this shift impacts microbiota function early in disease progression. Here, we analyzed the transition from health to gingivitis through both 16S v4-v5 rRNA amplicon and metatranscriptome sequencing of subgingival plaque samples from individuals undergoing an experimental gingivitis treatment. Beta-diversity analysis of 16S rRNA reveals that samples cluster based on disease severity and patient but not by oral hygiene status. Significant shifts in the abundance of several genera occurred during disease transition, suggesting a dysbiosis due to development of gingivitis. Comparing taxonomic abundance with transcriptomic activity revealed concordance of bacterial diversity composition between the two quantification assays in samples originating from both healthy and diseased teeth. Metatranscriptome sequencing analysis indicates that during the early stages of transition to gingivitis, a number of virulence-related transcripts were significantly differentially expressed in individual and across pooled patient samples. Upregulated genes include those involved in proteolytic and nucleolytic processes, while expression levels of those involved in surface structure assembly and other general virulence functions leading to colonization or adaptation within the host are more dynamic. These findings help characterize the transition from health to periodontal disease and identify genes associated with early disease. IMPORTANCE Although more than 50% of adults have some form of periodontal disease, there remains a significant gap in our understanding of its underlying cause. We initiated this study in order to better characterize the progression from oral health to disease. We first analyzed changes in the abundances of specific microorganisms in dental plaque collected from teeth during health and gingivitis, the mildest form of periodontal disease. We found that the clinical score of disease and patient from whom the sample originated but not tooth brushing are significantly correlated with microbial community composition. While a number of virulence-related gene transcripts are differentially expressed in gingivitis samples relative to health, not all are increased, suggesting that the overall activity of the microbiota is dynamic during disease transition. Better understanding of which microbes are present and their function during early periodontal disease can potentially lead to more targeted prophylactic approaches to prevent disease progression. Copyright © 2018 Nowicki et al.

'Candidatus Phytoplasma solani', a novel taxon associated with stolbur- and bois noir-related diseases of plants.

PubMed

Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward

2013-08-01

Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.

Hungatella effluvii gen. nov., sp. nov., an obligately anaerobic bacterium isolated from an effluent treatment plant, and reclassification of Clostridium hathewayi as Hungatella hathewayi gen. nov., comb. nov.

PubMed

Kaur, Sukhpreet; Yawar, Mir; Kumar, P Anil; Suresh, K

2014-03-01

A Gram-stain-positive, rod-shaped, spore-forming and strictly anaerobic bacterium, designated UB-B.2(T), was isolated from an industrial effluent anaerobic digester sample. It grew optimally at 30 °C and pH 7.0. Comparative analysis of the 16S rRNA gene sequence confirmed that strain UB-B.2(T) was closely related to Clostridium hathewayi DSM 13479(T) (97.84% similarity), a member of rRNA gene cluster XIVa of the genus Clostridium, and formed a coherent cluster with other related members of the Blautia (Clostridium) coccoides rRNA group in phylogenetic analyses. The end products of glucose fermentation by strain UB-B.2(T) were acetate and propionate. The G+C content of the DNA was 51.4 mol%. Although strain UB-B.2(T) showed 97.8% 16S rRNA gene sequence identity to the type strain of C. hathewayi, it exhibited only 38.4% relatedness at the whole-genome level. It also showed differences from its closest phylogenetic relative, C. hathewayi DSM 13479(T), in phenotypic characteristics such as hydrolysis of aesculin, starch and urea and fermentation end products. Both strains showed phenotypic differences from the members of rRNA gene cluster XIVa of the genus Clostridium. Based on these differences, C. hathewayi DSM 13479(T) and strain UB-B.2(T) were identified as representatives of a new genus of the family Clostridiaceae. Thus, we propose the reclassification of Clostridium hathewayi as Hungatella hathewayi gen. nov., comb. nov., the type species of the new genus (type strain DSM 13479(T) = CCUG 43506(T) = MTCC 10951(T)). Strain UB-B.2(T) ( = MTCC 11101(T) = DSM 24995(T)) is assigned to the novel species Hungatella effluvii gen. nov., sp. nov as the type strain.

Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

PubMed Central

Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

2002-01-01

An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

Direct regulation of RNA polymerase III transcription by RB, p53 and c-Myc.

PubMed

Felton-Edkins, Zoë A; Kenneth, Niall S; Brown, Timothy R P; Daly, Nicole L; Gomez-Roman, Natividad; Grandori, Carla; Eisenman, Robert N; White, Robert J

2003-01-01

The synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is cell cycle regulated in higher organisms. Overexpression of pol III products is a general feature of transformed cells. These observations may be explained by the fact that a pol III-specific transcription factor, TFIIIB, is strongly regulated by the tumor suppressors RB and p53, as well as the proto-oncogene product c-Myc. RB and p53 repress TFIIIB, but this restraint can be lost in tumors through a variety of mechanisms. In contrast, c-Myc binds and activates TFIIIB, causing potent induction of pol III transcription. Using chromatin immunoprecipitation and RNA interference, we show that c-Myc interacts with tRNA and 5S rRNA genes in transformed cervical cells, stimulating their expression. Availability of pol III products may be an important determinant of a cell's capacity to grow. The ability to regulate pol III output may therefore be integral to the growth control functions of RB, p53 and c-Myc.

The use of laser microdissection in the identification of suitable reference genes for normalization of quantitative real-time PCR in human FFPE epithelial ovarian tissue samples.

PubMed

Cai, Jing; Li, Tao; Huang, Bangxing; Cheng, Henghui; Ding, Hui; Dong, Weihong; Xiao, Man; Liu, Ling; Wang, Zehua

2014-01-01

Quantitative real-time PCR (qPCR) is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M) were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD), an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA) and nonparametric (Kruskal-Wallis) tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP) and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Impact of enrofloxacin on the human intestinal microbiota revealed by comparative molecular analysis.

PubMed

Kim, Bong-Soo; Kim, Jong Nam; Yoon, Seok-Hwan; Chun, Jongsik; Cerniglia, Carl E

2012-06-01

The indigenous human intestinal microbiota could be disrupted by residues of antibiotics in foods as well as therapeutically administered antibiotics to humans. These disruptions may lead to adverse health outcomes. To observe the possible impact of residues of antibiotics at concentrations below therapeutic levels on human intestinal microbiota, we performed studies using in vitro cultures of fecal suspensions from three individuals with 10 different concentrations (0, 0.1, 0.5, 1, 5, 10, 15, 25, 50 and 150 μg/ml) of the fluoroquinolone, enrofloxacin. The bacterial communities of the control and enrofloxacin dosed fecal samples were analyzed by denaturing gradient gel electrophoresis (DGGE) and pyrosequencing. In addition, changes of functional gene expression were analyzed by a pyrosequencing-based random whole-community mRNA sequencing method. Although each individual had a unique microbial composition, the communities of all individuals were affected by enrofloxacin. The proportions of two phyla, namely, Bacteroidetes and Proteobacteria, were significantly reduced with increasing concentrations of enrofloxacin exposure, while the proportion of Firmicutes increased. Principal Coordinate Analysis (PCoA) using the Fast UniFrac indicated that the community structures of intestinal microbiota were shifted by enrofloxacin. Most of the mRNA transcripts and the anti-microbial drug resistance genes increased with increasing concentrations of enrofloxacin. 16S rRNA gene pyrosequencing of control and enrofloxacin treated fecal suspensions provided valuable information of affected bacterial taxa down to the species level, and the community transcriptomic analyses using mRNA revealed the functional gene expression responses of the changed bacterial communities by enrofloxacin. Published by Elsevier Ltd.

Effects of altered gravity on a distribution of rDNA and nucleolar proteins and the expression of nucleolar proteins in plants

NASA Astrophysics Data System (ADS)

Sobol, Margaryta; Kordyum, Elizabeth; Medina, Francisco Javier

The nucleolus is an inner nuclear organelle originated from the activity of hundreds of rRNA genes, typically spanning several megabases. It morphologically reflects the functional events leading to ribosome biogenesis, from the transcription of rDNA through the processing of nascent pre-rRNA to the assembly of pre-ribosomes. A typical nucleolus consists of three major elements, namely fibrillar centers (FCs), the dense fibrillar component (DFC), and granular component (GC). The rate of ribosome biosynthesis and the subnucleolar structure are reliable monitors of the general level of cell metabolism and, consequently, of the rate of cellular growth, being influenced with many external factors, among which altered gravity could be included. Thus, we can hypothesize that the structural organization of the nucleolar subcomponents and the level, distribution and quantitative/qualitative characteristics of the nucleolar proteins would be changed under conditions of altered gravity. To confirm our hypothesis, we applied parallel procedures, such as cytochemistry, immunofluorescence, confocal laser microscopy, immunogold electron microscopy, monoand bi-dimensional electrophoresis and immunoblotting in root meristematic cells from two-day cress seedlings grown under slow horizontal clinorotation (2 rpm) and in stationary control. The complex model of the ultrastructural organization and functions of the nucleolus was created based on the location of rDNA and the nucleolar proteins fibrillarin, NhL90 and NhL68, these latter being cress nucleolin homologues. The principal stages of ribosome biogenesis, namely ribosomal gene activation, rDNA transcription and pre-rRNA processing were reflected in this model. Compared to the pattern shown in control ground gravity conditions, we found firstly a redistribution of both rDNA and nucleolar proteins in nucleolar subcomponents, induced by clinorotation. Under the conditions of altered gravity, nucleolar DNA concentrated predominantly in FCs in the form of condensed chromatin inclusions and internal non condensed fibrils, redistributing from the DFC and the transition zone between FCs and the DFC, recognized as the site of rDNA transcription. Regarding nucleolar proteins, a general decrease in the levels of fibrillarin and the nucleolin homologues, evaluated by estimating the density of immunogold labeling on the nucleolus, was recorded firstly in clinorotated samples, compared to controls. Furthermore, the intranucleolar location of the investigated proteins was also observed to change in response to the growth in altered gravity conditions. In particular, a decrease in the quantity of these proteins in the transition zone FCs-DFC as well as in the bulk of the DFC was observed in the experimental samples, compared to controls, whereas the content of the proteins was much higher in the inner space of FCs. Concerning the two-dimensional nuclear proteome, we revealed a decrease in the isoelectric point (pI) range of soluble proteins, which are known to be actively engaged in RNA (including rRNA) metabolism, and a shortening in the molecular weight range of them under clinorotation. Besides, minor and major protein spots in clinorotated samples showed decreased optical densities in comparison to control ones. Moreover, we showed the shortening of both the pI and the molecular weight ranges of the spots corresponding to the major nucleolin homologue NhL90 (detected by cross-reaction with anti-onion NopA100) in the fraction of soluble proteins in altered gravity. Based on these data, an effect of altered gravity in lowering the level of rDNA transcription as well as rRNA processing, that could be the evidence of a decrease in the level of nucleolar functional activity, is suggested.

Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.

PubMed

López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco

2002-07-01

A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.

Oxidative stress damages rRNA inside the ribosome and differentially affects the catalytic center

PubMed Central

Willi, Jessica; Küpfer, Pascal; Evéquoz, Damien; Fernandez, Guillermo; Polacek, Norbert

2018-01-01

Abstract Intracellular levels of reactive oxygen species (ROS) increase as a consequence of oxidative stress and represent a major source of damage to biomolecules. Due to its high cellular abundance RNA is more frequently the target for oxidative damage than DNA. Nevertheless the functional consequences of damage on stable RNA are poorly understood. Using a genome-wide approach, based on 8-oxo-guanosine immunoprecipitation, we present evidence that the most abundant non-coding RNA in a cell, the ribosomal RNA (rRNA), is target for oxidative nucleobase damage by ROS. Subjecting ribosomes to oxidative stress, we demonstrate that oxidized 23S rRNA inhibits the ribosome during protein biosynthesis. Placing single oxidized nucleobases at specific position within the ribosome's catalytic center by atomic mutagenesis resulted in markedly different functional outcomes. While some active site nucleobases tolerated oxidative damage well, oxidation at others had detrimental effects on protein synthesis by inhibiting different sub-steps of the ribosomal elongation cycle. Our data provide molecular insight into the biological consequences of RNA oxidation in one of the most central cellular enzymes and reveal mechanistic insight on the role of individual active site nucleobases during translation. PMID:29309687

Poly(ADP-Ribose) Polymerase 1 (PARP-1) Regulates Ribosomal Biogenesis in Drosophila Nucleoli

PubMed Central

Boamah, Ernest K.; Kotova, Elena; Garabedian, Mikael; Jarnik, Michael; Tulin, Alexei V.

2012-01-01

Poly(ADP-ribose) polymerase 1 (PARP1), a nuclear protein, utilizes NAD to synthesize poly(AD-Pribose) (pADPr), resulting in both automodification and the modification of acceptor proteins. Substantial amounts of PARP1 and pADPr (up to 50%) are localized to the nucleolus, a subnuclear organelle known as a region for ribosome biogenesis and maturation. At present, the functional significance of PARP1 protein inside the nucleolus remains unclear. Using PARP1 mutants, we investigated the function of PARP1, pADPr, and PARP1-interacting proteins in the maintenance of nucleolus structure and functions. Our analysis shows that disruption of PARP1 enzymatic activity caused nucleolar disintegration and aberrant localization of nucleolar-specific proteins. Additionally, PARP1 mutants have increased accumulation of rRNA intermediates and a decrease in ribosome levels. Together, our data suggests that PARP1 enzymatic activity is required for targeting nucleolar proteins to the proximity of precursor rRNA; hence, PARP1 controls precursor rRNA processing, post-transcriptional modification, and pre-ribosome assembly. Based on these findings, we propose a model that explains how PARP1 activity impacts nucleolar functions and, consequently, ribosomal biogenesis. PMID:22242017

The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.

PubMed

Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M

2018-06-01

Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.

Rapid and simple method for purification of nucleic acids.

PubMed

Boom, R; Sol, C J; Salimans, M M; Jansen, C L; Wertheim-van Dillen, P M; van der Noordaa, J

1990-03-01

We have developed a simple, rapid, and reliable protocol for the small-scale purification of DNA and RNA from, e.g., human serum and urine. The method is based on the lysing and nuclease-inactivating properties of the chaotropic agent guanidinium thiocyanate together with the nucleic acid-binding properties of silica particles or diatoms in the presence of this agent. By using size-fractionated silica particles, nucleic acids (covalently closed circular, relaxed circular, and linear double-stranded DNA; single-stranded DNA; and rRNA) could be purified from 12 different specimens in less than 1 h and were recovered in the initial reaction vessel. Purified DNA (although significantly sheared) was a good substrate for restriction endonucleases and DNA ligase and was recovered with high yields (usually over 50%) from the picogram to the microgram level. Copurified rRNA was recovered almost undegraded. Substituting size-fractionated silica particles for diatoms (the fossilized cell walls of unicellular algae) allowed for the purification of microgram amounts of genomic DNA, plasmid DNA, and rRNA from cell-rich sources, as exemplified for pathogenic gram-negative bacteria. In this paper, we show representative experiments illustrating some characteristics of the procedure which may have wide application in clinical microbiology.

Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2010-04-01

An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

Occurrence and characterization of hitherto unknown Streptomyces species in semi-arid soils.

PubMed

Kumar, Surendra; Priya, E; Singh Solanki, Dilip; Sharma, Ruchika; Gehlot, Praveen; Pathak, Rakesh; Singh, S K

2016-09-01

Streptomyces the predominant genus of Actinobacteria and plays an important role in the recycling of soil organic matter and production of important secondary metabolites. The occurrence and diversity assessment of Streptomyces species revealed alkaline and poor nutrient status of soils of semi-arid region of Jodhpur, Rajasthan. The morphological and biochemical characterization of 21 Streptomyces isolates facilitated Genus level identification but were insufficient to designate species. Species designation based on 16S rRNA gene delineated 21 isolates into 14 Streptomyces species. Upon BLAST search, the test isolates exhibited 98 to 100% identities with that of the best aligned sequences of the NCBI database. The GC content of 16S rRNA gene sequences of all the Streptomyces isolates tested ranged from 59.03% to 60.94%. The multiple sequence alignment of all the 21 Streptomyces isolates generated a phylogram with high bootstrap values indicating reliable grouping of isolates based on nucleotide sequence variations by way of insertion, deletion and substitutions and 16S rRNA length polymorphism. Some of the Streptomyces species molecularly identified under present study are reported for the first time from semi-arid region of Jodhpur.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Leakage of CO2 from sub-seafloor CO2 storage sites to the seabed; Impacts on sediment microorganisms and geochemical parameters during in situ and laboratory leakage experiments

NASA Astrophysics Data System (ADS)

Reigstad, L. J.; Hannisdal, B.; Hoffmann, F. U.; Sweetman, A. K.; Baumberger, T.; Eickmann, B.; Røy, H.; Thorseth, I. H.; Pedersen, R. B.

2013-12-01

Since 1996, 14 million tons of CO2 extracted from natural gas have been injected into the Utsira Formation, a saline aquifer at ~1000 m depth in the North Sea. The injected CO2 covers today an area of 4 x 2 km2. At present, there are three international treaties protecting the oceans, and all three allow CO2 storage in sub-seabed geological formations. One of these, the EU Directive 2009/31, states that monitoring must take place before, during and after CO2 storage in order to detect leakage of CO2 and significant adverse effects on the surrounding environment. However, few environmental studies have investigated the potential impacts of a CO2 leakage on the microbial life and geochemical conditions in seafloor sediment. To remedy this, we performed two experiments with abrupt CO2 acidification on the top 10 cm of the seafloor close to the North Sea storage site: 1) One laboratory CO2 acidification experiment on undisturbed sediment cores from the seafloor overlying the CO2 storage site (80 m water depth). The continuous flow of CO2 acidified seawater (pH 6.4) with 20 000 μatm pCO2 over the cores lasted for 1.5 months with sediment core terminations at regular intervals. 2) In situ CO2 acidification experiments carried out on the seafloor at 350 m water depth, with life span of 40 hours and exposure to 20 000 μatm pCO2. Both experiments showed increased O2 consumption in the water overlying the CO2 acidified sediment relative to the control sediment, indicating a rise in metabolic activity due to the treatment. After about 12 hours of acidification and throughout the laboratory experimental period, an increase in macrofauna burial activity could be seen, with dead/dying macrofauna appearing on the sediment surface. The pyrosequencing amplicon dataset obtained after bacterial and archaeal 16S rRNA amplification (RNA level) was subjected to multivariate analyses (PCA, NMDS), revealing changes in the active community on phylum, class and OTU levels. Changes were detected on all three levels in all depths investigated, but the response to acidification appeared among less-abundant prokaryotic groups in the sediment, rather than the numerically dominant groups. Quantification of the 16S rRNA genes (DNA level) indicated no increase in cell numbers in response to the treatment. However, an increase in the in situ microbial sulfate reduction rates and/or expression of marker genes for sulfate reduction (RNA level) was discovered. Analyses of marker gene expression for other prokaryotic metabolisms will be presented as well as correlations between specific organisms and geochemical parameters. Within the limitations of the experimental set up, our studies indicate that a leakage of CO2 from a sub-seafloor storage site may not dramatically change the composition of the active microbial community in the seabed sediment though we did register activity changes in some metabolisms.

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

PubMed Central

Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

2013-01-01

The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

PubMed Central

Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.

2013-01-01

Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana

PubMed Central

Chen, Ying-Jiun C.; Wang, Huei-Jing

2016-01-01

In eukaryotic cells, ribosomal RNAs (rRNAs) are transcribed, processed, and assembled with ribosomal proteins in the nucleolus. Regulatory mechanisms of rRNA gene (rDNA) transcription and processing remain elusive in plants, especially their connection to nucleolar organization. We performed an in silico screen for essential genes of unknown function in Arabidopsis thaliana and identified Thallo (THAL) encoding a SAS10/C1D family protein. THAL disruption caused enlarged nucleoli in arrested embryos, aberrant processing of precursor rRNAs at the 5’ External Transcribed Spacer, and repression of the major rDNA variant (VAR1). THAL overexpression lines showed de-repression of VAR1 and overall reversed effects on rRNA processing sites. Strikingly, THAL overexpression also induced formation of multiple nucleoli per nucleus phenotypic of mutants of heterochromatin factors. THAL physically associated with histone chaperone Nucleolin 1 (NUC1), histone-binding NUC2, and histone demethylase Jumonji 14 (JMJ14) in bimolecular fluorescence complementation assay, suggesting that it participates in chromatin regulation. Furthermore, investigation of truncated THAL proteins revealed that the SAS10 C-terminal domain is likely important for its function in chromatin configuration. THAL also interacted with putative Small Subunit processome components, including previously unreported Arabidopsis homologue of yeast M Phase Phosphoprotein 10 (MPP10). Our results uncovering the dual role of THAL in transcription and processing events critical for proper rRNA biogenesis and nucleolar organization during reproduction are the first to define the function of SAS10/C1D family members in plants. PMID:27792779

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

PubMed

Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

2016-10-25

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis

PubMed Central

Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier

2016-01-01

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Microbial community composition and functions are resilient to metal pollution along two forest soil gradients.

PubMed

Azarbad, Hamed; Niklińska, Maria; Laskowski, Ryszard; van Straalen, Nico M; van Gestel, Cornelis A M; Zhou, Jizhong; He, Zhili; Wen, Chongqing; Röling, Wilfred F M

2015-01-01

Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long-term metal pollution. Studying 12 sites located along two distinct gradients of metal pollution in Southern Poland revealed that functional potential and diversity (assessed using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level did, however, significantly impact bacterial community structure (as shown by MiSeq Illumina sequencing of 16S rRNA genes), but not bacterial taxon richness and community composition. Metal pollution caused changes in the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal-resistance genes showed significant correlations with metal concentrations in soil. Our study showed that microbial communities are resilient to metal pollution; despite differences in community structure, no clear impact of metal pollution levels on overall functional diversity was observed. While screens of phylogenetic marker genes, such as 16S rRNA genes, provide only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appears to be a more promising strategy. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

PubMed Central

Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-01-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

PubMed

Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-08-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.

PubMed

Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N

1998-10-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.

Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria

PubMed Central

Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.

1998-01-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.

PubMed

Gaspin, C; Cavaillé, J; Erauso, G; Bachellerie, J P

2000-04-07

Ribose methylation is a prevalent type of nucleotide modification in rRNA. Eukaryotic rRNAs display a complex pattern of ribose methylations, amounting to 55 in yeast Saccharomyces cerevisiae and about 100 in vertebrates. Ribose methylations of eukaryotic rRNAs are each guided by a cognate small RNA, belonging to the family of box C/D antisense snoRNAs, through transient formation of a specific base-pairing at the rRNA modification site. In prokaryotes, the pattern of rRNA ribose methylations has been fully characterized in a single species so far, Escherichia coli, which contains only four ribose methylated rRNA nucleotides. However, the hyperthermophile archaeon Sulfolobus solfataricus contains, like eukaryotes, a large number of (yet unmapped) rRNA ribose methylations and homologs of eukaryotic box C/D small nucleolar ribonuclear proteins have been identified in archaeal genomes. We have therefore searched archaeal genomes for potential homologs of eukaryotic methylation guide small nucleolar RNAs, by combining searches for structured motifs with homology searches. We have identified a family of 46 small RNAs, conserved in the genomes of three hyperthermophile Pyrococcus species, which we have experimentally characterized in Pyrococcus abyssi. The Pyrococcus small RNAs, the first reported homologs of methylation guide small nucleolar RNAs in organisms devoid of a nucleus, appear as a paradigm of minimalist box C/D antisense RNAs. They differ from their eukaryotic homologs by their outstanding structural homogeneity, extended consensus box motifs and the quasi-systematic presence of two (instead of one) rRNA antisense elements. Remarkably, for each small RNA the two antisense elements always match rRNA sequences close to each other in rRNA structure, suggesting an important role in rRNA folding. Only a few of the predicted P. abyssi rRNA ribose methylations have been detected so far. Further analysis of these archaeal small RNAs could provide new insights into the origin and functions of methylation guide small nucleolar RNAs and illuminate the still elusive role of rRNA ribose methylations. Copyright 2000 Academic Press.

Morphology and molecular analysis of Paratylenchus nanjingensis n. sp. (Nematoda: Paratylenchinae) from the rhizosphere soil of Pinus massoniana in China.

PubMed

Wang, K; Xie, H; Li, Y; Wu, W J; Xu, C L

2016-03-01

Paratylenchus nanjingensis n. sp. was obtained from Nanjing, Jiangsu Province, China. This new species is characterized by having a female with a slender, vermiform body (243-279 μm), head with distinct submedian lobes, slender and long stylet (64-68 μm), anchor-shaped stylet knobs, excretory pore anterior to the level of the stylet knobs, small lateral vulval flaps and lateral field with four lines; and male with more distinct body annuli, stylet lacking and pharynx degenerate. The internal transcribed spacer sequences of ribosomal RNA (ITS rRNA) gene of the new species were amplified and sequenced in this study. The phylogenetic relationships of the new species with other Paratylenchus species using the ITS rRNA gene sequences are given.

Antimicrobial Use and Resistance in Swine Waste Treatment Systems▿

PubMed Central

Jindal, Archana; Kocherginskaya, Svetlana; Mehboob, Asma; Robert, Matthew; Mackie, Roderick I.; Raskin, Lutgarde; Zilles, Julie L.

2006-01-01

Chlortetracycline and the macrolide tylosin were identified as commonly used antimicrobials for growth promotion and prophylaxis in swine production. Resistance to these antimicrobials was measured throughout the waste treatment processes at five swine farms by culture-based and molecular methods. Conventional farm samples had the highest levels of resistance with both culture-based and molecular methods and had similar levels of resistance despite differences in antimicrobial usage. The levels of resistance in organic farm samples, where no antimicrobials were used, were very low by a culture-based method targeting fecal streptococci. However, when the same samples were analyzed with a molecular method detecting methylation of a specific nucleotide in the 23S rRNA that results in resistance to macrolides, lincosamides, and streptogramin B (MLSB), an unexpectedly high level of resistant rRNA (approximately 50%) was observed, suggesting that the fecal streptococci were not an appropriate target group to evaluate resistance in the overall microbial community and that background levels of MLSB resistance may be substantial. All of the feed samples tested, including those from the organic farm, contained tetracycline resistance genes. Generally, the same tetracycline resistance genes and frequency of detection were found in the manure and lagoon samples for each commercial farm. The levels of tetracycline and MLSB resistance remained high throughout the waste treatment systems, suggesting that the potential impact of land application of treated wastes and waste treatment by-products on environmental levels of resistance should be investigated further. PMID:17041160

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Gut microbiota richness promotes its stability upon increased dietary fibre intake in healthy adults.

PubMed

Tap, Julien; Furet, Jean-Pierre; Bensaada, Martine; Philippe, Catherine; Roth, Hubert; Rabot, Sylvie; Lakhdari, Omar; Lombard, Vincent; Henrissat, Bernard; Corthier, Gérard; Fontaine, Eric; Doré, Joël; Leclerc, Marion

2015-12-01

Gut microbiota richness and stability are important parameters in host-microbe symbiosis. Diet modification, notably using dietary fibres, might be a way to restore a high richness and stability in the gut microbiota. In this work, during a 6-week nutritional trial, 19 healthy adults consumed a basal diet supplemented with 10 or 40 g dietary fibre per day for 5 days, followed by 15-day washout periods. Fecal samples were analysed by a combination of 16S rRNA gene pyrosequencing, intestinal cell genotoxicity assay, metatranscriptomics sequencing approach and short-chain fatty analysis. This short-term change in the dietary fibre level did not have the same impact for all individuals but remained significant within each individual gut microbiota at genus level. Higher microbiota richness was associated with higher microbiota stability upon increased dietary fibre intake. Increasing fibre modulated the expression of numerous microbiota metabolic pathways such as glycan metabolism, with genes encoding carbohydrate-active enzymes active on fibre or host glycans. High microbial richness was also associated with high proportions of Prevotella and Coprococcus species and high levels of caproate and valerate. This study provides new insights on the role of gut microbial richness in healthy adults upon dietary changes and host microbes' interaction. © 2015 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

NASA Technical Reports Server (NTRS)

Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

1992-01-01

A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

PubMed Central

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-01-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Use of functional gene expression and respirometry to study wastewater nitrification activity after exposure to low doses of copper.

PubMed

Kapoor, Vikram; Li, Xuan; Chandran, Kartik; Impellitteri, Christopher A; Santo Domingo, Jorge W

2016-04-01

Autotrophic nitrification in biological nitrogen removal systems has been shown to be sensitive to the presence of heavy metals in wastewater treatment plants. Using transcriptase-quantitative polymerase chain reaction (RT-qPCR) data, we examined the effect of copper on the relative expression of functional genes (i.e., amoA, hao, nirK, and norB) involved in redox nitrogen transformation in batch enrichment cultures obtained from a nitrifying bioreactor operated as a continuous reactor (24-h hydraulic retention time). 16S ribosomal RNA (rRNA) gene next-generation sequencing showed that Nitrosomonas-like populations represented 60-70% of the bacterial community, while other nitrifiers represented <5%. We observed a strong correspondence between the relative expression of amoA and hao and ammonia removal in the bioreactor. There were no considerable changes in the transcript levels of amoA, hao, nirK, and norB for nitrifying samples exposed to copper dosages ranging from 0.01 to 10 mg/L for a period of 12 h. Similar results were obtained when ammonia oxidation activity was measured via specific oxygen uptake rate (sOUR). The lack of nitrification inhibition by copper at doses lower than 10 mg/L may be attributed to the role of copper as cofactor for ammonia monooxygenase or to the sub-inhibitory concentrations of copper used in this study. Overall, these results demonstrate the use of molecular methods combined with conventional respirometry assays to better understand the response of wastewater nitrifying systems to the presence of copper.

Identification of RNA species in the RNA-toxin complex and structure of the complex in Clostridium botulinum type E.

PubMed

Kitamura, Masaru

2002-02-15

Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

PubMed

Goldfarb, Katherine C; Cech, Thomas R

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

PubMed

Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

2017-11-02

Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had altered diversity profiles. Both bioinformatics 16S rRNA pipelines used in this study (OTU and paired end) presented similar taxonomic profiles at genus level. We determined that DNA extraction from ELBW faecal samples, particularly those infants receiving probiotic supplementation, should include a prolonged beat-beating step. Furthermore, use of the 16S rRNA (V1 + V2 + V3) and (V6 + V7 + V8) regions provides reliable representation of ELBW microbiota profiles, while inclusion of the (V4 + V5) region may not be appropriate for studies where Bifidobacterium constitutes a resident microbiota member.

Phylogenetic comparisons of a coastal bacterioplankton community with its counterparts in open ocean and freshwater systems.

PubMed

Rappé; Vergin; Giovannoni

2000-09-01

In order to extend previous comparisons between coastal marine bacterioplankton communities and their open ocean and freshwater counterparts, here we summarize and provide new data on a clone library of 105 SSU rRNA genes recovered from seawater collected over the western continental shelf of the USA in the Pacific Ocean. Comparisons to previously published data revealed that this coastal bacterioplankton clone library was dominated by SSU rRNA gene phylotypes originally described from surface waters of the open ocean, but also revealed unique SSU rRNA gene lineages of beta Proteobacteria related to those found in clone libraries from freshwater habitats. beta Proteobacteria lineages common to coastal and freshwater samples included members of a clade of obligately methylotrophic bacteria, SSU rRNA genes affiliated with Xylophilus ampelinus, and a clade related to the genus Duganella. In addition, SSU rRNA genes were recovered from such previously recognized marine bacterioplankton SSU rRNA gene clone clusters as the SAR86, SAR11, and SAR116 clusters within the class Proteobacteria, the Roseobacter clade of the alpha subclass of the Proteobacteria, the marine group A/SAR406 cluster, and the marine Actinobacteria clade. Overall, these results support and extend previous observations concerning the global distribution of several marine planktonic prokaryote SSU rRNA gene phylotypes, but also show that coastal bacterioplankton communities contain SSU rRNA gene lineages (and presumably bacterioplankton) shown previously to be prevalent in freshwater habitats.

Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

PubMed

Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

2016-12-15

Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

PubMed

Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

2005-04-11

We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

[Cytogenetic characteristics of the uterine cervical epithelium in inflammatory diseases].

PubMed

Aleksieienko, O I

2011-01-01

Functional status of epithelial cells at inflammatory cervical pathologies has been studied with the use of cytogenetic method of detection of chromosome nucleolar organizer regions. The highest level of rRNA proliferation and synthesis has been detected in cylindrical epithelial cells using the indexes of compact and transitional nucleolonemic types of nucleolar organizer regions, a higher level--in squamous cells of intermediate type, and the lowest one in squamous epithelium of superficial type.

Genetic diversity of FLO1 and FLO5 genes in wine flocculent Saccharomyces cerevisiae strains.

PubMed

Tofalo, Rosanna; Perpetuini, Giorgia; Di Gianvito, Paola; Schirone, Maria; Corsetti, Aldo; Suzzi, Giovanna

2014-11-17

Twenty-eight flocculent wine strains were tested for adhesion and flocculation phenotypic variability. Moreover, the expression patterns of the main genes involved in flocculation (FLO1, FLO5 and FLO8) were studied both in synthetic medium and in presence of ethanol stress. Molecular identification and typing were achieved by PCR-RFLP of the 5.8S ITS rRNA region and microsatellite PCR fingerprinting, respectively. All isolates belong to Saccharomyces cerevisiae species. The analysis of microsatellites highlighted the intraspecific genetic diversity of flocculent wine S. cerevisiae strains allowing obtaining strain-specific profiles. Moreover, strains were characterized on the basis of adhesive properties. A wide biodiversity was observed even if none of the tested strains were able to form biofilms (or 'mats'), or to adhere to polystyrene. Moreover, genetic diversity of FLO1 and FLO5 flocculating genes was determined by PCR. Genetic diversity was detected for both genes, but a relationship with the flocculation degree was not found. So, the expression patterns of FLO1, FLO5 and FLO8 genes was investigated in a synthetic medium and a relationship between the expression of FLO5 gene and the flocculation capacity was established. To study the expression of FLO1, FLO5 and FLO8 genes in floc formation and ethanol stress resistance qRT-PCR was carried out and also in this case strains with flocculent capacity showed higher levels of FLO5 gene expression. This study confirmed the diversity of flocculation phenotype and genotype in wine yeasts. Moreover, the importance of FLO5 gene in development of high flocculent characteristic of wine yeasts was highlighted. The obtained collection of S. cerevisiae flocculent wine strains could be useful to study the relationship between the genetic variation and flocculation phenotype in wine yeasts. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization of the fecal microbiome in different swine groups by high-throughput sequencing.

PubMed

Park, Soo-Je; Kim, Jinu; Lee, Jong-Soo; Rhee, Sung-Keun; Kim, Hongik

2014-08-01

Swine have a complex microbial community within their gastrointestinal tract that plays a critical role in both health and disease. High-throughput 16S rRNA gene-based pyrosequencing was used to identify the possible core microorganisms in the gut of swine groups that differ in meat quality and weight grades (level 1 as higher meat quality and level 2 as lower meat quality). Samples were taken from the rectum and/or stool from ten animals, DNA was extracted, and the V1-V3 regions of the 16S rRNA gene were amplified. Two bacterial populations (Bacteroidetes and Firmicutes) dominated and were shared between the two groups. Significant differences between the groups were found at the genus level. The genera Lactobacillus and Oscillibacter were found in slightly higher proportions in the level 2 group (12.6 and 12.4% of the classified reads, respectively) than those of level 1 (9.6 and 7.7%, respectively). By contrast, the proportion of reads assigned to the genus Roseburia in the level 1 group (13.0%) was higher than that of level 2 (4.8%). The largest differences were related to the genera Clostridium, Oscillibacter, and Roseburia as core microorganisms. Moreover, two genera, Roseburia and Clostridium, related to level 1 produced linoleic acid or short chain fatty acids that might contribute to swine health and development. In conclusion, the presence of core bacteria in the swine gut is associated with meat quality with reduced body fat in swine. Copyright © 2014 Elsevier Ltd. All rights reserved.

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

PubMed

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

Diversity and cold adaptation of microorganisms isolated from the Schirmacher Oasis, Antarctica

NASA Astrophysics Data System (ADS)

Mojib, Nazia; Bej, Asim K.; Hoover, Richard

2008-08-01

We have investigated the feasibility of the PCR amplification of the 16S rRNA genes from eubacteria and Archea on samples collected on Whatman FTA filters from Schirmacher Oasis for the study of culture-independent analysis of the microbial diversity. Both conventional PCR and real-time TaqmaTM PCR successfully amplified the targeted genes. A number of diverse groups of psychrotolerant microorganisms with various pigments have been isolated when cultured on agar medium. 16S rRNA gene analysis of these isolates helped us to identify closest taxonomic genus Pseudomonas, Frigoribacterium, Arthrobacter, Flavobacterium, and Janthinobacterium. It is possible that the pigments play protective role from solar UV radiation, which is prevalent in Antarctic continent especially during Austral summer months. Study of the expression of cold adaptive protein CapB and ice-binding protein IBP using western blots showed positive detection of both or either of these proteins in 6 out of 8 isolates. Since the CapB and IBP protein structure greatly varies in microorganisms, it is possible that the 2 isolates with negative results could have a different class of these proteins. The expression of the CapB and the IBP in these isolates suggest that these proteins are essential for the survival in the Antarctic cold and subzero temperatures and protect themselves from freeze-damage. The current study provided sufficient data to further investigate the rich and diverse biota of psychrotolerant extremophiles in the Antarctic Schirmacher Oasis using both culture-independent and culture-based approaches; and understand the mechanisms of cold tolerance.

Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

PubMed

Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

2014-11-01

Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Lactobacillus brevis strains from fermented aloe vera survive gastroduodenal environment and suppress common food borne enteropathogens.

PubMed

Kim, Young-Wook; Jeong, Young-Ju; Kim, Ah-Young; Son, Hyun-Hee; Lee, Jong-Am; Jung, Cheong-Hwan; Kim, Chae-Hyun; Kim, Jaeman

2014-01-01

Five novel Lactobacillus brevis strains were isolated from naturally fermented Aloe vera leaf flesh. Each strain was identified by Random Amplified Polymorphic DNA (RAPD) analysis and 16S rRNA sequence comparison. These strains were highly tolerant to acid, surviving in pH2.5 for up to 4 hours, and resistant to 5% bile salts at 37°C for 18 hours. Due to its tolerance to acid and bile salts, one strain passed through the gastric barrier and colonised the intestine after oral administration. All five strains inhibited the growth of many harmful enteropathogens without restraining most of normal commensals in the gut and hence named POAL (Probiotics Originating from Aloe Leaf) strains. Additionally, each strain exhibited discriminative resistance to a wide range of antibiotics. The L. brevis POAL strains, moreover, expressed high levels of the glutamate decarboxylase (GAD) gene which produces a beneficial neurotransmitter, γ-aminobutyric acid (GABA). These characteristics in all suggest that the novel L. brevis strains should be considered as potential food additives and resources for pharmaceutical research.

High-Fat Diet Consumption Induces Microbiota Dysbiosis and Intestinal Inflammation in Zebrafish.

PubMed

Arias-Jayo, Nerea; Abecia, Leticia; Alonso-Sáez, Laura; Ramirez-Garcia, Andoni; Rodriguez, Alfonso; Pardo, Miguel A

2018-05-07

Energy-dense foods and overnutrition represent major starting points altering lipid metabolism, systemic inflammation and gut microbiota. The aim of this work was to investigate the effects of a high-fat diet (HFD) over a period of 25 days on intestinal microbiota and inflammation in zebrafish. Microbial composition of HFD-fed animals was analysed and compared to controls by 16S rRNA sequencing and quantitative PCR. The expression level on several genes related to inflammation was tested. Furthermore, microscopic assessment of the intestine was performed in both conditions. The consumption of the HFD resulted in microbial dysbiosis, characterised by an increase in the relative abundance of the phylum Bacteroidetes. Moreover, an emerging intestinal inflammation via NF-κβ activation was confirmed by the overexpression of several genes related to signalling receptors, antimicrobial metabolism and the inflammatory cascade. The intestinal barrier was also damaged, with an increase of goblet cell mucin production. This is the first study performed in zebrafish which suggests that the consumption of a diet enriched with 10% fat changes the intestinal microbial community composition, which was correlated with low-grade inflammation.

Lactobacillus brevis Strains from Fermented Aloe vera Survive Gastroduodenal Environment and Suppress Common Food Borne Enteropathogens

PubMed Central

Kim, Young-Wook; Jeong, Young-Ju; Kim, Ah-Young; Son, Hyun-Hee; Lee, Jong-Am; Jung, Cheong-Hwan; Kim, Chae-Hyun; Kim, Jaeman

2014-01-01

Five novel Lactobacillus brevis strains were isolated from naturally fermented Aloe vera leaf flesh. Each strain was identified by Random Amplified Polymorphic DNA (RAPD) analysis and 16S rRNA sequence comparison. These strains were highly tolerant to acid, surviving in pH2.5 for up to 4 hours, and resistant to 5% bile salts at 37°C for 18 hours. Due to its tolerance to acid and bile salts, one strain passed through the gastric barrier and colonised the intestine after oral administration. All five strains inhibited the growth of many harmful enteropathogens without restraining most of normal commensals in the gut and hence named POAL (Probiotics Originating from Aloe Leaf) strains. Additionally, each strain exhibited discriminative resistance to a wide range of antibiotics. The L. brevis POAL strains, moreover, expressed high levels of the glutamate decarboxylase (GAD) gene which produces a beneficial neurotransmitter, γ-aminobutyric acid (GABA). These characteristics in all suggest that the novel L. brevis strains should be considered as potential food additives and resources for pharmaceutical research. PMID:24598940

Exploiting 16S rRNA gene for the detection and quantification of fish as a potential allergenic food: A comparison of two real-time PCR approaches.

PubMed

Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

2018-04-15

Fish is one of the most common allergenic foods that should be accurately labelled to protect the health of allergic consumers. In this work, two real-time PCR systems based on the EvaGreen dye and a TaqMan probe are proposed and compared. New primers were designed to target the 16S rRNA gene, as a universal maker for fish detection, with fully demonstrated specificity for a wide range of fish species. Both systems showed similar absolute sensitivities, down to 0.01 pg of fish DNA, and adequate real-time PCR performance parameters. The probe system showed higher relative sensitivity and dynamic range (0.0001-50%) than the EvaGreen (0.05-50%). They were both precise, but trueness was compromised at the highest tested level with the EvaGreen assay. Therefore, both systems were successful, although the probe one exhibited the best performance. Its application to verify labelling compliance of foodstuffs suggested a high level of mislabelling and/or fraudulent practices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Evaluation of MALDI-TOF MS (Matrix-Assisted Laser Desorption-Ionization Time-of-Flight Mass Spectrometry) for routine identification of anaerobic bacteria.

PubMed

Rodríguez-Sánchez, Belén; Alcalá, Luis; Marín, Mercedes; Ruiz, Adrián; Alonso, Elena; Bouza, Emilio

2016-12-01

Information regarding the use of MALDI-TOF MS as an alternative to conventional laboratory methods for the rapid and reliable identification of bacterial isolates is still limited. In this study, MALDI-TOF MS was evaluated on 295 anaerobic isolates previously identified by 16S rRNA gene sequencing and with biochemical tests (Rapid ID 32A system, BioMérieux). In total, 85.8% of the isolates were identified by MALDI-TOF MS at the species level vs 49.8% using the Rapid ID 32A system (p < 0.0001). None of the isolates was discordantly identified at the genus level using MALDI-TOF MS and only 9 of them could not be identified using the method. Thus, our results show that MALDI-TOF MS is a robust and reliable tool for the identification of anaerobic isolates in the microbiology laboratory. Its implementation will reduce the turnaround time for a final identification and the number of isolates that require 16S rRNA sequencing. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of storage time on gene expression data acquired from unfrozen archived newborn blood spots.

PubMed

Ho, Nhan T; Busik, Julia V; Resau, James H; Paneth, Nigel; Khoo, Sok Kean

2016-11-01

Unfrozen archived newborn blood spots (NBS) have been shown to retain sufficient messenger RNA (mRNA) for gene expression profiling. However, the effect of storage time at ambient temperature for NBS samples in relation to the quality of gene expression data is relatively unknown. Here, we evaluated mRNA expression from quantitative real-time PCR (qRT-PCR) and microarray data obtained from NBS samples stored at ambient temperature to determine the effect of storage time on the quality of gene expression. These data were generated in a previous case-control study examining NBS in 53 children with cerebral palsy (CP) and 53 matched controls. NBS sample storage period ranged from 3 to 16years at ambient temperature. We found persistently low RNA integrity numbers (RIN=2.3±0.71) and 28S/18S rRNA ratios (~0) across NBS samples for all storage periods. In both qRT-PCR and microarray data, the expression of three common housekeeping genes-beta cytoskeletal actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and peptidylprolyl isomerase A (PPIA)-decreased with increased storage time. Median values of each microarray probe intensity at log 2 scale also decreased over time. After eight years of storage, probe intensity values were largely reduced to background intensity levels. Of 21,500 genes tested, 89% significantly decreased in signal intensity, with 13,551, 10,730, and 9925 genes detected within 5years, > 5 to <10years, and >10years of storage, respectively. We also examined the expression of two gender-specific genes (X inactivation-specific transcript, XIST and lysine-specific demethylase 5D, KDM5D) and seven gene sets representing the inflammatory, hypoxic, coagulative, and thyroidal pathways hypothesized to be related to CP risk to determine the effect of storage time on the detection of these biologically relevant genes. We found the gender-specific genes and CP-related gene sets detectable in all storage periods, but exhibited differential expression (between male vs. female or CP vs. control) only within the first six years of storage. We concluded that gene expression data quality deteriorates in unfrozen archived NBS over time and that differential gene expression profiling and analysis is recommended for those NBS samples collected and stored within six years at ambient temperature. Copyright © 2016 Elsevier Inc. All rights reserved.

RNAP-II transcribes two small RNAs at the promoter and terminator regions of the RNAP-I gene in Saccharomyces cerevisiae.

PubMed

Mayán, Maria D

2013-01-01

Three RNA polymerases coexist in the ribosomal DNA of Saccharomyces cerevisiae. RNAP-I transcribes the 35S rRNA, RNAP-III transcribes the 5S rRNA and RNAP-II is found in both intergenic non-coding regions. Previously, we demonstrated that RNAP-II molecules bound to the intergenic non-coding regions (IGS) of the ribosomal locus are mainly found in a stalled conformation, and the stalled polymerase mediates chromatin interactions, which isolate RNAP-I from the RNAP-III transcriptional domain. Besides, RNAP-II transcribes both IGS regions at low levels, using different cryptic promoters. This report demonstrates that RNAP-II also transcribes two sequences located in the 5'- and 3'-ends of the 35S rRNA gene that overlap with the sequences of the 35S rRNA precursor transcribed by RNAP-I. The sequence located at the promoter region of RNAP-I, called the p-RNA transcript, binds to the transcription termination-related protein, Reb1p, while the T-RNA sequence, located in the termination sites of RNAP-I gene, contains the stem-loop recognized by Rtn1p, which is necessary for proper termination of RNAP-I. Because of their location, these small RNAs may play a key role in the initiation and termination of RNAP-I transcription. To correctly synthesize proteins, eukaryotic cells may retain a mechanism that connects the three main polymerases. This report suggests that cryptic transcription by RNAP-II may be required for normal transcription by RNAP-I in the ribosomal locus of S. cerevisiae. Copyright © 2012 John Wiley & Sons, Ltd.

Giardia duodenalis and Cryptosporidium occurrence in Australian sea lions (Neophoca cinerea) exposed to varied levels of human interaction

PubMed Central

Delport, Tiffany C.; Asher, Amy J.; Beaumont, Linda J.; Webster, Koa N.; Harcourt, Robert G.; Power, Michelle L.

2014-01-01

Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations. PMID:25426423

Giardia duodenalis and Cryptosporidium occurrence in Australian sea lions (Neophoca cinerea) exposed to varied levels of human interaction.

PubMed

Delport, Tiffany C; Asher, Amy J; Beaumont, Linda J; Webster, Koa N; Harcourt, Robert G; Power, Michelle L

2014-12-01

Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations.

The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

PubMed

Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

2012-01-01

Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

PubMed Central

Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

2006-01-01

Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

Transfer of Bacillus halodenitrificans Denariaz et al. 1989 to the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

PubMed

Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha

2004-11-01

A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

High-Resolution Microbial Community Succession of Microbially Induced Concrete Corrosion in Working Sanitary Manholes

PubMed Central

Ling, Alison L.; Robertson, Charles E.; Harris, J. Kirk; Frank, Daniel N.; Kotter, Cassandra V.; Stevens, Mark J.; Pace, Norman R.; Hernandez, Mark T.

2015-01-01

Microbially-induced concrete corrosion in headspaces threatens wastewater infrastructure worldwide. Models for predicting corrosion rates in sewer pipe networks rely largely on information from culture-based investigations. In this study, the succession of microbes associated with corroding concrete was characterized over a one-year monitoring campaign using rRNA sequence-based phylogenetic methods. New concrete specimens were exposed in two highly corrosive manholes (high concentrations of hydrogen sulfide and carbon dioxide gas) on the Colorado Front Range for up to a year. Community succession on corroding surfaces was assessed using Illumina MiSeq sequencing of 16S bacterial rRNA amplicons and Sanger sequencing of 16S universal rRNA clones. Microbial communities associated with corrosion fronts presented distinct succession patterns which converged to markedly low α-diversity levels (< 10 taxa) in conjunction with decreasing pH. The microbial community succession pattern observed in this study agreed with culture-based models that implicate acidophilic sulfur-oxidizer Acidithiobacillus spp. in advanced communities, with two notable exceptions. Early communities exposed to alkaline surface pH presented relatively high α-diversity, including heterotrophic, nitrogen-fixing, and sulfur-oxidizing genera, and one community exposed to neutral surface pH presented a diverse transition community comprised of less than 20% sulfur-oxidizers. PMID:25748024

High-resolution microbial community succession of microbially induced concrete corrosion in working sanitary manholes.

PubMed

Ling, Alison L; Robertson, Charles E; Harris, J Kirk; Frank, Daniel N; Kotter, Cassandra V; Stevens, Mark J; Pace, Norman R; Hernandez, Mark T

2015-01-01

Microbially-induced concrete corrosion in headspaces threatens wastewater infrastructure worldwide. Models for predicting corrosion rates in sewer pipe networks rely largely on information from culture-based investigations. In this study, the succession of microbes associated with corroding concrete was characterized over a one-year monitoring campaign using rRNA sequence-based phylogenetic methods. New concrete specimens were exposed in two highly corrosive manholes (high concentrations of hydrogen sulfide and carbon dioxide gas) on the Colorado Front Range for up to a year. Community succession on corroding surfaces was assessed using Illumina MiSeq sequencing of 16S bacterial rRNA amplicons and Sanger sequencing of 16S universal rRNA clones. Microbial communities associated with corrosion fronts presented distinct succession patterns which converged to markedly low α-diversity levels (< 10 taxa) in conjunction with decreasing pH. The microbial community succession pattern observed in this study agreed with culture-based models that implicate acidophilic sulfur-oxidizer Acidithiobacillus spp. in advanced communities, with two notable exceptions. Early communities exposed to alkaline surface pH presented relatively high α-diversity, including heterotrophic, nitrogen-fixing, and sulfur-oxidizing genera, and one community exposed to neutral surface pH presented a diverse transition community comprised of less than 20% sulfur-oxidizers.

Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics.

PubMed

Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L

2018-01-01

Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

A Comparative Study: Taxonomic Grouping of Alkaline Protease Producing Bacilli.

PubMed

Tekin, Nilgun; Cihan, Arzu Coleri; Karaca, Basar; Cokmus, Cumhur

2017-03-30

Alkaline proteases have biotechnological importance due to their activity and stability at alkaline pH. 56 bacteria, capable of growing under alkaline conditions were isolated and their alkaline protease activities were carried out at different parameters to determine their optimum alkaline protease production conditions. Seven isolates were showed higher alkaline protease production capacity than the reference strains. The highest alkaline protease producing isolates (103125 U/g), E114 and C265, were identified as Bacillus licheniformis with 99.4% and Bacillus mojavensis 99.8% based on 16S rRNA gene sequence similarities, respectively. Interestingly, the isolates identified as Bacillus safensis were also found to be high alkaline protease producing strains. Genotypic characterizations of the isolates were also determined by using a wide range of molecular techniques (ARDRA, ITS-PCR, (GTG)5-PCR, BOX-PCR). These different techniques allowed us to differentiate the alkaliphilic isolates and the results were in concurrence with phylogenetic analyses of the 16S rRNA genes. While ITS-PCR provided the highest correlation with 16S rRNA groups, (GTG)5-PCR showed the highest differentiation at species and intra-species level. In this study, each of the biotechnologically valuable alkaline protease producing isolates was grouped into their taxonomic positions with multi-genotypic analyses.

Clinorotation influences rDNA and NopA100 localization in nucleoli

NASA Astrophysics Data System (ADS)

Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.

PubMed

Chao, Shiou-Huei; Wu, Ruei-Jie; Watanabe, Koichi; Tsai, Ying-Chieh

2009-11-15

Fu-tsai and suan-tsai are spontaneously fermented mustard products traditionally prepared by the Hakka tribe of Taiwan. We chose 5 different processing stages of these products for analysis of the microbial community of lactic acid bacteria (LAB) by 16S rRNA gene sequencing. From 500 LAB isolates we identified 119 representative strains belonging to 5 genera and 18 species, including Enterococcus (1 species), Lactobacillus (11 species), Leuconostoc (3 species), Pediococcus (1 species), and Weissella (2 species). The LAB composition of mustard fermented for 3 days, known as the Mu sample, was the most diverse, with 11 different LAB species being isolated. We used sequence analysis of the 16S rRNA gene to identify the LAB strains and analysis of the dnaA, pheS, and rpoA genes to identify 13 LAB strains for which identification by 16S rRNA gene sequences was not possible. These 13 strains were found to belong to 5 validated known species: Lactobacillus farciminis, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Weissella cibaria, and Weissella paramesenteroides, and 5 possibly novel Lactobacillus species. These results revealed that there is a high level of diversity in LAB at the different stages of fermentation in the production of suan-tsai and fu-tsai.

Natrinema gari sp. nov., a halophilic archaeon isolated from fish sauce in Thailand.

PubMed

Tapingkae, Wanaporn; Tanasupawat, Somboon; Itoh, Takashi; Parkin, Kirk L; Benjakul, Soottawat; Visessanguan, Wonnop; Valyasevi, Ruud

2008-10-01

Two Gram-negative, rod-shaped, halophilic archaea, designated strains HIS40-3(T) and HDS3-1, were isolated from anchovy fish sauce (nam-pla) collected from two different locations in Thailand. The two strains were able to grow at 20-60 degrees C (optimum 37-40 degrees C), at 1.7-5.1 M NaCl (optimum 2.6-3.4 M NaCl) and at pH 5.5-8.5 (optimum pH 6.0-6.5). Hypotonic treatment with less than 1.7 M NaCl caused cell lysis. The major polar lipids of the isolates were C(20)C(20) and C(20)C(25) derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate, two glycolipids and one unidentified lipid. The DNA G+C contents were 64.0-65.4 mol%. In addition to phenotypic and chemotaxonomic characteristics, phylogenetic analysis based on 16S rRNA gene sequence similarities showed that strains HIS40-3(T) and HDS3-1 were related most closely to species of the genus Natrinema. Levels of 16S rRNA gene sequence similarity between strains HIS40-3(T) and HDS3-1 and the type strains of recognized Natrinema species were 99.1-96.6 %. The two novel strains could be distinguished from recognized Natrinema species on the basis of low levels of DNA-DNA relatedness and differences in whole-cell protein patterns and phenotypic properties. Levels of 16S rRNA gene sequence similarity and DNA-DNA relatedness between the two strains were 99.7 and 77.7 %, respectively, suggesting that they should be classified as representing a single species. Based on these taxonomic data, strains HIS40-3(T) and HDS3-1 are considered to represent a novel species of the genus Natrinema, for which the name Natrinema gari sp. nov. is proposed. The type strain is HIS40-3(T) (=BCC 24370(T) =JCM 14663(T) =PCU 303(T)).

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

PubMed

Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

2018-04-02

During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

The association of TIF-IA and polymerase I mediates promoter recruitment and regulation of ribosomal RNA transcription in Acanthamoeba castellanii.

PubMed

Gogain, Joseph C; Paule, Marvin R

2005-01-01

Large amounts of energy are expended for the construction of the ribosome during both transcription and processing, so it is of utmost importance for the cell to efficiently regulate ribosome production. Understanding how this regulation occurs will provide important insights into cellular growth control and into the coordination of gene expression mediated by all three transcription systems. Ribosomal RNA (rRNA) transcription rates closely parallel the need for protein synthesis; as a cell approaches stationary phase or encounters conditions that negatively affect either growth rate or protein synthesis, rRNA transcription is decreased. In eukaryotes, the interaction of RNA polymerase I (pol I) with the essential transcription initiation factor IA (TIF-IA) has been implicated in this downregulation of transcription. In agreement with the first observation that rRNA transcription is regulated by altering recruitment of pol I to the promoter in Acanthamoeba castellanii, we show here that pol I and an 80-kDa homologue of TIF-IA are found tightly associated in pol I fractions competent for specific transcription. Disruption of the pol I-TIF-IA complex is mediated by a specific dephosphorylation of either pol I or TIF-IA. Phosphatase treatment of TIF-IA-containing A. castellanii pol I fractions results in a downregulation of both transcriptional activity and promoter binding, reminiscent of the inactive pol I fractions purified from encysted cells. The fraction of pol I competent for promoter recruitment is enriched in TIF-IA relative to that not bound by immobilized promoter DNA. This downregulation coincides with an altered electrophoretic mobility of TIF-IA, suggesting at least it is phosphorylated.

The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei Qiping; Zhou Xiangtian; Yang Li

2007-06-15

We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

Extrachromosomal Nucleolus-Like Compartmentalization by a Plasmid-Borne Ribosomal RNA Operon and Its Role in Nucleoid Compaction.

PubMed

Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun

2018-01-01

In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Detection of Low-Level Cardinium and Wolbachia Infections in Culicoides

PubMed Central

Mee, Peter T.; Weeks, Andrew R.; Walker, Peter J.; Hoffmann, Ary A.

2015-01-01

Bacterial endosymbionts have been identified as potentially useful biological control agents for a range of invertebrate vectors of disease. Previous studies of Culicoides (Diptera: Ceratopogonidae) species using conventional PCR assays have provided evidence of Wolbachia (1/33) and Cardinium (8/33) infections. Here, we screened 20 species of Culicoides for Wolbachia and Cardinium, utilizing a combination of conventional PCR and more sensitive quantitative PCR (qPCR) assays. Low levels of Cardinium DNA were detected in females of all but one of the Culicoides species screened, and low levels of Wolbachia were detected in females of 9 of the 20 Culicoides species. Sequence analysis based on partial 16S rRNA gene and gyrB sequences identified “Candidatus Cardinium hertigii” from group C, which has previously been identified in Culicoides from Japan, Israel, and the United Kingdom. Wolbachia strains detected in this study showed 98 to 99% sequence identity to Wolbachia previously detected from Culicoides based on the 16S rRNA gene, whereas a strain with a novel wsp sequence was identified in Culicoides narrabeenensis. Cardinium isolates grouped to geographical regions independent of the host Culicoides species, suggesting possible geographical barriers to Cardinium movement. Screening also identified Asaia bacteria in Culicoides. These findings point to a diversity of low-level endosymbiont infections in Culicoides, providing candidates for further characterization and highlighting the widespread occurrence of these endosymbionts in this insect group. PMID:26150447

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Lysine acetylation stoichiometry and proteomics analyses reveal pathways regulated by sirtuin 1 in human cells.

PubMed

Gil, Jeovanis; Ramírez-Torres, Alberto; Chiappe, Diego; Luna-Peñaloza, Juan; Fernandez-Reyes, Francis C; Arcos-Encarnación, Bolivar; Contreras, Sandra; Encarnación-Guevara, Sergio

2017-11-03

Lysine acetylation is a widespread posttranslational modification affecting many biological pathways. Recent studies indicate that acetylated lysine residues mainly exhibit low acetylation occupancy, but challenges in sample preparation and analysis make it difficult to confidently assign these numbers, limiting understanding of their biological significance. Here, we tested three common sample preparation methods to determine their suitability for assessing acetylation stoichiometry in three human cell lines, identifying the acetylation occupancy in more than 1,300 proteins from each cell line. The stoichiometric analysis in combination with quantitative proteomics also enabled us to explore their functional roles. We found that higher abundance of the deacetylase sirtuin 1 (SIRT1) correlated with lower acetylation occupancy and lower levels of ribosomal proteins, including those involved in ribosome biogenesis and rRNA processing. Treatment with the SIRT1 inhibitor EX-527 confirmed SIRT1's role in the regulation of pre-rRNA synthesis and processing. Specifically, proteins involved in pre-rRNA transcription, including subunits of the polymerase I and SL1 complexes and the RNA polymerase I-specific transcription initiation factor RRN3, were up-regulated after SIRT1 inhibition. Moreover, many protein effectors and regulators of pre-rRNA processing needed for rRNA maturation were also up-regulated after EX-527 treatment with the outcome that pre-rRNA and 28S rRNA levels also increased. More generally, we found that SIRT1 inhibition down-regulates metabolic pathways, including glycolysis and pyruvate metabolism. Together, these results provide the largest data set thus far of lysine acetylation stoichiometry (available via ProteomeXchange with identifier PXD005903) and set the stage for further biological investigations of this central posttranslational modification. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Variations in gut microbiota and fecal metabolic phenotype associated with depression by 16S rRNA gene sequencing and LC/MS-based metabolomics.

PubMed

Yu, Meng; Jia, Hongmei; Zhou, Chao; Yang, Yong; Zhao, Yang; Yang, Maohua; Zou, Zhongmei

2017-05-10

As a prevalent, life-threatening and highly recurrent psychiatric illness, depression is characterized by a wide range of pathological changes; however, its etiology remains incompletely understood. Accumulating evidence supports that gut microbiota affects not only gastrointestinal physiology but also central nervous system (CNS) function and behavior through the microbiota-gut-brain axis. To assess the impact of gut microbiota on fecal metabolic phenotype in depressive conditions, an integrated approach of 16S rRNA gene sequencing combined with ultra high-performance liquid chromatography-mass spectrometry (UHPLC-MS) based metabolomics was performed in chronic variable stress (CVS)-induced depression rat model. Interestingly, depression led to significant gut microbiota changes, at the phylum and genus levels in rats treated with CVS compared to controls. The relative abundances of the bacterial genera Marvinbryantia, Corynebacterium, Psychrobacter, Christensenella, Lactobacillus, Peptostreptococcaceae incertae sedis, Anaerovorax, Clostridiales incertae sedis and Coprococcus were significantly decreased, whereas Candidatus Arthromitus and Oscillibacter were markedly increased in model rats compared with normal controls. Meanwhile, distinct changes in fecal metabolic phenotype of depressive rats were also found, including lower levels of amino acids, and fatty acids, and higher amounts of bile acids, hypoxanthine and stercobilins. Moreover, there were substantial associations of perturbed gut microbiota genera with the altered fecal metabolites, especially compounds involved in the metabolism of tryptophan and bile acids. These results showed that the gut microbiota was altered in association with fecal metabolism in depressive conditions. These findings suggest that the 16S rRNA gene sequencing and LC-MS based metabolomics approach can be further applied to assess pathogenesis of depression. Copyright © 2017 Elsevier B.V. All rights reserved.

Ribosomal RNA gene detection and targeted culture of novel nitrogen-responsive fungal taxa from temperate pine forest soil.

PubMed

Hesse, Cedar N; Torres-Cruz, Terry J; Tobias, Terri Billingsley; Al-Matruk, Maryam; Porras-Alfaro, Andrea; Kuske, Cheryl R

Soil fungal communities are responsible for carbon and nitrogen (N) cycling. The high complexity of the soil fungal community and the high proportion of taxonomically unidentifiable sequences confound ecological interpretations in field studies because physiological information is lacking for many organisms known only by their rRNA sequences. This situation forces experimental comparisons to be made at broader taxonomic racks where functions become difficult to infer. The objective of this study was to determine OTU (operational taxonomic units) level responses of the soil fungal community to N enrichment in a temperate pine forest experiment and to use the sequencing data to guide culture efforts of novel N-responsive fungal taxa. Replicate samples from four soil horizons (up to 10 cm depth) were obtained from ambient, enriched CO 2 and N-fertilization plots. Through a fungal large subunit rRNA gene (LSU) sequencing survey, we identified two novel fungal clades that were abundant in our soil sampling (representing up to 27% of the sequences in some samples) and responsive to changes in soil N. The two N-responsive taxa with no predicted taxonomic association were targeted for isolation and culturing from specific soil samples where their sequences were abundant. Representatives of both OTUs were successfully cultured using a filtration approach. One taxon (OTU6) was most closely related to Saccharomycotina; the second taxon (OTU69) was most closely related to Mucoromycotina. Both taxa likely represent novel species. This study shows how observation of specific OTUs level responses to altered N status in a large rRNA gene field survey provided the impetus to design targeted culture approaches for isolation of novel N-responsive fungal taxa.

A taxonomic framework for cable bacteria and proposal of the candidate genera Electrothrix and Electronema.

PubMed

Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas

2016-07-01

Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.

Desulfovibrio tunisiensis sp. nov., a novel weakly halotolerant, sulfate-reducing bacterium isolated from exhaust water of a Tunisian oil refinery.

PubMed

Ben Ali Gam, Zouhaier; Oueslati, Ridha; Abdelkafi, Slim; Casalot, Laurence; Tholozan, Jean Luc; Labat, Marc

2009-05-01

A novel weakly halotolerant, sulfate-reducing bacterium, designated strain RB22(T), was isolated from exhaust water of a Tunisian oil refinery. Cells of strain RB22(T) were Gram-negative, motile, vibrio-shaped or sigmoid and non-spore-forming, and occurred singly or in chains. Strain RB22(T) grew between 15 and 45 degrees C (optimum, 37 degrees C) and at pH 4.5 to 9 (optimum, pH 7). NaCl was not required for growth, but the strain tolerated high NaCl concentrations (up to 70 g l(-1)) with an optimum of 40 g l(-1). Sulfate, thiosulfate, sulfite and elemental sulfur served as electron acceptors, but not fumarate. Nitrate and nitrite were not reduced. Strain RB22(T) utilized lactate, formate, fumarate, succinate, glycerol, H(2)+CO(2) and methanol as substrates. The DNA G+C content was found to be 59.6 mol%. Phylogenetic analysis based on the 16S rRNA gene revealed that the isolate was a member of the genus Desulfovibrio, with no close relatives at the species level (16S rRNA gene sequence similarity of less than 95 %). Strain RB22(T) exhibited levels of 16S rRNA gene sequence similarity of 94.6 and 94.12 % to the type strains of the closely related species Desulfovibrio aespoeensis and Desulfovibrio dechloracetivorans, respectively. On the basis of genotypic and phylogenetic characteristics, and significant phenotypic differences, we suggest that strain RB22(T) represents a novel species, for which the name Desulfovibrio tunisiensis sp. nov. is proposed. The type strain is RB22(T) (=NCIMB 14400(T)=JCM 15076(T)=DSM 19275(T)).

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

PubMed

Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

2014-10-17

RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Analysis of the gut microbiome in beef cattle and its association with feed intake, growth, and efficiency

USDA-ARS?s Scientific Manuscript database

Next-generation sequencing has taken a central role in studies of microbial ecology, especially with regard to culture-independent methods based on molecular phylogenies of the small-subunit ribosomal RNA gene (16S rRNA gene). The ability to relate trends at the species or genus level to host/envir...

CARM1 modulators affect epigenome of stem cells and change morphology of nucleoli.

PubMed

Franek, M; Legartová, S; Suchánková, J; Milite, C; Castellano, S; Sbardella, G; Kozubek, S; Bártová, E

2015-01-01

CARM1 interacts with numerous transcription factors to mediate cellular processes, especially gene expression. This is important for the maintenance of ESC pluripotency or intervention to tumorigenesis. Here, we studied epigenomic effects of two potential CARM1 modulators: an activator (EML159) and an inhibitor (ellagic acid dihydrate, EA). We examined nuclear morphology in human and mouse embryonic stem cells (hESCs, mESCs), as well as in iPS cells. The CARM1 modulators did not function similarly in all cell types. EA decreased the levels of the pluripotency markers, OCT4 and NANOG, particularly in iPSCs, whereas the levels of these proteins increased after EML159 treatment. EML159 treatment of mouse ESCs led to decreased levels of OCT4 and NANOG, which was accompanied by an increased level of Endo-A. The same trend was observed for NANOG and Endo-A in hESCs affected by EML159. Interestingly, EA mainly changed epigenetic features of nucleoli because a high level of arginine asymmetric di-methylation in the nucleoli of hESCs was reduced after EA treatment. ChIP-PCR of ribosomal genes confirmed significantly reduced levels of H3R17me2a, in both the promoter region of ribosomal genes and rDNA encoding 28S rRNA, after EA addition. Moreover, EA treatment changed the nuclear pattern of AgNORs (silver-stained nucleolus organizer regions) in all cell types studied. In EA-treated ESCs, AgNOR pattern was similar to the pattern of AgNORs after inhibition of RNA pol I by actinomycin D. Together, inhibitory effect of EA on arginine methylation and effect on related morphological parameters was especially observed in compartment of nucleoli.

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

NASA Technical Reports Server (NTRS)

Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

1987-01-01

A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

NASA Technical Reports Server (NTRS)

Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

1994-01-01

When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Morphometric and molecular data on two mitochondrial genes of a newly discovered chimaeran fish ( Hydrolagus melanophasma, Chondrichthyes)

NASA Astrophysics Data System (ADS)

De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio

2012-06-01

Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.