25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

NASA Technical Reports Server (NTRS)

Baharaeen, S.; Vishniac, H. S.

1984-01-01

Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

Transposition of an intron in yeast mitochondria requires a protein encoded by that intron.

PubMed

Macreadie, I G; Scott, R M; Zinn, A R; Butow, R A

1985-06-01

The optional 1143 bp intron in the yeast mitochondrial 21S rRNA gene (omega +) is nearly quantitatively inserted in genetic crosses into 21S rRNA alleles that lack it (omega -). The intron contains an open reading frame that can encode a protein of 235 amino acids, but no function has been ascribed to this sequence. We previously found an in vivo double-strand break in omega - DNA at or close to the intron insertion site only in zygotes of omega + X omega - crosses that appears with the same kinetics as intron insertion. We now show that mutations in the intron open reading frame that would alter the translation product simultaneously inhibit nonreciprocal omega recombination and the in vivo double-strand break in omega - DNA. These results provide evidence that the open reading frame encodes a protein required for intron transposition and support the role of the double-strand break in the process.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

The microbial diversity of an industrially produced lambic beer shares members of a traditionally produced one and reveals a core microbiota for lambic beer fermentation.

PubMed

Spitaels, Freek; Wieme, Anneleen D; Janssens, Maarten; Aerts, Maarten; Van Landschoot, Anita; De Vuyst, Luc; Vandamme, Peter

2015-08-01

The microbiota involved in lambic beer fermentations in an industrial brewery in West-Flanders, Belgium, was determined through culture-dependent and culture-independent techniques. More than 1300 bacterial and yeast isolates from 13 samples collected during a one-year fermentation process were identified using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry followed by sequence analysis of rRNA and various protein-encoding genes. The bacterial and yeast communities of the same samples were further analyzed using denaturing gradient gel electrophoresis of PCR-amplified V3 regions of the 16S rRNA genes and D1/D2 regions of the 26S rRNA genes, respectively. In contrast to traditional lambic beer fermentations, there was no Enterobacteriaceae phase and a larger variety of acetic acid bacteria were found in industrial lambic beer fermentations. Like in traditional lambic beer fermentations, Saccharomyces cerevisiae, Saccharomyces pastorianus, Dekkera bruxellensis and Pediococcus damnosus were the microorganisms responsible for the main fermentation and maturation phases. These microorganisms originated most probably from the wood of the casks and were considered as the core microbiota of lambic beer fermentations. Copyright © 2015 Elsevier Ltd. All rights reserved.

House microbiotas as sources of lactic acid bacteria and yeasts in traditional Italian sourdoughs.

PubMed

Minervini, Fabio; Lattanzi, Anna; De Angelis, Maria; Celano, Giuseppe; Gobbetti, Marco

2015-12-01

This study aimed at understanding the extent of contamination by lactic acid bacteria (LAB) and yeasts from the house microbiotas during sourdough back-slopping. Besides sourdoughs, wall, air, storage box, dough mixer and flour of four bakeries were analyzed. Based on plate counts, LAB and yeasts dominated the house microbiota. Based on high throughput sequencing of the 16S rRNA genes, flour harbored the highest number of Firmicutes, but only few of them adapted to storage box, dough mixer and sourdough. Lactobacillus sanfranciscensis showed the highest abundance in dough mixer and sourdoughs. Lactobacillus plantarum persisted only in storage box, dough mixer and sourdough of two bakeries. Weissella cibaria also showed higher adaptability in sourdough than in bakery equipment, suggesting that flour is the main origin of this species. Based on 18S rRNA data, Saccharomyces cerevisiae was the dominant yeast in house and sourdough microbiotas, excepted one bakery dominated by Kazachstania exigua. The results of this study suggest that the dominant species of sourdough LAB and yeasts dominated also the house microbiota. Copyright © 2015 Elsevier Ltd. All rights reserved.

Improvement of stress tolerance and leavening ability under multiple baking-associated stress conditions by overexpression of the SNR84 gene in baker's yeast.

PubMed

Lin, Xue; Zhang, Cui-Ying; Bai, Xiao-Wen; Feng, Bing; Xiao, Dong-Guang

2015-03-16

During the bread-making process, industrial baker's yeast cells are exposed to multiple baking-associated stresses, such as elevated high-temperature, high-sucrose and freeze-thaw stresses. There is a high demand for baker's yeast strains that could withstand these stresses with high leavening ability. The SNR84 gene encodes H/ACA snoRNA (small nucleolar RNA), which is known to be involved in pseudouridylation of the large subunit rRNA. However, the function of the SNR84 gene in baker's yeast coping with baking-associated stresses remains unclear. In this study, we explored the effect of SNR84 overexpression on baker's yeast which was exposed to high-temperature, high-sucrose and freeze-thaw stresses. These results suggest that overexpression of the SNR84 gene conferred tolerance of baker's yeast cells to high-temperature, high-sucrose and freeze-thaw stresses and enhanced their leavening ability in high-sucrose and freeze-thaw dough. These findings could provide a valuable insight for breeding of novel stress-resistant baker's yeast strains that are useful for baking. Copyright © 2015 Elsevier B.V. All rights reserved.

Yeasts and moulds contaminants of food ice cubes and their survival in different drinks.

PubMed

Francesca, N; Gaglio, R; Stucchi, C; De Martino, S; Moschetti, G; Settanni, L

2018-01-01

To evaluate the levels of unicellular and filamentous fungi in ice cubes produced at different levels and to determine their survival in alcoholic beverages and soft drinks. Sixty samples of ice cubes collected from home level (HL) productions, bars and pubs (BP) and industrial manufacturing plants (MP) were investigated for the presence and cell density of yeasts and moulds. Moulds were detected in almost all samples, while yeasts developed from the majority of HL and MP samples. Representative colonies of microfungi were subjected to phenotypic and genotypic characterization. The identification was carried out by restriction fragment length polymorphism (RFLP) analysis of the region spanning the internal transcribed spacers (ITS1 and ITS2) and the 5·8S rRNA gene. The process of yeast identification was concluded by sequencing the D1/D2 region of the 26S rRNA gene. The fungal biodiversity associated with food ice was represented by nine yeast and nine mould species. Strains belonging to Candida parapsilosis and Cryptococcus curvatus, both opportunistic human pathogens, and Penicillium glabrum, an ubiquitous mould in the ice samples analysed, were selected to evaluate the effectiveness of the ice cubes to transfer pathogenic microfungi to consumers, after addition to alcoholic beverages and soft drinks. All strains retained their viability. The survival test indicated that the most common mode of consumption of ice cubes, through its direct addition to drinks and beverages, did not reduce the viability of microfungi. This study evidenced the presence of microfungi in food ice and ascertained their survival in soft drinks and alcoholic beverages. © 2017 The Society for Applied Microbiology.

Beyond tRNA cleavage: novel essential function for yeast tRNA splicing endonuclease unrelated to tRNA processing

PubMed Central

Dhungel, Nripesh; Hopper, Anita K.

2012-01-01

Pre-tRNA splicing is an essential process in all eukaryotes. In yeast and vertebrates, the enzyme catalyzing intron removal from pre-tRNA is a heterotetrameric complex (splicing endonuclease [SEN] complex). Although the SEN complex is conserved, the subcellular location where pre-tRNA splicing occurs is not. In yeast, the SEN complex is located at the cytoplasmic surface of mitochondria, whereas in vertebrates, pre-tRNA splicing is nuclear. We engineered yeast to mimic the vertebrate cell biology and demonstrate that all three steps of pre-tRNA splicing, as well as tRNA nuclear export and aminoacylation, occur efficiently when the SEN complex is nuclear. However, nuclear pre-tRNA splicing fails to complement growth defects of cells with defective mitochondrial-located splicing, suggesting that the yeast SEN complex surprisingly serves a novel and essential function in the cytoplasm that is unrelated to tRNA splicing. The novel function requires all four SEN complex subunits and the catalytic core. A subset of pre-rRNAs accumulates when the SEN complex is restricted to the nucleus, indicating that the SEN complex moonlights in rRNA processing. Thus, findings suggest that selection for the subcellular distribution of the SEN complex may reside not in its canonical, but rather in a novel, activity. PMID:22391451

Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

PubMed

Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

2014-02-01

Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

PubMed Central

Mills, David A.; Johannsen, Eric A.; Cocolin, Luca

2002-01-01

Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytis-affected (“botrytized”) wine fermentations carried out at high (∼30°C) and ambient (∼20°C) temperatures. Fermentations at both temperatures possessed similar populations of Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel electrophoresis profiles of yeast ribosomal DNA or rRNA amplified from the fermentation samples correlated well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population not identified in the plating analysis. rRNA analysis also indicated a large population (>106 cells per ml) of a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in fermentations containing higher populations of Candida. Analysis of wine fermentation microbial ecology by using both culture-dependent and -independent methods reveals the complexity of yeast interactions enriched during spontaneous fermentations. PMID:12324335

Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

PubMed Central

Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

2007-01-01

Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

Assessment of the yeast species composition of cocoa bean fermentations in different cocoa-producing regions using denaturing gradient gel electrophoresis.

PubMed

Papalexandratou, Zoi; De Vuyst, Luc

2011-11-01

The yeast species composition of 12 cocoa bean fermentations carried out in Brazil, Ecuador, Ivory Coast and Malaysia was investigated culture-independently. Denaturing gradient gel electrophoresis of 26S rRNA gene fragments, obtained through polymerase chain reaction with universal eukaryotic primers, was carried out with two different commercial apparatus (the DCode and CBS systems). In general, this molecular method allowed a rapid monitoring of the yeast species prevailing during fermentation. Under similar and optimal denaturing gradient gel electrophoresis conditions, the CBS system allowed a better separated band pattern than the DCode system and an unambiguous detection of the prevailing species present in the fermentation samples. The most frequent yeast species were Hanseniaspora sp., followed by Pichia kudriavzevii and Saccharomyces cerevisiae, independent of the origin of the cocoa. This indicates a restricted yeast species composition of the cocoa bean fermentation process. Exceptionally, the Ivorian cocoa bean box fermentation samples showed a wider yeast species composition, with Hyphopichia burtonii and Meyerozyma caribbica among the main representatives. Yeasts were not detected in the samples when the temperature inside the fermenting cocoa pulp-bean mass reached values higher than 45 °C or under early acetic acid production conditions. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Real-Time PCR Assay for Detection and Enumeration of Dekkera bruxellensis in Wine

PubMed Central

Phister, Trevor G.; Mills, David A.

2003-01-01

Traditional methods to detect the spoilage yeast Dekkera bruxellensis from wine involve lengthy enrichments. To overcome this difficulty, we developed a quantitative real-time PCR method to directly detect and enumerate D. bruxellensis in wine. Specific PCR primers to D. bruxellensis were designed to the 26S rRNA gene, and nontarget yeast and bacteria common to the winery environment were not amplified. The assay was linear over a range of cell concentrations (6 log units) and could detect as little as 1 cell per ml in wine. The addition of large amounts of nontarget yeasts did not impact the efficiency of the assay. This method will be helpful to identify possible routes of D. bruxellensis infection in winery environments. Moreover, the time involved in performing the assay (3 h) should enable winemakers to more quickly make wine processing decisions in order to reduce the threat of spoilage by D. bruxellensis. PMID:14660395

Three new anascosporic genera of the Saccharomycotina: Danielozyma gen. nov., Deakozyma gen. nov. and Middelhovenomyces gen. nov.

USDA-ARS?s Scientific Manuscript database

Three new non-ascosporic, ascomycetous yeast genera are proposed based on their isolation from currently described species and genera. Phylogenetic placement of the genera was determined from analysis of nuclear gene sequences for D1/D2 large subunit rRNA, small subunit rRNA, translation elongation...

Candida xinjiangensis sp. nov., a new anamorphic yeast species isolated from Scolytus scheryrewi Semenov in China.

PubMed

Zhu, Xiao-Feng; Zhang, Dian-Peng; Yang, Sen; Zhang, Qing-Wen

2017-03-01

Three yeast strains designated as S44, XF1 and XF2, respectively, were isolated from Scolytus scheryrewi Semenov of apricot tree in Shule County, Xinjiang, China, and were demonstrated to be a new member of the genus Candida by sequence comparisons of 26S rRNA gene D1/D2 domain and internal transcribed spacer (ITS) region. BLASTn alignments on NCBI showed that the similarity of 26S rRNA gene sequences of S44 (type strain) to all sequences of other Candida yeasts was very low (≦93 %). The phylogenetic tree based on the 26S rRNA gene D1/D2 domain and ITS region sequences revealed that the strain S44 is closely related to C. blattae, C. dosseyi, C. pruni, C. asparagi, C. fructus and C. musae. However, the strain S44 is distinguished from these Candida species by the physiological characteristics. Moreover, the strain S44 formed typical pseudohyphae when grown on cornmeal agar at 25 °C for 7 days, but did not form ascospores in sporulation medium for 3-4 weeks. Therefore, the name Candida xinjiangensis is proposed for the novel species, with S44 (=KCTC T 27747) as the type strain.

Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov., four anamorphic, ascomycetous yeast species isolated from soil in Taiwan.

PubMed

Liu, Chun-Hao; Young, Shuh-Sen; Chang, Tsung-Chain; Lee, Ching-Fu

2008-08-01

Nine anamorphic, ascomycetous yeast strains belonging to the Pichia anomala clade were recovered from forest soil in 2006 in Taiwan. The nine yeast strains represent four novel yeast species based on the sequences of their D1/D2 domain of the large subunit (LSU) rRNA gene and their physiological characteristics. The scientific names of Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov. are proposed for these novel yeast species. The type strains are C. dajiaensis SM11S03(T) (=CBS 10590(T)=BCRC 23099(T)), C. yuanshanicus SY3S02(T) (=CBS 10589(T)=BCRC 23100(T)), C. jianshihensis SM8S04(T) (=CBS 10591(T)=BCRC 23096(T)), and C. sanyiensis SA1S06(T) (=CBS 10592(T)=BCRC 23094(T)). Sequence analysis of the D1/D2 of the LSU rRNA gene revealed that the three species, C. dajiaensis, C. yuanshanicus and Pichia onychis, shared a separate branch in the phylogenetic tree, C. jianshihensis is phylogenetically related to Candida ulmi and Pichia alni, and the phylogenetically closest relative of C. sanyiensis is Pichia populi.

Characterization of a new clinical yeast species, Candida tunisiensis sp. nov., isolated from a strain collection from Tunisian hospitals.

PubMed

Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed; Sanglard, Dominique

2013-01-01

From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches.

Characterization of a New Clinical Yeast Species, Candida tunisiensis sp. nov., Isolated from a Strain Collection from Tunisian Hospitals

PubMed Central

Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed

2013-01-01

From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches. PMID:23077122

Among-Population Variation in Microbial Community Structure in the Floral Nectar of the Bee-Pollinated Forest Herb Pulmonaria officinalis L

PubMed Central

Jacquemyn, Hans; Lenaerts, Marijke; Brys, Rein; Willems, Kris; Honnay, Olivier; Lievens, Bart

2013-01-01

Background Microbial communities in floral nectar have been shown to be characterized by low levels of species diversity, yet little is known about among-plant population variation in microbial community composition. Methodology/Principal Findings We investigated the microbial community structure (yeasts and bacteria) in floral nectar of ten fragmented populations of the bee-pollinated forest herb Pulmonaria officinalis. We also explored possible relationships between plant population size and microbial diversity in nectar, and related microbial community composition to the distance separating plant populations. Culturable bacteria and yeasts occurring in the floral nectar of a total of 100 plant individuals were isolated and identified by partially sequencing the 16S rRNA gene and D1/D2 domains of the 26S rRNA gene, respectively. A total of 9 and 11 yeast and 28 and 39 bacterial OTUs was found, taking into account a 3% (OTU0.03) and 1% sequence dissimilarity cut-off (OTU0.01). OTU richness at the plant population level (i.e. the number of OTUs per population) was low for yeasts (mean: 1.7, range: 0–4 OTUs0.01/0.03 per population), whereas on average 6.9 (range: 2–13) OTUs0.03 and 7.9 (range 2–16) OTUs0.01 per population were found for bacteria. Both for yeasts and bacteria, OTU richness was not significantly related to plant population size. Similarity in community composition among populations was low (average Jaccard index: 0.14), and did not decline with increasing distance between populations. Conclusions/Significance We found low similarity in microbial community structure among populations, suggesting that the assembly of nectar microbiota is to a large extent context-dependent. Although the precise factors that affect variation in microbial community structure in floral nectar require further study, our results indicate that both local and regional processes may contribute to among-population variation in microbial community structure in nectar. PMID:23536759

Among-population variation in microbial community structure in the floral nectar of the bee-pollinated forest herb Pulmonaria officinalis L.

PubMed

Jacquemyn, Hans; Lenaerts, Marijke; Brys, Rein; Willems, Kris; Honnay, Olivier; Lievens, Bart

2013-01-01

Microbial communities in floral nectar have been shown to be characterized by low levels of species diversity, yet little is known about among-plant population variation in microbial community composition. We investigated the microbial community structure (yeasts and bacteria) in floral nectar of ten fragmented populations of the bee-pollinated forest herb Pulmonaria officinalis. We also explored possible relationships between plant population size and microbial diversity in nectar, and related microbial community composition to the distance separating plant populations. Culturable bacteria and yeasts occurring in the floral nectar of a total of 100 plant individuals were isolated and identified by partially sequencing the 16S rRNA gene and D1/D2 domains of the 26S rRNA gene, respectively. A total of 9 and 11 yeast and 28 and 39 bacterial OTUs was found, taking into account a 3% (OTU0.03) and 1% sequence dissimilarity cut-off (OTU0.01). OTU richness at the plant population level (i.e. the number of OTUs per population) was low for yeasts (mean: 1.7, range: 0-4 OTUs0.01/0.03 per population), whereas on average 6.9 (range: 2-13) OTUs0.03 and 7.9 (range 2-16) OTUs0.01 per population were found for bacteria. Both for yeasts and bacteria, OTU richness was not significantly related to plant population size. Similarity in community composition among populations was low (average Jaccard index: 0.14), and did not decline with increasing distance between populations. We found low similarity in microbial community structure among populations, suggesting that the assembly of nectar microbiota is to a large extent context-dependent. Although the precise factors that affect variation in microbial community structure in floral nectar require further study, our results indicate that both local and regional processes may contribute to among-population variation in microbial community structure in nectar.

Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape.

PubMed

Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

2015-01-01

Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking.

Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape

PubMed Central

Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

2015-01-01

Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking. PMID:26413065

rRNA fragmentation induced by a yeast killer toxin.

PubMed

Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

2014-02-01

Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Four new species of Metschnikowia and the transfer of seven Candida species to Metschnikowia and Clavispora as new combinations

USDA-ARS?s Scientific Manuscript database

From comparisons of ITS1-5.8S-ITS2 and gene sequences for nuclear D1/D2 LSU rRNA, nuclear SSU (18S) rRNA, translation elongation factor 1-a (EF1-a) and RNA polymerase II subunit 2 (RPB2), the following four new ascosporogenous yeast species were resolved and are described as Metschnikowia anglica (N...

Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

PubMed

Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

2016-01-01

Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard ecosystem, which contains yeasts from different species. The description of this yeast diversity will lead to the selection of native microbiota that can be used to produce quality wines with the characteristics of the Priorat.

Five novel Wickerhamomyces- and Metschnikowia-related yeast species, Wickerhamomyces chaumierensis sp. nov., Candida pseudoflosculorum sp. nov., Candida danieliae sp. nov., Candida robnettiae sp. nov. and Candida eppingiae sp. nov., isolated from plants.

PubMed

Groenewald, Marizeth; Robert, Vincent; Smith, Maudy Th

2011-08-01

On the basis of nucleotide divergences in the D1/D2 domain of the 26S rRNA gene and the internal transcribed spacers (ITS) domain of the rRNA gene, five novel yeast species, Wickerhamomyces chaumierensis sp. nov. (CBS 8565(T)  = JCM 17246(T)), Candida pseudoflosculorum sp. nov. (CBS 8584(T)  = JCM 17242(T)), Candida danieliae sp. nov. (CBS 8533(T)  = JCM 17247(T)), Candida robnettiae sp. nov. (CBS 8580(T)  = JCM 17243(T)) and Candida eppingiae sp. nov. (CBS 8586(T)  = JCM 17241(T)), isolated from plants in Thailand and Guyana, are proposed in this study.

Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.

PubMed

Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

2010-11-15

The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO₂ and temperature) useful for industrial application. Copyright © 2010 Elsevier B.V. All rights reserved.

Apoptotic signals induce specific degradation of ribosomal RNA in yeast

PubMed Central

Mroczek, Seweryn; Kufel, Joanna

2008-01-01

Organisms exposed to reactive oxygen species, generated endogenously during respiration or by environmental conditions, undergo oxidative stress. Stress response can either repair the damage or activate one of the programmed cell death (PCD) mechanisms, for example apoptosis, and finally end in cell death. One striking characteristic, which accompanies apoptosis in both vertebrates and yeast, is a fragmentation of cellular DNA and mammalian apoptosis is often associated with degradation of different RNAs. We show that in yeast exposed to stimuli known to induce apoptosis, such as hydrogen peroxide, acetic acid, hyperosmotic stress and ageing, two large subunit ribosomal RNAs, 25S and 5.8S, became extensively degraded with accumulation of specific intermediates that differ slightly depending on cell death conditions. This process is most likely endonucleolytic, is correlated with stress response, and depends on the mitochondrial respiratory status: rRNA is less susceptible to degradation in respiring cells with functional defence against oxidative stress. In addition, RNA fragmentation is independent of two yeast apoptotic factors, metacaspase Yca1 and apoptosis-inducing factor Aif1, but it relies on the apoptotic chromatin condensation induced by histone H2B modifications. These data describe a novel phenotype for certain stress- and ageing-related PCD pathways in yeast. PMID:18385160

Rrp5p, Noc1p and Noc2p form a protein module which is part of early large ribosomal subunit precursors in S. cerevisiae

PubMed Central

Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert

2013-01-01

Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026

Yeast community in traditional Portuguese Serpa cheese by culture-dependent and -independent DNA approaches.

PubMed

Gonçalves Dos Santos, Maria Teresa P; Benito, María José; Córdoba, María de Guía; Alvarenga, Nuno; Ruiz-Moyano Seco de Herrera, Santiago

2017-12-04

This study investigated the yeast community present in the traditional Portuguese cheese, Serpa, by culture-dependent and -independent methods. Sixteen batches of Serpa cheeses from various regional industries registered with the Protected Designation of Origin (PDO) versus non-PDO registered, during spring and winter, were used. Irrespective of the producer, the yeast counts were around 5log CFU/g in winter and, overall, were lower in spring. The yeast species identified at the end of ripening (30days), using PCR-RFLP analysis and sequencing of the 26S rRNA, mainly corresponded to Debaryomyces hansenii and Kluyveromyces marxianus, with Candida spp. and Pichia spp. present to a lesser extent. The culture-independent results, obtained using high-throughput sequencing analysis, confirmed the prevalence of Debaryomyces spp. and Kluyveromyces spp. but, also, that Galactomyces spp. was relevant for three of the five producers, which indicates its importance during the early stages of the cheese ripening process, considering it was not found among the dominant viable yeast species. In addition, differences between the identified yeast isolated from cheeses obtained from PDO and non-PDO registered industries, showed that the lack of regulation of the cheese-making practice, may unfavourably influence the final yeast microbiota. The new knowledge provided by this study of the yeast diversity in Serpa cheese, could be used to modify the cheese ripening conditions, to favour desirable yeast species. Additionally, the prevalent yeast isolates identified, Debaryomyces hansenii and Kluyveromyces spp., may have an important role during cheese ripening and in the final sensorial characteristics. Thus, the study of their technological and functional properties could be relevant, in the development of an autochthonous starter culture, to ensure final quality and safety of the cheese. Copyright © 2017 Elsevier B.V. All rights reserved.

Conserved Regulators of Nucleolar Size Revealed by Global Phenotypic Analyses

PubMed Central

Neumüller, Ralph A.; Gross, Thomas; Samsonova, Anastasia A.; Vinayagam, Arunachalam; Buckner, Michael; Founk, Karen; Hu, Yanhui; Sharifpoor, Sara; Rosebrock, Adam P.; Andrews, Brenda; Winston, Fred; Perrimon, Norbert

2014-01-01

Regulation of cell growth is a fundamental process in development and disease that integrates a vast array of extra- and intracellular information. A central player in this process is RNA polymerase I (Pol I), which transcribes ribosomal RNA (rRNA) genes in the nucleolus. Rapidly growing cancer cells are characterized by increased Pol I–mediated transcription and, consequently, nucleolar hypertrophy. To map the genetic network underlying the regulation of nucleolar size and of Pol I–mediated transcription, we performed comparative, genome-wide loss-of-function analyses of nucleolar size in Saccharomyces cerevisiae and Drosophila melanogaster coupled with mass spectrometry–based analyses of the ribosomal DNA (rDNA) promoter. With this approach, we identified a set of conserved and nonconserved molecular complexes that control nucleolar size. Furthermore, we characterized a direct role of the histone information regulator (HIR) complex in repressing rRNA transcription in yeast. Our study provides a full-genome, cross-species analysis of a nuclear subcompartment and shows that this approach can identify conserved molecular modules. PMID:23962978

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

The Carboxy-Terminal Domain of Erb1 Is a Seven-Bladed ß-Propeller that Binds RNA

PubMed Central

Marcin, Wegrecki; Neira, Jose Luis; Bravo, Jeronimo

2015-01-01

Erb1 (Eukaryotic Ribosome Biogenesis 1) protein is essential for the maturation of the ribosomal 60S subunit. Functional studies in yeast and mammalian cells showed that altogether with Nop7 and Ytm1 it forms a stable subcomplex called PeBoW that is crucial for a correct rRNA processing. The exact function of the protein within the process remains unknown. The N-terminal region of the protein includes a well conserved region shown to be involved in PeBoW complex formation whereas the carboxy-terminal half was predicted to contain seven WD40 repeats. This first structural report on Erb1 from yeast describes the architecture of a seven-bladed β-propeller domain that revealed a characteristic extra motif formed by two α-helices and a β-strand that insert within the second WD repeat. We performed analysis of molecular surface and crystal packing, together with multiple sequence alignment and comparison of the structure with other β-propellers, in order to identify areas that are more likely to mediate protein-protein interactions. The abundance of many positively charged residues on the surface of the domain led us to investigate whether the propeller of Erb1 might be involved in RNA binding. Three independent assays confirmed that the protein interacted in vitro with polyuridilic acid (polyU), thus suggesting a possible role of the domain in rRNA rearrangement during ribosome biogenesis. PMID:25880847

NOP132 is required for proper nucleolus localization of DEAD-box RNA helicase DDX47

PubMed Central

Sekiguchi, Takeshi; Hayano, Toshiya; Yanagida, Mitsuaki; Takahashi, Nobuhiro; Nishimoto, Takeharu

2006-01-01

Previously, we described a novel nucleolar protein, NOP132, which interacts with the small GTP binding protein RRAG A. To elucidate the function of NOP132 in the nucleolus, we identified proteins that interact with NOP132 using mass spectrometric methods. NOP132 associated mainly with proteins involved in ribosome biogenesis and RNA metabolism, including the DEAD-box RNA helicase protein, DDX47, whose yeast homolog is Rrp3, which has roles in pre-rRNA processing. Immunoprecipitation of FLAG-tagged DDX47 co-precipitated rRNA precursors, as well as a number of proteins that are probably involved in ribosome biogenesis, implying that DDX47 plays a role in pre-rRNA processing. Introduction of NOP132 small interfering RNAs induced a ring-like localization of DDX47 in the nucleolus, suggesting that NOP132 is required for the appropriate localization of DDX47 within the nucleolus. We propose that NOP132 functions in the recruitment of pre-rRNA processing proteins, including DDX47, to the region where rRNA is transcribed within the nucleolus. PMID:16963496

Characterization of Osmotolerant Yeasts and Yeast-Like Molds from Apple Orchards and Apple Juice Processing Plants in China and Investigation of Their Spoilage Potential.

PubMed

Wang, Huxuan; Hu, Zhongqiu; Long, Fangyu; Niu, Chen; Yuan, Yahong; Yue, Tianli

2015-08-01

Yeasts and yeast-like fungal isolates were recovered from apple orchards and apple juice processing plants located in the Shaanxi province of China. The strains were evaluated for osmotolerance by growing them in 50% (w/v) glucose. Of the strains tested, 66 were positive for osmotolerance and were subsequently identified by 26S or 5.8S-ITS ribosomal RNA (rRNA) gene sequencing. Physiological tests and RAPD-PCR analysis were performed to reveal the polymorphism of isolates belonging to the same species. Further, the spoilage potential of the 66 isolates was determining by evaluating their growth in 50% to 70% (w/v) glucose and measuring gas generation in 50% (w/v) glucose. Thirteen osmotolerant isolates representing 9 species were obtained from 10 apple orchards and 53 target isolates representing 19 species were recovered from 2 apple juice processing plants. In total, members of 14 genera and 23 species of osmotolerant isolates including yeast-like molds were recovered from all sources. The commonly recovered osmotolerant isolates belonged to Kluyveromyces marxianus, Hanseniaspora uvarum, Saccharomyces cerevisiae, Zygosaccharomyces rouxii, Candida tropicalis, and Pichia kudriavzevii. The polymorphism of isolates belonging to the same species was limited to 1 to 3 biotypes. The majority of species were capable of growing within a range of glucose concentration, similar to sugar concentrations found in apple juice products with a lag phase from 96 to 192 h. Overall, Z. rouxii was particularly the most tolerant to high glucose concentration with the shortest lag phase of 48 h in 70% (w/v) glucose and the fastest gas generation rate in 50% (w/v) glucose. © 2015 Institute of Food Technologists®

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing

PubMed Central

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

ABSTRACT Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

PubMed

Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

2016-01-01

Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation.

Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana

PubMed Central

Chen, Ying-Jiun C.; Wang, Huei-Jing

2016-01-01

In eukaryotic cells, ribosomal RNAs (rRNAs) are transcribed, processed, and assembled with ribosomal proteins in the nucleolus. Regulatory mechanisms of rRNA gene (rDNA) transcription and processing remain elusive in plants, especially their connection to nucleolar organization. We performed an in silico screen for essential genes of unknown function in Arabidopsis thaliana and identified Thallo (THAL) encoding a SAS10/C1D family protein. THAL disruption caused enlarged nucleoli in arrested embryos, aberrant processing of precursor rRNAs at the 5’ External Transcribed Spacer, and repression of the major rDNA variant (VAR1). THAL overexpression lines showed de-repression of VAR1 and overall reversed effects on rRNA processing sites. Strikingly, THAL overexpression also induced formation of multiple nucleoli per nucleus phenotypic of mutants of heterochromatin factors. THAL physically associated with histone chaperone Nucleolin 1 (NUC1), histone-binding NUC2, and histone demethylase Jumonji 14 (JMJ14) in bimolecular fluorescence complementation assay, suggesting that it participates in chromatin regulation. Furthermore, investigation of truncated THAL proteins revealed that the SAS10 C-terminal domain is likely important for its function in chromatin configuration. THAL also interacted with putative Small Subunit processome components, including previously unreported Arabidopsis homologue of yeast M Phase Phosphoprotein 10 (MPP10). Our results uncovering the dual role of THAL in transcription and processing events critical for proper rRNA biogenesis and nucleolar organization during reproduction are the first to define the function of SAS10/C1D family members in plants. PMID:27792779

Saccharomyces cerevisiae RNA Polymerase I Terminates Transcription at the Reb1 Terminator In Vivo

PubMed Central

Reeder, Ronald H.; Guevara, Palmira; Roan, Judith G.

1999-01-01

We have mapped transcription termination sites for RNA polymerase I in the yeast Saccharomyces cerevisiae. S1 nuclease mapping shows that the primary terminator is the Reb1p terminator located at +93 downstream of the 3′ end of 25S rRNA. Reverse transcription coupled with quantitative PCR shows that approximately 90% of all transcripts terminate at this site. Transcripts which read through the +93 site quantitatively terminate at a fail-safe terminator located further downstream at +250. Inactivation of Rnt1p (an RNase III involved in processing the 3′ end of 25S rRNA) greatly stabilizes transcripts extending to both sites and increases readthrough at the +93 site. In vivo assay of mutants of the Reb1p terminator shows that this site operates in vivo by the same mechanism as has previously been delineated through in vitro studies. PMID:10523625

Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

PubMed Central

Sharma, Kishor; Tollervey, David

1999-01-01

The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

Wickerhamomyces mori sp. nov., an anamorphic yeast species found in the guts of wood-boring insect larvae.

PubMed

Hui, Feng-Li; Chen, Liang; Chu, Xue-Ying; Niu, Qiu-Hong; Ke, Tao

2013-03-01

A novel anamorphic yeast species is described to accommodate three isolates recovered from the guts of three different wood-boring insect larvae collected in Henan, central China. On the basis of sequence analyses of the D1/D2 domains of the large-subunit rRNA gene and the internal transcribed spacer regions, the three strains are assigned to a novel species of the genus Wickerhamomyces, although the formation of ascospores was not observed. These strains also exhibited a number of distinct morphological and physiological characteristics that clearly differentiated them from Wickerhamomyces mucosus, Candida odintsovae and Wickerhamomyces rabaulensis, the most closely related species. In view of the phenotypic differences and unique rRNA gene sequences, we consider that these three isolates represent a novel species of the genus Wickerhamomyces, Wickerhamomyces mori sp. nov. The type strain is NYNU 1216(T) ( = CICC 1983(T)  = CBS 12678(T)).

Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

PubMed Central

Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

2016-01-01

Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard ecosystem, which contains yeasts from different species. The description of this yeast diversity will lead to the selection of native microbiota that can be used to produce quality wines with the characteristics of the Priorat. PMID:27379060

Yeast Reporter Assay to Identify Cellular Components of Ricin Toxin A Chain Trafficking.

PubMed

Becker, Björn; Schnöder, Tina; Schmitt, Manfred J

2016-12-06

RTA, the catalytic A-subunit of the ribosome inactivating A/B toxin ricin, inhibits eukaryotic protein biosynthesis by depurination of 28S rRNA. Although cell surface binding of ricin holotoxin is mainly mediated through its B-subunit (RTB), sole application of RTA is also toxic, albeit to a significantly lower extent, suggesting alternative pathways for toxin uptake and transport. Since ricin toxin trafficking in mammalian cells is still not fully understood, we developed a GFP-based reporter assay in yeast that allows rapid identification of cellular components required for RTA uptake and subsequent transport through a target cell. We hereby show that Ypt6p, Sft2p and GARP-complex components play an important role in RTA transport, while neither the retromer complex nor COPIB vesicles are part of the transport machinery. Analyses of yeast knock-out mutants with chromosomal deletion in genes whose products regulate ADP-ribosylation factor GTPases (Arf-GTPases) and/or retrograde Golgi-to-ER (endoplasmic reticulum) transport identified Sso1p, Snc1p, Rer1p, Sec22p, Erv46p, Gea1p and Glo3p as novel components in RTA transport, suggesting the developed reporter assay as a powerful tool to dissect the multistep processes of host cell intoxication in yeast.

Dimorphic cycle in Candida citri sp. nov., a novel yeast species isolated from rotting fruit in Borneo.

PubMed

Sipiczki, Matthias

2011-03-01

Five dimorphic yeast strains were isolated from rotting lime fruits in Borneo. The sequences of the D1/D2 domains of the 26S rRNA genes, the internal transcribed spacer (ITS) chromosomal regions and the 18S rRNA genes were identical in the isolates and differed from the corresponding sequences of all known yeast species. Based on the sequence differences (12-15% in the D1/D2 domain) from the closest relatives and the different pattern of taxonomic traits, the new isolates are assigned the status of a new species, for which the name Candida citri sp. nov. is proposed. Its type strain is 11-469(T) , which has been deposited in Centralbureau voor Schimmelcultures (Utrecht, the Netherlands) as CBS 11858(T) , Culture Collection of Yeasts (Bratislava, Slovakia) as CCY 29-181-1(T) and the National Collection of Agricultural and Industrial Microorganisms (Budapest, Hungary) as NCAIM Y.01978(T) . MycoBank number: MB 519100. The GenBank accession numbers for nucleotide sequences of its D1/D2 domain, ITS and 18S regions are HM803241, HM803242 and HM803243, respectively. Candida citri produces invasive mycelium composed of true septate hyphae that grow towards nutrient-rich parts of the medium and develop large vacuoles at the nongrowing ends of their cells. The hyphae produce blastoconidia, which can establish satellite yeast colonies in the invaded solid substrate. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Conserved composition of mammalian box H/ACA and box C/D small nucleolar ribonucleoprotein particles and their interaction with the common factor Nopp140.

PubMed

Yang, Y; Isaac, C; Wang, C; Dragon, F; Pogacic, V; Meier, U T

2000-02-01

Small nucleolar ribonucleoprotein particles (snoRNPs) mainly catalyze the modification of rRNA. The two major classes of snoRNPs, box H/ACA and box C/D, function in the pseudouridylation and 2'-O-methylation, respectively, of specific nucleotides. The emerging view based on studies in yeast is that each class of snoRNPs is composed of a unique set of proteins. Here we present a characterization of mammalian snoRNPs. We show that the previously characterized NAP57 is specific for box H/ACA snoRNPs, whereas the newly identified NAP65, the rat homologue of yeast Nop5/58p, is a component of the box C/D class. Using coimmunoprecipitation experiments, we show that the nucleolar and coiled-body protein Nopp140 interacts with both classes of snoRNPs. This interaction is corroborated in vivo by the exclusive depletion of snoRNP proteins from nucleoli in cells transfected with a dominant negative Nopp140 construct. Interestingly, RNA polymerase I transcription is arrested in nucleoli depleted of snoRNPs, raising the possibility of a feedback mechanism between rRNA modification and transcription. Moreover, the Nopp140-snoRNP interaction appears to be conserved in yeast, because depletion of Srp40p, the yeast Nopp140 homologue, in a conditional lethal strain induces the loss of box H/ACA small nucleolar RNAs. We propose that Nopp140 functions as a chaperone of snoRNPs in yeast and vertebrate cells.

Conserved Composition of Mammalian Box H/ACA and Box C/D Small Nucleolar Ribonucleoprotein Particles and Their Interaction with the Common Factor Nopp140

PubMed Central

Yang, Yunfeng; Isaac, Cynthia; Wang, Chen; Dragon, François; Pogac̆ić, Vanda; Meier, U. Thomas

2000-01-01

Small nucleolar ribonucleoprotein particles (snoRNPs) mainly catalyze the modification of rRNA. The two major classes of snoRNPs, box H/ACA and box C/D, function in the pseudouridylation and 2′-O-methylation, respectively, of specific nucleotides. The emerging view based on studies in yeast is that each class of snoRNPs is composed of a unique set of proteins. Here we present a characterization of mammalian snoRNPs. We show that the previously characterized NAP57 is specific for box H/ACA snoRNPs, whereas the newly identified NAP65, the rat homologue of yeast Nop5/58p, is a component of the box C/D class. Using coimmunoprecipitation experiments, we show that the nucleolar and coiled-body protein Nopp140 interacts with both classes of snoRNPs. This interaction is corroborated in vivo by the exclusive depletion of snoRNP proteins from nucleoli in cells transfected with a dominant negative Nopp140 construct. Interestingly, RNA polymerase I transcription is arrested in nucleoli depleted of snoRNPs, raising the possibility of a feedback mechanism between rRNA modification and transcription. Moreover, the Nopp140-snoRNP interaction appears to be conserved in yeast, because depletion of Srp40p, the yeast Nopp140 homologue, in a conditional lethal strain induces the loss of box H/ACA small nucleolar RNAs. We propose that Nopp140 functions as a chaperone of snoRNPs in yeast and vertebrate cells. PMID:10679015

Yeast species associated with orange juice: evaluation of different identification methods.

PubMed

Arias, Covadonga R; Burns, Jacqueline K; Friedrich, Lorrie M; Goodrich, Renee M; Parish, Mickey E

2002-04-01

Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

The Effects of a Probiotic Yeast on the Bacterial Diversity and Population Structure in the Rumen of Cattle

PubMed Central

Pinloche, Eric; McEwan, Neil; Marden, Jean-Philippe; Bayourthe, Corinne; Auclair, Eric; Newbold, C. Jamie

2013-01-01

It has been suggested that the ability of live yeast to improve milk yield and weight gain in cattle is because the yeast stimulates bacterial activity within the rumen. However it remains unclear if this is a general stimulation of all species or a specific stimulation of certain species. Here we characterised the change in the bacterial population within the rumen of cattle fed supplemental live yeast. Three cannulated lactating cows received a daily ration (24 kg/d) of corn silage (61% of DM), concentrates (30% of DM), dehydrated alfalfa (9% of DM) and a minerals and vitamins mix (1% of DM). The effect of yeast (BIOSAF SC 47, Lesaffre Feed Additives, France; 0.5 or 5 g/d) was compared to a control (no additive) in a 3×3 Latin square design. The variation in the rumen bacterial community between treatments was assessed using Serial Analysis of V1 Ribosomal Sequence Tag (SARST-V1) and 454 pyrosequencing based on analysis of the 16S rRNA gene. Compared to the control diet supplementation of probiotic yeast maintained a healthy fermentation in the rumen of lactating cattle (higher VFA concentration [high yeast dose only], higher rumen pH, and lower Eh and lactate). These improvements were accompanied with a shift in the main fibrolytic group (Fibrobacter and Ruminococcus) and lactate utilising bacteria (Megasphaera and Selenomonas). In addition we have shown that the analysis of short V1 region of 16s rRNA gene (50–60 bp) could give as much phylogenetic information as a longer read (454 pyrosequencing of 250 bp). This study also highlights the difficulty of drawing conclusions on composition and diversity of complex microbiota because of the variation caused by the use of different methods (sequencing technology and/or analysis). PMID:23844101

Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jun; McCann, Kathleen L.; Qiu, Chen

Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less

Comparison of preribosomal RNA processing pathways in yeast, plant and human cells - focus on coordinated action of endo- and exoribonucleases.

PubMed

Tomecki, Rafal; Sikorski, Pawel J; Zakrzewska-Placzek, Monika

2017-07-01

Proper regulation of ribosome biosynthesis is mandatory for cellular adaptation, growth and proliferation. Ribosome biogenesis is the most energetically demanding cellular process, which requires tight control. Abnormalities in ribosome production have severe consequences, including developmental defects in plants and genetic diseases (ribosomopathies) in humans. One of the processes occurring during eukaryotic ribosome biogenesis is processing of the ribosomal RNA precursor molecule (pre-rRNA), synthesized by RNA polymerase I, into mature rRNAs. It must not only be accurate but must also be precisely coordinated with other phenomena leading to the synthesis of functional ribosomes: RNA modification, RNA folding, assembly with ribosomal proteins and nucleocytoplasmic RNP export. A multitude of ribosome biogenesis factors ensure that these events take place in a correct temporal order. Among them are endo- and exoribonucleases involved in pre-rRNA processing. Here, we thoroughly present a wide spectrum of ribonucleases participating in rRNA maturation, focusing on their biochemical properties, regulatory mechanisms and substrate specificity. We also discuss cooperation between various ribonucleolytic activities in particular stages of pre-rRNA processing, delineating major similarities and differences between three representative groups of eukaryotes: yeast, plants and humans. © 2017 Federation of European Biochemical Societies.

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

PubMed

Štornik, Aleksandra; Skok, Barbara; Trček, Janja

2016-03-01

Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of organic apple cider vinegar is clearly more heterogeneous than the bacterial microbiota for the industrial production of conventional apple cider vinegar. Further chemical analysis should reveal if a difference in microbiota composition influences the quality of different types of apple cider vinegar.

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

PubMed Central

Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-01-01

Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

PubMed

Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-11-01

Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.

PubMed

Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A

2017-02-01

Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation

PubMed Central

Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W.; Voisset, Cécile

2016-01-01

6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI+] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI+]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI+] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

Occultifur kilbournensis f.a. sp. nov., a new member of the Cystobasidiales associated with maize (Zea mays) cultivation.

PubMed

Kurtzman, Cletus P; Robnett, Christie J

2015-05-01

During a study of microorganisms associated with maize (Zea mays) cultivation, yeasts were isolated from overwintered stalks, cobs and surrounding soil, which were collected from an agricultural field in south-central Illinois, USA. Predominant among isolates were two species of Cryptococcus (Cr. flavescens, Cr. magnus) and a red yeast that D1/D2 LSU rRNA gene sequences revealed to be a new species of the basidiomycete yeast genus Occultifur. The species, which was not detected in the same field during the growing season, is described here as Occultifur kilbournensis (MycoBank number MB 811259; type strain NRRL Y-63695, CBS 13982, GenBank numbers, D1/D2 LSU rRNA gene, KP413160, ITS, KP413162; allotype strain NRRL Y-63699, CBS 13983). Mixture of the type and allotype strains resulted in formation of hyphae with clamp connections and a small number of apparent basidia following incubation on 5% malt extract agar at 15 °C for 2 months. In view of the uncertainty of the life cycle, the new species is being designated as forma asexualis. From analysis of D1/D2 and ITS nucleotide sequences, the new species is most closely related to Occultifur externus.

Description of Kuraishia piskuri f.a., sp. nov., a new methanol assimilating yeast and transfer of phylogenetically related Candida species to the genera Kuraishia and Nakazawaea as new combinations.

PubMed

Kurtzman, Cletus P; Robnett, Christie J

2014-11-01

The new anamorphic yeast Kuraishia piskuri, f.a., sp. nov. is described for three strains that were isolated from insect frass from trees growing in Florida, USA (type strain, NRRL YB-2544, CBS 13714). Species placement was based on phylogenetic analysis of nuclear gene sequences for the D1/D2 domains of large subunit rRNA, small subunit rRNA, translation elongation factor-1α, and subunits B1 and B2 of RNA polymerase II B. From this analysis, the anamorphic species Candida borneana, Candida cidri, Candida floccosa, Candida hungarica, and Candida ogatae were transferred to the genus Kuraishia as new combinations and Candida anatomiae, Candida ernobii, Candida ishiwadae, Candida laoshanensis, Candida molendini-olei, Candida peltata, Candida pomicola, Candida populi, Candida wickerhamii, and Candida wyomingensis were transferred to the genus Nakazawaea. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Molecular monitoring of spoilage yeasts during the production of candied fruit nougats to determine food contamination sources.

PubMed

Martorell, Patricia; Fernández-Espinar, M Teresa; Querol, Amparo

2005-06-15

In the present work, we have analysed the yeast microbiota present in a manufacturing plant of candied fruits and nougats. Four yeasts species (Zygosaccharomyces bailii, Zygosaccharomyces rouxii, Sporobolomyces roseus, and Debaryomyces hansenii) and a filamentous fungi (Nectria mauriiticola) were identified according to restriction analysis of 5.8S-ITS rDNA. These identifications were subsequently confirmed by sequencing the D1/D2 domain of the 26S rRNA gene. Z. rouxii and Z. bailii were isolated at high frequency along the whole manufacturing process. Since food alteration by Z. bailii and Z. rouxii is the cause of important economic losses for the food industry, there is a need for differentiating yeasts at the strain level as an essential part of quality control programs in this industry. For this purpose, we have tested the performance of three molecular techniques (RFLP mtDNA, RAPD-PCR, and microsatellite with (GAC)5 and (GTG)5 primers) to differentiate strains belonging to these two Zygosaccharomyces species. Those techniques with the best discriminatory power were applied to differentiate Zygosaccharomyces species isolates. The results of this analysis indicate that one strain of Z. bailii and two strains of Z. rouxii were involved in the spoilage of candied fruits. Moreover, the Z. bailii strain was also present in the spoiled nougat, hence being responsible of this alteration.

Candida queiroziae sp. nov., a cellobiose-fermenting yeast species isolated from rotting wood in Atlantic Rain Forest.

PubMed

Santos, Renata O; Cadete, Raquel M; Badotti, Fernanda; Mouro, Adriane; Wallheim, Daniela O; Gomes, Fátima C O; Stambuk, Boris U; Lachance, Marc-André; Rosa, Carlos A

2011-03-01

Eight strains of a novel yeast species were isolated from rotting wood and wood-boring insects in Atlantic Rain Forest ecosystems in Brazil. Sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that the yeast belongs to the Scheffersomyces clade and that it is related to Candida lignicola and Candida coipomoensis. The new species was isolated from rotting wood of three different localities and a wood-boring insect suggesting that these substrates are its ecological niche. This new yeast species is able to assimilate cellobiose and other compounds related to rotting wood. Strong fermentation of cellobiose in Durham tubes was observed for the strains of this new yeast. The new species produced an intracellular β-glucosidase responsible for cellobiose hydrolysis. The novel species, Candida queiroziae sp. nov., is proposed to accommodate these isolates. The type strain of C. queiroziae is UFMG-CLM 5.1(T) (=CBS 11853(T) = NRRL Y-48722(T)).

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro.

PubMed

Gallenberger, Martin; Meinel, Dominik M; Kroeber, Markus; Wegner, Michael; Milkereit, Philipp; Bösl, Michael R; Tamm, Ernst R

2011-02-01

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.

Description of Dioszegia patagonica sp. nov., a novel carotenogenic yeast isolated from cold environments.

PubMed

Trochine, Andrea; Turchetti, Benedetta; Vaz, Aline B M; Brandao, Luciana; Rosa, Luiz H; Buzzini, Pietro; Rosa, Carlos; Libkind, Diego

2017-11-01

During a survey of carotenogenic yeasts from cold and oligotrophic environments in Patagonia, several yeasts of the genus Dioszegia (Tremellales, Agaricomycotina) were detected, including three strains that could not be assigned to any known taxa. Analyses of internal transcribed spacer and D1/D2 regions of the large subunit rRNA gene showed these strains are conspecific with several other strains found in the Italian Alps and in Antarctica soil. Phylogenetic analyses showed that 19 of these strains represent a novel yeast species of the genus Dioszegia. The name Dioszegia patagonica sp. nov. is proposed to accommodate these strains and CRUB 1147 T (UFMG 195 T =CBMAI 1564 T =DBVPG 10618 T =CBS 14901 T ; MycoBank MB 819782) was designated as the type strain. This Dioszegia species accumulates biotechnologically valuable compounds such as carotenoid pigments and mycosporines.

Molecular identification and physiological characterization of yeasts, lactic acid bacteria and acetic acid bacteria isolated from heap and box cocoa bean fermentations in West Africa.

PubMed

Visintin, Simonetta; Alessandria, Valentina; Valente, Antonio; Dolci, Paola; Cocolin, Luca

2016-01-04

Yeast, lactic acid bacteria (LAB) and acetic acid bacteria (AAB) populations, isolated from cocoa bean heap and box fermentations in West Africa, have been investigated. The fermentation dynamicswere determined by viable counts, and 106 yeasts, 105 LAB and 82 AAB isolateswere identified by means of rep-PCR grouping and sequencing of the rRNA genes. During the box fermentations, the most abundant species were Saccharomyces cerevisiae, Candida ethanolica, Lactobacillus fermentum, Lactobacillus plantarum, Acetobacter pasteurianus and Acetobacter syzygii, while S. cerevisiae, Schizosaccharomyces pombe, Hanseniaspora guilliermondii, Pichia manshurica, C. ethanolica, Hanseniaspora uvarum, Lb. fermentum, Lb. plantarum, A. pasteurianus and Acetobacter lovaniensis were identified in the heap fermentations. Furthermore, the most abundant species were molecularly characterized by analyzing the rep-PCR profiles. Strains grouped according to the type of fermentations and their progression during the transformation process were also highlighted. The yeast, LAB and AAB isolates were physiologically characterized to determine their ability to grow at different temperatures, as well as at different pH, and ethanol concentrations, tolerance to osmotic stress, and lactic acid and acetic acid inhibition. Temperatures of 45 °C, a pH of 2.5 to 3.5, 12% (v/v) ethanol and high concentrations of lactic and acetic acid have a significant influence on the growth of yeasts, LAB and AAB. Finally, the yeastswere screened for enzymatic activity, and the S. cerevisiae, H. guilliermondii, H. uvarumand C. ethanolica species were shown to possess several enzymes that may impact the quality of the final product.

Relationships among genera of the Saccharomycotina (Ascomycota) from multigene phylogenetic analysis of type species

USDA-ARS?s Scientific Manuscript database

Phylogenetic relatedness among ascomycetous yeast genera (subphylum Saccharomycotina, phylum Ascomycota) has been uncertain. In the present study, type species of 70 currently recognized genera are compared from divergence in the nearly entire nuclear gene sequences for large subunit rRNA, small sub...

Water quality and antifungal susceptibility of opportunistic yeast pathogens from rivers.

PubMed

Monapathi, M E; Bezuidenhout, C C; Rhode, O H J

2017-03-01

Yeasts from water sources have been associated with diseases ranging from superficial mucosal infections to life threatening diseases. The aim of this study was to determine the water quality as well as diversity and antifungal susceptibility of yeasts from two rivers. Yeast levels and physico-chemical parameter data were analyzed by principal component analysis to determine correlations between physico-chemical data and yeast levels. Yeast morphotypes were identified by biochemical tests and 26S rRNA gene sequencing. Disk diffusion antifungal susceptibility tests were conducted. Physico-chemical parameters of the water were within target water quality range (TWQR) for livestock farming. For irrigational use, total dissolved solids and nitrates were not within the TWQR. Yeast levels ranged between 27 ± 10 and 2,573 ± 306 cfu/L. Only non-pigmented, ascomycetous yeasts were isolated. Saccharomyces cerevisiae and Candida glabrata were most frequently isolated. Several other opportunistic pathogens were also isolated. A large number of isolates were resistant to azoles, especially fluconazole, but also to other antifungal classes. Candida species were resistant to almost all the antifungal classes. These water sources are used for recreation and religious as well as for watering livestock and irrigation. Of particular concern is the direct contact of individuals with opportunistic yeast, especially the immune-compromised. Resistance of these yeast species to antifungal agents is a further health concern.

Conformational changes in the P site and mRNA entry channel evoked by AUG recognition in yeast translation preinitiation complexes

PubMed Central

Zhang, Fan; Saini, Adesh K.; Shin, Byung-Sik; Nanda, Jagpreet; Hinnebusch, Alan G.

2015-01-01

The translation preinitiation complex (PIC) is thought to assume an open conformation when scanning the mRNA leader, with AUG recognition evoking a closed conformation and more stable P site interaction of Met-tRNAi; however, physical evidence is lacking that AUG recognition constrains interaction of mRNA with the 40S binding cleft. We compared patterns of hydroxyl radical cleavage of rRNA by Fe(II)-BABE tethered to unique sites in eIF1A in yeast PICs reconstituted with mRNA harboring an AUG or near-cognate (AUC) start codon. rRNA residues in the P site display reduced cleavage in AUG versus AUC PICs; and enhanced cleavage in the AUC complexes was diminished by mutations of scanning enhancer elements of eIF1A that increase near-cognate recognition in vivo. This suggests that accessibility of these rRNA residues is reduced by accommodation of Met-tRNAi in the P site (PIN state) and by their interactions with the anticodon stem of Met-tRNAi. Our cleavage data also provide evidence that AUG recognition evokes dissociation of eIF1 from its 40S binding site, ejection of the eIF1A-CTT from the P-site and rearrangement to a closed conformation of the entry channel with reduced mobility of mRNA. PMID:25670678

The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

PubMed

Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

2015-12-01

The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Spontaneous cocoa bean fermentation carried out in a novel-design stainless steel tank: influence on the dynamics of microbial populations and physical-chemical properties.

PubMed

de Melo Pereira, Gilberto Vinícius; Magalhães, Karina Teixeira; de Almeida, Euziclei Gonzaga; da Silva Coelho, Irene; Schwan, Rosane Freitas

2013-02-01

Spontaneous cocoa bean fermentations carried out in a novel-design 40-kg-capacity stainless steel tank (SST) was studied in parallel to traditional Brazilian methods of fermentation in wooden boxes (40-kg-capacity wooden boxes (WB1) and 600-kg-capacity wooden boxes (WB2)) using a multiphasic approach that entailed culture-dependent and -independent microbiological analyses of fermenting cocoa bean pulp samples and target metabolite analyses of both cocoa pulp and cotyledons. Both microbiological approaches revealed that the dominant species of major physiological roles were the same for fermentations in SST, relative to boxes. These species consisted of Saccharomyces cerevisiae and Hanseniaspora sp. in the yeast group; Lactobacillus fermentum and L. plantarum in the lactic acid bacteria (LAB) group; Acetobacter tropicalis belonging to the acetic acid bacteria (AAB) group; and Bacillus subtilis in the Bacillaceae family. A greater diversity of bacteria and non-Saccharomyces yeasts was observed in box fermentations. Additionally, a potentially novel AAB belonging to the genus Asaia was isolated during fermentation in WB1. Cluster analysis of the rRNA genes-PCR-DGGE profiles revealed a more complex picture of the box samples, indicating that bacterial and yeast ecology were fermentation-specific processes (wooden boxes vs. SST). The profile of carbohydrate consumption and fermentation products in the pulp and beans showed similar trends during both fermentation processes. However, the yeast-AAB-mediated conversion of carbohydrates into ethanol, and subsequent conversion of ethanol into acetic acid, was achieved with greater efficiency in SST, while temperatures were generally higher during fermentation in wooden boxes. With further refinements, the SST model may be useful in designing novel bioreactors for the optimisation of cocoa fermentation with starter cultures. Copyright © 2012 Elsevier B.V. All rights reserved.

Selection of starter cultures for the production of sour cassava starch in a pilot-scale fermentation process.

PubMed

Penido, Fernanda Corrêa Leal; Piló, Fernanda Barbosa; Sandes, Sávio Henrique de Cicco; Nunes, Álvaro Cantini; Colen, Gecernir; Oliveira, Evelyn de Souza; Rosa, Carlos Augusto; Lacerda, Inayara Cristina Alves

2018-02-28

Sour cassava starch (Polvilho azedo) is obtained from a spontaneous fermentation conducted by microorganisms from raw materials and fermentation tanks. This product is traditionally used in the baking industry for the manufacture of biscuits and Brazilian cheese breads. However, the end of fermentation is evaluated empirically, and the process occurs without standardization, which results in products of inconsistent quality. Predominant microbiota from a cassava flour manufacturer was isolated in order to select starter cultures for the production of sour cassava starch in a pilot-scale fermentation process. Lactic acid bacteria and yeasts were isolated, enumerated and grouped by Restriction Fragment Length Polymorphism, and PCR fingerprinting, respectively. One isolate of each molecular profile was identified by sequencing of the rRNA gene. LAB were prevalent throughout the entire process. Lactobacillus brevis (21.5%), which produced the highest values of acidity, and Lactobacillus plantarum (13.9%) were among the most frequent species. Pichia scutulata (52.2%) was the prevalent yeast and showed amylolytic activity. The aforementioned species were tested as single and mixed starter cultures in a pilot-scale fermentation process for 28 days. L. plantarum exhibited better performance as a starter culture, which suggests its potential for the production of sour cassava starch. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Microbial diversity in the floral nectar of seven Epipactis (Orchidaceae) species

PubMed Central

Jacquemyn, Hans; Lenaerts, Marijke; Tyteca, Daniel; Lievens, Bart

2013-01-01

Abstract Floral nectar of animal-pollinated plants is commonly infested with microorganisms, yet little is known about the microorganisms inhabiting the floral nectar of orchids. In this study, we investigated microbial communities occurring in the floral nectar of seven Epipactis (Orchidaceae) species. Culturable bacteria and yeasts were isolated and identified by partially sequencing the small subunit (SSU) ribosomal RNA (rRNA) gene and the D1/D2 domains of the large subunit (LSU) rRNA gene, respectively. Using three different culture media, we found that bacteria were common inhabitants of the floral nectar of Epipactis. The most widely distributed bacterial operational taxonomic units (OTUs) in nectar of Epipactis were representatives of the family of Enterobacteriaceae, with an unspecified Enterobacteriaceae bacterium as the most common. In contrast to previous studies investigating microbial communities in floral nectar, very few yeast species (mainly of the genus Cryptococcus) were observed, and most of them occurred in very low densities. Total OTU richness (i.e., the number of bacterial and yeast OTUs per orchid species) varied between 4 and 20. Cluster analysis revealed that microbial communities of allogamous species differed from those of autogamous and facultatively autogamous species. This study extends previous efforts to identify microbial communities in floral nectar and indicates that the floral nectar of the orchids investigated mainly contained bacterial communities with moderate phylogenetic diversity. PMID:23836678

Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of "Shanxi aged vinegar", a traditional Chinese vinegar.

PubMed

Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng

2012-05-01

Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

The environmental and intrinsic yeast diversity of Cuban cocoa bean heap fermentations.

PubMed

Fernández Maura, Yurelkys; Balzarini, Tom; Clapé Borges, Pablo; Evrard, Pierre; De Vuyst, Luc; Daniel, H-M

2016-09-16

The environmental yeast diversity of spontaneous cocoa bean fermentations in east Cuba was investigated. Seven fermentations, 25 equipment- and handling-related samples, and 115 environmental samples, such as flowers, leaf and cocoa pod surfaces, as well as drosophilid insects, were analysed. The basic fermentation parameters temperature and pH were recorded during five fermentations for at least six days. A total of 435 yeast isolates were identified by a combination of PCR-fingerprinting of genomic DNA with the M13 primer and sequence analysis of DNA from representative isolates, using the internal transcribed spacer region, the D1/D2 region of the large subunit rRNA gene, and an actin gene-encoding fragment, as required. Among 65 yeast species detected, Pichia manshurica and Hanseniaspora opuntiae were the most frequently isolated species, obtained from five and four fermentations, followed in frequency by Pichia kudriavzevii from two fermentations. Saccharomyces cerevisiae was isolated only occasionally. Cocoa fermentation yeast species were also present on processing equipment. The repeated isolation of a preliminarily as Yamadazyma sp. classified species, a group of strains similar to Saccharomycopsis crataegensis from fermentations and equipment, and the isolation of fifteen other potentially novel yeast species in low numbers provides material for further studies. Environmental samples showed higher yeast diversity compared to the fermentations, included the most frequent fermentation species, whereas the most frequently isolated environmental species were Candida carpophila, Candida conglobata, and Candida quercitrusa. Potential selective advantages of the most frequently isolated species were only partly explained by the physiological traits tested. For instance, tolerance to higher ethanol concentrations was more frequent in strains of Pichia spp. and S. cerevisiae compared to Hanseniaspora spp.; the ability to also assimilate ethanol might have conferred a selective advantage to Pichia spp. In contrast, high glucose tolerance was common among strains of Hanseniaspora spp., Torulaspora delbrueckii, and Candida tropicalis, among which only Hanseniaspora spp. were frequently isolated. Copyright © 2016 Elsevier B.V. All rights reserved.

Establishment of intestinal microbiota with focus on yeasts of unweaned and weaned piglets kept under different farm conditions.

PubMed

Urubschurov, Vladimir; Janczyk, Pawel; Souffrant, Wolfgang-Bernhard; Freyer, Gertraude; Zeyner, Annette

2011-09-01

This study aimed to characterize the intestinal yeasts in weaning piglets and to establish their possible relationships with main bacterial groups. German Landrace piglets were weaned (WP, n=32) at 28 days of age or kept with the dams until day 39 without creep feed (UP, n=32). The experiment was performed at an experimental and a commercial farm (CF). Faeces were collected from the piglets, sows and pen floors on days 28, 33 and 39 for isolation of DNA and cultivation for enumeration of yeasts, enterobacteria, enterococci and lactobacilli. Fragments of the D1 domain of 26S rRNA gene were amplified and separated by denaturing gradient gel electrophoresis (DGGE). No yeasts could be cultured from water and feed samples. No or only low numbers of yeasts were detected among all UP. In WP at CF, yeasts correlated with lactobacilli (r=0.456; P=0.009) and enterobacteria (r=-0.407; P=0.021). Kazachstania slooffiae dominated among the cultured yeasts. It was the only yeast species detected by PCR-DGGE. Yeasts, especially K. slooffiae, established in the porcine gastrointestinal tract after consumption of grain-based feed and may interrelate with the intestinal microbiota. The study provides data indicating importance of K. slooffiae for the development of balanced porcine gut microbiota. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Study on the effects of near-future ocean acidification on marine yeasts: a microcosm approach

NASA Astrophysics Data System (ADS)

Krause, Evamaria; Wichels, Antje; Erler, René; Gerdts, Gunnar

2013-12-01

Marine yeasts play an important role in biodegradation and nutrient cycling and are often associated with marine flora and fauna. They show maximum growth at pH levels lower than present-day seawater pH. Thus, contrary to many other marine organisms, they may actually profit from ocean acidification. Hence, we conducted a microcosm study, incubating natural seawater from the North Sea at present-day pH (8.10) and two near-future pH levels (7.81 and 7.67). Yeasts were isolated from the initial seawater sample and after 2 and 4 weeks of incubation. Isolates were classified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and representative isolates were identified by partial sequencing of the large subunit rRNA gene. From the initial seawater sample, we predominantly isolated a yeast-like filamentous fungus related to Aureobasidium pullulans, Cryptococcus sp., Candida sake, and various cold-adapted yeasts. After incubation, we found more different yeast species at near-future pH levels than at present-day pH. Yeasts reacting to low pH were related to Leucosporidium scottii, Rhodotorula mucilaginosa, Cryptococcus sp., and Debaryomyces hansenii. Our results suggest that these yeasts will benefit from seawater pH reductions and give a first indication that the importance of yeasts will increase in a more acidic ocean.

Characterization of yakju brewed from glutinous rice and wild-type yeast strains isolated from nuruks.

PubMed

Kim, Hye Ryun; Kim, Jae-Ho; Bae, Dong-Hoon; Ahn, Byung-Hak

2010-12-01

Korean traditional rice wines yakju and takju are generally brewed with nuruk as the source of the saccharogenic enzymes by natural fermentation. To improve the quality of Korean rice wine, the microorganisms in the nuruk need to be studied. The objective of this research was to improve the quality of Korean wine with the wild-type yeast strains isolated from the fermentation starter, nuruk. Only strain YA-6 showed high activity in 20% ethanol. Precipitation of Y89-5-3 was similar to that of very flocculent yeast (〉80%) at 75.95%. Using 18S rRNA sequencing, all 10 strains were identified as Saccharomyces cerevisiae. Volatile compounds present in yakju were analyzed by gas chromatography-mass selective detector. The principal component analysis (PCA) of the volatile compounds grouped long-chain esters on the right side of the first principal component, PC1; these compounds were found in yakju that was made with strains YA-6, Y89-5-3, Y89-5- 2, Y90-9, and Y89-1-1. On the other side of PC1 were short-chain esters; these compounds were found in wines that were brewed with strains Y183-2, Y268-3, Y54-3, Y98-4, and Y88-4. Overall, the results indicated that using different wild-type yeast strains in the fermentation process significantly affects the chemical characteristics of the glutinous rice wine.

Distribution of tannin-'tolerant yeasts isolated from Miang, a traditional fermented tea leaf (Camellia sinensis var. assamica) in northern Thailand.

PubMed

Kanpiengjai, Apinun; Chui-Chai, Naradorn; Chaikaew, Siriporn; Khanongnuch, Chartchai

2016-12-05

Miang is a fermented food product prepared from the tea leaves of Camellia sinensis var. assamica, and is traditionally produced in mountainous areas of northern Thailand. Although Miang has a long history and reveals deep-rooted cultural involvement with local people in northern Thailand, little is known regarding its microbial diversity. Yeasts were isolated from 47 Miang samples collected from 28 sampling sites, including eight provinces in upper northern Thailand. A hundred and seven yeast isolates were recovered and identified within 14 species based on the comparison of the D1/D2 sequence of the large subunit (LSU) rRNA gene. Candida ethanolica was determined to be the dominant species that was frequently found in Miang together with minor resident yeast species. All yeast isolates demonstrated their tannin-tolerant capability when cultivated on yeast malt agar (YMA) containing 50g/l tannin, but nine isolates displayed clear zones forming around their colonies, e.g., Debaryomyces hansenii, Cyberlindnera rhodanensis, and Sporidiobolus ruineniae. The results obtained from a visual reading method of tannase revealed that all yeast isolates were positive for methyl gallate, indicating that they possess tannase activity. It is assumed that a tannin-tolerant ability is one of the most important factors for developing a yeast community in Miang. This research study is the first report to describe tannin-tolerant yeasts and yeast communities in traditionally fermented tea leaves. Copyright © 2016. Published by Elsevier B.V.

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

PubMed Central

Štornik, Aleksandra; Skok, Barbara

2016-01-01

Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial production of organic apple cider vinegar is clearly more heterogeneous than the bacterial microbiota for the industrial production of conventional apple cider vinegar. Further chemical analysis should reveal if a difference in microbiota composition influences the quality of different types of apple cider vinegar. PMID:27904401

Candida ficus sp. nov., a novel yeast species from the gut of Apriona germari larvae.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Liu, Zheng

2012-11-01

A novel yeast species is described based on three strains from the gut of wood-boring larvae collected in a tree trunk of Ficus carica cultivated in parks near Nanyang, central China. Phylogenetic analysis based on sequences of the D1/D2 domains of the large subunit rRNA gene showed that these strains occurred in a separate clade that was genetically distinct from all known ascomycetous yeasts. In terms of pairwise sequence divergence, the novel strains differed by 15.3% divergence from the type strain of Pichia terricola, and by 15.8% divergence from the type strains of Pichia exigua and Candida rugopelliculosa in the D1/D2 domains. All three are ascomycetous yeasts in the Pichia clade. Unlike P. terricola, P. exigua and C. rugopelliculosa, the novel isolates did not ferment glucose. The name Candida ficus sp. nov. is proposed to accommodate these highly divergent organisms, with STN-8(T) (=CICC 1980(T)=CBS 12638(T)) as the type strain.

The diversity of eukaryotic microbiota in the traditional Slovak sheep cheese--bryndza.

PubMed

Laurencík, M; Sulo, P; Sláviková, E; Piecková, E; Seman, M; Ebringer, L

2008-09-30

We investigated the occurrence and diversity of yeasts and filamentous fungi in bryndza an artisanal Slovak soft spreadable cheese prepared from raw sheep milk or from a mixture of sheep and cow milk. Samples collected during four months of the summer production period from two locations (northern and southern parts of central Slovakia) contained 10(5)-10(7) (cfu) yeasts and about 10(2) (cfu) of mold per gram of wet weight. Further characterization by conventional taxonomy and sequence comparison of D1/D2 region from 26S rRNA gene revealed Mucor circinelloides v. Tieghem as the predominant filamentous fungus. A novel Geotrichum sp. together with Kluyveromyces (K. lactis/K. marxianus) was identified as the most abundant yeast species. Occasionally other yeasts, such as Candida inconspicua, Candida silvae, Pichia fermentans and Trichosporon domesticum were found. Conventional taxonomy readily identified isolates to the genus level, but DNA sequence comparison was capable of discriminating them at the species level.

The Primary open-angle glaucoma gene WDR36 functions in ribosomal RNA processing and interacts with the p53 stress–response pathway

PubMed Central

Skarie, Jonathan M.; Link, Brian A.

2008-01-01

Primary open-angle glaucoma (POAG) is a genetically complex neuropathy that affects retinal ganglion cells and is a leading cause of blindness worldwide. WDR36, a gene of unknown function, was recently identified as causative for POAG at locus GLC1G. Subsequent studies found disease-associated variants in control populations, leaving the role of WDR36 in this disease unclear. To address this issue, we determined the function of WDR36. We studied Wdr36 in zebrafish and found it is the functional homolog of yeast Utp21. Utp21 is cell essential and functions in the nucleolar processing of 18S rRNA, which is required for ribosome biogenesis. Evidence for functional homology comes from sequence alignment, ubiquitous expression, sub-cellular localization to the nucleolus and loss-of-function phenotypes that include defects in 18S rRNA processing and abnormal nucleolar morphology. Additionally, we show that loss of Wdr36 function leads to an activation of the p53 stress–response pathway, suggesting that co-inheritance of defects in p53 pathway genes may influence the impact of WDR36 variants on POAG. Although these results overall do not provide evidence for or against a role of WDR36 in POAG, they do provide important baseline information for future studies. PMID:18469340

Mitochondrial ribosome assembly in health and disease

PubMed Central

De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

2015-01-01

The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

Candida amazonensis sp. nov., an ascomycetous yeast isolated from rotting wood in the Amazonian forest.

PubMed

Cadete, Raquel M; Melo, Monaliza A; Lopes, Mariana R; Pereira, Gilmara M D; Zilli, Jerri E; Vital, Marcos J S; Gomes, Fátima C O; Lachance, Marc-André; Rosa, Carlos A

2012-06-01

Five strains of a novel yeast species were isolated from rotting wood samples collected in an Amazonian forest site in the state of Roraima, northern Brazil. The sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that this species belongs to the Scheffersomyces clade and is related to Candida coipomoensis, Candida lignicola and Candida queiroziae. The novel species Candida amazonensis sp. nov. is proposed to accommodate these isolates. The type strain of C. amazonensis sp. nov. is UFMG-HMD-26.3(T) ( = CBS 12363(T) = NRRL Y-48762(T)).

Candida wangnamkhiaoensis sp. nov., an anamorphic yeast species in the Hyphopichia clade isolated in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Nakase, Takashi

2012-06-01

Two strains representing a single novel yeast species were isolated from a flower of Calycoopteris floribunda Lame (SK170(T)) and insect frass (ST-122) collected in Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were assigned as a single novel Candida species in the Hyphopichia clade for which the name Candida wangnamkhiaoensis sp. nov. is proposed. The type strain is SK170(T)=BCC 39604(T)=NBRC 106724(T)=CBS 11695(T)).

DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

PubMed

Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

2010-04-01

Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

A Comparison of the Beneficial Effects of Live and Heat-Inactivated Baker's Yeast on Nile Tilapia: Suggestions on the Role and Function of the Secretory Metabolites Released from the Yeast.

PubMed

Ran, Chao; Huang, Lu; Liu, Zhi; Xu, Li; Yang, Yalin; Tacon, Philippe; Auclair, Eric; Zhou, Zhigang

2015-01-01

Yeast is frequently used as a probiotic in aquaculture with the potential to substitute for antibiotics. In this study, the involvement and extent to which the viability of yeast cells and thus the secretory metabolites released from the yeast contribute to effects of baker's yeast was investigated in Nile tilapia. No yeast, live yeast or heat-inactivated baker's yeast were added to basal diets high in fishmeal and low in soybean (diet A) or low in fishmeal and high in soybean (diet B), which were fed to fish for 8 weeks. Growth, feed utilization, gut microvilli morphology, and expressions of hsp70 and inflammation-related cytokines in the intestine and head kidney were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Gut alkaline phosphatase (AKP) activity was measured after challenging the fish with Aeromonas hydrophila. Results showed that live yeast significantly improved FBW and WG (P < 0.05), and tended to improve FCR (P = 0.06) of fish compared to the control (no yeast). No significant differences were observed between inactivated yeast and control. Live yeast improved gut microvilli length (P < 0.001) and density (P < 0.05) while inactivated yeast did not. The hsp70 expression level in both the intestine and head kidney of fish was significantly reduced by live yeast (P < 0.05) but not inactivated yeast. Live yeast but not inactivated yeast reduced intestinal expression of tnfα (P < 0.05), tgfβ (P < 0.05 under diet A) and il1β (P = 0.08). Intestinal Lactococcus spp. numbers were enriched by both live and inactivated yeast. Lastly, both live and inactivated yeast reduced the gut AKP activity compared to the control (P < 0.001), indicating protection of the host against infection by A. hydrophila. In conclusion, secretory metabolites did not play major roles in the growth promotion and disease protection effects of yeast. Nevertheless, secretory metabolites were the major contributing factor towards improved gut microvilli morphology, relieved stress status, and reduced intestinal inflammation of Nile tilapia fed diets supplemented with baker's yeast.

Microbial Diversity and Biochemical Analysis of Suanzhou: A Traditional Chinese Fermented Cereal Gruel

PubMed Central

Qin, Huibin; Sun, Qinghui; Pan, Xuewei; Qiao, Zhijun; Yang, Hongjiang

2016-01-01

Suanzhou as a traditional Chinese gruel is fermented from proso millet and millet. The biochemical analysis showed Suanzhou had relatively high concentrations of lactic acid, acetic acid, and free amino acids. The metagenomics of Suanzhou were studied, with the analysis of the V4 region of 16S rRNA gene, the genera Lactobacillus and Acetobacter were found dominant with the average abundance of 58.2 and 24.4%, respectively; and with the analysis of the ITS1 region between 18S and 5.8S rRNA genes, 97.3% of the fungal community was found belonging to the genus Pichia and 2.7% belonging to five other genera. Moreover, the isolates recovered from 59 Suanzhou samples with various media were identified with the 16S rRNA or 18S rRNA gene analyses. Lactobacillus fermentum (26.9%), L. pentosus (19.4%), L. casei (17.9%), and L. brevis (16.4%) were the four dominant Lactobacillus species; Acetobacter lovaniensis (38.1%), A. syzygii (16.7%), A. okinawensis (16.7%), and A. indonesiensis (11.9%) were the four dominant Acetobacter species; and Pichia kudriavzevii (55.8%) and Galactomyces geotrichum (23.1%) were the two dominant fungal species. Additionally, L. pentosus p28-c and L. casei h28-c1 were selected for the fermentations mimicking the natural process. Collectively, our data demonstrate that Suanzhou is a nutritional food high in free amino acids and organic acids. Diverse Lactobacillus, Acetobacter, and yeast species are identified as the dominant microorganisms in Suanzhou. The isolated strains can be further characterized and used as starters for the industrial production of Suanzhou safely. PMID:27610102

The SSU processome interactome in Saccharomyces cerevisiae reveals novel protein subcomplexes.

PubMed

Vincent, Nicholas G; Charette, J Michael; Baserga, Susan J

2018-01-01

Ribosome assembly is an evolutionarily conserved and energy intensive process required for cellular growth, proliferation, and maintenance. In yeast, assembly of the small ribosomal subunit (SSU) requires approximately 75 assembly factors that act in coordination to form the SSU processome, a 6 MDa ribonucleoprotein complex. The SSU processome is required for processing, modifying, and folding the preribosomal RNA (rRNA) to prepare it for incorporation into the mature SSU. Although the protein composition of the SSU processome has been known for some time, the interaction network of the proteins required for its assembly has remained poorly defined. Here, we have used a semi-high-throughput yeast two-hybrid (Y2H) assay and coimmunoprecipitation validation method to produce a high-confidence interactome of SSU processome assembly factors (SPAFs), providing essential insight into SSU assembly and ribosome biogenesis. Further, we used glycerol density-gradient sedimentation to reveal the presence of protein subcomplexes that have not previously been observed. Our work not only provides essential insight into SSU assembly and ribosome biogenesis, but also serves as an important resource for future investigations into how defects in biogenesis and assembly cause congenital disorders of ribosomes known as ribosomopathies. © 2018 Vincent et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Comparative analysis of Gram's stain, PNA-FISH and Sepsityper with MALDI-TOF MS for the identification of yeast direct from positive blood cultures.

PubMed

Gorton, Rebecca L; Ramnarain, P; Barker, K; Stone, N; Rattenbury, S; McHugh, T D; Kibbler, C C

2014-10-01

Fungaemia diagnosis could be improved by reducing the time to identification of yeast from blood cultures. This study aimed to evaluate three rapid methods for the identification of yeast direct from blood cultures; Gram's stain analysis, the AdvanDX Peptide Nucleic Acid in Situ Hybridisation Yeast Traffic Light system (PNA-FISH YTL) and Bruker Sepsityper alongside matrix-assisted laser desorption ionisation time of flight mass spectrometry (MALDI-TOF MS). Fifty blood cultures spiked with a known single yeast strain were analysed by blinded operators experienced in each method. Identifications were compared with MALDI-TOF MS CHROMagar Candida culture and ITS rRNA sequence-based identifications. On first attempt, success rates of 96% (48/50) and 76% (36/50) were achieved using PNA-FISH YTL and Gram's stain respectively. MALDI-TOF MS demonstrated a success rate of 56% (28/50) when applying manufacturer's species log score thresholds and 76% (38/50) using in-house parameters, including lowering the species log score threshold to >1.5. In conclusion, PNA-FISH YTL demonstrated a high success rate successfully identifying yeast commonly encountered in fungaemia. Sepsityper(™) with MALDI-TOF MS was accurate but increased sensitivity is required. Due to the misidentification of commonly encountered yeast Gram's stain analysis demonstrated limited utility in this setting. © 2014 Blackwell Verlag GmbH.

Fatal Saccharomyces Cerevisiae Aortic Graft Infection

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Smith, Davey; Metzgar, David; Wills, Christopher; Fierer, Joshua

2002-01-01

Saccharomyces cerevisiae is a yeast commonly used in baking and a frequent colonizer of human mucosal surfaces. It is considered relatively nonpathogenic in immunocompetent adults. We present a case of S. cerevisiae fungemia and aortic graft infection in an immunocompetent adult. This is the first reported case of S. cerevisiue fungemia where the identity of the pathogen was confirmed by rRNA sequencing.

Wickerhamomyces xylosica sp. nov. and Candida phayaonensis sp. nov., two xylose-assimilating yeast species from soil.

PubMed

Limtong, Savitree; Nitiyon, Sukanya; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Am-In, Somjit; Yongmanitchai, Wichien

2012-11-01

Two strains (NT29(T) and NT31(T)) of xylose-assimilating yeasts were obtained from soils collected in northern Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were found to represent two novel ascomycete yeast species. Strain NT29(T) was assigned to the genus Candida belonging to the Pichia clade as a representative of Candida phayaonensis sp. nov.; the type strain is NT29(T) (=BCC 47634(T)=NBRC 108868(T)=CBS 12319(T)). Strain NT31(T) represented a novel Wickerhamomyces species, which was named Wickerhamomyces xylosica sp. nov.; the type strain is NT31(T) (=BCC 47635(T)=NBRC 108869(T)=CBS 12320(T)).

Papiliotrema plantarum sp. nov., a novel tremellaceous sexual yeast species.

PubMed

Into, Parichat; Pontes, Ana; Jacques, Noémie; Casaregola, Serge; Limtong, Savitree; Sampaio, José Paulo

2018-06-01

During a survey of the yeast community associated with the phylloplane of corn in Thailand, a basidiomycetous yeast strain belonging to the genus Papiliotrema was isolated. Analyses of the D1/D2 domains of the 26S (LSU) rRNA gene and complete ITS region supported the recognition of a novel species, for which the name Papiliotrema plantarum sp. nov. is proposed (type strain DMKU-CP801 T =CBS 15220 T =PYCC 7257 T ). Another strain of P. plantarum sp. nov., isolated in French Guiana, was found to be sexually compatible with the Thai isolate and mycelium with clamp connections, basidia and basidiospores were observed in culture. The basidial morphology of P. plantarum combined features previously observed for Papiliotrema bandonii and Papiliotrema fuscus, which represent the only sexual species hitherto known in the genus, i.e. transversely septate basidia, with sexual structures of the Tremella type.

Characterization and stability of lactobacilli and yeast microbiota in kefir grains.

PubMed

Vardjan, T; Mohar Lorbeg, P; Rogelj, I; Čanžek Majhenič, A

2013-05-01

Characterization and stability of lactobacilli and yeasts from kefir grains using culture-dependent and culture-independent methods were investigated in this study. Culture-dependent analysis, followed by sequencing of 16S ribosomal DNA for bacteria and 26S rRNA gene for yeasts, revealed 3 different species of lactobacilli and yeasts, respectively. The most frequently isolated bacterial species were Lactobacillus kefiranofaciens ssp. kefirgranum, Lb. parakefiri, and Lb. kefiri, whereas yeasts belonged to Kluyveromyces marxianus, Kazachstania exigua, and Rhodosporidium kratochvilovae. This study is the first to report on the presence of R. kratochvilovae in kefir grains. On the other hand, PCR-denaturing gradient gel electrophoresis in the culture-independent method showed that the dominant microorganisms were Lb. kefiranofaciens ssp. kefirgranum, Kl. marxianus and Ka. exigua, but did not reveal bands corresponding to Lb. parakefiri, Lb. kefiri, or R. kratochvilovae. Our results support the necessity of combining more techniques for detailed and reliable study of microbial communities in kefir grains. Another interesting finding confirmed that the detected dominant microbiota of kefir grains is very stable and did not change over experimental time. This finding is important to ensure consistent product quality. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

PubMed

Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

2015-03-01

Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity.

PubMed

Sharma, Neelam; Park, Sang-Wook; Vepachedu, Ramarao; Barbieri, Luigi; Ciani, Marialibera; Stirpe, Fiorenzo; Savary, Brett J; Vivanco, Jorge M

2004-01-01

Ribosome-inactivating proteins (RIPs) are N-glycosidases that remove a specific adenine from the sarcin/ricin loop of the large rRNA, thus arresting protein synthesis at the translocation step. In the present study, a protein termed tobacco RIP (TRIP) was isolated from tobacco (Nicotiana tabacum) leaves and purified using ion exchange and gel filtration chromatography in combination with yeast ribosome depurination assays. TRIP has a molecular mass of 26 kD as evidenced by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and showed strong N-glycosidase activity as manifested by the depurination of yeast rRNA. Purified TRIP showed immunoreactivity with antibodies of RIPs from Mirabilis expansa. TRIP released fewer amounts of adenine residues from ribosomal (Artemia sp. and rat ribosomes) and non-ribosomal substrates (herring sperm DNA, rRNA, and tRNA) compared with other RIPs. TRIP inhibited translation in wheat (Triticum aestivum) germ more efficiently than in rabbit reticulocytes, showing an IC50 at 30 ng in the former system. Antimicrobial assays using highly purified TRIP (50 microg mL(-1)) conducted against various fungi and bacterial pathogens showed the strongest inhibitory activity against Trichoderma reesei and Pseudomonas solancearum. A 15-amino acid internal polypeptide sequence of TRIP was identical with the internal sequences of the iron-superoxide dismutase (Fe-SOD) from wild tobacco (Nicotiana plumbaginifolia), Arabidopsis, and potato (Solanum tuberosum). Purified TRIP showed SOD activity, and Escherichia coli Fe-SOD was observed to have RIP activity too. Thus, TRIP may be considered a dual activity enzyme showing RIP-like activity and Fe-SOD characteristics.

Potentiality of yeast Candida sp. SMN04 for degradation of cefdinir, a cephalosporin antibiotic: kinetics, enzyme analysis and biodegradation pathway.

PubMed

Selvi, A; Das, Devlina; Das, Nilanjana

2015-01-01

A new yeast strain isolated from the pharmaceutical wastewater was capable of utilizing cefdinir as a sole carbon source for their growth in mineral medium. The yeast was identified and named as Candida sp. SMN04 based on morphology and 18S-ITS-D1/D2/D3 rRNA sequence analysis. The interaction between factors pH (3.0-9.0), inoculum dosage (1-7%), time (1-11 day) and cefdinir concentration (50-450 mg/L) was studied using a Box-Behnken design. The factors were studied as a result of their effect on cell dry weight (R1; g/L), extended spectrum β-lactamase (ESBL) assay (R2; mm), P450 activity (R3; U/mL) and degradation (R4; %). Maximum values of R1, R2, R3 and R4 were obtained at central values of all the parameters. The isolated yeast strain efficiently degraded 84% of 250 mg L⁻¹ of cefdinir within 6 days with a half-life of 2.97 days and degradation rate constant of 0.2335 per day. Pseudo-first-order model efficiently described the process. Among the various enzymes tested, the order of activity at the end of Day 4 was noted to be: cytochrome P450 (1.76 ± 0.03) > NADPH reductase (1.51 ± 0.20) > manganese peroxidase and amylase (0.66 ± 0.15; 0.66 ± 0.70). Intermediates were successfully characterized by liquid chromatography-mass spectrometry. The opening of the β-lactam ring involving ESBL activity was considered as one of the major steps in the cefdinir degradation process. Fourier transform-infrared spectroscopy analysis showed the absence of spectral vibrations between 1766 and 1519 cm⁻¹ confirming the complete removal of lactam ring during cefdinir degradation. The results of the present study are promising for the use of isolated yeast Candida sp. SMN04 as a potential bioremediation agent.

A Novel Flucytosine-Resistant Yeast Species, Candida pseudoaaseri, Causes Disease in a Cancer Patient ▿

PubMed Central

Pfüller, Roland; Gräser, Yvonne; Erhard, Marcel; Groenewald, Marizeth

2011-01-01

Some members of the genus Candida are among the most common human fungal pathogens and cause serious diseases especially in immunocompromised people. A yeast was isolated from a blood culture from an immunocompromised cancer patient who suffered from acute pneumonia. The growth characteristics of the yeast on CHROMagar Candida were similar to those of Candida tropicalis, whereas the API ID 32C system identified the yeast as Candida silvicola. On the basis of the nucleotide divergence in the D1/D2 domain of the 26S nuclear rRNA (nrRNA) gene, as well as the internal transcribed spacer (ITS) domain of the nrRNA gene region, a new species, Candida pseudoaaseri sp. nov. with type strain VK065094 (CBS 11170T), which was found to be closely related to Candida aaseri, is proposed. While C. aaseri strains were susceptible to all tested antifungals, the new species is resistant to flucytosine and may also be distinguished from C. aaseri by its ability to assimilate l-rhamnose, whereas its colony morphology on CHROMagar Candida may be helpful for differentiation. PMID:21976765

Candida neustonensis sp. nov., a novel ascomycetous yeast isolated from the sea surface microlayer in Taiwan.

PubMed

Chang, Chin-Feng; Lee, Ching-Fu; Liu, Shiu-Mei

2010-01-01

A new ascomycetous yeast species, Candida neustonensis is proposed in this study based on four strains (SN92(T), SN47, SJ22, SJ25) isolated from sea surface microlayer in Taiwan. These four yeast strains were morphologically, physiologically and phylogenetically identical to each other. No sexual reproduction was observed on 5% malt extract agar, corn meal agar, V8 agar, McClary's acetate agar and potato-dextrose agar. Phylogenetic analysis of the sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene places C. neustonensis as a member of the Pichia guilliermondii clade, it also reveals that the phylogenetically closest relatives of C. neustonensis are C. fukuyamaensis (4.4% divergence), C. xestobii (4.4% divergence) and P. guilliermondii (4.5% divergence). C. neustonensis also is clearly distinguished from other known species in the P. guilliermondii clade based on the results of physiology tests. From these comparison analyses, the following novel yeast species is proposed: Candida neustonensis sp. nov., with strain SN92(T) (= BCRC 23108(T) = JCM 14892(T) = CBS 11061(T)) as the type strain.

Cryptococcus nanyangensis sp. nov., a new basidiomycetous yeast isolated from the gut of wood-boring larvae.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia

2012-11-01

Two strains of a novel basidiomycetous yeast species were isolated from the gut of wood-boring larvae collected in the Baotianman Nature Reserve, the central China. Sequence analysis of the D1/D2 domains of the large subunit (LSU) rRNA gene and internal transcribed spacer (ITS) regions showed that these yeasts belong to the Bulleromyces clade and formed a cluster together with eleven undescribed Cryptococcus species. The novel species differed from its closest known species, Cryptococcus rajasthanensis, by 3.3 % divergence (15 substitutions and 6 gaps over 630 bases) in the D1/D2 domains, and by 13.4 % divergence (41 substitutions and 27 gaps over 508 bases) in the ITS regions. Physiologically, the fermentation of glucose, galactose, sucrose, trehalose, and raffinose in Durham tubes was observed for the strains of this new yeast. Based on the phenotypical and molecular characteristics presented, the two strains are proposed as a new species, Cryptococcus nanyangensis sp. nov., with the type strain KCY-1(T) (=CICC 1976(T) = CBS 12474(T)).

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

Biologische Wirkungen der Bestrahlung mit schweren Ionen

NASA Astrophysics Data System (ADS)

Kiefer, Jürgen

1982-06-01

Experiments with accelerated heavy ions may contribute to the understanding of biological radiation action. After outlining the theoretical background experiments are described which were carried out at the UNILAC-machine (Gesellschaft für Schwerionenforschung, Darmstadt, Germany) where ions up to uranium can be accelerated to maximal specific energies of 10 MeV/u. Yeast cells served as biological test systems with the synthesis of ribosomal RNA (r-RNA), colony-forming ability and mutation induction as experimental endpoints. A relationship between action and energy deposition by individual particles can be demonstrated for the inhibition of r-RNA synthesis, in other cases the ion energy plays also an important role indicating that the interaction of δ-electrons from different particles contributes significantly to the biological effect.

Both endonucleolytic and exonucleolytic cleavage mediate ITS1 removal during human ribosomal RNA processing

PubMed Central

Sloan, Katherine E.; Mattijssen, Sandy; Lebaron, Simon; Tollervey, David; Pruijn, Ger J.M.

2013-01-01

Human ribosome production is up-regulated during tumorogenesis and is defective in many genetic diseases (ribosomopathies). We have undertaken a detailed analysis of human precursor ribosomal RNA (pre-rRNA) processing because surprisingly little is known about this important pathway. Processing in internal transcribed spacer 1 (ITS1) is a key step that separates the rRNA components of the large and small ribosomal subunits. We report that this was initiated by endonuclease cleavage, which required large subunit biogenesis factors. This was followed by 3′ to 5′ exonucleolytic processing by RRP6 and the exosome, an enzyme complex not previously linked to ITS1 removal. In contrast, RNA interference–mediated knockdown of the endoribonuclease MRP did not result in a clear defect in ITS1 processing. Despite the apparently high evolutionary conservation of the pre-rRNA processing pathway and ribosome synthesis factors, each of these features of human ITS1 processing is distinct from those in budding yeast. These results also provide significant insight into the links between ribosomopathies and ribosome production in human cells. PMID:23439679

A Comparison of the Beneficial Effects of Live and Heat-Inactivated Baker’s Yeast on Nile Tilapia: Suggestions on the Role and Function of the Secretory Metabolites Released from the Yeast

PubMed Central

Liu, Zhi; Xu, Li; Yang, Yalin; Tacon, Philippe; Auclair, Eric; Zhou, Zhigang

2015-01-01

Yeast is frequently used as a probiotic in aquaculture with the potential to substitute for antibiotics. In this study, the involvement and extent to which the viability of yeast cells and thus the secretory metabolites released from the yeast contribute to effects of baker’s yeast was investigated in Nile tilapia. No yeast, live yeast or heat-inactivated baker’s yeast were added to basal diets high in fishmeal and low in soybean (diet A) or low in fishmeal and high in soybean (diet B), which were fed to fish for 8 weeks. Growth, feed utilization, gut microvilli morphology, and expressions of hsp70 and inflammation-related cytokines in the intestine and head kidney were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Gut alkaline phosphatase (AKP) activity was measured after challenging the fish with Aeromonas hydrophila. Results showed that live yeast significantly improved FBW and WG (P < 0.05), and tended to improve FCR (P = 0.06) of fish compared to the control (no yeast). No significant differences were observed between inactivated yeast and control. Live yeast improved gut microvilli length (P < 0.001) and density (P < 0.05) while inactivated yeast did not. The hsp70 expression level in both the intestine and head kidney of fish was significantly reduced by live yeast (P < 0.05) but not inactivated yeast. Live yeast but not inactivated yeast reduced intestinal expression of tnfα (P < 0.05), tgfβ (P < 0.05 under diet A) and il1β (P = 0.08). Intestinal Lactococcus spp. numbers were enriched by both live and inactivated yeast. Lastly, both live and inactivated yeast reduced the gut AKP activity compared to the control (P < 0.001), indicating protection of the host against infection by A. hydrophila. In conclusion, secretory metabolites did not play major roles in the growth promotion and disease protection effects of yeast. Nevertheless, secretory metabolites were the major contributing factor towards improved gut microvilli morphology, relieved stress status, and reduced intestinal inflammation of Nile tilapia fed diets supplemented with baker’s yeast. PMID:26696403

Diversity of endophytic yeasts from sweet orange and their localization by scanning electron microscopy.

PubMed

Gai, Cláudia Santos; Lacava, Paulo Teixeira; Maccheroni, Walter; Glienke, Chirlei; Araújo, Welington Luiz; Miller, Thomas Albert; Azevedo, João Lúcio

2009-10-01

Endophytes are microorganisms that colonize plant tissues internally without causing harm to the host. Despite the increasing number of studies on sweet orange pathogens and endophytes, yeast has not been described as a sweet orange endophyte. In the present study, endophytic yeasts were isolated from sweet orange plants and identified by sequencing of internal transcribed spacer (ITS) rRNA. Plants sampled from four different sites in the state of São Paulo, Brazil exhibited different levels of CVC (citrus variegated chlorosis) development. Three citrus endophytic yeasts (CEYs), chosen as representative examples of the isolates observed, were identified as Rhodotorula mucilaginosa, Pichia guilliermondii and Cryptococcus flavescens. These strains were inoculated into axenic Citrus sinensis seedlings. After 45 days, endophytes were re-isolated in populations ranging from 10(6) to 10(9) CFU/g of plant tissue, but, in spite of the high concentrations of yeast cells, no disease symptoms were observed. Colonized plant material was examined by scanning electron microscopy (SEM), and yeast cells were found mainly in the stomata and xylem of plants, reinforcing their endophytic nature. P. guilliermondii was isolated primarily from plants colonized by the causal agent of CVC, Xylella fastidiosa. The supernatant from a culture of P. guilliermondii increased the in vitro growth of X. fastidiosa, suggesting that the yeast could assist in the establishment of this pathogen in its host plant and, therefore, contribute to the development of disease symptoms. Copyright 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

(GTG)5 MSP-PCR fingerprinting as a technique for discrimination of wine associated yeasts?

PubMed

Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Inostroza-Ponta, Mario; Valente, Patricia

2014-01-01

In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure.

(GTG)5 MSP-PCR Fingerprinting as a Technique for Discrimination of Wine Associated Yeasts?

PubMed Central

Inostroza-Ponta, Mario; Valente, Patricia

2014-01-01

In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure. PMID:25171185

An N-terminal fragment of yeast ribosomal protein L3 inhibits the cytotoxicity of pokeweed antiviral protein in Saccharomyces cerevisiae.

PubMed

Di, Rong; Tumer, Nilgun E

2014-04-11

We have previously shown that ribosomal protein L3 is required for pokeweed antiviral protein (PAP), a type I ribosome inactivating protein, to bind to ribosomes and depurinate the α-sarcin/ricin loop (SRL) in yeast. Co-expression of the N-terminal 99 amino acids of yeast L3 (L3Δ99) with PAP in transgenic tobacco plants completely abolished the toxicity of PAP. In this study, we investigated the interaction between PAP and L3Δ99 in Saccharomyces cerevisiae. Yeast cells co-transformed with PAP and L3Δ99 showed markedly reduced growth inhibition and reduced rRNA depurination by PAP, compared to cells transformed with PAP alone. Co-transformation of yeast with PAP and L3Δ21 corresponding to the highly conserved N-terminal 21 amino acids of L3Δ99, reduced the cytotoxicity of PAP. PAP mRNA and protein levels were elevated and L3Δ99 or L3Δ21 mRNA and protein levels were reduced in yeast co-transformed with PAP and L3Δ99 or with PAP and L3Δ21, respectively. PAP interacted with L3Δ21 in yeast cells in vivo and by Biacore analysis in vitro, suggesting that the interaction between L3Δ21 and PAP may inhibit PAP-mediated depurination of the SRL, leading to a reduction in the cytotoxicity of PAP.

Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.

PubMed

Gaspin, C; Cavaillé, J; Erauso, G; Bachellerie, J P

2000-04-07

Ribose methylation is a prevalent type of nucleotide modification in rRNA. Eukaryotic rRNAs display a complex pattern of ribose methylations, amounting to 55 in yeast Saccharomyces cerevisiae and about 100 in vertebrates. Ribose methylations of eukaryotic rRNAs are each guided by a cognate small RNA, belonging to the family of box C/D antisense snoRNAs, through transient formation of a specific base-pairing at the rRNA modification site. In prokaryotes, the pattern of rRNA ribose methylations has been fully characterized in a single species so far, Escherichia coli, which contains only four ribose methylated rRNA nucleotides. However, the hyperthermophile archaeon Sulfolobus solfataricus contains, like eukaryotes, a large number of (yet unmapped) rRNA ribose methylations and homologs of eukaryotic box C/D small nucleolar ribonuclear proteins have been identified in archaeal genomes. We have therefore searched archaeal genomes for potential homologs of eukaryotic methylation guide small nucleolar RNAs, by combining searches for structured motifs with homology searches. We have identified a family of 46 small RNAs, conserved in the genomes of three hyperthermophile Pyrococcus species, which we have experimentally characterized in Pyrococcus abyssi. The Pyrococcus small RNAs, the first reported homologs of methylation guide small nucleolar RNAs in organisms devoid of a nucleus, appear as a paradigm of minimalist box C/D antisense RNAs. They differ from their eukaryotic homologs by their outstanding structural homogeneity, extended consensus box motifs and the quasi-systematic presence of two (instead of one) rRNA antisense elements. Remarkably, for each small RNA the two antisense elements always match rRNA sequences close to each other in rRNA structure, suggesting an important role in rRNA folding. Only a few of the predicted P. abyssi rRNA ribose methylations have been detected so far. Further analysis of these archaeal small RNAs could provide new insights into the origin and functions of methylation guide small nucleolar RNAs and illuminate the still elusive role of rRNA ribose methylations. Copyright 2000 Academic Press.

Ethanol yield and volatile compound content in fermentation of agave must by Kluyveromyces marxianus UMPe-1 comparing with Saccharomyces cerevisiae baker's yeast used in tequila production.

PubMed

López-Alvarez, Arnoldo; Díaz-Pérez, Alma Laura; Sosa-Aguirre, Carlos; Macías-Rodríguez, Lourdes; Campos-García, Jesús

2012-05-01

In tequila production, fermentation is an important step. Fermentation determines the ethanol productivity and organoleptic properties of the beverage. In this study, a yeast isolated from native residual agave must was identified as Kluyveromyces marxianus UMPe-1 by 26S rRNA sequencing. This yeast was compared with the baker's yeast Saccharomyces cerevisiae Pan1. Our findings demonstrate that the UMPe-1 yeast was able to support the sugar content of agave must and glucose up to 22% (w/v) and tolerated 10% (v/v) ethanol concentration in the medium with 50% cells survival. Pilot and industrial fermentation of agave must tests showed that the K. marxianus UMPe-1 yeast produced ethanol with yields of 94% and 96% with respect to fermentable sugar content (glucose and fructose, constituting 98%). The S. cerevisiae Pan1 baker's yeast, however, which is commonly used in some tequila factories, showed 76% and 70% yield. At the industrial level, UMPe-1 yeast shows a maximum velocity of fermentable sugar consumption of 2.27g·L(-1)·h(-1) and ethanol production of 1.38g·L(-1)·h(-1), providing 58.78g ethanol·L(-1) at 72h fermentation, which corresponds to 96% yield. In addition, the major and minor volatile compounds in the tequila beverage obtained from UMPe-1 yeast were increased. Importantly, 29 volatile compounds were identified, while the beverage obtained from Pan1-yeast contained fewer compounds and in lower concentrations. The results suggest that the K. marxianus UMPe-1 is a suitable yeast for agave must fermentation, showing high ethanol productivity and increased volatile compound content comparing with a S. cerevisiae baker's yeast used in tequila production. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effects of dietary live and heat-inactive baker's yeast on growth, gut health, and disease resistance of Nile tilapia under high rearing density.

PubMed

Ran, Chao; Huang, Lu; Hu, Jun; Tacon, Philippe; He, Suxu; Li, Zhimin; Wang, Yibing; Liu, Zhi; Xu, Li; Yang, Yalin; Zhou, Zhigang

2016-09-01

In this study, the effects of baker's yeast as probiotics was evaluated in Nile tilapia reared at high density. Juvenile tilapia were distributed to tanks at high density (436 fish/m(3)) and fed with basal diet (CK) or diets supplemented with live (LY) or heat-inactivated yeast (HIY). Another group of fish reared at low density (218 fish/m(3)) and fed with basal diet was also included (LowCK). After 8 weeks of feeding, growth, feed utilization, gut microvilli morphology, digestive enzymes, and expressions of hsp70 and inflammation-related cytokines in the intestine were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Fish were challenged with Aeromonas hydrophila to evaluate disease resistance. High rearing density significantly decreased the growth, feed utilization, microvilli length, and disease resistance of fish (CK versus LowCK). Moreover, the intestinal hsp70 expression was increased in fish reared at high density, supporting a stress condition. Compared to CK group, supplementation of live yeast significantly increased gut microvilli length and trypsin activity, decreased intestinal hsp70 expression, and enhanced resistance of fish against A. hydrophila (reflected by reduced intestinal alkaline phosphatase activity 24 h post infection). The gut microbiota was not markedly influenced by either rearing density or yeast supplementation. Heat-inactivated yeast (HIY) didn't display the beneficial effects observed in LY except an increase in gut trypsin activity, suggesting the importance of yeast viability and thus secretory metabolites of yeast. In conclusion, live baker's yeast may alleviate the negative effects induced by crowding stress, and has the potential to be used as probiotics for tilapia reared at high density. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

PubMed

Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

2015-07-01

Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

Candida baotianmanensis sp. nov. and Candida pseudoviswanathii sp. nov., two ascosporic yeast species isolated from the gut of beetles.

PubMed

Ren, Yong-Cheng; Xu, Long-Long; Zhang, Lin; Hui, Feng-Li

2015-10-01

Four yeast strains were isolated from the gut of beetles collected on Baotianman Mountain and People's Park of Nanyang in Henan Province, China. These strains produced unconjugated asci with one or two ellipsoidal to elongate ascospores in a persistent ascus. Phylogenetic analysis of the D1/D2 domains of the LSU rRNA gene sequences indicated that the isolates represent two novel sexual species in the Candida/Lodderomyces clade. Candida baotianmanensis sp. nov. was located in a statistically well-supported branch together with Candida maltosa. Candida pseudoviswanathii sp. nov. formed a subclade with its closest relative Candida viswanathii supported by a strong bootstrap value. The two novel species were distinguished from their most closely related described species, Candida maltosa and Candida viswanathii, in the D1/D2 LSU rRNA gene and internal transcribed spacer (ITS) sequences and in phenotypic traits. The type strain of Candida baotianmanensis sp. nov. is NYNU 14719T ( = CBS 13915T = CICC 33052T), and the type strain of Candida pseudoviswanathii sp. nov. is NYNU 14772T ( = CBS 13916T = CICC 33053T). The MycoBank numbers for Candida baotianmanensis sp. nov. and Candida pseudoviswanathii sp. nov. are MB 812621 and MB 812622.

New lipid-dependent Malassezia species from parrots.

PubMed

Cabañes, F Javier; Coutinho, S Dall' Acqua; Puig, Laura; Bragulat, M Rosa; Castellá, Gemma

2016-01-01

All the currently recognized Malassezia species have been isolated from mammals. However, only a few of them have been isolated from birds. In fact, birds have been less frequently studied as carriers of Malassezia yeasts than mammals. In this study we describe two new taxa, Malassezia brasiliensis sp. nov. and Malassezia psittaci sp. nov. The isolates studied in this publication were isolated from pet parrots from Brazil. They were characterized using the current morphological and physiological identification scheme. DNA sequencing and analysis of the D1/D2 regions of the 26S rRNA gene, the ITS-5.8S rRNA gene sequences and the β-tubulin gene were also performed. The strains proposed as new species did not completely fit the phenotypic profiles of any the described species. The validation of these new species was supported by analysis of the genes studied. The multilocus sequence analysis of the three loci provides robust support to delineate these species. These studies confirm the separation of these two new species from the other species of the genus Malassezia, as well as the presence of lipid-dependent Malassezia yeasts on parrots. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Candida olivae sp. nov., a novel yeast species from 'Greek-style' black olive fermentation.

PubMed

Nisiotou, Aspasia A; Panagou, Efstathios Z; Nychas, George-John E

2010-05-01

Two yeast strains (FMCC Y-1(T) and FMCC Y-2) were recovered during a survey of the yeast biota associated with fermenting black olives, collected from an olive tree (Olea europaea L. cv. 'Conservolea') orchard in Central Greece. Phylogenetic analysis based on rRNA gene sequences (18S, 26S, and 5.8S-ITS) indicated that the two strains represent a separate species within the Candida membranifaciens clade, in close relation to Candida blattariae NRRL Y-27703(T). Electrophoretic karyotyping and physiological analysis support the affiliation of the two strains to a novel species as Candida olivae sp. nov. The novel strains are conspecific with two Candida sp. strains previously isolated from the Mid-Atlantic Ridge hydrothermal fields [Gadanho & Sampaio (2005). Microb Ecol 50, 408-417], indicating that Candida olivae sp. nov. may occupy diverse ecological niches. FMCC Y-1(T) (=CBS 11171(T) =ATCC MYA-4568(T)) is the type strain.

Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.

PubMed

James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

2013-01-01

In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain.

Structural organizations of yeast RNase P and RNase MRP holoenzymes as revealed by UV-crosslinking studies of RNA–protein interactions

PubMed Central

Khanova, Elena; Esakova, Olga; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S.

2012-01-01

Eukaryotic ribonuclease (RNase) P and RNase MRP are closely related ribonucleoprotein complexes involved in the metabolism of various RNA molecules including tRNA, rRNA, and some mRNAs. While evolutionarily related to bacterial RNase P, eukaryotic enzymes of the RNase P/MRP family are much more complex. Saccharomyces cerevisiae RNase P consists of a catalytic RNA component and nine essential proteins; yeast RNase MRP has an RNA component resembling that in RNase P and 10 essential proteins, most of which are shared with RNase P. The structural organizations of eukaryotic RNases P/MRP are not clear. Here we present the results of RNA–protein UV crosslinking studies performed on RNase P and RNase MRP holoenzymes isolated from yeast. The results indicate locations of specific protein-binding sites in the RNA components of RNase P and RNase MRP and shed light on the structural organizations of these large ribonucleoprotein complexes. PMID:22332141

Structural organizations of yeast RNase P and RNase MRP holoenzymes as revealed by UV-crosslinking studies of RNA-protein interactions.

PubMed

Khanova, Elena; Esakova, Olga; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S

2012-04-01

Eukaryotic ribonuclease (RNase) P and RNase MRP are closely related ribonucleoprotein complexes involved in the metabolism of various RNA molecules including tRNA, rRNA, and some mRNAs. While evolutionarily related to bacterial RNase P, eukaryotic enzymes of the RNase P/MRP family are much more complex. Saccharomyces cerevisiae RNase P consists of a catalytic RNA component and nine essential proteins; yeast RNase MRP has an RNA component resembling that in RNase P and 10 essential proteins, most of which are shared with RNase P. The structural organizations of eukaryotic RNases P/MRP are not clear. Here we present the results of RNA-protein UV crosslinking studies performed on RNase P and RNase MRP holoenzymes isolated from yeast. The results indicate locations of specific protein-binding sites in the RNA components of RNase P and RNase MRP and shed light on the structural organizations of these large ribonucleoprotein complexes.

Two new anamorphic yeasts species, Cyberlindnera samutprakarnensis sp. nov. and Candida thasaenensis sp. nov., isolated from industrial wastes in Thailand.

PubMed

Poomtien, Jamroonsri; Jindamorakot, Sasitorn; Limtong, Savitree; Pinphanichakarn, Pairoh; Thaniyavarn, Jiraporn

2013-01-01

Three yeast strains were isolated from industrial wastes in Thailand. Based on the phylogenetic sequence analysis of the D1/D2 region of the large subunit rRNA gene, the internal transcribed spacer (ITS1-5.8S rRNA gene-ITS2; ITS1-2) region, and their physiological characteristics, the three strains were found to represent two novel species of the ascomycetous anamorphic yeast. Strain JP52(T) represent a novel species which was named Cyberlindnera samutprakarnensis sp. nov. (type strain JP52(T); = BCC 46825(T) = JCM 17816(T) = CBS 12528(T), MycoBank no. MB800879), which was differentiated from the closely related species Cyberlindnera mengyuniae CBS 10845(T) by 2.9 % sequence divergence in the D1/D2 region and 4.4 % sequence divergence in the ITS1-2. Strain JP59(T) and JP60 were identical in their D1/D2 and ITS1-2 regions, which were closely related to those of Scheffersomyces spartinae CBS 6059(T) by 0.9 and 1.0 % sequence divergence, respectively. In addition, supportive evidence of actin gene and translational elongation factor gene by sequence divergence of 6.5 % each confirmed their distinct status. Furthermore, JP59(T) and JP60 differentiated from the closely related species in some biochemical and physiological characteristics. These two strains were assigned as a single novel species which was named Candida thasaenensis sp. nov. (type JP59(T) = BCC 46828(T) = JCM 17817(T) = CBS 12529(T), MycoBank no. MB800880).

Comparative evaluation of matrix-assisted laser desorption ionisation-time of flight mass spectrometry and conventional phenotypic-based methods for identification of clinically important yeasts in a UK-based medical microbiology laboratory.

PubMed

Fatania, Nita; Fraser, Mark; Savage, Mike; Hart, Jason; Abdolrasouli, Alireza

2015-12-01

Performance of matrix-assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-TOF MS) was compared in a side-by side-analysis with conventional phenotypic methods currently in use in our laboratory for identification of yeasts in a routine diagnostic setting. A diverse collection of 200 clinically important yeasts (19 species, five genera) were identified by both methods using standard protocols. Discordant or unreliable identifications were resolved by sequencing of the internal transcribed spacer region of the rRNA gene. MALDI-TOF and conventional methods were in agreement for 182 isolates (91%) with correct identification to species level. Eighteen discordant results (9%) were due to rarely encountered species, hence the difficulty in their identification using traditional phenotypic methods. MALDI-TOF MS enabled rapid, reliable and accurate identification of clinically important yeasts in a routine diagnostic microbiology laboratory. Isolates with rare, unusual or low probability identifications should be confirmed using robust molecular methods. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Adaptability of lactic acid bacteria and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava and use of competitive strains as starters.

PubMed

Vogelmann, Stephanie A; Seitter, Michael; Singer, Ulrike; Brandt, Markus J; Hertel, Christian

2009-04-15

The adaptability of lactic acid bacteria (LAB) and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava was investigated using PCR-DGGE and bacteriological culture combined with rRNA gene sequence analysis. Sourdoughs were prepared either from flours of the cereals wheat, rye, oat, barley, rice, maize, and millet, or from the pseudocereals amaranth, quinoa, and buckwheat, or from cassava, using a starter consisting of various species of LAB and yeasts. Doughs were propagated until a stable microbiota was established. The dominant LAB and yeast species were Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus paralimentarius, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus spicheri, Issatchenkia orientalis and Saccharomyces cerevisiae. The proportion of the species within the microbiota varied. L. paralimentarius dominated in the pseudocereal sourdoughs, L. fermentum, L. plantarum and L. spicheri in the cassava sourdough, and L. fermentum, L. helveticus and L. pontis in the cereal sourdoughs. S. cerevisiae constituted the dominating yeast, except for quinoa sourdough, where I. orientalis also reached similar counts, and buckwheat and oat sourdoughs, where no yeasts could be detected. To assess the usefulness of competitive LAB and yeasts as starters, the fermentations were repeated using flours from rice, maize, millet and the pseudocereals, and by starting the dough fermentation with selected dominant strains. At the end of fermentation, most of starter strains belonged to the dominating microbiota. For the rice, millet and quinoa sourdoughs the species composition was similar to that of the prior fermentation, whereas in the other sourdoughs, the composition differed.

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Fluorescence In Situ Hybridization with Peptide Nucleic Acid Probes for Rapid Identification of Candida albicans Directly from Blood Culture Bottles

PubMed Central

Rigby, Susan; Procop, Gary W.; Haase, Gerhard; Wilson, Deborah; Hall, Geraldine; Kurtzman, Cletus; Oliveira, Kenneth; Von Oy, Sabina; Hyldig-Nielsen, Jens J.; Coull, James; Stender, Henrik

2002-01-01

A new fluorescence in situ hybridization (FISH) method that uses peptide nucleic acid (PNA) probes for identification of Candida albicans directly from positive-blood-culture bottles in which yeast was observed by Gram staining (herein referred to as yeast-positive blood culture bottles) is described. The test (the C. albicans PNA FISH method) is based on a fluorescein-labeled PNA probe that targets C. albicans 26S rRNA. The PNA probe is added to smears made directly from the contents of the blood culture bottle and hybridized for 90 min at 55°C. Unhybridized PNA probe is removed by washing of the mixture (30 min), and the smears are examined by fluorescence microscopy. The specificity of the method was confirmed with 23 reference strains representing phylogenetically related yeast species and 148 clinical isolates covering the clinically most significant yeast species, including C. albicans (n = 72), C. dubliniensis (n = 58), C. glabrata (n = 5), C. krusei (n = 2), C. parapsilosis (n = 4), and C. tropicalis (n = 3). The performance of the C. albicans PNA FISH method as a diagnostic test was evaluated with 33 routine and 25 simulated yeast-positive blood culture bottles and showed 100% sensitivity and 100% specificity. It is concluded that this 2.5-h method for the definitive identification of C. albicans directly from yeast-positive blood culture bottles provides important information for optimal antifungal therapy and patient management. PMID:12037084

Saccharomyces jurei sp. nov., isolation and genetic identification of a novel yeast species from Quercus robur.

PubMed

Naseeb, Samina; James, Stephen A; Alsammar, Haya; Michaels, Christopher J; Gini, Beatrice; Nueno-Palop, Carmen; Bond, Christopher J; McGhie, Henry; Roberts, Ian N; Delneri, Daniela

2017-06-01

Two strains, D5088T and D5095, representing a novel yeast species belonging to the genus Saccharomyces were isolated from oak tree bark and surrounding soil located at an altitude of 1000 m above sea level in Saint Auban, France. Sequence analyses of the internal transcribed spacer (ITS) region and 26S rRNA D1/D2 domains indicated that the two strains were most closely related to Saccharomyces mikatae and Saccharomyces paradoxus. Genetic hybridization analyses showed that both strains are reproductively isolated from all other Saccharomyces species and, therefore, represent a distinct biological species. The species name Saccharomyces jurei sp. nov. is proposed to accommodate these two strains, with D5088T (=CBS 14759T=NCYC 3947T) designated as the type strain.

TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p.

PubMed

Bodem, J; Dobreva, G; Hoffmann-Rohrer, U; Iben, S; Zentgraf, H; Delius, H; Vingron, M; Grummt, I

2000-08-01

Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro.

TIF-IA, the factor mediating growth-dependent control of ribosomal RNA synthesis, is the mammalian homolog of yeast Rrn3p

PubMed Central

Bodem, Jochen; Dobreva, Gergana; Hoffmann-Rohrer, Urs; Iben, Sebastian; Zentgraf, Hanswalter; Delius, Hajo; Vingron, Martin; Grummt, Ingrid

2000-01-01

Cells carefully modulate the rate of rRNA transcription in order to prevent an overinvestment in ribosome synthesis under less favorable nutritional conditions. In mammals, growth-dependent regulation of RNA polymerase I (Pol I) transcription is mediated by TIF-IA, an essential initiation factor that is active in extracts from growing but not starved or cycloheximide-treated mammalian cells. Here we report the molecular cloning and functional characterization of recombinant TIF-IA, which turns out to be the mammalian homolog of the yeast factor Rrn3p. We demonstrate that TIF-IA interacts with Pol I in the absence of template DNA, augments Pol I transcription in vivo and rescues transcription in extracts from growth-arrested cells in vitro. PMID:11265758

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Biological diversity of yeasts in the gastrointestinal tract of weaned piglets kept under different farm conditions.

PubMed

Urubschurov, Vladimir; Janczyk, Pawel; Pieper, Robert; Souffrant, Wolfgang B

2008-12-01

The study was conducted to determine yeasts present in the gastrointestinal tract (GIT) of piglets kept under experimental farm (EF) and commercial farm (CF) conditions. Ninety five German Landrace full- and half-sibling piglets were sacrificed at 39 days of age. Sixty eight piglets were weaned at 28th day of life, when they were offered one diet ad libitum. Twenty seven piglets remained unweaned by their dams. None of the piglets received any creep feed before weaning. Digesta samples were collected from 1/3 distal small intestine (SI), caecum and proximal colon. One hundred seventy three colonies of isolated yeasts were characterized by sequence analysis of the PCR-amplified D1/D2 domain of the 26S rRNA gene with following alignment of the recovered sequences to GenBank entries. From the 17 phylotypes found, isolates most closely related to Galactomyces geotrichum, Kazachstania slooffiae and Candida catenulata dominated in the GIT of CF piglets. Kazachstania slooffiae and Candida glabrata dominated in GIT of EF piglets. Sørenson and Morisita-Horn similarity indices between farms were low (0.44 and 0.54 respectively) and the Simpson diversity index was higher for EF (7.58) than for CF (4.34). The study brings new data on yeasts composition in the pig GIT and shows differences in yeasts biodiversity between farms operated at different hygiene conditions.

Cyclin-dependent Kinase 9 Links RNA Polymerase II Transcription to Processing of Ribosomal RNA*

PubMed Central

Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

2013-01-01

Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3′ extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3′ processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3′ rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing. PMID:23744076

Fervidicella metallireducens gen. nov., sp. nov., a thermophilic, anaerobic bacterium from geothermal waters.

PubMed

Ogg, Christopher D; Patel, Bharat K C

2010-06-01

A strictly anaerobic, thermophilic bacterium, designated strain AeB(T), was isolated from microbial mats colonizing a run-off channel formed by free-flowing thermal water from a bore well (registered number 17263) of the Great Artesian Basin, Australia. Cells of strain AeB(T) were slightly curved rods (2.5-6.0x1.0 mum) that stained Gram-negative and formed spherical terminal to subterminal spores. The strain grew optimally in tryptone-yeast extract-Casamino acids medium at 50 degrees C (range 37-55 degrees C) and pH 7 (range pH 5-9). Strain AeB(T) grew poorly on yeast extract (0.2 %) and tryptone (0.2 %) as sole carbon sources, which were obligately required for growth on other energy sources. Growth of strain AeB(T) increased in the presence of various carbohydrates and amino acids, but not organic acids. End products detected from glucose fermentation were ethanol, acetate, CO2 and H2. In the presence of 0.2 % yeast extract, iron(III), manganese(IV), vanadium(V) and cobalt(III) were reduced, but not sulfate, thiosulfate, sulfite, elemental sulfur, nitrate or nitrite. Iron(III) was also reduced in the presence of tryptone, peptone, Casamino acids and amyl media (Research Achievement), but not starch, xylan, chitin, glycerol, ethanol, pyruvate, benzoate, lactate, acetate, propionate, succinate, glycine, serine, lysine, threonine, arginine, glutamate, valine, leucine, histidine, alanine, aspartate, isoleucine or methionine. Growth was inhibited by chloramphenicol, streptomycin, tetracycline, penicillin, ampicillin and NaCl concentrations >2 %. The DNA G+C content was 35.4+/-1 mol%, as determined by the thermal denaturation method. 16S rRNA gene sequence analysis indicated that strain AeB(T) is a member of the family Clostridiaceae, class Clostridia, phylum 'Firmicutes', and is positioned approximately equidistantly between the genera Sarcina, Anaerobacter, Caloramator and Clostridium (16S rRNA gene similarity values of 87.8-90.9 %). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain AeB(T) is considered to represent a novel species in a new genus, for which the name Fervidicella metallireducens gen. nov., sp. nov. is proposed; the type strain is AeB(T) (=JCM 15555(T)=KCTC 5667(T)).

Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces cerevisiae.

PubMed

Uthe, Henriette; Vanselow, Jens T; Schlosser, Andreas

2017-02-27

Here we present the most comprehensive analysis of the yeast Mediator complex interactome to date. Particularly gentle cell lysis and co-immunopurification conditions allowed us to preserve even transient protein-protein interactions and to comprehensively probe the molecular environment of the Mediator complex in the cell. Metabolic 15 N-labeling thereby enabled stringent discrimination between bona fide interaction partners and nonspecifically captured proteins. Our data indicates a functional role for Mediator beyond transcription initiation. We identified a large number of Mediator-interacting proteins and protein complexes, such as RNA polymerase II, general transcription factors, a large number of transcriptional activators, the SAGA complex, chromatin remodeling complexes, histone chaperones, highly acetylated histones, as well as proteins playing a role in co-transcriptional processes, such as splicing, mRNA decapping and mRNA decay. Moreover, our data provides clear evidence, that the Mediator complex interacts not only with RNA polymerase II, but also with RNA polymerases I and III, and indicates a functional role of the Mediator complex in rRNA processing and ribosome biogenesis.

Effect of postharvest practices including degreening on citrus carpoplane microbial biomes.

PubMed

Gomba, A; Chidamba, L; Korsten, L

2017-04-01

To investigate the effect of commercial citrus packhouse processing steps on the fruit surface microbiome of Clementines and Palmer navel oranges. Viable bacteria, yeast and fungi counts, and the pyrosequencing analysis of the 16S rRNA and ITS were used to evaluate the community structure and population dynamics of phylloepiphytic bacteria and fungi associated with commercial postharvest processing. Drenching significantly reduced microbial counts in all cases except for yeasts on navels, while the extent of degreening effects varied between the citrus varieties. Pyrosequencing analysis showed a total of 4409 bacteria and 5792 fungi nonchimeric unique sequences with an average of 1102 bacteria and 1448 fungi reads per sample. Dominant phyla on the citrus carpoplane were Proteobacteria (53·5%), Actinobacteria (19·9%), Bacteroidetes (5·6%) and Deinococcus-Thermus (5·4%) for bacteria and Ascomycota (80·5%) and Basidiomycota (9·8%) for fungi. Beginning with freshly harvested fruit fungal diversity declined significantly after drenching, but had little effect on bacteria and populations recovered during degreening treatments, including those for Penicillium sp. Packhouse processing greatly influences microbial communities on the citrus carpoplane. A broad orange biome was described with pyrosequencing and gave insight into the likely survival and persistence of pathogens, especially as they may affect the quality and safety of the packed product. A close examination of the microbiota of fruit and the impact of intervention strategies on the ecological balance may provide a more durable approach to reduce losses and spoilage. © 2017 The Society for Applied Microbiology.

The microbiology of Bandji, palm wine of Borassus akeassii from Burkina Faso: identification and genotypic diversity of yeasts, lactic acid and acetic acid bacteria.

PubMed

Ouoba, L I I; Kando, C; Parkouda, C; Sawadogo-Lingani, H; Diawara, B; Sutherland, J P

2012-12-01

To investigate physicochemical characteristics and especially genotypic diversity of the main culturable micro-organisms involved in fermentation of sap from Borassus akeassii, a newly identified palm tree from West Africa. Physicochemical characterization was performed using conventional methods. Identification of micro-organisms included phenotyping and sequencing of: 26S rRNA gene for yeasts, 16S rRNA and gyrB genes for lactic acid bacteria (LAB) and acetic acid bacteria (AAB). Interspecies and intraspecies genotypic diversities of the micro-organisms were screened respectively by amplification of the ITS1-5.8S rDNA-ITS2/16S-23S rDNA ITS regions and repetitive sequence-based PCR (rep-PCR). The physicochemical characteristics of samples were: pH: 3.48-4.12, titratable acidity: 1.67-3.50 mg KOH g(-1), acetic acid: 0.16-0.37%, alcohol content: 0.30-2.73%, sugars (degrees Brix): 2.70-8.50. Yeast included mainly Saccharomyces cerevisiae and species of the genera Arthroascus, Issatchenkia, Candida, Trichosporon, Hanseniaspora, Kodamaea, Schizosaccharomyces, Trigonopsis and Galactomyces. Lactobacillus plantarum was the predominant LAB species. Three other species of Lactobacillus were also identified as well as isolates of Leuconostoc mesenteroides, Fructobacillus durionis and Streptococcus mitis. Acetic acid bacteria included nine species of the genus Acetobacter with Acetobacter indonesiensis as predominant species. In addition, isolates of Gluconobacter oxydans and Gluconacetobacter saccharivorans were also identified. Intraspecies diversity was observed for some species of micro-organisms including four genotypes for Acet. indonesiensis, three for Candida tropicalis and Lactobacillus fermentum and two each for S. cerevisiae, Trichosporon asahii, Candida pararugosa and Acetobacter tropicalis. fermentation of palm sap from B. akeassii involved multi-yeast-LAB-AAB cultures at genus, species and intraspecies level. First study describing microbiological and physicochemical characteristics of palm wine from B. akeassii. Genotypic diversity of palm wine LAB and AAB not reported before is demonstrated and this constitutes valuable information for better understanding of the fermentation which can be used to improve the product quality and develop added value by-products. © 2012 The Society for Applied Microbiology.

MALDI-TOF mass spectrometry proteomic phenotyping of clinically relevant fungi.

PubMed

Putignani, Lorenza; Del Chierico, Federica; Onori, Manuela; Mancinelli, Livia; Argentieri, Marta; Bernaschi, Paola; Coltella, Luana; Lucignano, Barbara; Pansani, Laura; Ranno, Stefania; Russo, Cristina; Urbani, Andrea; Federici, Giorgio; Menichella, Donato

2011-03-01

Proteomics is particularly suitable for characterising human pathogens with high life cycle complexity, such as fungi. Protein content and expression levels may be affected by growth states and life cycle morphs and correlate to species and strain variation. Identification and typing of fungi by conventional methods are often difficult, time-consuming and frequently, for unusual species, inconclusive. Proteomic phenotypes from MALDI-TOF MS were employed as analytical and typing expression profiling of yeast, yeast-like species and strain variants in order to achieve a microbial proteomics population study. Spectra from 303 clinical isolates were generated and processed by standard pattern matching with a MALDI-TOF Biotyper (MT). Identifications (IDs) were compared to a reference biochemical-based system (Vitek-2) and, when discordant, MT IDs were verified with genotyping IDs, obtained by sequencing the 25-28S rRNA hypervariable D2 region. Spectra were converted into virtual gel-like formats, and hierarchical clustering analysis was performed for 274 Candida profiles to investigate species and strain typing correlation. MT provided 257/303 IDs consistent with Vitek-2 ones. However, amongst 26/303 discordant MT IDs, only 5 appeared "true". No MT identification was achieved for 20/303 isolates for incompleteness of database species variants. Candida spectra clustering agreed with identified species and topology of Candida albicans and Candida parapsilosis specific dendrograms. MT IDs show a high analytical performance and profiling heterogeneity which seems to complement or even outclass existing typing tools. This variability reflects the high biological complexity of yeasts and may be properly exploited to provide epidemiological tracing and infection dispersion patterns.

Zooming-in on floral nectar: a first exploration of nectar-associated bacteria in wild plant communities.

PubMed

Alvarez-Pérez, Sergio; Herrera, Carlos M; de Vega, Clara

2012-06-01

Floral nectar of some animal-pollinated plants usually harbours highly adapted yeast communities which can profoundly alter nectar characteristics and, therefore, potentially have significant impacts on plant reproduction through their effects on insect foraging behaviour. Bacteria have also been occasionally observed in floral nectar, but their prevalence, phylogenetic diversity and ecological role within plant-pollinator-yeast systems remains unclear. Here we present the first reported survey of bacteria in floral nectar from a natural plant community. Culturable bacteria occurring in a total of 71 nectar samples collected from 27 South African plant species were isolated and identified by 16S rRNA gene sequencing. Rarefaction-based analyses were used to assess operational taxonomic units (OTUs) richness at the plant community level using nectar drops as sampling units. Our results showed that bacteria are common inhabitants of floral nectar of South African plants (53.5% of samples yielded growth), and their communities are characterized by low species richness (18 OTUs at a 16S rRNA gene sequence dissimilarity cut-off of 3%) and moderate phylogenetic diversity, with most isolates belonging to the Gammaproteobacteria. Furthermore, isolates showed osmotolerance, catalase activity and the ability to grow under microaerobiosis, three traits that might help bacteria to overcome important factors limiting their survival and/or growth in nectar. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Candida ruelliae sp. nov., a novel yeast species isolated from flowers of Ruellia sp. (Acanthaceae).

PubMed

Saluja, Puja; Prasad, Gandham S

2008-06-01

Two novel yeast strains designated as 16Q1 and 16Q3 were isolated from flowers of the Ruellia species of the Acanthaceae family. The D1/D2 domain and ITS sequences of these two strains were identical. Sequence analysis of the D1/D2 domain of large-subunit rRNA gene indicated their relationship to species of the Candida haemulonii cluster. However, they differ from C. haemulonii by 14% nucleotide sequence divergence, from Candida pseudohaemulonii by 16.1% and from C. haemulonii type II by 16.5%. These strains also differ in 18 physiological tests from the type strain of C. haemulonii, and 12 and 16 tests, respectively, from C. pseudohaemulonii and C. haemulonii type II. They also differ from C. haemulonii and other related species by more than 13% sequence divergence in the internal transcribed spacer region. In the SSU rRNA gene sequences, strain 16Q1 differs by 1.7% nucleotide divergence from C. haemulonii. Sporulation was not observed in pure or mixed cultures on several media examined. All these data support the assignment of these strains to a novel species; we have named them as Candida ruelliae sp. nov., and designate strain 16Q1(T)=MTCC 7739(T)=CBS10815(T) as type strain of the novel species.

Evolution of bacterial consortia in spontaneously started rye sourdoughs during two months of daily propagation.

PubMed

Bessmeltseva, Marianna; Viiard, Ene; Simm, Jaak; Paalme, Toomas; Sarand, Inga

2014-01-01

The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping.

Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage

PubMed Central

Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

2018-01-01

Objective This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Methods Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. Results In addition to species of Candida glabrata and Pichia kudriavzevii (P. kudriavzevii) previously isolated in WCC and TMR, Pichia manshurica (P. manshurica), Candida ethanolica (C. ethanolica), and Zygosaccharomyces bailii (Z. bailii) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. Conclusion The inhibition of yeasts, particularly P. kudriavzevii, probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast species during aerobic deterioration of TMR silages. PMID:28728388

Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage.

PubMed

Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

2018-02-01

This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. In addition to species of Candida glabrata and Pichia kudriavzevii ( P. kudriavzevii ) previously isolated in WCC and TMR, Pichia manshurica ( P. manshurica ), Candida ethanolica ( C. ethanolica ), and Zygosaccharomyces bailii ( Z. bailii ) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. The inhibition of yeasts, particularly P. kudriavzevii , probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast species during aerobic deterioration of TMR silages.

Influencing cocoa flavour using Pichia kluyveri and Kluyveromyces marxianus in a defined mixed starter culture for cocoa fermentation.

PubMed

Crafack, Michael; Mikkelsen, Morten B; Saerens, Sofie; Knudsen, Morten; Blennow, Andreas; Lowor, Samuel; Takrama, Jemmy; Swiegers, Jan H; Petersen, Gert B; Heimdal, Hanne; Nielsen, Dennis S

2013-10-01

The potential impact of aromatic and pectinolytic yeasts on cocoa flavour was investigated using two defined mixed starter cultures encompassing strains of Pichia kluyveri and Kluyveromyces marxianus for inoculating cocoa beans in small scale tray fermentations. Samples for microbial and metabolite analysis were collected at 12-24 hour intervals during 120 h of fermentation. Yeast isolates were grouped by (GTG)5-based rep-PCR fingerprinting and identified by sequencing of the D1/D2 region of the 26S rRNA gene and the actin gene. Pulsed Field Gel Electrophoresis (PFGE) was conducted on isolates belonging to the species P. kluyveri and K. marxianus to verify strain level identity with the inoculated strains. Furthermore, Denaturing Gradient Gel Electrophoresis (DGGE) was performed to follow yeast and bacterial dynamics over time including the presence of the bacterial inoculum consisting of Lactobacillus fermentum and Acetobacter pasteurianus. Yeast cell counts peaked after 12 h of fermentation with the predominant species being identified as Hanseniaspora opuntiae and Hanseniaspora thailandica. P. kluyveri and K. marxianus were found to compose 9.3% and 13.5% of the yeast population, respectively, after 12 h of fermentation whilst PFGE showed that ~88% of all P. kluyveri isolates and 100% of all K. marxianus isolates were identical to the inoculated strains. Despite never being the dominant yeast species at any stage of fermentation, the un-conched chocolates produced from the two inoculated fermentations were judged by sensory analysis to differ in flavour profile compared to the spontaneously fermented control. This could indicate that yeasts have a greater impact on the sensory qualities of cocoa than previously assumed. © 2013.

Coexistence of Lactic Acid Bacteria and Potential Spoilage Microbiota in a Dairy Processing Environment

PubMed Central

Stellato, Giuseppina; De Filippis, Francesca; La Storia, Antonietta

2015-01-01

Microbial contamination in food processing plants can play a fundamental role in food quality and safety. In this study, the microbiota in a dairy plant was studied by both 16S rRNA- and 26S rRNA-based culture-independent high-throughput amplicon sequencing. Environmental samples from surfaces and tools were studied along with the different types of cheese produced in the same plant. The microbiota of environmental swabs was very complex, including more than 200 operational taxonomic units with extremely variable relative abundances (0.01 to 99%) depending on the species and sample. A core microbiota shared by 70% of the samples indicated a coexistence of lactic acid bacteria with a remarkable level of Streptococcus thermophilus and possible spoilage-associated bacteria, including Pseudomonas, Acinetobacter, and Psychrobacter, with a relative abundance above 50%. The most abundant yeasts were Kluyveromyces marxianus, Yamadazyma triangularis, Trichosporon faecale, and Debaryomyces hansenii. Beta-diversity analyses showed a clear separation of environmental and cheese samples based on both yeast and bacterial community structure. In addition, predicted metagenomes also indicated differential distribution of metabolic pathways between the two categories of samples. Cooccurrence and coexclusion pattern analyses indicated that the occurrence of potential spoilers was excluded by lactic acid bacteria. In addition, their persistence in the environment can be helpful to counter the development of potential spoilers that may contaminate the cheeses, with possible negative effects on their microbiological quality. PMID:26341209

Candida xylanilytica sp. nov., a xylan-degrading yeast species isolated from Thailand.

PubMed

Boonmak, Chanita; Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Yongmanitchai, Wichien; Suzuki, Ken-ichiro; Nakase, Takashi; Kawasaki, Hiroko

2011-05-01

Xylan is a major component of hemicellulose, which constitutes about 40 % of plant biomass. Hydrolysis of xylan into simple sugars is one of the important steps in the conversion of lignocellulosic material to value-added products. During an investigation of cellulose- and xylan-degrading yeasts, two yeast strains that were able to use cellulose and xylan as sole carbon source were found to represent a phylogenetically distinct species in the Spathaspora clade. The closest species in terms of pairwise sequence similarity in the D1/D2 domain of the LSU rRNA gene was Candida subhashii. The novel species can be distinguished from the other species in the Spathaspora clade based on the ability to assimilate methanol and raffinose, growth in medium containing 60 % glucose, and growth at 42 °C. It ferments glucose but not other carbohydrates. The name Candida xylanilytica sp. nov. is proposed for this species. The type strain is KU-Xn11(T) ( = NBRC 106499(T)  = BCC 34694(T)  = CBS 11761(T)).

Candida chanthaburiensis sp. nov., Candida kungkrabaensis sp. nov. and Candida suratensis sp. nov., three novel yeast species from decaying plant materials submerged in water of mangrove forests.

PubMed

Limtong, Savitree; Yongmanitchai, Wichien

2010-10-01

In a taxonomic study of yeasts isolated from decaying plant materials submerged in water of mangrove forests in Thailand, three strains isolated from tree bark (EM33(T)), a fallen leaf (EM40(T)) and a detached branch (SM56(T)) were found to represent three novel yeast species. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, the sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene, and the phylogenetic analysis, the three strains were assigned as three novel Candida species. They were named as Candida chanthaburiensis sp. nov. (type strain EM33(T) = BCC 23057(T) = NBRC 102176(T) = CBS 10926(T)), Candida kungkrabaensis sp. nov. (type strain EM40(T) = BCC 23060(T) = NBRC 102179(T) = CBS 10927(T)), and Candida suratensis sp. nov. (type strain SM56(T) = BCC 25961(T) = NBRC 103858(T) = CBS 10928(T)).

Saccharomyces cerevisiae and non-Saccharomyces yeasts in grape varieties of the São Francisco Valley

PubMed Central

de Ponzzes-Gomes, Camila M.P.B.S.; de Mélo, Dângelly L.F.M.; Santana, Caroline A.; Pereira, Giuliano E.; Mendonça, Michelle O.C.; Gomes, Fátima C.O.; Oliveira, Evelyn S.; Barbosa, Antonio M.; Trindade, Rita C.; Rosa, Carlos A.

2014-01-01

The aims of this work was to characterise indigenous Saccharomyces cerevisiae strains in the naturally fermented juice of grape varieties Cabernet Sauvignon, Grenache, Tempranillo, Sauvignon Blanc and Verdejo used in the São Francisco River Valley, northeastern Brazil. In this study, 155 S. cerevisiae and 60 non-Saccharomyces yeasts were isolated and identified using physiological tests and sequencing of the D1/D2 domains of the large subunit of the rRNA gene. Among the non-Saccharomyces species, Rhodotorula mucilaginosa was the most common species, followed by Pichia kudriavzevii, Candida parapsilosis, Meyerozyma guilliermondii, Wickerhamomyces anomalus, Kloeckera apis, P. manshurica, C. orthopsilosis and C. zemplinina. The population counts of these yeasts ranged among 1.0 to 19 × 105 cfu/mL. A total of 155 isolates of S. cerevisiae were compared by mitochondrial DNA restriction analysis, and five molecular mitochondrial DNA restriction profiles were detected. Indigenous strains of S. cerevisiae isolated from grapes of the São Francisco Valley can be further tested as potential starters for wine production. PMID:25242923

Saccharomyces cerevisiae and non-Saccharomyces yeasts in grape varieties of the São Francisco Valley.

PubMed

de Ponzzes-Gomes, Camila M P B S; de Mélo, Dângelly L F M; Santana, Caroline A; Pereira, Giuliano E; Mendonça, Michelle O C; Gomes, Fátima C O; Oliveira, Evelyn S; Barbosa, Antonio M; Trindade, Rita C; Rosa, Carlos A

2014-01-01

The aims of this work was to characterise indigenous Saccharomyces cerevisiae strains in the naturally fermented juice of grape varieties Cabernet Sauvignon, Grenache, Tempranillo, Sauvignon Blanc and Verdejo used in the São Francisco River Valley, northeastern Brazil. In this study, 155 S. cerevisiae and 60 non-Saccharomyces yeasts were isolated and identified using physiological tests and sequencing of the D1/D2 domains of the large subunit of the rRNA gene. Among the non-Saccharomyces species, Rhodotorula mucilaginosa was the most common species, followed by Pichia kudriavzevii, Candida parapsilosis, Meyerozyma guilliermondii, Wickerhamomyces anomalus, Kloeckera apis, P. manshurica, C. orthopsilosis and C. zemplinina. The population counts of these yeasts ranged among 1.0 to 19 × 10(5) cfu/mL. A total of 155 isolates of S. cerevisiae were compared by mitochondrial DNA restriction analysis, and five molecular mitochondrial DNA restriction profiles were detected. Indigenous strains of S. cerevisiae isolated from grapes of the São Francisco Valley can be further tested as potential starters for wine production.

Candida potacharoeniae sp. nov. and Candida spenceri sp. nov., two novel galactose-containing ascomycetous anamorphic yeast species isolated in Thailand.

PubMed

Nakase, Takashi; Jindamorakot, Sasitorn; Imanishi, Yumi; Am-In, Somjit; Ninomiya, Shinya; Kawasaki, Hiroko; Limtong, Savitree

2010-08-01

Fifteen strains of anamorphic yeasts isolated from various natural substrates collected in various places in Thailand were found to represent two novel species of anamorphic yeast genus Candida based on the sequence analysis of the D1/D2 domain of the large subunit rRNA genes, chemotaxonomic and conventional properties used for the classification of yeasts. These strains are located in the clade including Candida etchellsii and Candida magnoliae. Fourteen strains represented by ST-490(T) (BCC 15176(T)=NBRC 106439(T)= CBS 11674(T)) are closely related to Candida sorbosivorans in the D1/D2 sequences but 11 nucleotides (2.4%) were substituted. The remaining strain, ST-594(T) (=BCC 15278(T)=NBRC 106446(T)=CBS 11673(T)) showed a close relationship to Candida geochares but 21 nucleotides (4.7%) were substituted. Apparently, these strains represent two novel Candida species of the Starmerella clade. The two species are described as Candida potacharoeniae sp. nov. and Candida spenceri sp. nov. in the present paper. Like the most species of this clade, the two species contain galactose in the cells in addition to glucose and mannose and have high mol% G + C of 54.4-55.9 and 54.9, respectively.

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology.

PubMed

Pulschen, André A; Rodrigues, Fabio; Duarte, Rubens T D; Araujo, Gabriel G; Santiago, Iara F; Paulino-Lima, Ivan G; Rosa, Carlos A; Kato, Massuo J; Pellizari, Vivian H; Galante, Douglas

2015-08-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75-2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to -6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology

PubMed Central

Pulschen, André A; Rodrigues, Fabio; Duarte, Rubens T D; Araujo, Gabriel G; Santiago, Iara F; Paulino-Lima, Ivan G; Rosa, Carlos A; Kato, Massuo J; Pellizari, Vivian H; Galante, Douglas

2015-01-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75–2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to −6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes. PMID:26147800

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology

NASA Astrophysics Data System (ADS)

Pulschen, A. A.; Rodrigues, F.; Duarte, R. T.; Araujo, G. G.; Santiago, I. F.; Paulino-Lima, Ivan G.; Rosa, Carlos A.; Kato, Massuo J.; Pellizari, Vivian H.; Galante, Douglas

2015-08-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75-2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to -6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes.

Bacteria and yeast microbiota in milk kefir grains from different Italian regions.

PubMed

Garofalo, Cristiana; Osimani, Andrea; Milanović, Vesna; Aquilanti, Lucia; De Filippis, Francesca; Stellato, Giuseppina; Di Mauro, Simone; Turchetti, Benedetta; Buzzini, Pietro; Ercolini, Danilo; Clementi, Francesca

2015-08-01

Kefir grains are a unique symbiotic association of different microrganisms, mainly lactic acid bacteria, yeasts and occasionally acetic acid bacteria, cohabiting in a natural polysaccharide and a protein matrix. The microbial composition of kefir grains can be considered as extremely variable since it is strongly influenced by the geographical origin of the grains and by the sub-culturing method used. The aim of this study was to elucidate the bacteria and yeast species occurring in milk kefir grains collected in some Italian regions by combining the results of scanning electron microscopy analysis, viable counts on selective culture media, PCR-DGGE and pyrosequencing. The main bacterial species found was Lactobacillus kefiranofaciens while Dekkera anomala was the predominant yeast. The presence of sub-dominant species ascribed to Streptococcus thermophilus, Lactococcus lactis and Acetobacter genera was also highlighted. In addition, Lc. lactis, Enterococcus sp., Bacillus sp., Acetobacter fabarum, Acetobacter lovaniensis and Acetobacter orientalis were identified as part of the cultivable community. This work further confirms both the importance of combining culture-independent and culture-dependent approaches to study microbial diversity in food and how the combination of multiple 16S rRNA gene targets strengthens taxonomic identification using sequence-based identification approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.

The presence of Enterococcus, coliforms and E. coli in a commercial yeast manufacturing process.

PubMed

O'Brien, S S; Lindsay, D; von Holy, A

2004-07-01

This study evaluated a typical commercial yeast manufacturing process for bacterial contamination. Product line samples of a commercial yeast manufacturing process and the corresponding seed yeast manufacturing process were obtained upstream from the final compressed and dry yeast products. All samples were analysed before (non-PI) and after preliminary incubation (PI) at 37 degrees C for 24 h. The PI procedure was incorporated for amplification of bacterial counts below the lower detection limit. Enterococcus, coliform and Escherichia coli counts were quantified by standard pour-plate techniques using selective media. Presence at all stages and progressive increases in counts of Enterococcus, coliforms and E. coli during processing in the commercial manufacturing operation suggested that the primary source of contamination of both compressed and dry yeast with these bacteria was the seed yeast manufacturing process and that contamination was amplified throughout the commercial yeast manufacturing process. This was confirmed by surveys of the seed yeast manufacturing process which indicated that contamination of the seed yeast with Enterococcus, coliforms and E. coli occurred during scale up of seed yeast biomass destined as inoculum for the commercial fermentation.

Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., two yeast species isolated from Cerrado ecosystem in North Brazil.

PubMed

Rosa, Carlos A; Morais, Paula B; Lachance, Marc-André; Santos, Renata O; Melo, Weilan G P; Viana, Rodney H O; Bragança, Marcos A L; Pimenta, Raphael S

2009-05-01

Two novel yeast species, Wickerhamomyces queroliae sp. nov. and Candida jalapaonensis sp. nov., were isolated, respectively, from larvae of Anastrepha mucronata (Diptera: Tephritidae) collected from ripe fruit of Peritassa campestris ('Bacupari', Hippocrateaceae) and from flowers of Centropogon cornutus (Campanulaceae) in the Cerrado ecosystem of the state of Tocantins, Brazil. Analysis of the D1/D2 large-subunit rRNA gene sequences placed W. queroliae in the Wickerhamomyces clade near Wickerhamomyces ciferri and Candida silvicultrix. Candida jalapaonensis belongs to the Wickerhamiella clade and is related to Candida drosophilae. The type strain of Wickerhamomyces queroliae is UFMG-05-T200.1(T) (=CBS 10936(T)=NRRL Y-48478(T)) and the type strain of Candida jalapaonensis is UFMG-03-T210(T) (=CBS 10935(T)=NRRL Y-48477(T)).

Wickerhamiella pagnoccae sp. nov. and Candida tocantinsensis sp. nov., two ascomycetous yeasts from flower bracts of Heliconia psittacorum (Heliconiaceae).

PubMed

Barbosa, Anne C; Morais, Camila G; Morais, Paula B; Rosa, Luiz H; Pimenta, Raphael S; Lachance, Marc-André; Rosa, Carlos A

2012-02-01

Two novel yeast species were isolated from nectar of flower bracts of Heliconia psittacorum (Heliconiaceae) collected in a Cerrado ecosystem in the state of Tocantins, northern Brazil. Wickerhamiella pagnoccae sp. nov., which is closely related to Candida jalapaonensis, is heterothallic and produces one spheroid ascospore per ascus. Candida tocantinsensis sp. nov. belongs to the Metschnikowiaceae clade and its nearest relative is Candida ubatubensis, but the sequence identity (%) in the D1/D2 domains of the rRNA gene is low. The type strain of W. pagnoccae is UFMG-F18C1(T) ( = CBS 12178(T) = NRRL Y-48735(T)) and the type strain of C. tocantinsensis is UFMG-F16D1(T) ( = CBS 12177(T) = NRRL Y-48734(T)).

Saccharomyces jurei sp. nov., isolation and genetic identification of a novel yeast species from Quercus robur

PubMed Central

Alsammar, Haya; Michaels, Christopher J.; Gini, Beatrice; Nueno-Palop, Carmen; Bond, Christopher J.; McGhie, Henry; Roberts, Ian N.

2017-01-01

Two strains, D5088T and D5095, representing a novel yeast species belonging to the genus Saccharomyces were isolated from oak tree bark and surrounding soil located at an altitude of 1000 m above sea level in Saint Auban, France. Sequence analyses of the internal transcribed spacer (ITS) region and 26S rRNA D1/D2 domains indicated that the two strains were most closely related to Saccharomyces mikatae and Saccharomyces paradoxus. Genetic hybridization analyses showed that both strains are reproductively isolated from all other Saccharomyces species and, therefore, represent a distinct biological species. The species name Saccharomyces jurei sp. nov. is proposed to accommodate these two strains, with D5088T (=CBS 14759T=NCYC 3947T) designated as the type strain. PMID:28639933

The dominant microbial community associated with fermentation of Obushera (sorghum and millet beverages) determined by culture-dependent and culture-independent methods.

PubMed

Mukisa, Ivan M; Porcellato, Davide; Byaruhanga, Yusuf B; Muyanja, Charles M B K; Rudi, Knut; Langsrud, Thor; Narvhus, Judith A

2012-11-01

Obushera includes four fermented cereal beverages from Uganda namely: Obutoko, Enturire, Ekitiribita and Obuteire, whose microbial diversity has not hitherto been fully investigated. Knowledge of the microbial diversity and dynamics in these products is crucial for understanding their safety and development of appropriate starter cultures for controlled industrial processing. Culture-dependent and culture-independent techniques including denaturating gradient gel electrophoresis (DGGE) and mixed DNA sequencing of polymerase chain reaction (PCR) amplified ribosomal RNA genes were used to study the bacteria and yeast diversity of Obushera. The pH dropped from 6.0-4.6 to 3.5-4.0 within 1-2 days for Obutoko, Enturire and Obuteire whereas that of Ekitiribita decreased to 4.4 after 4 days. Counts of lactic acid bacteria (LAB) increased from 5.0 to 11.0 log cfug(-1) and yeasts increased from 3.4 to 7.1 log cfug(-1) while coliform counts decreased from 2.0 to <1 log cfug(-1) during four days of fermentation. LAB and yeast isolates were identified by rRNA gene sequence analysis. LAB isolates included: Enterococcus spp., Lactobacillus (Lb.) plantarum, Lb. fermentum, Lb. delbrueckii, Lactococcus lactis, Leuconostoc lactis, Streptococcus (S.) infantarius subsp. infantarius, Pediococcus pentosaceus and Weisella (W.) confusa. DGGE indicated predominance of S. gallolyticus, S. infantarius subsp. infantarius, Lb. fermentum, Lb. delbrueckii, W. confusa, Lb. reuteri, Fructobacillus spp., L. lactis and L. lactis. Yeast isolates included Clavispora lusitaniae, Cyberlindnera fabianii, Issatchenkia orientalis and Saccharomyces cerevisiae. DGGE indicated predominance of S. cerevisiae in Obutoko, Enturire and Obuteire and also detected Pichia spp. and I. orientalis in Obutoko. Obushera produced in the laboratory was initially dominated by Enterobacteriaceae and later by Lactococcus spp. Enterobacteriaceae and Bacillus spp. were also detected in Ekitiribita. Development of starters for Obushera may require combinations of LAB and S. cerevisiae for Obutoko, Enturire and Obuteire and LAB for Ekitiribita. Copyright © 2012 Elsevier B.V. All rights reserved.

Fatal Saccharomyces cerevisiae aortic graft infection.

PubMed

Smith, Davey; Metzgar, David; Wills, Christopher; Fierer, Joshua

2002-07-01

Saccharomyces cerevisiae is a yeast commonly used in baking and a frequent colonizer of human mucosal surfaces. It is considered relatively nonpathogenic in immunocompetent adults (J. N. Aucott, J. Fayan, H. Grossnicklas, A. Morrissey, M. M. Lederman, and R. A. Salata, Rev. Infect. Dis. 12:406-411, 1990). We present a case of S. cerevisiae fungemia and aortic graft infection in an immunocompetent adult. This is the first reported case of S. cerevisiae fungemia where the identity of the pathogen was confirmed by rRNA sequencing.

Evolutionary relationships among pathogenic Candida species and relatives.

PubMed Central

Barns, S M; Lane, D J; Sogin, M L; Bibeau, C; Weisburg, W G

1991-01-01

Small subunit rRNA sequences have been determined for 10 of the most clinically important pathogenic species of the yeast genus Candida (including Torulopsis [Candida] glabrata and Yarrowia [Candida] lipolytica) and for Hansenula polymorpha. Phylogenetic analyses of these sequences and those of Saccharomyces cerevisiae, Kluyveromyces marxianus var. lactis, and Aspergillus fumigatus indicate that Candida albicans, C. tropicalis, C. parapsilosis, and C. viswanathii form a subgroup within the genus. The remaining significant pathogen, T. glabrata, falls into a second, distinct subgroup and is specifically related to S. cerevisiae and more distantly related to C. kefyr (psuedotropicalis) and K. marxianus var. lactis. The 18S rRNA sequence of Y. lipolytica has evolved rapidly in relation to the other Candida sequences examined and appears to be only distantly related to them. As anticipated, species of several other genera appear to bear specific relationships to members of the genus Candida. PMID:2007550

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Multicenter study evaluating the Vitek MS system for identification of medically important yeasts.

PubMed

Westblade, Lars F; Jennemann, Rebecca; Branda, John A; Bythrow, Maureen; Ferraro, Mary Jane; Garner, Omai B; Ginocchio, Christine C; Lewinski, Michael A; Manji, Ryhana; Mochon, A Brian; Procop, Gary W; Richter, Sandra S; Rychert, Jenna A; Sercia, Linda; Burnham, Carey-Ann D

2013-07-01

The optimal management of fungal infections is correlated with timely organism identification. Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) is revolutionizing the identification of yeasts isolated from clinical specimens. We present a multicenter study assessing the performance of the Vitek MS system (bioMérieux) in identifying medically important yeasts. A collection of 852 isolates was tested, including 20 Candida species (626 isolates, including 58 C. albicans, 62 C. glabrata, and 53 C. krusei isolates), 35 Cryptococcus neoformans isolates, and 191 other clinically relevant yeast isolates; in total, 31 different species were evaluated. Isolates were directly applied to a target plate, followed by a formic acid overlay. Mass spectra were acquired using the Vitek MS system and were analyzed using the Vitek MS v2.0 database. The gold standard for identification was sequence analysis of the D2 region of the 26S rRNA gene. In total, 823 isolates (96.6%) were identified to the genus level and 819 isolates (96.1%) were identified to the species level. Twenty-four isolates (2.8%) were not identified, and five isolates (0.6%) were misidentified. Misidentified isolates included one isolate of C. albicans (n = 58) identified as Candida dubliniensis, one isolate of Candida parapsilosis (n = 73) identified as Candida pelliculosa, and three isolates of Geotrichum klebahnii (n = 6) identified as Geotrichum candidum. The identification of clinically relevant yeasts using MS is superior to the phenotypic identification systems currently employed in clinical microbiology laboratories.

Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.

PubMed

Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu

2004-02-18

By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Bacteria of the Candidate Phylum TM7 are Prevalent in Acidophilic Nitrifying Sequencing-Batch Reactors

PubMed Central

Hanada, Akiko; Kurogi, Takashi; Giang, Nguyen Minh; Yamada, Takeshi; Kamimoto, Yuki; Kiso, Yoshiaki; Hiraishi, Akira

2014-01-01

Laboratory-scale acidophilic nitrifying sequencing-batch reactors (ANSBRs) were constructed by seeding with sewage-activated sludge and cultivating with ammonium-containing acidic mineral medium (pH 4.0) with or without a trace amount of yeast extract. In every batch cycle, the pH varied between 2.7 and 4.0, and ammonium was completely converted to nitrate. Attempts to detect nitrifying functional genes in the fully acclimated ANSBRs by PCR with previously designed primers mostly gave negative results. 16S rRNA gene-targeted PCR and a subsequent denaturating gradient gel electrophoresis analysis revealed that a marked change occurred in the bacterial community during the overall period of operation, in which members of the candidate phylum TM7 and the class Gammaproteobacteria became predominant at the fully acclimated stage. This result was fully supported by a 16S rRNA gene clone library analysis, as the major phylogenetic groups of clones detected (>5% of the total) were TM7 (33%), Gammaproteobacteria (37%), Actinobacteria (10%), and Alphaproteobacteria (8%). Fluorescence in situ hybridization with specific probes also demonstrated the prevalence of TM7 bacteria and Gammaproteobacteria. These results suggest that previously unknown nitrifying microorganisms may play a major role in ANSBRs; however, the ecophysiological significance of the TM7 bacteria predominating in this process remains unclear. PMID:25241805

Thermotalea metallivorans gen. nov., sp. nov., a thermophilic, anaerobic bacterium from the Great Artesian Basin of Australia aquifer.

PubMed

Ogg, Christopher D; Patel, Bharat K C

2009-05-01

A strictly anaerobic, thermophilic bacterium, designated strain B2-1(T), was isolated from microbial mats colonizing a runoff channel formed by free-flowing thermal water from a Great Artesian Basin, Australia, bore well (registered number 17263). The cells of strain B2-1(T) were slightly curved rods (3.0-3.5 x 0.6-0.7 microm) which stained Gram-negative. The strain grew optimally in tryptone-yeast extract-glucose medium at 50 degrees C (temperature growth range 30-55 degrees C) and a pH of 8 (pH growth range 6.5-9). Strain B2-1(T) grew poorly on yeast extract (0.2 %) and/or tryptone (0.2 %), which were obligately required for growth on other energy sources, including a range of other carbohydrates and organic acids, but not amino acids. The end-products of glucose fermentation were ethanol and acetate. In the presence of 0.2 % yeast extract, iron(III), manganese(IV) and elemental sulfur were reduced but sulfate, thiosulfate, sulfite, nitrate and nitrite were not reduced. Growth was inhibited by chloramphenicol, streptomycin, tetracycline, penicillin, ampicillin, sodium azide and by NaCl concentrations greater than 4 % (w/v). The DNA G+C content was 48+/-1 mol% as determined by the thermal denaturation method. 16S rRNA gene sequence analysis indicated that strain B2-1(T) was a member of the family Clostridiaceae, class Clostridia, phylum Firmicutes and was most closely related to Geosporobacter subterraneus DSM 17957(T) (89.9 % similarity). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain B2-1(T) is considered to represent a novel species of a new genus, for which the name Thermotalea metallivorans gen. nov., sp. nov. is proposed. The type strain is B2-1(T) (=KCTC 5625(T)=JCM 15105(T)=DSM 21119(T)).

Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

PubMed

Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

2014-02-28

Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used as a reliable tool for rapid and accurate identification of closely related species of M. guilliermondii complex and for differentiating emerging infectious yeasts of the Saccharomycotina CTG clade.

Candida uthaithanina sp. nov., an anamorphic yeast species in Nakaseomyces clade isolated in Thailand.

PubMed

Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Kaewwichian, Rungluk; Nitiyon, Sukanya; Yongmanitchai, Wichien; Nakase, Takashi

2011-05-01

Three yeast stains were isolated from two unknown fruits (strains DD2-22-1(T) and SK44) and moss (strain ST-449) in Thailand. Analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene sequences of the three strains revealed that they belonged to the same species. In terms of pairwise sequence similarity, Candida cf. glabrata UWO(PS) 98-110.4 and Candida nivariensis were the closest undescribed and recognized taxa, but the levels of nucleotide substitutions were 1.7-1.9% and 2.0-2.2%, respectively. The levels of nucleotide substitutions were sufficient to justify the description of a separate species of Candida. In the phylogenetic tree based on the D1/D2 domain of the LSU rRNA gene the three strains were placed in a separate branch in the Nakaseomyces clade with C. cf. glabrata UWO(PS)98-110.4, C. nivariensis, Candida glabrata, Candida bracarensis, Candida kungkrabaensis and Nakaseomyces delphensis. Phenotypic characteristics of the three strains were similar which included proliferation by multilateral budding, absence of ascospores, arthrospores or ballistospores; negative for Diazonium blue B and urease tests. The major ubiquinone was Q-6. On the basis of the above findings, the three strains were assigned to a single novel species of Candida, for which the name Candida uthaithanina sp. nov is proposed. The type strain is DD2-22-1(T) (= BCC 29899(T) = NBRC 104876(T) = CBS 10932(T)).

Candida andamanensis sp. nov., Candida laemsonensis sp. nov. and Candida ranongensis sp. nov., anamorphic yeast species isolated from estuarine waters in a Thai mangrove forest.

PubMed

Am-In, Somjit; Limtong, Savitree; Yongmanitchai, Wichien; Jindamorakot, Sasitorn

2011-02-01

Five strains (RV5(T), RV140, R31(T), RS17 and RS28(T)) representing three novel anamorphic ascomycetous yeast species were isolated by membrane filtration from estuarine waters collected from a mangrove forest in Laem Son National Park, Ranong Province, Thailand, on different occasions. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and the internal transcribed spacer region and phylogenetic analysis, three strains were found to represent two novel Candida species. Two strains (RV5(T) and RV140) represented a single novel species, for which the name Candida laemsonensis sp. nov. is proposed. The type strain is RV5(T) (=BCC 35154(T) =NBRC 105873(T) =CBS 11419(T)). Strain R31(T) was assigned to a novel species that was named Candida andamanensis sp. nov. (type strain R31(T) =BCC 25965(T) =NBRC 103862(T) =CBS 10859(T)). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and phylogenetic analysis, strains RS17 and RS28(T) represented another novel species of Candida, for which the name Candida ranongensis sp. nov. is proposed. The type strain is RS28(T) (=BCC 25964(T) =NBRC 103861(T) =CBS 10861(T)).

Candida vulturna pro tempore sp. nov., a dimorphic yeast species related to the Candida haemulonis species complex isolated from flowers and clinical sample.

PubMed

Sipiczki, Matthias; Tap, Ratna Mohd

2016-10-01

In a taxonomic study of yeasts isolated from flowers in Cagayan de Oro, Mindenao Island, The Philippines, strains were identified as representing Kabatiella microsticta, Metschnikowia koreensis and a hitherto undescribed dimorphic species. Sequences of the D1/D2 domains of the LSU 26S rRNA genes, the internal transcribed spacer (ITS) regions and the SSU 18S rRNA genes were identical in the strains of the last-named group and differed from the corresponding sequences of the type strain of the closest related species, Candida duobushaemulonii, by 4 % (D1/D2), 7 % (ITS) and 1 % (SSU). In an independent study, a strain with D1/D2 and ITS sequences very similar to those of the Philippine strains was isolated in Malaysia from the blood of a patient dying of aspiration pneumonia. Both groups of isolates were moderately sensitive to anidulafungin, caspofungin, fluconazole, itraconazole and voriconazole but resistant to amphotericin B. Molecular phylogenetic analysis of the sequences placed the Philippine and Malaysian isolates close to the Candida haemulonis complex of Candida species. To reflect the geographical location of the sites of sample collection, the novel species name Candida vulturna pro tempore sp. nov. is proposed to accommodate these strains. The type strain is 11-1170T (=CBS 14366T=CCY 094-001-001T=NCAIM-Y02177T) isolated in Cagayan de Oro, The Philippines. Mycobank: MB 817222.

Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

PubMed

Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

2018-05-24

Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

Candida phyllophila sp. nov. and Candida vitiphila sp. nov., two novel yeast species from grape phylloplane in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk

2013-01-01

Three strains (K59(T), K60 and K70 (T)) representing two novel yeast species were isolated from the external surface of leaves of different wine grape (Vitis vinifera) plants, which were collected from the Kanchanaburi Research Station (N14°07'15.1″ E099°19'05.6″), Wang Dong Sub-district, Mueang District, Kanchanaburi Province, Thailand, by an enrichment technique. The sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene of two strains (K59(T) and K60) were identical and differed from that of strain K70(T). In terms of pairwise sequence similarity of the D1/D2 domain, the closest species to the three strains was Candida asparagi but with 2.3% nucleotide substitutions for strains K59(T) and K60, and 2.1% nucleotide substitutions for strain K70(T). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and the sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene, the three strains were assigned to be two novel Candida species. Two strains (K59(T) and K60) were assigned as Candida phyllophila sp. nov. (type strain K59(T)=BCC 42662(T)=NBRC 107776(T)=CBS 12671(T)). Candida vitiphila sp. nov. is proposed for strain K70(T) (=BCC 42663(T)=NBRC 107777(T)=CBS 12672(T)).

Evolution of Bacterial Consortia in Spontaneously Started Rye Sourdoughs during Two Months of Daily Propagation

PubMed Central

Simm, Jaak; Paalme, Toomas; Sarand, Inga

2014-01-01

The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping. PMID:24748058

Candida sirachaensis sp. nov. and Candida sakaeoensis sp. nov. two anamorphic yeast species from phylloplane in Thailand.

PubMed

Limtong, Savitree; Koowadjanakul, Nampueng; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Nakase, Takashi

2012-08-01

Three strains (LM008(T), LM068 and LM078(T)), representing two novel yeast species were isolated from the phylloplane of three plant species by an enrichment technique. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal spacer region, the three strains were assigned as two novel Candida species. Strain LM008(T) was assigned to be Candida sirachaensis sp. nov. (type strain LM008(T) = BCC 47628(T) = NBRC 108605(T) CBS 12094(T)) in the Starmerella clade. Two strains (LM068 and LM078(T)) represent a single species in the Lodderomyces-Spathaspora clade for which the name Candida sakaeoensis sp. nov. is proposed with the type strain LM078(T) = BCC 47632(T) = NBRC 108895(T) = CBS 12318(T).

Candida asparagi sp. nov., Candida diospyri sp. nov. and Candida qinlingensis sp. nov., novel anamorphic, ascomycetous yeast species.

PubMed

Lu, Hui-Zhong; Jia, Jian-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2004-07-01

Among ascomycetous yeasts that were isolated from several nature reserve areas in China, three anamorphic strains isolated from soil (QL 5-5T) and fruit (QL 21-2T and SN 15-1T) were revealed, by conventional characterization and molecular phylogenetic analysis based on internal transcribed spacer and large subunit (26S) rRNA gene D1/D2 region sequencing, to represent three novel species in the genus Candida. Candida qinlingensis sp. nov. (type strain, QL 5-5T=AS 2.2524T=CBS 9768T) was related closely to a teleomorphic species, Williopsis pratensis. The close relatives of Candida diospyri sp. nov. (type strain, QL 21-2T=AS 2.2525T=CBS 9769T) are Candida friedrichii and Candida membranifaciens. Candida asparagi sp. nov. (type strain, SN 15-1T=AS 2.2526T=CBS 9770T) forms a clade with Candida fructus.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Rapid Molecular Identification of Pathogenic Yeasts by Pyrosequencing Analysis of 35 Nucleotides of Internal Transcribed Spacer 2 ▿

PubMed Central

Borman, Andrew M.; Linton, Christopher J.; Oliver, Debra; Palmer, Michael D.; Szekely, Adrien; Johnson, Elizabeth M.

2010-01-01

Rapid identification of yeast species isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. Here, we have evaluated the utility of pyrosequencing analysis of a portion of the internal transcribed spacer 2 region (ITS2) for identification of pathogenic yeasts. A total of 477 clinical isolates encompassing 43 different fungal species were subjected to pyrosequencing analysis in a strictly blinded study. The molecular identifications produced by pyrosequencing were compared with those obtained using conventional biochemical tests (AUXACOLOR2) and following PCR amplification and sequencing of the D1-D2 portion of the nuclear 28S large rRNA gene. More than 98% (469/477) of isolates encompassing 40 of the 43 fungal species tested were correctly identified by pyrosequencing of only 35 bp of ITS2. Moreover, BLAST searches of the public synchronized databases with the ITS2 pyrosequencing signature sequences revealed that there was only minimal sequence redundancy in the ITS2 under analysis. In all cases, the pyrosequencing signature sequences were unique to the yeast species (or species complex) under investigation. Finally, when pyrosequencing was combined with the Whatman FTA paper technology for the rapid extraction of fungal genomic DNA, molecular identification could be accomplished within 6 h from the time of starting from pure cultures. PMID:20702674

Target of Rapamycin Signaling Regulates Metabolism, Growth, and Life Span in Arabidopsis[W][OA

PubMed Central

Ren, Maozhi; Venglat, Prakash; Qiu, Shuqing; Feng, Li; Cao, Yongguo; Wang, Edwin; Xiang, Daoquan; Wang, Jinghe; Alexander, Danny; Chalivendra, Subbaiah; Logan, David; Mattoo, Autar; Selvaraj, Gopalan; Datla, Raju

2012-01-01

Target of Rapamycin (TOR) is a major nutrition and energy sensor that regulates growth and life span in yeast and animals. In plants, growth and life span are intertwined not only with nutrient acquisition from the soil and nutrition generation via photosynthesis but also with their unique modes of development and differentiation. How TOR functions in these processes has not yet been determined. To gain further insights, rapamycin-sensitive transgenic Arabidopsis thaliana lines (BP12) expressing yeast FK506 Binding Protein12 were developed. Inhibition of TOR in BP12 plants by rapamycin resulted in slower overall root, leaf, and shoot growth and development leading to poor nutrient uptake and light energy utilization. Experimental limitation of nutrient availability and light energy supply in wild-type Arabidopsis produced phenotypes observed with TOR knockdown plants, indicating a link between TOR signaling and nutrition/light energy status. Genetic and physiological studies together with RNA sequencing and metabolite analysis of TOR-suppressed lines revealed that TOR regulates development and life span in Arabidopsis by restructuring cell growth, carbon and nitrogen metabolism, gene expression, and rRNA and protein synthesis. Gain- and loss-of-function Ribosomal Protein S6 (RPS6) mutants additionally show that TOR function involves RPS6-mediated nutrition and light-dependent growth and life span in Arabidopsis. PMID:23275579

Flowers as a reservoir of yeast diversity: description of Wickerhamiella nectarea f.a. sp. nov., and Wickerhamiella natalensis f.a. sp. nov. from South African flowers and pollinators, and transfer of related Candida species to the genus Wickerhamiella as new combinations.

PubMed

de Vega, Clara; Albaladejo, Rafael G; Guzmán, Beatriz; Steenhuisen, Sandy-Lynn; Johnson, Steven D; Herrera, Carlos M; Lachance, Marc-André

2017-08-01

Flowers offer favourable microenvironments for yeast growth, and are increasingly recognised as a rich source of novel yeast species. Independent surveys of yeasts associated with flowers and pollinators in South Africa led to the discovery of 38 strains of two new species. Physiological profiles and analysis of the internal transcribed spacer and the D1/D2 domains of the large subunit rRNA gene showed that they represent two novel species that belong to the Wickerhamiella clade. We describe the species as Wickerhamiella nectarea f.a. sp. nov. (type strain EBDCdVSA11-1T, CBS 14162T, NRRL Y-63791T) and W. natalensis f.a. sp. nov. (type strain EBDCdVSA7-1T, CBS 14161T, NRRL Y-63790T). We extend the known range of flower-associated Wickerhamiella species to South Africa and discuss the ecology and phylogenetic relationships of the clade in relation to its host species and biogeography. Examination of growth characteristics supports that the Wickerhamiella clade exhibits a high degree of evolutionary lability, and that specialisation to different niches may occur rapidly. We review the current status of floral yeast biodiversity and nectar as a reservoir of species diversity, and the importance of pollinators and biogeography. In addition, 18 species formerly assigned to the genus Candida are reassigned formally to the genus Wickerhamiella. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Multicenter Study Evaluating the Vitek MS System for Identification of Medically Important Yeasts

PubMed Central

Westblade, Lars F.; Jennemann, Rebecca; Branda, John A.; Bythrow, Maureen; Ferraro, Mary Jane; Garner, Omai B.; Ginocchio, Christine C.; Lewinski, Michael A.; Manji, Ryhana; Mochon, A. Brian; Procop, Gary W.; Richter, Sandra S.; Rychert, Jenna A.; Sercia, Linda

2013-01-01

The optimal management of fungal infections is correlated with timely organism identification. Matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (MS) is revolutionizing the identification of yeasts isolated from clinical specimens. We present a multicenter study assessing the performance of the Vitek MS system (bioMérieux) in identifying medically important yeasts. A collection of 852 isolates was tested, including 20 Candida species (626 isolates, including 58 C. albicans, 62 C. glabrata, and 53 C. krusei isolates), 35 Cryptococcus neoformans isolates, and 191 other clinically relevant yeast isolates; in total, 31 different species were evaluated. Isolates were directly applied to a target plate, followed by a formic acid overlay. Mass spectra were acquired using the Vitek MS system and were analyzed using the Vitek MS v2.0 database. The gold standard for identification was sequence analysis of the D2 region of the 26S rRNA gene. In total, 823 isolates (96.6%) were identified to the genus level and 819 isolates (96.1%) were identified to the species level. Twenty-four isolates (2.8%) were not identified, and five isolates (0.6%) were misidentified. Misidentified isolates included one isolate of C. albicans (n = 58) identified as Candida dubliniensis, one isolate of Candida parapsilosis (n = 73) identified as Candida pelliculosa, and three isolates of Geotrichum klebahnii (n = 6) identified as Geotrichum candidum. The identification of clinically relevant yeasts using MS is superior to the phenotypic identification systems currently employed in clinical microbiology laboratories. PMID:23658267

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces cerevisiae

PubMed Central

Uthe, Henriette; Vanselow, Jens T.; Schlosser, Andreas

2017-01-01

Here we present the most comprehensive analysis of the yeast Mediator complex interactome to date. Particularly gentle cell lysis and co-immunopurification conditions allowed us to preserve even transient protein-protein interactions and to comprehensively probe the molecular environment of the Mediator complex in the cell. Metabolic 15N-labeling thereby enabled stringent discrimination between bona fide interaction partners and nonspecifically captured proteins. Our data indicates a functional role for Mediator beyond transcription initiation. We identified a large number of Mediator-interacting proteins and protein complexes, such as RNA polymerase II, general transcription factors, a large number of transcriptional activators, the SAGA complex, chromatin remodeling complexes, histone chaperones, highly acetylated histones, as well as proteins playing a role in co-transcriptional processes, such as splicing, mRNA decapping and mRNA decay. Moreover, our data provides clear evidence, that the Mediator complex interacts not only with RNA polymerase II, but also with RNA polymerases I and III, and indicates a functional role of the Mediator complex in rRNA processing and ribosome biogenesis. PMID:28240253

Characterization of two subsurface H2-utilizing bacteria, Desulfomicrobium hypogeium sp. nov. and Acetobacterium psammolithicum sp. nov., and their ecological roles.

PubMed

Krumholz, L R; Harris, S H; Tay, S T; Suflita, J M

1999-06-01

We examined the relative roles of acetogenic and sulfate-reducing bacteria in H2 consumption in a previously characterized subsurface sandstone ecosystem. Enrichment cultures originally inoculated with ground sandstone material obtained from a Cretaceous formation in central New Mexico were grown with hydrogen in a mineral medium supplemented with 0.02% yeast extract. Sulfate reduction and acetogenesis occurred in these cultures, and the two most abundant organisms carrying out the reactions were isolated. Based on 16S rRNA analysis data and on substrate utilization patterns, these organisms were named Desulfomicrobium hypogeium sp. nov. and Acetobacterium psammolithicum sp. nov. The steady-state H2 concentrations measured in sandstone-sediment slurries (threshold concentration, 5 nM), in pure cultures of sulfate reducers (threshold concentration, 2 nM), and in pure cultures of acetogens (threshold concentrations 195 to 414 nM) suggest that sulfate reduction is the dominant terminal electron-accepting process in the ecosystem examined. In an experiment in which direct competition for H2 between D. hypogeium and A. psammolithicum was examined, sulfate reduction was the dominant process.

The Microbial Community Dynamics during the Vitex Honey Ripening Process in the Honeycomb

PubMed Central

Wen, Yaqin; Wang, Lin; Jin, Yue; Zhang, Jinzhen; Su, Lei; Zhang, Xiaoling; Zhou, Jinhui; Li, Yi

2017-01-01

The bacterial and fungal communities of vitex honey were surveyed by sequencing the 16S rRNA gene and the internal transcribed spacer region of ribosomal DNA. Vitex honey samples were analyzed at different stage of ripening; the vitex flower was also analyzed, and the effect of the chemical composition in the experimental setup was assessed. The results confirmed the presence of dominant Bacillus spp. as the dominant bacterial in honey, and yeast related genera was the main fungal in the honey, respectively. Lactococcus and Enterococcus were detected for the first time in honey. The proportion of most of the fungal community decreased during the honey ripening process. Multivariate analyses also showed that the fungal community of 5, 10, and 15 days honey samples tended to cluster together and were completely separated from the 1 day honey sample. The change in the fungal community showed a correlation with the variation in the chemical components, such as moisture and phenolic compounds. Together, these results suggest that ripening of honey could change its microbial composition, and decrease the potential risk of microbiology. PMID:28912763

Survey of molds, yeast and Alicyclobacillus spp. from a concentrated apple juice productive process.

PubMed

de Cássia Martins Salomão, Beatriz; Muller, Chalana; do Amparo, Hudson Couto; de Aragão, Gláucia Maria Falcão

2014-01-01

Bacteria and molds may spoil and/or contaminate apple juice either by direct microbial action or indirectly by the uptake of metabolites as off-flavours and toxins. Some of these microorganisms and/or metabolites may remain in the food even after extensive procedures. This study aim to identify the presence of molds (including heat resistant species) and Alicyclobacillus spp., during concentrated apple juice processing. Molds were isolated at different steps and then identified by their macroscopic and microscopic characteristics after cultivation on standard media at 5, 25 and 37 °C, during 7 days. Among the 19 isolated found, 63% were identified as Penicillium with 50% belonging to the P. expansum specie. With regards to heat resistant molds, the species Neosartorya fischeri, Byssochlamys fulva and also the genus Eupenicillium sp., Talaromyces sp. and Eurotium sp. were isolated. The thermoacidophilic spore-forming bacteria were identified as A. acidoterrestris by a further investigation based on 16S rRNA sequence similarity. The large contamination found indicates the need for methods to eliminate or prevent the presence of these microorganisms in the processing plants in order to avoid both spoilage of apple juice and toxin production.

Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

PubMed Central

Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

1992-01-01

Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

Dynamical analysis of yeast protein interaction network during the sake brewing process.

PubMed

Mirzarezaee, Mitra; Sadeghi, Mehdi; Araabi, Babak N

2011-12-01

Proteins interact with each other for performing essential functions of an organism. They change partners to get involved in various processes at different times or locations. Studying variations of protein interactions within a specific process would help better understand the dynamic features of the protein interactions and their functions. We studied the protein interaction network of Saccharomyces cerevisiae (yeast) during the brewing of Japanese sake. In this process, yeast cells are exposed to several stresses. Analysis of protein interaction networks of yeast during this process helps to understand how protein interactions of yeast change during the sake brewing process. We used gene expression profiles of yeast cells for this purpose. Results of our experiments revealed some characteristics and behaviors of yeast hubs and non-hubs and their dynamical changes during the brewing process. We found that just a small portion of the proteins (12.8 to 21.6%) is responsible for the functional changes of the proteins in the sake brewing process. The changes in the number of edges and hubs of the yeast protein interaction networks increase in the first stages of the process and it then decreases at the final stages.

Kondoa gutianensis f.a. sp. nov., a novel ballistoconidium-forming yeast species isolated from plant leaves.

PubMed

Liu, Xin-Zhan; Groenewald, Marizeth; Boekhout, Teun; Bai, Feng-Yan

2018-01-01

Two strains, GT-165 T and GT-261, isolated from plant leaves collected from Gutian Mountain in Zhejiang province in China were identified as a novel species of the genus Kondoa by the sequence analysis of the internal transcribed spacer (ITS) region, the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and the RNA polymerase II second largest subunit (RPB2), complemented by physiological tests. Phylogenetic analysis based on the concatenated sequences of ITS, D1/D2 and RPB2 showed that the closest known relatives of the new species are three undescribed Kondoa species and Kondoa thailandica. The ITS and D1/D2 sequences of the new species differ from the closely related species by 11-22% and 2-9%, respectively. The name Kondoa gutianensis f.a. sp. nov. (MB 820648, holotype = CGMCC 2.5703 T ; isotype: CBS 14811 T = CGMCC 2.5703 T ) is proposed to accommodate the new taxon.

Journey of a molecular biologist.

PubMed

Nomura, Masayasu

2011-01-01

My journey into a research career began in fermentation biochemistry in an applied science department during the difficult post-World War II time in Japan. Subsequently, my desire to do research in basic science developed. I was fortunate to be a postdoctoral fellow in the United States during the early days of molecular biology. From 1957 to 1960, I worked with three pioneers of molecular biology, Sol Spiegelman, James Watson, and Seymour Benzer. These experiences helped me develop into a basic research scientist. My initial research projects at Osaka University, and subsequently at the University of Wisconsin, Madison, were on the mode of action of colicins as well as on mRNA and ribosomes. Following success in the reconstitution of ribosomal subunits, my efforts focused more on ribosomes, initially on the aspects of structure, function, and in vitro assembly, such as the construction of the 30S subunit assembly map. After this, my laboratory studied the regulation of the synthesis of ribosomes and ribosomal components in Escherichia coli. Our achievements included the discovery of translational feedback regulation of ribosomal protein synthesis and the identification of several repressor ribosomal proteins used in this regulation. In 1984, I moved to the University of California, Irvine, and initiated research on rRNA transcription by RNA polymerase I in the yeast Saccharomyces cerevisiae. The use of yeast genetics combined with biochemistry allowed us to identify genes uniquely involved in rRNA synthesis and to elucidate the mechanism of initiation of transcription. This essay is a reflection on my life as a research scientist.

Evolutionary appearance of genes encoding proteins associated with box H/ACA snoRNAs: Cbf5p in Euglena gracilis, an early diverging eukaryote, and candidate Gar1p and Nop10p homologs in archaebacteria

PubMed Central

Watanabe, Yoh-ichi; Gray, Michael W.

2000-01-01

A reverse transcription–polymerase chain reaction (RT–PCR) approach was used to clone a cDNA encoding the Euglena gracilis homolog of yeast Cbf5p, a protein component of the box H/ACA class of snoRNPs that mediate pseudouridine formation in eukaryotic rRNA. Cbf5p is a putative pseudouridine synthase, and the Euglena homolog is the first full-length Cbf5p sequence to be reported for an early diverging unicellular eukaryote (protist). Phylogenetic analysis of putative pseudouridine synthase sequences confirms that archaebacterial and eukaryotic (including Euglena) Cbf5p proteins are specifically related and are distinct from the TruB/Pus4p clade that is responsible for formation of pseudouridine at position 55 in eubacterial (TruB) and eukaryotic (Pus4p) tRNAs. Using a bioinformatics approach, we also identified archaebacterial genes encoding candidate homologs of yeast Gar1p and Nop10p, two additional proteins known to be associated with eukaryotic box H/ACA snoRNPs. These observations raise the possibility that pseudouridine formation in archaebacterial rRNA may be dependent on analogs of the eukaryotic box H/ACA snoRNPs, whose evolutionary origin may therefore predate the split between Archaea (archaebacteria) and Eucarya (eukaryotes). Database searches further revealed, in archaebacterial and some eukaryotic genomes, two previously unrecognized groups of genes (here designated ‘PsuX’ and ‘PsuY’) distantly related to the Cbf5p/TruB gene family. PMID:10871366

Optimization of antifungal production by an alkaliphilic and halotolerant actinomycete, Streptomyces sp. SY-BS5, using response surface methodology.

PubMed

Souagui, Y; Tritsch, D; Grosdemange-Billiard, C; Kecha, M

2015-06-01

Optimization of medium components and physicochemical parameters for antifungal production by an alkaliphilic and salt-tolerant actinomycete designated Streptomyces sp. SY-BS5; isolated from an arid region in south of Algeria. The strain showed broad-spectrum activity against pathogenic and toxinogenic fungi. Identification of the actinomycete strain was realized on the basis of 16S rRNA gene sequencing. Antifungal production was optimized following one-factor-at-a-time (OFAT) and response surface methodology (RSM) approaches. The most suitable medium for growth and antifungal production was found using one-factor-at-a-time methodology. The individual and interaction effects of three nutritional variables, carbon source (glucose), nitrogen source (yeast extract) and sodium chloride (NaCl) were optimized by Box-Behnken design. Finally, culture conditions for the antifungal production, pH and temperature were studied and determined. Analysis of the 16S rRNA gene sequence (1454 nucleotides) assigned this strain to Streptomyces genus with 99% similarity with Streptomyces cyaneofuscatus JCM4364(T), the most closely related. The results of the optimization study show that concentrations 3.476g/L of glucose, 3.876g/L of yeast extract and 41.140g/L of NaCl are responsible for the enhancement of antifungal production by Streptomyces sp. SY-BS5. The preferable culture conditions for antifungal production were pH 10, temperature 30°C for 09 days. This study proved that RSM is usual and powerful tool for the optimization of antifungal production from actinomycetes. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Proteiniborus ethanoligenes gen. nov., sp. nov., an anaerobic protein-utilizing bacterium.

PubMed

Niu, Lili; Song, Lei; Dong, Xiuzhu

2008-01-01

A novel anaerobic, mesophilic, protein-utilizing bacterial strain, GW(T), was isolated from the mesophilic hydrogen-producing granular sludge used to treat food industry wastewater. The strain was a Gram-positive, non-spore-forming and non-motile rod. Growth of the strain was observed at 20-48 degrees C and at pH 6.4-10.0. The strain used yeast extract and peptone as carbon and energy sources. Weak growth was also observed with tryptone and Casamino acids as carbon and energy sources. The strain used none of the tested carbohydrates, alcohols or fatty acids. The fermentation products in peptone-yeast broth included ethanol, acetic acid, hydrogen and carbon dioxide. Gelatin was not hydrolysed. Nitrate was reduced. Indole was produced. NH(3) and H(2)S were not produced. The DNA G+C content of strain GW(T) was 38.0 mol%. The predominant cellular fatty acids were the saturated fatty acids C(14:0) (15.58%), C(16:0) (25.40%) and C(18:0) (12.03%). Phylogenetic analysis based on 16S rRNA gene sequence similarity revealed that strain GW(T) represented a new branch within cluster XII of the Clostridium subphylum, with <89.6% 16S rRNA gene sequence similarities to all described species. On the basis of polyphasic evidence from this study, strain GW(T) represents a new genus and novel species, for which the name Proteiniborus ethanoligenes gen. nov., sp. nov. is proposed. The type strain is GW(T) (=CGMCC 1.5055(T)=JCM 14574(T)).

Halotolerance and survival kinetics of lactic acid bacteria isolated from jalapeño pepper (Capsicum annuum L.) fermentation.

PubMed

González-Quijano, Génesis Karendash; Dorantes-Alvarez, Lidia; Hernández-Sánchez, Humberto; Jaramillo-Flores, María Eugenia; de Jesús Perea-Flores, María; Vera-Ponce de León, Arturo; Hernández-Rodríguez, César

2014-08-01

The microbiota associated with spontaneous fermentation of vegetables in a saline substrate may represent an important group of bacteria in the food industry. In this work, the lactic acid bacteria (LAB) Weissella cibaria, Lactobacillus plantarum, Lactobacillus paraplantarum, and Leuconostoc citreum were identified by partial 16S rRNA gene sequence analysis. In addition, entophytic bacteria such as Pantoea eucalypti, Pantoea anthophila, Enterobacter cowanii, and Enterobacter asburiae were detected, but they were irrelevant for the fermentation process and were inhibited after 12 h of fermentation when the pH decreased from 6.5 to 4.9. Moreover, 2 species of yeast were isolated and identified as Hanseniaspora pseudoguilliermondii and Kodamaea ohmeri by their partial 26S rRNA gene sequence. The growth of LAB was evaluated at different sodium chloride contents. L. citreum was the most halotolerant species followed by L. plantarum and W. cibaria with a concentration index to obtain a 50% population reduction (IC(50)) of 7.2%, 6.6%, and 5.2%, respectively. Furthermore, the growth of LAB and Escherichia coli O157:H7 was evaluated in the presence of the main phenylpropanoids from chilli peppers such as p-coumaric and ferulic acid. It was determined that LAB can grow in both acids at 4 mM, unlike E. coli O157:H7, whose growth is inhibited in the presence of these acids. © 2014 Institute of Food Technologists®

Spontaneous organic cocoa bean box fermentations in Brazil are characterized by a restricted species diversity of lactic acid bacteria and acetic acid bacteria.

PubMed

Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc

2011-10-01

Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm. Copyright © 2011 Elsevier Ltd. All rights reserved.

Chaperoning 5S RNA assembly

PubMed Central

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-01-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes.

PubMed

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K; Bindics, János; Slusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L; Tamaru, Hisashi

2014-11-11

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48A(NPL4) complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction.

The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes

PubMed Central

Mérai, Zsuzsanna; Chumak, Nina; García-Aguilar, Marcelina; Hsieh, Tzung-Fu; Nishimura, Toshiro; Schoft, Vera K.; Bindics, János; Ślusarz, Lucyna; Arnoux, Stéphanie; Opravil, Susanne; Mechtler, Karl; Zilberman, Daniel; Fischer, Robert L.; Tamaru, Hisashi

2014-01-01

Centromeres mediate chromosome segregation and are defined by the centromere-specific histone H3 variant (CenH3)/centromere protein A (CENP-A). Removal of CenH3 from centromeres is a general property of terminally differentiated cells, and the persistence of CenH3 increases the risk of diseases such as cancer. However, active mechanisms of centromere disassembly are unknown. Nondividing Arabidopsis pollen vegetative cells, which transport engulfed sperm by extended tip growth, undergo loss of CenH3; centromeric heterochromatin decondensation; and bulk activation of silent rRNA genes, accompanied by their translocation into the nucleolus. Here, we show that these processes are blocked by mutations in the evolutionarily conserved AAA-ATPase molecular chaperone, CDC48A, homologous to yeast Cdc48 and human p97 proteins, both of which are implicated in ubiquitin/small ubiquitin-like modifier (SUMO)-targeted protein degradation. We demonstrate that CDC48A physically associates with its heterodimeric cofactor UFD1-NPL4, known to bind ubiquitin and SUMO, as well as with SUMO1-modified CenH3 and mutations in NPL4 phenocopy cdc48a mutations. In WT vegetative cell nuclei, genetically unlinked ribosomal DNA (rDNA) loci are uniquely clustered together within the nucleolus and all major rRNA gene variants, including those rDNA variants silenced in leaves, are transcribed. In cdc48a mutant vegetative cell nuclei, however, these rDNA loci frequently colocalized with condensed centromeric heterochromatin at the external periphery of the nucleolus. Our results indicate that the CDC48ANPL4 complex actively removes sumoylated CenH3 from centromeres and disrupts centromeric heterochromatin to release bulk rRNA genes into the nucleolus for ribosome production, which fuels single nucleus-driven pollen tube growth and is essential for plant reproduction. PMID:25344531

Isolation and characterization of yeasts associated with plants growing in heavy-metal- and arsenic-contaminated soils.

PubMed

Ramos-Garza, Juan; Bustamante-Brito, Rafael; Ángeles de Paz, Gabriela; Medina-Canales, Ma Gabriela; Vásquez-Murrieta, María Soledad; Wang, En Tao; Rodríguez-Tovar, Aída Verónica

2016-04-01

Yeasts were quantified and isolated from the rhizospheres of 5 plant species grown at 2 sites of a Mexican region contaminated with arsenic, lead, and other heavy metals. Yeast abundance was about 10(2) CFU/g of soil and 31 isolates were obtained. On the basis of the phylogenetic analysis of 26S rRNA and internal transcribed spacer fragment, 6 species were identified within the following 5 genera: Cryptococcus (80.64%), Rhodotorula (6.45%), Exophiala (6.45%), Trichosporon (3.22%), and Cystobasidium (3.22%). Cryptococcus spp. was the predominant group. Pectinases (51.6%), proteases (51.6%), and xylanases (41.9%) were the enzymes most common, while poor production of siderophores (16.1%) and indole acetic acid (9.67%) was detected. Isolates of Rhodotorula mucilaginosa and Cystobasidium sloffiae could promote plant growth and seed germination in a bioassay using Brassica juncea. Resistance of isolates by arsenic and heavy metals was as follows: As(3+) ≥ 100 mmol/L, As(5+) ≥ 30 mmol/L, Zn(2+) ≥ 2 mmol/L, Pb(2+) ≥ 1.2 mmol/L, and Cu(2+) ≥ 0.5 mmol/L. Strains of Cryptococcus albidus were able to reduce arsenate (As(5+)) into arsenite (As(3+)), but no isolate was capable of oxidizing As(3+). This is the first study on the abundance and identification of rhizosphere yeasts in a heavy-metal- and arsenic-contaminated soil, and of the reduction of arsenate by the species C. albidus.

Surface Microflora of Four Smear-Ripened Cheeses

PubMed Central

Mounier, Jérôme; Gelsomino, Roberto; Goerges, Stefanie; Vancanneyt, Marc; Vandemeulebroecke, Katrien; Hoste, Bart; Scherer, Siegfried; Swings, Jean; Fitzgerald, Gerald F.; Cogan, Timothy M.

2005-01-01

The microbial composition of smear-ripened cheeses is not very clear. A total of 194 bacterial isolates and 187 yeast isolates from the surfaces of four Irish farmhouse smear-ripened cheeses were identified at the midpoint of ripening using pulsed-field gel electrophoresis (PFGE), repetitive sequence-based PCR, and 16S rRNA gene sequencing for identifying and typing the bacteria and Fourier transform infrared spectroscopy and mitochondrial DNA restriction fragment length polymorphism (mtDNA RFLP) analysis for identifying and typing the yeast. The yeast microflora was very uniform, and Debaryomyces hansenii was the dominant species in the four cheeses. Yarrowia lipolytica was also isolated in low numbers from one cheese. The bacteria were highly diverse, and 14 different species, Corynebacterium casei, Corynebacterium variabile, Arthrobacter arilaitensis, Arthrobacter sp., Microbacterium gubbeenense, Agrococcus sp. nov., Brevibacterium linens, Staphylococcus epidermidis, Staphylococcus equorum, Staphylococcus saprophyticus, Micrococcus luteus, Halomonas venusta, Vibrio sp., and Bacillus sp., were identified on the four cheeses. Each cheese had a more or less unique microflora with four to nine species on its surface. However, two bacteria, C. casei and A. arilaitensis, were found on each cheese. Diversity at the strain level was also observed, based on the different PFGE patterns and mtDNA RFLP profiles of the dominant bacterial and yeast species. None of the ripening cultures deliberately inoculated onto the surface were reisolated from the cheeses. This study confirms the importance of the adventitious, resident microflora in the ripening of smear cheeses. PMID:16269673

The gut mycobiome of the Human Microbiome Project healthy cohort.

PubMed

Nash, Andrea K; Auchtung, Thomas A; Wong, Matthew C; Smith, Daniel P; Gesell, Jonathan R; Ross, Matthew C; Stewart, Christopher J; Metcalf, Ginger A; Muzny, Donna M; Gibbs, Richard A; Ajami, Nadim J; Petrosino, Joseph F

2017-11-25

Most studies describing the human gut microbiome in healthy and diseased states have emphasized the bacterial component, but the fungal microbiome (i.e., the mycobiome) is beginning to gain recognition as a fundamental part of our microbiome. To date, human gut mycobiome studies have primarily been disease centric or in small cohorts of healthy individuals. To contribute to existing knowledge of the human mycobiome, we investigated the gut mycobiome of the Human Microbiome Project (HMP) cohort by sequencing the Internal Transcribed Spacer 2 (ITS2) region as well as the 18S rRNA gene. Three hundred seventeen HMP stool samples were analyzed by ITS2 sequencing. Fecal fungal diversity was significantly lower in comparison to bacterial diversity. Yeast dominated the samples, comprising eight of the top 15 most abundant genera. Specifically, fungal communities were characterized by a high prevalence of Saccharomyces, Malassezia, and Candida, with S. cerevisiae, M. restricta, and C. albicans operational taxonomic units (OTUs) present in 96.8, 88.3, and 80.8% of samples, respectively. There was a high degree of inter- and intra-volunteer variability in fungal communities. However, S. cerevisiae, M. restricta, and C. albicans OTUs were found in 92.2, 78.3, and 63.6% of volunteers, respectively, in all samples donated over an approximately 1-year period. Metagenomic and 18S rRNA gene sequencing data agreed with ITS2 results; however, ITS2 sequencing provided greater resolution of the relatively low abundance mycobiome constituents. Compared to bacterial communities, the human gut mycobiome is low in diversity and dominated by yeast including Saccharomyces, Malassezia, and Candida. Both inter- and intra-volunteer variability in the HMP cohort were high, revealing that unlike bacterial communities, an individual's mycobiome is no more similar to itself over time than to another person's. Nonetheless, several fungal species persisted across a majority of samples, evidence that a core gut mycobiome may exist. ITS2 sequencing data provided greater resolution of the mycobiome membership compared to metagenomic and 18S rRNA gene sequencing data, suggesting that it is a more sensitive method for studying the mycobiome of stool samples.

In situ and Enriched Microbial Community Composition and Function Associated with Coal Bed Methane from Powder River Basin Coals

NASA Astrophysics Data System (ADS)

Barnhart, Elliott; Davis, Katherine; Varonka, Matthew; Orem, William; Fields, Matthew

2016-04-01

Coal bed methane (CBM) is a relatively clean source of energy but current CBM production techniques have not sustained long-term production or produced enough methane to remain economically practical with lower natural gas prices. Enhancement of the in situ microbial community that actively generates CBM with the addition of specific nutrients could potentially sustain development. CBM production more than doubled from native microbial populations from Powder River Basin (PRB) coal beds, when yeast extract and several individual components of yeast extract (proteins and amino acids) were added to laboratory microcosms. Microbial populations capable of hydrogenotrophic (hydrogen production/utilization) methanogenesis were detected in situ and under non-stimulated conditions. Stimulation with yeast extract caused a shift in the community to microorganisms capable of acetoclastic (acetate production/utilization) methanogenesis. Previous isotope analysis from CBM production wells indicated a similar microbial community shift as observed in stimulation experiments: hydrogenotrophic methanogenesis was found throughout the PRB, but acetoclastic methanogenesis dominated major recharge areas. In conjunction, a high proportion of cyanobacterial and algal SSU rRNA gene sequences were detected in a CBM well within a major recharge area, suggesting that these phototrophic organisms naturally stimulate methane production. In laboratory studies, adding phototrophic (algal) biomass stimulated CBM production by PRB microorganisms similarly to yeast extract (~40μg methane increase per gram of coal). Analysis of the British thermal unit (BTU) content of coal from long-term incubations indicated >99.5% of BTU content remained after CBM stimulation with either algae or yeast extract. Biomimicry of in situ algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO2).

Discovering modes of action for therapeutic compounds using a genome-wide screen of yeast heterozygotes.

PubMed

Lum, Pek Yee; Armour, Christopher D; Stepaniants, Sergey B; Cavet, Guy; Wolf, Maria K; Butler, J Scott; Hinshaw, Jerald C; Garnier, Philippe; Prestwich, Glenn D; Leonardson, Amy; Garrett-Engele, Philip; Rush, Christopher M; Bard, Martin; Schimmack, Greg; Phillips, John W; Roberts, Christopher J; Shoemaker, Daniel D

2004-01-09

Modern medicine faces the challenge of developing safer and more effective therapies to treat human diseases. Many drugs currently in use were discovered without knowledge of their underlying molecular mechanisms. Understanding their biological targets and modes of action will be essential to design improved second-generation compounds. Here, we describe the use of a genome-wide pool of tagged heterozygotes to assess the cellular effects of 78 compounds in Saccharomyces cerevisiae. Specifically, lanosterol synthase in the sterol biosynthetic pathway was identified as a target of the antianginal drug molsidomine, which may explain its cholesterol-lowering effects. Further, the rRNA processing exosome was identified as a potential target of the cell growth inhibitor 5-fluorouracil. This genome-wide screen validated previously characterized targets or helped identify potentially new modes of action for over half of the compounds tested, providing proof of this principle for analyzing the modes of action of clinically relevant compounds.

Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

PubMed

Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

2010-11-01

MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

Candida adriatica sp. nov. and Candida molendinolei sp. nov., two yeast species isolated from olive oil and its by-products.

PubMed

Čadež, Neža; Raspor, Peter; Turchetti, Benedetta; Cardinali, Gianluigi; Ciafardini, Gino; Veneziani, Gianluca; Péter, Gábor

2012-09-01

Thirteen strains isolated from virgin olive oil or its by-products in several Mediterranean countries were found to be phenotypically and genetically divergent from currently recognized yeast species. Sequence analysis of the large subunit (LSU) rDNA D1/D2 domain and internal transcribed spacer regions/5.8S rDNA revealed that the strains represented two novel species described as Candida adriatica sp. nov. (type strain ZIM 2334(T) = CBS 12504(T) = NCAIM Y.02001(T)) and Candida molendinolei sp. nov. (type strain DBVPG 5508(T) = CBS 12508(T) = NCAIM Y.02000(T)). Phylogenetic analysis based on concatenated sequences of the small subunit rRNA gene, the D1/D2 region of the LSU rDNA and the translation elongation factor-1α gene suggested that C. adriatica sp. nov. and C. molendinolei sp. nov. should be placed within the Lindnera and Nakazawaea clades, respectively.

Candida sanyaensis sp. nov., an ascomycetous yeast species isolated from soil.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia; Lee, Ching-Fu

2013-01-01

Strains representing a novel ascomycetous yeast species, Candida sanyaensis, were isolated from soil samples collected on Hainan Island and Taiwan Island in China. Analysis of the D1/D2 domains of the large subunit (LUS) rRNA gene and internal transcribed spacer (ITS) regions of these strains showed that this species was related to Candida tropicalis and Candida sojae, their closest relatives. C. sanyaensis differed by three substitutions and one gap from C. tropicalis, and by four substitutions and one gap from C. sojae, in the D1/D2 domain sequences. However, the ITS sequences of C. sanyaensis were quite divergent from the latter two species, showing that it is a genetically separate species. The novel strains were also found to have very similar PCR-fingerprinting profiles which were quite distinct from those of C. tropicalis and C. sojae strains. The type strain of C. sanyaensis is HN-26(T) (= CICC 1979(T) = CBS 12637(T)).

Spathaspora piracicabensis f. a., sp. nov., a D-xylose-fermenting yeast species isolated from rotting wood in Brazil.

PubMed

Varize, Camila S; Cadete, Raquel M; Lopes, Lucas D; Christofoleti-Furlan, Renata M; Lachance, Marc-André; Rosa, Carlos A; Basso, Luiz C

2018-04-01

Two strains of a novel yeast species were isolated from rotting wood of an ornamental tree (purple quaresmeira, Tibouchina granulosa, Melastomataceae) in an Atlantic Rainforest area in Brazil. Analysis of the sequences of the internal transcribed spacer (ITS-5.8S) region and the D1/D2 domains of the large subunit rRNA gene showed that this species belongs to the Spathaspora clade, and is phylogenetically related to Spathaspora brasiliensis, Candida materiae and Sp. girioi. The novel species ferments D-xylose, producing ethanol, with amounts between 3.37 and 3.48 g L -1 ethanol from 2% D-xylose. Ascospores were not observed from this new species. The name Spathaspora piracicabensis f. a., sp. nov. is proposed to accommodate these isolates. The type strain is UFMG-CM-Y5867 T (= CBS 15054 T  = ESALQ-I54 T ). The MycoBank number is MB 822,320.

Oxidative stress, glutathione level and antioxidant response to heavy metals in multi-resistant pathogen, Candida tropicalis.

PubMed

Ilyas, Sidra; Rehman, Abdul

2015-01-01

In this study, we explored the multiple heavy metal-resistant yeast isolated from heavy metal-polluted environment. The isolated yeast showed maximum growth at 30 °C, pH 7.0, and the strain was identified as Candida tropicalis through 18S ribosomal RNA (rRNA) gene sequence analysis. Yeast cells grew well in medium containing different concentrations of heavy metal ions [CdCl₂, Pb(NO₃)₂, NaAsO₂, CuSO₄ and K₂Cr₂O₇]. Minimum inhibitory concentration (MIC) against different metal ions was ranged from 5 to 19 mM, and the metal resistance value against each metal observed by yeast cells was 5 mM (Cr), 10 mM (Cd), 15 mM (As), 14 mM (Cu) and 19 mM (Pb) and increased in the following order: Pb > Cu > As ≥ Cd > Cr. The total cellular glutathione, GSH/GSSG redox couple and metallothioneins like protein (MT) were assayed by growing cultures for 24 h and exposed to 100 mg/L of each heavy metal ion. Remarkable increase in γ-glutamylcysteinylglycine (GSH) level was determined in arsenic and cadmium treatment followed by chromium, lead and copper. Stressed cells had much more oxidized GSH than unstressed cells. GSH/GSSG ratio was significantly increased in cadmium and copper treatment in contrast to chromium, arsenic and lead. Statistical analysis revealed significantly higher cysteine level in all metal-treated samples as compared to control. Antioxidant glutathione transferase activity was not detected in metal-treated and untreated yeast samples. One-dimensional electrophoresis of proteins revealed marked differences in banding pattern of heavy metal-exposed yeast samples. A prominent 20 kDa band was observed in all treated samples suggesting that some differential proteins could be over-expressed during heavy metal treatment and might be involved in cell resistance mechanisms.

Fine Structure of Tibetan Kefir Grains and Their Yeast Distribution, Diversity, and Shift

PubMed Central

Lu, Man; Wang, Xingxing; Sun, Guowei; Qin, Bing; Xiao, Jinzhou; Yan, Shuling; Pan, Yingjie; Wang, Yongjie

2014-01-01

Tibetan kefir grains (TKGs), a kind of natural starter for fermented milk in Tibet, China, host various microorganisms of lactic acid bacteria, yeasts, and occasionally acetic acid bacteria in a polysaccharide/protein matrix. In the present study, the fine structure of TKGs was studied to shed light on this unusual symbiosis with stereomicroscopy and thin sections. The results reveal that TKGs consist of numerous small grain units, which are characterized by a hollow globular structure with a diameter between 2.0 and 9.0 mm and a wall thickness of approximately 200 µm. A polyhedron-like net structure, formed mainly by the bacteria, was observed in the wall of the grain units, which has not been reported previously to our knowledge. Towards the inside of the grain unit, the polyhedron-like net structures became gradually larger in diameter and fewer in number. Such fine structures may play a crucial role in the stability of the grains. Subsequently, the distribution, diversity, and shift of yeasts in TKGs were investigated based on thin section, scanning electron microscopy, cloning and sequencing of D1/D2 of the 26S rRNA gene, real-time quantitative PCR, and in situ hybridization with specific fluorescence-labeled oligonucleotide probes. These show that (i) yeasts appear to localize on the outer surface of the grains and grow normally together to form colonies embedded in the bacterial community; (ii) the diversity of yeasts is relatively low on genus level with three dominant species – Saccharomyces cerevisiae, Kluyveromyces marxianus, and Yarrowia lipolytica; (iii) S. cerevisiae is the stable predominant yeast species, while the composition of Kluyveromyces and Yarrowia are subject to change over time. Our results indicate that TKGs are relatively stable in structure, and culture conditions to some extent shape the microbial community and interaction in kefir grains. These findings pave the way for further study of the specific symbiotic associations between S. cerevisiae and Lactobacillus bacteria in TKGs. PMID:24977409

Vacuolar morphology of Saccharomyces cerevisiae during the process of wine making and Japanese sake brewing.

PubMed

Izawa, Shingo; Ikeda, Kayo; Miki, Takeo; Wakai, Yoshinori; Inoue, Yoshiharu

2010-09-01

Although ethanol and osmotic stress affect the vacuolar morphology of Saccharomyces cerevisiae, little information is available about changes in vacuolar morphology during the processes of wine making and Japanese sake (rice wine) brewing. Here, we elucidated changes in the morphology of yeast vacuoles using Zrc1p-GFP, a vacuolar membrane protein, so as to better understand yeast physiology during the brewing process. Wine yeast cells (OC-2 and EC1118) contained highly fragmented vacuoles in the sake mash (moromi) as well as in the grape must. Although sake yeast cells (Kyokai no. 9 and no. 10) also contained highly fragmented vacuoles during the wine-making process, they showed quite a distinct vacuolar morphology during sake brewing. Since the environment surrounding sake yeast cells in the sake mash did not differ much from that surrounding wine yeast cells, the difference in vacuolar morphology during sake brewing between wine yeast and sake yeast was likely caused by innate characters.

[Recent advances in research on Malassezia microbiota in humans].

PubMed

Sugita, Takashi; Zhang, Enshi; Tanaka, Takafumi; Nishikawa, Akemi; Tajima, Mami; Tsuboi, Ryoji

2013-01-01

Malassezia species of lipophilic yeasts account for most fungal microbiota. Although they colonize healthy skin, they are also associated with several skin diseases, including pityriasis versicolor, seborrheic dermatitis, Malassezia folliculitis, and atopic dermatitis. To date, 14 members of the Malassezia genus have been identified. Of these, both M. globosa and M. restricta predominate, regardless of skin-disease type. Comprehensive analysis of fungal microbiota in the skin of patients with atopic dermatitis using an rRNA clone library method revealed that fungal microbiota cluster according to disease severity. The external ear canal and sole of the foot are colonized by specific Malassezia microbiota.

Candida nivariensis as a New Emergent Agent of Vulvovaginal Candidiasis: Description of Cases and Review of Published Studies.

PubMed

Aznar-Marin, Pilar; Galan-Sanchez, Fátima; Marin-Casanova, Pilar; García-Martos, Pedro; Rodríguez-Iglesias, Manuel

2016-06-01

Candida nivariensis is a new emergent agent related to human infections in the vaginal tract and other localizations, but the phenotypic characteristics are very similar to Candida glabrata and can be misidentified and underdiagnosed. We described four cases of vulvovaginitis identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and confirmed the results with PCR amplification and sequencing of the entire ITS genomic region (ITS1, ITS2 and 5.8 rRNA). We reinforce the need for new diagnostic tools for the correct identification of yeast infections.

Candida aechmeae sp. nov. and Candida vrieseae sp. nov., novel yeast species isolated from the phylloplane of bromeliads in Southern Brazil.

PubMed

Landell, Melissa Fontes; Billodre, Raisa; Ramos, Jesus P; Leoncini, Orílio; Vainstein, Marilene H; Valente, Patrícia

2010-01-01

Two novel yeast species, Candida aechmeae sp. nov. and Candida vrieseae sp. nov., were isolated from bromeliads in Itapuã Park, Rio Grande do Sul, Brazil. These species are genetically isolated from all other currently recognized ascomycetous yeasts based on their sequence divergence in the D1/D2 domain of the LSU rRNA gene. C. aechmeae sp. nov. is phylogenetically close to Candida ubatubensis, a species also isolated from bromeliads in Brazil, but the novel species can be differentiated on the basis of differences in the D1/D2 domain and positive results for the assimilation of l-arabinose, raffinose, inulin and citrate. Candida vrieseae sp. nov. is phylogenetically placed in a clade near Candida membranifaciens that is composed of several species associated with insects, but the novel species can be differentiated from them by the D1/D2 and ITS gene sequences, positive results for the assimilation of nitrite and a negative result for the assimilation of ethylamine. The type strain for Candida aechmeae sp. nov. is BI153(T) (=CBS 10831(T)=NRRL Y-48456(T)) and the type strain for C. vrieseae sp. nov. is BI146(T) (=CBS 10829(T)=NRRL Y-48461(T)).

Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

PubMed

Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

2015-11-01

Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Metschnikowia maroccana f.a., sp. nov., a new yeast species associated with floral nectar from Morocco.

PubMed

de Vega, Clara; Albaladejo, Rafael G; Lachance, Marc-André

2018-04-24

Wild flowers, and in particular, nectar of flowers, have been shown to be a rich reservoir of yeast biodiversity. In a taxonomic study of yeasts recovered from floral nectar in Morocco, nine strains were found to represent a novel species. Morphological and physiological characteristics and sequence analyses of the D1/D2 region of the large subunit rRNA gene as well as the internal transcribed spacer region showed that the novel species belonged to the genus Metschnikowia. The name Metschnikowia maroccana f.a., sp. nov. (EBDCdVMor24-1 T =CBS 15053 T =NRRL Y-63972 T ) is proposed to accommodate this new species. Metschnikowia maroccana was isolated from floral nectar of Teucrium pseudochamaepitys, Teucrium polium and Gladiolus italicus. The ascosporic state of the novel species was not found. Metschnikowia maroccana was phylogenetically distinct from any currently recognized species and forms a well-supported subclade (bootstrap value 81 %) containing species associated with flowers and flower-visiting insects, including Metschnikowia gruessii, Metschnikowia lachancei and Metschnikowia vanudenii. The close genealogical relationship of M. maroccana with the M. gruessii clade is also consistent with the striking similarity of their 'aeroplane' cells morphologies and the lack of utilization of the α-glucoside trehalose. The ecology of these novel species and its probable endemicity are discussed.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Dry-grind processing using amylase corn and superior yeast to reduce the exogenous enzyme requirements in bioethanol production.

PubMed

Kumar, Deepak; Singh, Vijay

2016-01-01

Conventional corn dry-grind ethanol production process requires exogenous alpha and glucoamylases enzymes to breakdown starch into glucose, which is fermented to ethanol by yeast. This study evaluates the potential use of new genetically engineered corn and yeast, which can eliminate or minimize the use of these external enzymes, improve the economics and process efficiencies, and simplify the process. An approach of in situ ethanol removal during fermentation was also investigated for its potential to improve the efficiency of high-solid fermentation, which can significantly reduce the downstream ethanol and co-product recovery cost. The fermentation of amylase corn (producing endogenous α-amylase) using conventional yeast and no addition of exogenous α-amylase resulted in ethanol concentration of 4.1 % higher compared to control treatment (conventional corn using exogenous α-amylase). Conventional corn processed with exogenous α-amylase and superior yeast (producing glucoamylase or GA) with no exogenous glucoamylase addition resulted in ethanol concentration similar to control treatment (conventional yeast with exogenous glucoamylase addition). Combination of amylase corn and superior yeast required only 25 % of recommended glucoamylase dose to complete fermentation and achieve ethanol concentration and yield similar to control treatment (conventional corn with exogenous α-amylase, conventional yeast with exogenous glucoamylase). Use of superior yeast with 50 % GA addition resulted in similar increases in yield for conventional or amylase corn of approximately 7 % compared to that of control treatment. Combination of amylase corn, superior yeast, and in situ ethanol removal resulted in a process that allowed complete fermentation of 40 % slurry solids with only 50 % of exogenous GA enzyme requirements and 64.6 % higher ethanol yield compared to that of conventional process. Use of amylase corn and superior yeast in the dry-grind processing industry can reduce the total external enzyme usage by more than 80 %, and combining their use with in situ removal of ethanol during fermentation allows efficient high-solid fermentation.

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

PubMed Central

Al-Khouri, Anna Maria; Paule, Marvin R.

2002-01-01

In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

PubMed

Al-Khouri, Anna Maria; Paule, Marvin R

2002-02-01

In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

PubMed

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Accumulation and metabolism of selenium by yeast cells.

PubMed

Kieliszek, Marek; Błażejak, Stanisław; Gientka, Iwona; Bzducha-Wróbel, Anna

2015-07-01

This paper examines the process of selenium bioaccumulation and selenium metabolism in yeast cells. Yeast cells can bind elements in ionic from the environment and permanently integrate them into their cellular structure. Up to now, Saccharomyces cerevisiae, Candida utilis, and Yarrowia lipolytica yeasts have been used primarily in biotechnological studies to evaluate binding of minerals. Yeast cells are able to bind selenium in the form of both organic and inorganic compounds. The process of bioaccumulation of selenium by microorganisms occurs through two mechanisms: extracellular binding by ligands of membrane assembly and intracellular accumulation associated with the transport of ions across the cytoplasmic membrane into the cell interior. During intracellular metabolism of selenium, oxidation, reduction, methylation, and selenoprotein synthesis processes are involved, as exemplified by detoxification processes that allow yeasts to survive under culture conditions involving the elevated selenium concentrations which were observed. Selenium yeasts represent probably the best absorbed form of this element. In turn, in terms of wide application, the inclusion of yeast with accumulated selenium may aid in lessening selenium deficiency in a diet.

Yeast population dynamics of industrial fuel-ethanol fermentation process assessed by PCR-fingerprinting.

PubMed

da Silva-Filho, Eurípedes Alves; Brito dos Santos, Scheila Karina; Resende, Alecsandra do Monte; de Morais, José Otamar Falcão; de Morais, Marcos Antonio; Ardaillon Simões, Diogo

2005-07-01

Yeast population used in industrial production of fuel-ethanol may vary according to the plant process condition and to the environmental stresses imposed to yeast cells. Therefore, yeast strains isolated from a particular industrial process may be adapted to such conditions and should be used as starter strain instead of less adapted commercial strains. This work reports the use of PCR-fingerprinting method based on microsatellite primer (GTG)5 to characterize the yeast population dynamics along the fermentation period in six distilleries. The results show that indigenous fermenting strains present in the crude substrate can be more adapted to the industrial process than commercial strains. We also identified new strains that dominate the yeast population and were more present either in molasses or sugar cane fermenting distilleries. Those strains were proposed to be used as starters in those industrial processes. This is the first report on the use of molecular markers to discriminate Saccharomyces cerevisiae strains from fuel-ethanol producing process.

Characterization of Two Subsurface H2-Utilizing Bacteria, Desulfomicrobium hypogeium sp. nov. and Acetobacterium psammolithicum sp. nov., and Their Ecological Roles

PubMed Central

Krumholz, Lee R.; Harris, Steve H.; Tay, Stephen T.; Suflita, Joseph M.

1999-01-01

We examined the relative roles of acetogenic and sulfate-reducing bacteria in H2 consumption in a previously characterized subsurface sandstone ecosystem. Enrichment cultures originally inoculated with ground sandstone material obtained from a Cretaceous formation in central New Mexico were grown with hydrogen in a mineral medium supplemented with 0.02% yeast extract. Sulfate reduction and acetogenesis occurred in these cultures, and the two most abundant organisms carrying out the reactions were isolated. Based on 16S rRNA analysis data and on substrate utilization patterns, these organisms were named Desulfomicrobium hypogeium sp. nov. and Acetobacterium psammolithicum sp. nov. The steady-state H2 concentrations measured in sandstone-sediment slurries (threshold concentration, 5 nM), in pure cultures of sulfate reducers (threshold concentration, 2 nM), and in pure cultures of acetogens (threshold concentrations 195 to 414 nM) suggest that sulfate reduction is the dominant terminal electron-accepting process in the ecosystem examined. In an experiment in which direct competition for H2 between D. hypogeium and A. psammolithicum was examined, sulfate reduction was the dominant process. PMID:10347005

Light differentially regulates cell division and the mRNA abundance of pea nucleolin during de-etiolation

NASA Technical Reports Server (NTRS)

Reichler, S. A.; Balk, J.; Brown, M. E.; Woodruff, K.; Clark, G. B.; Roux, S. J.

2001-01-01

The abundance of plant nucleolin mRNA is regulated during de-etiolation by phytochrome. A close correlation between the mRNA abundance of nucleolin and mitosis has also been previously reported. These results raised the question of whether the effects of light on nucleolin mRNA expression were a consequence of light effects on mitosis. To test this we compared the kinetics of light-mediated increases in cell proliferation with that of light-mediated changes in the abundance of nucleolin mRNA using plumules of dark-grown pea (Pisum sativum) seedlings. These experiments show that S-phase increases 9 h after a red light pulse, followed by M-phase increases in the plumule leaves at 12 h post-irradiation, a time course consistent with separately measured kinetics of red light-induced increases in the expression of cell cycle-regulated genes. These increases in cell cycle-regulated genes are photoreversible, implying that the light-induced increases in cell proliferation are, like nucleolin mRNA expression, regulated via phytochrome. Red light stimulates increases in the mRNA for nucleolin at 6 h post-irradiation, prior to any cell proliferation changes and concurrent with the reported timing of phytochrome-mediated increases of rRNA abundance. After a green light pulse, nucleolin mRNA levels increase without increasing S-phase or M-phase. Studies in animals and yeast indicate that nucleolin plays a significant role in ribosome biosynthesis. Consistent with this function, pea nucleolin can rescue nucleolin deletion mutants of yeast that are defective in rRNA synthesis. Our data show that during de-etiolation, the increased expression of nucleolin mRNA is more directly regulated by light than by mitosis.

Carpoglyphus lactis (Acari: Astigmata) from various dried fruits differed in associated micro-organisms.

PubMed

Hubert, J; Nesvorná, M; Kopecký, J; Ságová-Marečková, M; Poltronieri, P

2015-02-01

Carpoglyphus lactis is a stored product mite infesting saccharide-rich stored commodities including dried fruits, wine, beer, milk products, jams and honey. The association with micro-organisms can improve the survival of mites on dried fruits. The microbial communities associated with C. lactis were studied in specimens originating from the packages of dried apricot, plums and figs and compared to the laboratory strain reared on house dust mite diet (HDMd). Clone libraries of bacterial 16S rRNA gene and fungal internal transcribed spacer (ITS) region were constructed and analysed by operational taxonomic unit (OTU) approach. The 16S rRNA gene libraries differed among the compared diets. The sequences classified to the genera Leuconostoc, Elizabethkingia, Ewingella, Erwinia, Bacillus and Serratia were prevailing in mites sampled from the dried fruits. The ITS library showed smaller differences between the laboratory strain on HDMd and the isolates from dried fruits packages, with the exception of the mite strain from dried plums. The population growth was used as an indirect indicator of fitness and decreased in the order from yeast diet to HDMd and dried fruits. The treatment and pretreatment of mites by antibiotics did not reveal the presence of antagonistic bacteria which might slow down the C. lactis population growth. The shifts of the microbial community in the gut of C. lactis were induced by the diet changes. The identified yeasts and bacteria are suggested as the main food source of stored product mites on dried fruits. The study describes the adaptation of C. lactis to feeding on dried fruits including the interaction with micro-organisms. We also identified potentially pathogenic bacteria carried by the mites to dried fruits for human consumption. © 2014 The Society for Applied Microbiology.

Alkaline Anaerobic Respiration: Isolation and Characterization of a Novel Alkaliphilic and Metal-Reducing Bacterium

PubMed Central

Ye, Qi; Roh, Yul; Carroll, Susan L.; Blair, Benjamin; Zhou, Jizhong; Zhang, Chuanlun L.; Fields, Matthew W.

2004-01-01

Iron-reducing enrichments were obtained from leachate ponds at the U.S. Borax Company in Boron, Calif. Based on partial small-subunit (SSU) rRNA gene sequences (approximately 500 nucleotides), six isolates shared 98.9% nucleotide identity. As a representative, the isolate QYMF was selected for further analysis. QYMF could be grown with Fe(III)-citrate, Fe(III)-EDTA, Co(III)-EDTA, or Cr(VI) as electron acceptors, and yeast extract and lactate could serve as electron donors. Growth during iron reduction occurred over the pH range of 7.5 to 11.0 (optimum, pH 9.5), a sodium chloride range of 0 to 80 g/liter (optimum, 20 g/liter), and a temperature range of 4 to 45°C (optimum, approximately 35°C), and iron precipitates were formed. QYMF was a strict anaerobe that could be grown in the presence of borax, and the cells were straight rods that produced endospores. Sodium chloride and yeast extract stimulated growth. Phylogenetic analysis of the SSU rRNA gene indicated that the bacterium was a low-G+C gram-positive microorganism and had 96 and 92% nucleotide identity with Alkaliphilus transvaalensis and Alkaliphilus crotonatoxidans, respectively. The major phospholipid fatty acids were 14:1, 16:1ω7c, and 16:0, which were different from those of other alkaliphiles but similar to those of reported iron-reducing bacteria. The results demonstrated that the isolate might represent a novel metal-reducing alkaliphilic species. The name Alkaliphilus metalliredigens sp. nov. is proposed. The isolation and activity of metal-reducing bacteria from borax-contaminated leachate ponds suggest that bioremediation of metal-contaminated alkaline environments may be feasible and have implications for alkaline anaerobic respiration. PMID:15345448

Fine structure of the 21S ribosomal RNA region on yeast mitochondrial DNA. III. Physical location of mitochondrial genetic markers and the molecular nature of omega.

PubMed

Heyting, C; Menke, H H

1979-01-11

1. We have determined the physical location of mitochondrial genetic markers in the 21S region of yeast mtDNA by genetic analysis of petite mutants whose mtDNA has been physically mapped on the wild-type mtDNA. 2. The order of loci, determined in this study, is in agreement with the order deduced from recombination analysis and coretention analysis except for the position of omega+: we conclude that omega+ is located between C321 (RIB-1) and E514 (RIB-3). 3. The marker E514 (RIB-3) has been localized on a DNA segment of 3800 bp, and the markers E354, E553 and cs23 (RIB-2) on a DNA segment of 1100 base pairs; both these segments overlap the 21S rRNA cistron. The marker C321 (RIB-1) has been localized within a segment of 240 bp which also overlaps the 21S rRNA cistron, and we infer on the basis of indirect evidence that this marker lies within this cistron. 4. In all our rho+ as well as rho- strains there is a one-to-one correlation between the omega+ phenotype, the ability to transmit the omega+ allele and the presence of a mtDNA segment of about 1000 bp long, located between sequences specifying RIB-3 and sequences corresponding to the loci RIB-1 and RIB-2. This segment may be inserted at this same position into omega- mtDNA by recombination. 5. The role which the different allelic forms of omega may play in the polarity of recombination is discussed.

Anaerosalibacter bizertensis gen. nov., sp. nov., a halotolerant bacterium isolated from sludge.

PubMed

Rezgui, Raja; Maaroufi, Abderrazak; Fardeau, Marie-Laure; Ben Ali Gam, Zouhaier; Cayol, Jean-Luc; Ben Hamed, Saïd; Labat, Marc

2012-10-01

A strictly anaerobic, halotolerant and thermotolerant strain, designated C5BEL(T), was isolated in north Tunisia from storage tanks holding waste generated by the recycling of discarded motor oils. Cells of strain C5BEL(T) were Gram-stain-positive, motile by laterally inserted flagella, straight, and spore-forming. Their two major fatty acids were iso-C(15 : 0) and iso-C(15 : 0) dimethyl acetal. Growth was observed at temperatures of 25-55 °C (optimum, 40 °C) and at pH 6-9 (optimum, pH 7.5). The salinity range for growth was 0-100 g l(-1) NaCl (optimum, 5 g l(-1)). Yeast extract was required for growth. Strain C5BEL(T) was heterotrophic, able to use glucose, pyruvate, succinate, yeast extract, bio-trypticase and peptone, but unable to grow on Casamino acids. Sulfate, thiosulfate, sulfite, elemental sulfur, fumarate, nitrate and nitrite were not reduced. The DNA G+C content of strain C5BEL(T) was 31.1 mol%. 16S rRNA gene sequence analysis indicated that strain C5BEL(T) was a member of the family Clostridiaceae, class Clostridia, phylum Firmicutes and was most closely related to Sporanaerobacter acetigenes Lup33(T) ( = DSM 13106(T)) (92.4 % similarity). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain C5BEL(T) can be classified as a novel species in a new genus, for which the name Anaerosalibacter bizertensis gen. nov., sp. nov. is proposed. The type strain of the type species is C5BEL(T) ( = DSM 23801(T) = JCM 17239(T)).

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing

PubMed Central

Goldfarb, Katherine C.; Cech, Thomas R.

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR–Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor—analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing—implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. PMID:28115465

Fungal Colonization and Biodeterioration of Plasticized Polyvinyl Chloride

PubMed Central

Webb, Jeremy S.; Nixon, Marianne; Eastwood, Ian M.; Greenhalgh, Malcolm; Robson, Geoffrey D.; Handley, Pauline S.

2000-01-01

Significant substratum damage can occur when plasticized PVC (pPVC) is colonized by microorganisms. We investigated microbial colonization of pPVC in an in situ, longitudinal study. Pieces of pPVC containing the plasticizers dioctyl phthalate and dioctyl adipate (DOA) were exposed to the atmosphere for up to 2 years. Fungal and bacterial populations were quantified, and colonizing fungi were identified by rRNA gene sequencing and morphological characteristics. Aureobasidium pullulans was the principal colonizing fungus, establishing itself on the pPVC between 25 and 40 weeks of exposure. A group of yeasts and yeast-like fungi, including Rhodotorula aurantiaca and Kluyveromyces spp., established themselves on the pPVC much later (after 80 weeks of exposure). Numerically, these organisms dominated A. pullulans after 95 weeks, with a mean viable count ± standard error of 1,000 ± 200 yeast CFU cm−2, compared to 390 ± 50 A. pullulans CFU cm−2. No bacterial colonization was observed. We also used in vitro tests to characterize the deteriogenic properties of fungi isolated from the pPVC. All strains of A. pullulans tested could grow with the intact pPVC formulation as the sole source of carbon, degrade the plasticizer DOA, produce extracellular esterase, and cause weight loss of the substratum during growth in vitro. In contrast, several yeast isolates could not grow on pPVC or degrade DOA. These results suggest that microbial succession may occur during the colonization of pPVC and that A. pullulans is critical to the establishment of a microbial community on pPVC. PMID:10919769

27 CFR 24.192 - Process and materials.

Code of Federal Regulations, 2010 CFR

2010-04-01

... the kinds and within the limitations prescribed in § 24.182 may be added with yeast or yeast culture to acclimate the yeast and to facilitate the process of secondary fermentation or to correct the wine...

27 CFR 24.192 - Process and materials.

Code of Federal Regulations, 2013 CFR

2013-04-01

... the kinds and within the limitations prescribed in § 24.182 may be added with yeast or yeast culture to acclimate the yeast and to facilitate the process of secondary fermentation or to correct the wine...

27 CFR 24.192 - Process and materials.

Code of Federal Regulations, 2014 CFR

2014-04-01

... the kinds and within the limitations prescribed in § 24.182 may be added with yeast or yeast culture to acclimate the yeast and to facilitate the process of secondary fermentation or to correct the wine...

27 CFR 24.192 - Process and materials.

Code of Federal Regulations, 2011 CFR

2011-04-01

... the kinds and within the limitations prescribed in § 24.182 may be added with yeast or yeast culture to acclimate the yeast and to facilitate the process of secondary fermentation or to correct the wine...

27 CFR 24.192 - Process and materials.

Code of Federal Regulations, 2012 CFR

2012-04-01

... the kinds and within the limitations prescribed in § 24.182 may be added with yeast or yeast culture to acclimate the yeast and to facilitate the process of secondary fermentation or to correct the wine...

Chaperoning 5S RNA assembly.

PubMed

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

New anamorphic yeast species: Candida infanticola sp. nov., Candida polysorbophila sp. nov., Candida transvaalensis sp. nov. and Trigonopsis californica sp. nov.

PubMed

Kurtzman, Cletus P

2007-08-01

Three new species of Candida and a new species of Trigonopsis are described based on their recognition from phylogenetic analysis of gene sequences from large subunit ribosomal RNA, ITS1/ITS2 rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II. Candida infanticola sp. nov. (type strain NRRL Y-17858, CBS 7922) was isolated from the ear of an infant in Germany and is closely related to Candida sorbophila. Candida polysorbophila sp. nov. (type strain NRRL Y-27161, CBS 7317) is a member of the Zygoascus clade and was isolated in South Africa as a contaminant from an emulsion of white oil and polysorbate. Candida transvaalensis sp. nov. (type strain NRRL Y-27140, CBS 6663) was obtained from forest litter, the Transvaal, South Africa, and forms an isolated clade with Candida santjacobensis. Trigonopsis californica sp. nov. (type strain NRRL Y-27307, CBS 10351) represents a contaminant from wine in California, and forms a well-supported clade with Trigonopsis cantarellii, Trigonopsis variabilis and Trigonopsis vinaria.

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

PubMed

Palková, Zdena; Váchová, Libuše

2016-09-01

Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

Three anamorphic yeast species Candida sanitii sp. nov., Candida sekii sp. nov. and Candida suwanaritii, three novel yeasts in the Saturnispora clade isolated in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk; Am-In, Somjit; Boonmak, Chanita; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Srisuk, Natana; Kawasaki, Hiroko; Nakase, Takashi

2010-02-01

Nine strains of three novel anamorphic yeast species were obtained from samples collected in Thailand including six strains (RV96, RV152, R14, RS9, RS58 and EA1) obtained from estuarine waters collected from two mangrove forests, one strain (ST84) from insect frass and two strains (SR16 and UB13) from forest soils. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene, the nine strains were found to represent three novel Candida species in the Saturnispora clade. Five strains (RV96, RV152, R14, RS9 and RS58) were assigned as a single novel species, which was named Candida sanitii sp. nov. The type strain is RV152(T) (BCC 25967(T)=NBRC 103864(T)=CBS 10864(T)). Strain EA1 was named as Candida suwanaritii sp. nov. The type strain is EA1(T) (BCC 29900(T)=NBRC 104877(T)=CBS 11021(T)). Three strains (ST84, SR16 and UB13) represented another novel species, for which Candida sekii sp. nov. is proposed. The type strain is ST84(T) (BCC 8320(T)=NBRC 105671(T)=CBS 10931(T)).

Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

PubMed

Gamalinda, Michael; Woolford, John L

2014-11-01

Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

Wickerhamomyces tratensis sp. nov. and Candida namnaoensis sp. nov., two novel ascomycetous yeast species in the Wickerhamomyces clade found in Thailand.

PubMed

Nakase, Takashi; Jindamorakot, Sasitorn; Am-In, Somjit; Ninomiya, Shinya; Kawasaki, Hiroko

2012-01-01

Two closely related yeast strains, ST-382 and ST-392, isolated in Thailand showed intermediate relatedness in the DNA-DNA hybridization experiment suggesting that the two strains represent closely related distinct species. In the tree based on the D1/D2 domain sequences of the large subunit rRNA gene, the two strains are located in a subclade in the Wickerhamomyces clade with high bootstrap support. In the D1/D2 domain, the two strains differed by two nucleotides and are assumed to be very closely related. Strain ST-392(T) (=BCC 15102(T) = NBRC 107799(T) = CBS 12176(T) forming hat-shaped ascospores is described as Wickerhamomyces tratensis sp. nov. and strain ST-382(T) (= BCC 15093(T) = NBRC 107800(T) = CBS 12175(T) is described as Candida namnaoensis sp. nov. because ascospores are not found in this strain. In phenotypic characteristics, W. tratensis and C. namnaoensis are discriminated by the ability of alcoholic fermentation and the assimilation of galactose, D-xylose and D-gluconic acid.

Candida saraburiensis sp. nov. and Candida prachuapensis sp. nov., xylose-utilizing yeast species isolated in Thailand.

PubMed

Nitiyon, Sukanya; Boonmak, Chanita; Am-In, Somjit; Jindamorakot, Sasitorn; Kawasaki, Hiroko; Yongmanitchai, Wichien; Limtong, Savitree

2011-02-01

Four strains of two novel xylose-utilizing yeast species were obtained from samples collected in Thailand from decaying corncobs (strains KU-Xs13(T) and KU-Xs18), a decaying grass (KU-Xs20) and estuarine water from a mangrove forest (WB15(T)). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 domain of the large subunit rRNA gene, the four strains were found to represent two novel species of the genus Candida in the Candida albicans/Lodderomyces elongisporus clade. Three strains (KU-Xs13(T), KU-Xs18 and KU-Xs20) were assigned as a single novel species, which was named Candida saraburiensis sp. nov. The type strain is KU-Xs13(T) (=CBS 11696(T)=NBRC 106721(T)=BCC 39601(T)). Strain WB15(T) represented another novel species of the genus Candida that was named Candida prachuapensis sp. nov. The type strain is WB15(T) (=CBS 11024(T)=NBRC 104881(T)=BCC 29904(T)).

Candida kuoi sp. nov., an anamorphic species of the Starmerella yeast clade that synthesizes sophorolipids.

PubMed

Kurtzman, Cletus P

2012-09-01

A novel strain of anamorphic yeast, designated strain NRRL Y-27208(T), was isolated from concentrated grape juice in Cape Province, South Africa. Analysis of nuclear large subunit rRNA gene sequences from the D1/D2 domains separated the novel isolate from strains of Starmerella bombicola and Starmerella meliponinorum, as well as from species of the genus Candida that are members of the Starmerella clade. Compared to previously described species, strain NRRL Y-27208(T) is most closely related to S. bombicola but can be separated from this species by its ability to grow on D-ribose and erythritol. Strain NRRL Y-27208(T) produced sophorolipids that have an open chain structure similar to Candida batistae, Candida riodocensis and Candida stellata, which is in contrast to the closed chain sophorolipids produced by S. bombicola and Candida apicola. The analyses showed that NRRL Y-27208(T) (= CBS 7267(T)) represents a novel species distinct from previously described species, for which the name Candida kuoi sp. nov. is proposed.

Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

USGS Publications Warehouse

Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

2010-01-01

During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

Evolutionary biology through the lens of budding yeast comparative genomics.

PubMed

Marsit, Souhir; Leducq, Jean-Baptiste; Durand, Éléonore; Marchant, Axelle; Filteau, Marie; Landry, Christian R

2017-10-01

The budding yeast Saccharomyces cerevisiae is a highly advanced model system for studying genetics, cell biology and systems biology. Over the past decade, the application of high-throughput sequencing technologies to this species has contributed to this yeast also becoming an important model for evolutionary genomics. Indeed, comparative genomic analyses of laboratory, wild and domesticated yeast populations are providing unprecedented detail about many of the processes that govern evolution, including long-term processes, such as reproductive isolation and speciation, and short-term processes, such as adaptation to natural and domestication-related environments.

Synthetic biology stretching the realms of possibility in wine yeast research.

PubMed

Jagtap, Umesh B; Jadhav, Jyoti P; Bapat, Vishwas A; Pretorius, Isak S

2017-07-03

It took several millennia to fully understand the scientific intricacies of the process through which grape juice is turned into wine. This yeast-driven fermentation process is still being perfected and advanced today. Motivated by ever-changing consumer preferences and the belief that the 'best' wine is yet to be made, numerous approaches are being pursued to improve the process of yeast fermentation and the quality of wine. Central to recent enhancements in winemaking processes and wine quality is the development of Saccharomyces cerevisiae yeast strains with improved robustness, fermentation efficiencies and sensory properties. The emerging science of Synthetic Biology - including genome engineering and DNA editing technologies - is taking yeast strain development into a totally new realm of possibility. The first example of how future wine strain development might be impacted by these new 'history-making' Synthetic Biology technologies, is the de novo production of the raspberry ketone aroma compound, 4-[4-hydroxyphenyl]butan-2-one, in a wine yeast containing a synthetic DNA cassette. This article explores how this breakthrough and the imminent outcome of the international Yeast 2.0 (or Sc2.0) project, aimed at the synthesis of the entire genome of a laboratory strain of S. cerevisiae, might accelerate the design of improved wine yeasts. Copyright © 2017 Elsevier B.V. All rights reserved.

A homozygous NOP14 variant is likely to cause recurrent pregnancy loss.

PubMed

Suzuki, Toshifumi; Behnam, Mahdiyeh; Ronasian, Firooze; Salehi, Mansoor; Shiina, Masaaki; Koshimizu, Eriko; Fujita, Atsushi; Sekiguchi, Futoshi; Miyatake, Satoko; Mizuguchi, Takeshi; Nakashima, Mitsuko; Ogata, Kazuhiro; Takeda, Satoru; Matsumoto, Naomichi; Miyake, Noriko

2018-04-01

Recurrent pregnancy loss is newly defined as more than two consecutive miscarriages. Recurrent pregnancy loss occurs in <5% of total pregnancies. The cause in approximately 40-60% of recurrent pregnancy loss cases remains elusive and must be determined. We investigated two unrelated Iranian consanguineous families with recurrent pregnancy loss. We performed exome sequencing using DNA from a miscarriage tissue and identified a homozygous NOP14 missense variant (c.[136C>G];[136C>G]) in both families. NOP14 is an evolutionally conserved protein among eukaryotes and is required for 18S rRNA processing and 40S ribosome biogenesis. Interestingly, in zebrafish, homozygous mutation of nop14 (possibly loss of function) resulting from retrovirus-mediated insertional mutagenesis led to embryonic lethality at 5 days after fertilization, mimicking early pregnancy loss in humans. Similarly, it is known that the nop14-null yeast is inviable. These data suggest that the homozygous NOP14 mutation is likely to cause recurrent pregnancy loss. Furthermore, this study shows that exome sequencing is very useful to determine the etiology of unsolved recurrent pregnancy loss.

Rapid identification of ascomycetous yeasts from clinical specimens by a molecular method based on flow cytometry and comparison with identifications from phenotypic assays.

PubMed

Page, Brent T; Shields, Christine E; Merz, William G; Kurtzman, Cletus P

2006-09-01

This study was designed to compare the identification of ascomycetous yeasts recovered from clinical specimens by using phenotypic assays (PA) and a molecular flow cytometric (FC) method. Large-subunit rRNA domains 1 and 2 (D1/D2) gene sequence analysis was also performed and served as the reference for correct strain identification. A panel of 88 clinical isolates was tested that included representatives of nine commonly encountered species and six infrequently encountered species. The PA included germ tube production, fermentation of seven carbohydrates, morphology on corn meal agar, urease and phenoloxidase activities, and carbohydrate assimilation tests when needed. The FC method (Luminex) employed species-specific oligonucleotides attached to polystyrene beads, which were hybridized with D1/D2 amplicons from the unidentified isolates. The PA identified 81 of 88 strains correctly but misidentified 4 of Candida dubliniensis, 1 of C. bovina, 1 of C. palmioleophila, and 1 of C. bracarensis. The FC method correctly identified 79 of 88 strains and did not misidentify any isolate but did not identify nine isolates because oligonucleotide probes were not available in the current library. The FC assay takes approximately 5 h, whereas the PA takes from 2 h to 5 days for identification. In conclusion, PA did well with the commonly encountered species, was not accurate for uncommon species, and takes significantly longer than the FC method. These data strongly support the potential of FC technology for rapid and accurate identification of medically important yeasts. With the introduction of new antifungals, rapid, accurate identification of pathogenic yeasts is more important than ever for guiding antifungal chemotherapy.

Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

PubMed

Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

2010-08-16

In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy number and chromosomal organisation may occur within relatively short evolutionary time. We hypothesize that the 5S gene integration within the 35S unit might have repeatedly occurred during plant evolution, and probably once in Asteraceae.

Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

PubMed Central

2010-01-01

Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy number and chromosomal organisation may occur within relatively short evolutionary time. We hypothesize that the 5S gene integration within the 35S unit might have repeatedly occurred during plant evolution, and probably once in Asteraceae. PMID:20712858

Effects of the dose and viability of Saccharomyces cerevisiae. 1. Diversity of ruminal microbes as analyzed by Illumina MiSeq sequencing and quantitative PCR.

PubMed

Jiang, Y; Ogunade, I M; Qi, S; Hackmann, T J; Staples, C R; Adesogan, A T

2017-01-01

This study was conducted to examine effects of the dose and viability of supplemental Saccharomyces cerevisiae on the ruminal fermentation and bacteria population and the performance of lactating dairy cows. Four ruminally cannulated lactating cows averaging 284±18d in milk were assigned to 4 treatments arranged in a 4×4 Latin square design with four 21-d periods. Cows were fed a total mixed ration containing 41.7% corn silage, 12.1% brewer's grains, and 46.2% concentrate on a dry matter basis. The diet was supplemented with no yeast (control) or with a low dose of live yeast (5.7×10 7 cfu/cow per day; LLY), a high dose of live yeast (6.0×10 8 cfu/cow per day; HLY), or a high dose of killed yeast (6.0×10 8 cfu/cow per day; HDY). Microbial diversity was examined by high-throughput Illumina MiSeq sequencing (Illumina Inc., San Diego, CA) of the V4 region of the 16S rRNA gene. The relative abundance of select ruminal bacteria was also quantified by quantitative PCR (qPCR). Adding LLY to the diet increased the relative abundance of some ruminal cellulolytic bacteria (Ruminococcus and Fibrobacter succinogenes) and amylolytic bacteria (Ruminobacter, Bifidobacterium, and Selenomonas ruminantium). Adding live instead of killed yeast increased the relative abundance of Ruminococcus and F. succinogenes; adding HDY increased the relative abundance of Ruminobacter, Bifidobacterium, Streptococcus bovis, and Selenomonas ruminantium. The most dominant (≥1% of total sequences) bacteria that responded to LLY addition whose functions are among the least understood in relation to the mode of action of yeast include Paraprevotellaceae, CF231, Treponema, and Lachnospiraceae. Future studies should aim to speciate, culture, and examine the function of these bacteria to better understand their roles in the mode of action of yeast. A relatively precise relationship was detected between the relative abundance of F. succinogenes (R 2 =0.67) from qPCR and MiSeq sequencing, but weak relationships were detected for Megasphaera elsdenii, Ruminococcus flavefaciens, and S. ruminantium (R 2 ≤0.19). Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Fervidicola ferrireducens gen. nov., sp. nov., a thermophilic anaerobic bacterium from geothermal waters of the Great Artesian Basin, Australia.

PubMed

Ogg, Christopher D; Patel, Bharat K C

2009-05-01

A strictly anaerobic, thermophilic bacterium, designated strain Y170(T), was isolated from a microbial mat colonizing thermal waters of a run-off channel created by the free-flowing waters of a Great Artesian Basin (GAB) bore well (New Lorne bore; registered number 17263). Cells of strain Y170(T) were slightly curved rods (1.2-12x0.8-1.1 mum) and stained Gram-negative. The strain grew optimally in tryptone-yeast extract-glucose medium at 70 degrees C (temperature range for growth was 55-80 degrees C) and pH 7 (pH range for growth was 5-9). Strain Y170(T) grew poorly on yeast extract as a sole carbon source, but not on tryptone (0.2 %). Yeast extract could not be replaced by tryptone and was obligately required for growth on tryptone, peptone, glucose, fructose, galactose, cellobiose, mannose, sucrose, xylose, mannitol, formate, pyruvate, Casamino acids and threonine. No growth was observed on arabinose, lactose, maltose, raffinose, chitin, xylan, pectin, starch, acetate, benzoate, lactate, propionate, succinate, myo-inositol, ethanol, glycerol, amyl media, aspartate, leucine, glutamate, alanine, arginine, serine and glycine. End products detected from glucose fermentation were acetate, ethanol and presumably CO(2) and H(2). Iron(III), manganese(IV), thiosulfate and elemental sulfur, but not sulfate, sulfite, nitrate or nitrite, were used as electron acceptors in the presence of 0.2 % yeast extract. Iron(III) in the form of amorphous Fe(III) oxhydroxide and Fe(III) citrate was also reduced in the presence of tryptone, peptone and Casamino acids, but not with chitin, xylan, pectin, formate, starch, pyruvate, acetate, benzoate, threonine, lactate, propionate, succinate, inositol, ethanol, glycerol, mannitol, aspartate, leucine, glutamate, alanine, arginine, serine or glycine. Strain Y170(T) was not able to utilize molecular hydrogen and/or carbon dioxide in the presence or absence of iron(III). Chloramphenicol, streptomycin, tetracycline, penicillin and ampicillin and NaCl concentrations greater than 2 % inhibited growth. The G+C content of the DNA was 48+/-1 mol% [sd (n=3); T(m)]. 16S rRNA gene sequence analysis indicated that strain Y170(T) is a member of the family Syntrophomonadaceae, class Clostridia, phylum Firmicutes and was most closely related to members of the genus Thermosediminibacter (mean similarity of 93.6 %). On the basis of the 16S rRNA gene sequence comparisons and physiological characteristics, strain Y170(T) is considered to represent a novel species of a new genus, for which the name Fervidicola ferrireducens gen. nov., sp. nov. is proposed. The type strain is Y170(T) (=KCTC 5610(T)=JCM 15106(T)=DSM 21121(T)).

The Red and White Yeast Lab: An Introduction to Science as a Process.

ERIC Educational Resources Information Center

White, Brian T.

1999-01-01

Describes an experimental system based on an engineered strain of bakers' yeast that is designed to involve students in the process by which scientific knowledge is generated. Students are asked to determine why the yeast grow to form a reproducible pattern of red and white. (WRM)

A polyphasic study on the taxonomic position of industrial sour dough yeasts.

PubMed

Mäntynen, V H; Korhola, M; Gudmundsson, H; Turakainen, H; Alfredsson, G A; Salovaara, H; Lindström, K

1999-02-01

The sour dough bread making process is extensively used to produce wholesome palatable rye bread. The process is traditionally done using a back-slopping procedure. Traditional sour doughs in Finland comprise of lactic acid bacteria and yeasts. The yeasts present in these doughs have been enriched in the doughs due to their metabolic activities, e.g. acid tolerance. We characterized the yeasts in five major sour bread bakeries in Finland. We found that most of the commercial sour doughs contained yeasts which were similar to Candida milleri on the basis of 18S rDNA and EF-3 PCR-RFLP patterns and metabolic activities. Some of the bakery yeasts exhibited extensive karyotype polymorphism. The minimum growth temperature was 8 degrees C for C. milleri and also for most of sour dough yeasts.

Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations.

PubMed

Steensels, Jan; Verstrepen, Kevin J

2014-01-01

Yeasts are the main driving force behind several industrial food fermentation processes, including the production of beer, wine, sake, bread, and chocolate. Historically, these processes developed from uncontrolled, spontaneous fermentation reactions that rely on a complex mixture of microbes present in the environment. Because such spontaneous processes are generally inconsistent and inefficient and often lead to the formation of off-flavors, most of today's industrial production utilizes defined starter cultures, often consisting of a specific domesticated strain of Saccharomyces cerevisiae, S. bayanus, or S. pastorianus. Although this practice greatly improved process consistency, efficiency, and overall quality, it also limited the sensorial complexity of the end product. In this review, we discuss how Saccharomyces yeasts were domesticated to become the main workhorse of food fermentations, and we investigate the potential and selection of nonconventional yeasts that are often found in spontaneous fermentations, such as Brettanomyces, Hanseniaspora, and Pichia spp.

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

PubMed

Goldfarb, Katherine C; Cech, Thomas R

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

Identification of Dekkera bruxellensis (Brettanomyces) from Wine by Fluorescence In Situ Hybridization Using Peptide Nucleic Acid Probes

PubMed Central

Stender, Henrik; Kurtzman, Cletus; Hyldig-Nielsen, Jens J.; Sørensen, Ditte; Broomer, Adam; Oliveira, Kenneth; Perry-O'Keefe, Heather; Sage, Andrew; Young, Barbara; Coull, James

2001-01-01

A new fluorescence in situ hybridization method using peptide nucleic acid (PNA) probes for identification of Brettanomyces is described. The test is based on fluorescein-labeled PNA probes targeting a species-specific sequence of the rRNA of Dekkera bruxellensis. The PNA probes were applied to smears of colonies, and results were interpreted by fluorescence microscopy. The results obtained from testing 127 different yeast strains, including 78 Brettanomyces isolates from wine, show that the spoilage organism Brettanomyces belongs to the species D. bruxellensis and that the new method is able to identify Brettanomyces (D. bruxellensis) with 100% sensitivity and 100% specificity. PMID:11157265

Peptoniphilus catoniae sp. nov., isolated from a human faecal sample from a traditional Peruvian coastal community.

PubMed

Patel, Nisha B; Tito, Raul Y; Obregón-Tito, Alexandra J; O'Neal, Lindsey; Trujillo-Villaroel, Omar; Marin-Reyes, Luis; Troncoso-Corzo, Luzmila; Guija-Poma, Emilio; Lewis, Cecil M; Lawson, Paul A

2016-05-01

A novel Gram-stain-positive, coccus-shaped, obligately anaerobic bacterium was isolated from a faecal sample obtained from an individual in a traditional community located off the southern coast of Peru. Comparative 16S rRNA gene sequence analysis showed the novel bacterium belonged to the genus Peptoniphilus but showed no particular relationship with any species, demonstrating less than 91 % 16S rRNA gene sequence similarity with all members of the genus. The major cellular fatty acids of the novel isolate were determined to be C10 : 0, C14 : 0, C16 : 0, C18 : 1ω9c and C18 : 2ω6,9c/anteiso-C18 : 0. The DNA G+C content was 34.4 mol%. End-products of metabolism from peptone-yeast-glucose broth (PYG) were determined to be acetate and butyrate. Based on the phenotypic, chemotaxonomic and phylogenetic results, the organism represents a novel species of the genus Peptoniphilus, for which the name Peptoniphilus catoniae sp. nov. is proposed. The type strain is M6.X2DT ( = DSM 29874T = CCUG 66798T).

Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

PubMed Central

Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

2016-01-01

Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

Biotechnology of non-Saccharomyces yeasts--the ascomycetes.

PubMed

Johnson, Eric A

2013-01-01

Saccharomyces cerevisiae and several other yeast species are among the most important groups of biotechnological organisms. S. cerevisiae and closely related ascomycetous yeasts are the major producer of biotechnology products worldwide, exceeding other groups of industrial microorganisms in productivity and economic revenues. Traditional industrial attributes of the S. cerevisiae group include their primary roles in food fermentations such as beers, cider, wines, sake, distilled spirits, bakery products, cheese, sausages, and other fermented foods. Other long-standing industrial processes involving S. cerevisae yeasts are production of fuel ethanol, single-cell protein (SCP), feeds and fodder, industrial enzymes, and small molecular weight metabolites. More recently, non-Saccharomyces yeasts (non-conventional yeasts) have been utilized as industrial organisms for a variety of biotechnological roles. Non-Saccharomyces yeasts are increasingly being used as hosts for expression of proteins, biocatalysts and multi-enzyme pathways for the synthesis of fine chemicals and small molecular weight compounds of medicinal and nutritional importance. Non-Saccharomyces yeasts also have important roles in agriculture as agents of biocontrol, bioremediation, and as indicators of environmental quality. Several of these products and processes have reached commercial utility, while others are in advanced development. The objective of this mini-review is to describe processes currently used by industry and those in developmental stages and close to commercialization primarily from non-Saccharomyces yeasts with an emphasis on new opportunities. The utility of S. cerevisiae in heterologous production of selected products is also described.

Yeasts in sustainable bioethanol production: A review.

PubMed

Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

2017-07-01

Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

Association of nonribosomal nucleolar proteins in ribonucleoprotein complexes during interphase and mitosis.

PubMed

Piñol-Roma, S

1999-01-01

rRNA precursors are bound throughout their length by specific proteins, as the pre-rRNAs emerge from the transcription machinery. The association of pre-rRNA with proteins as ribonucleoprotein (RNP) complexes persists during maturation of 18S, 5.8S, and 28S rRNA, and through assembly of ribosomal subunits in the nucleolus. Preribosomal RNP complexes contain, in addition to ribosomal proteins, an unknown number of nonribosomal nucleolar proteins, as well as small nucleolar RNA-ribonucleoproteins (sno-RNPs). This report describes the use of a specific, rapid, and mild immunopurification approach to isolate and analyze human RNP complexes that contain nonribosomal nucleolar proteins, as well as ribosomal proteins and rRNA. Complexes immunopurified with antibodies to nucleolin-a major nucleolar RNA-binding protein-contain several distinct specific polypeptides that include, in addition to nucleolin, the previously identified nucleolar proteins B23 and fibrillarin, proteins with electrophoretic mobilities characteristic of ribosomal proteins including ribosomal protein S6, and a number of additional unidentified proteins. The physical association of these proteins with one another is mediated largely by RNA, in that the complexes dissociate upon digestion with RNase. Complexes isolated from M-phase cells are similar in protein composition to those isolated from interphase cell nuclear extracts. Therefore, the predominant proteins that associate with nucleolin in interphase remain in RNP complexes during mitosis, despite the cessation of rRNA synthesis and processing in M-phase. In addition, precursor rRNA, as well as processed 18S and 28S rRNA and candidate rRNA processing intermediates, is found associated with the immunopurified complexes. The characteristics of the rRNP complexes described here, therefore, indicate that they represent bona fide precursors of mature cytoplasmic ribosomal subunits.

Fermentation and microflora of plaa-som, a thai fermented fish product prepared with different salt concentrations.

PubMed

Paludan-Müller, Christine; Madsen, Mette; Sophanodora, Pairat; Gram, Lone; Møller, Peter Lange

2002-02-25

Plaa-som is a Thai fermented fish product prepared from snakehead fish, salt, palm syrup and sometimes roasted rice. We studied the effects of different salt concentrations on decrease in pH and on microflora composition during fermentation. Two low-salt batches were prepared, containing 6% and 7% salt (w/w) as well as two high-salt batches, containing 9% and 11% salt. pH decreased rapidly from 6 to 4.5 in low-salt batches, whereas in high-salt batches, a slow or no decrease in pH was found. Lactic acid bacteria (LAB) and yeasts were isolated as the dominant microorganisms during fermentation. LAB counts increased to 10(8)-10(9) cfu g(-1) and yeast counts to 10(7)-5 x 10(7) cfu g(-1) in all batches, except in the 11% salt batch, where counts were 1-2 log lower. Phenotypic tests, ITS-PCR, carbohydrate fermentations and 16S rRNA gene sequencing identified LAB isolates as Pediococcus pentosaceus, Lactobacillus alimentarius/farciminis, Weisella confusa, L. plantarum and Lactococcus garviae. The latter species was only isolated from high-salt batches. Phenotypic characteristics, ITS-PCR and carbohydrate assimilation identified 95% of the yeasts as Zygosaccharomyces rouxii. It is concluded that the fermentation of plaa-som is delayed by a salt-level of 9% due to an inhibition of LAB growth. The growth of Z. rouxii has no influence on the fermentation rate, but may contribute positively to the flavour development of the product.

Prospective evaluation of the VITEK MS for the routine identification of bacteria and yeast in the clinical microbiology laboratory: assessment of accuracy of identification and turnaround time.

PubMed

Charnot-Katsikas, Angella; Tesic, Vera; Boonlayangoor, Sue; Bethel, Cindy; Frank, Karen M

2014-02-01

This study assessed the accuracy of bacterial and yeast identification using the VITEK MS, and the time to reporting of isolates before and after its implementation in routine clinical practice. Three hundred and sixty-two isolates of bacteria and yeast, consisting of a variety of clinical isolates and American Type Culture Collection strains, were tested. Results were compared with reference identifications from the VITEK 2 system and with 16S rRNA sequence analysis. The VITEK MS provided an acceptable identification to species level for 283 (78 %) isolates. Considering organisms for which genus-level identification is acceptable for routine clinical care, 315 isolates (87 %) had an acceptable identification. Six isolates (2 %) were identified incorrectly, five of which were Shigella species. Finally, the time for reporting the identifications was decreased significantly after implementation of the VITEK MS for a total mean reduction in time of 10.52 h (P<0.0001). Overall, accuracy of the VITEK MS was comparable or superior to that from the VITEK 2. The findings were also comparable to other studies examining the accuracy of the VITEK MS, although differences exist, depending on the diversity of species represented as well as on the versions of the databases used. The VITEK MS can be incorporated effectively into routine use in a clinical microbiology laboratory and future expansion of the database should provide improved accuracy for the identification of micro-organisms.

RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

PubMed

Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

2013-05-01

The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

PubMed Central

Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

2013-01-01

The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.

PubMed

Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R

1998-01-01

Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T).

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Yeast Based Sensors

NASA Astrophysics Data System (ADS)

Shimomura-Shimizu, Mifumi; Karube, Isao

Since the first microbial cell sensor was studied by Karube et al. in 1977, many types of yeast based sensors have been developed as analytical tools. Yeasts are known as facultative anaerobes. Facultative anaerobes can survive in both aerobic and anaerobic conditions. The yeast based sensor consisted of a DO electrode and an immobilized omnivorous yeast. In yeast based sensor development, many kinds of yeast have been employed by applying their characteristics to adapt to the analyte. For example, Trichosporon cutaneum was used to estimate organic pollution in industrial wastewater. Yeast based sensors are suitable for online control of biochemical processes and for environmental monitoring. In this review, principles and applications of yeast based sensors are summarized.

Three novel ascomycetous yeast species of the Kazachstania clade, Kazachstania saulgeensis sp. nov., Kazachstaniaserrabonitensis sp. nov. and Kazachstania australis sp. nov. Reassignment of Candida humilis to Kazachstania humilis f.a. comb. nov. and Candida pseudohumilis to Kazachstania pseudohumilis f.a. comb. nov.

PubMed

Jacques, Noémie; Sarilar, Véronique; Urien, Charlotte; Lopes, Mariana R; Morais, Camila G; Uetanabaro, Ana Paula T; Tinsley, Colin R; Rosa, Carlos A; Sicard, Delphine; Casaregola, Serge

2016-12-01

Five ascosporogenous yeast strains related to the genus Kazachstania were isolated. Two strains (CLIB 1764T and CLIB 1780) were isolated from French sourdoughs; three others (UFMG-CM-Y273T, UFMG-CM-Y451 and UFMG-CM-Y452) were from rotting wood in Brazil. The sequences of the French and Brazilian strains differed by one and three substitutions, respectively, in the D1/D2 large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS). The D1/D2 LSU rRNA sequence of these strains differed by 0.5 and 0.7 % from Kazachstania exigua, but their ITS sequences diverged by 8.1 and 8.3 %, respectively, from that of the closest described species Kazachstania barnettii. Analysis of protein coding sequences of RPB1, RPB2 and EF-1α distinguished the French from the Brazilian strains, with respectively 3.3, 6 and 11.7 % substitutions. Two novel species are described to accommodate these newly isolated strains: Kazachstania saulgeensis sp. nov. (type strain CLIB 1764T=CBS 14374T) and Kazachstania serrabonitensis sp. nov. (type strain UFMG-CM-Y273T=CLIB 1783T=CBS 14236T). Further analysis of culture collections revealed a strain previously assigned to the K. exigua species, but having 3.8 % difference (22 substitutions and 2 indels) in its ITS with respect to K. exigua. Hence, we describe a new taxon, Kazachstania australis sp. nov. (type strain CLIB 162T=CBS 2141T), to accommodate this strain. Finally, Candida humilis and Candida pseudohumilis are reassigned to the genus Kazachstania as new combinations. On the basis of sequence analysis, we also propose that Candida milleri and Kazachstania humilis comb. nov. are conspecific.

Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

PubMed

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

Microbial Populations in Naked Neck Chicken Ceca Raised on Pasture Flock Fed with Commercial Yeast Cell Wall Prebiotics via an Illumina MiSeq Platform

PubMed Central

Park, Si Hong; Lee, Sang In; Ricke, Steven C.

2016-01-01

Prebiotics are non-digestible carbohydrate dietary supplements that selectively stimulate the growth of one or more beneficial bacteria in the gastrointestinal tract of the host. These bacteria can inhibit colonization of pathogenic bacteria by producing antimicrobial substances such as short chain fatty acids (SCFAs) and competing for niches with pathogens within the gut. Pasture flock chickens are generally raised outdoors with fresh grass, sunlight and air, which represents different environmental growth conditions compared to conventionally raised chickens. The purpose of this study was to evaluate the difference in microbial populations from naked neck chicken ceca fed with commercial prebiotics derived from brewer’s yeast cell wall via an Illumina MiSeq platform. A total of 147 day-of-hatch naked neck chickens were distributed into 3 groups consisted of 1) C: control (no prebiotic), 2) T1: Biolex® MB40 with 0.2%, and 3) T2: Leiber® ExCel with 0.2%, consistently supplemented prebiotics during the experimental period. At 8 weeks, a total of 15 birds from each group were randomly selected and ceca removed for DNA extraction. The Illumina Miseq platform based on V4 region of 16S rRNA gene was applied for microbiome analysis. Both treatments exhibited limited impact on the microbial populations at the phylum level, with no significant differences in the OTU number of Bacteroidetes among groups and an increase of Proteobacteria OTUs for the T1 (Biolex® MB40) group. In addition there was a significant increase of genus Faecalibacterium OTU, phylum Firmicutes. According to the development of next generation sequencing (NGS), microbiome analysis based on 16S rRNA gene proved to be informative on the prebiotic impact on poultry gut microbiota in pasture-raised naked neck birds. PMID:26992104

Microbial Populations in Naked Neck Chicken Ceca Raised on Pasture Flock Fed with Commercial Yeast Cell Wall Prebiotics via an Illumina MiSeq Platform.

PubMed

Park, Si Hong; Lee, Sang In; Ricke, Steven C

2016-01-01

Prebiotics are non-digestible carbohydrate dietary supplements that selectively stimulate the growth of one or more beneficial bacteria in the gastrointestinal tract of the host. These bacteria can inhibit colonization of pathogenic bacteria by producing antimicrobial substances such as short chain fatty acids (SCFAs) and competing for niches with pathogens within the gut. Pasture flock chickens are generally raised outdoors with fresh grass, sunlight and air, which represents different environmental growth conditions compared to conventionally raised chickens. The purpose of this study was to evaluate the difference in microbial populations from naked neck chicken ceca fed with commercial prebiotics derived from brewer's yeast cell wall via an Illumina MiSeq platform. A total of 147 day-of-hatch naked neck chickens were distributed into 3 groups consisted of 1) C: control (no prebiotic), 2) T1: Biolex® MB40 with 0.2%, and 3) T2: Leiber® ExCel with 0.2%, consistently supplemented prebiotics during the experimental period. At 8 weeks, a total of 15 birds from each group were randomly selected and ceca removed for DNA extraction. The Illumina Miseq platform based on V4 region of 16S rRNA gene was applied for microbiome analysis. Both treatments exhibited limited impact on the microbial populations at the phylum level, with no significant differences in the OTU number of Bacteroidetes among groups and an increase of Proteobacteria OTUs for the T1 (Biolex® MB40) group. In addition there was a significant increase of genus Faecalibacterium OTU, phylum Firmicutes. According to the development of next generation sequencing (NGS), microbiome analysis based on 16S rRNA gene proved to be informative on the prebiotic impact on poultry gut microbiota in pasture-raised naked neck birds.

Solving ethanol production problems with genetically modified yeast strains.

PubMed

Abreu-Cavalheiro, A; Monteiro, G

2013-01-01

The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

Solving ethanol production problems with genetically modified yeast strains

PubMed Central

Abreu-Cavalheiro, A.; Monteiro, G.

2013-01-01

The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast. PMID:24516432

Use of autochthonous starters to ferment red and yellow peppers (Capsicum annum L.) to be stored at room temperature.

PubMed

Di Cagno, Raffaella; Surico, Rosalinda F; Minervini, Giovanna; De Angelis, Maria; Rizzello, Carlo G; Gobbetti, Marco

2009-03-31

Strains of Lactobacillus curvatus, Leuconostoc mesenteroides, Lactobacillus plantarum and Weissella confusa were identified from raw red and yellow peppers (RYPs) by partial 16S rRNA gene sequence and subjected to typing by Random Amplified Polymorphic DNA-Polymerase Chain Reaction (RAPD-PCR) analysis. L. plantarum PE21, L. curvatus PE4 and W. confusa PE36 were selected based on the kinetics of growth and acidification, and used as the autochthonous mixed starter for the fermentation of RYPs. A protocol which included blanching at 85 degrees C for 2 min, fermentation at 35 degrees C for 15 h in brine (1%, w/v), and heat treatment at 85 degrees C for 15 min, followed by storage at room temperature for 30 days with and without sunflower seeds oil was set up. Unstarted RYPs subjected to the same treatments were used as the control. Cell numbers of autochthonous starter in the RYPs were ca. 1000 times higher than presumptive lactic acid bacteria in unstarted RYPs. As shown by RAPD-PCR analysis, all three autochthonous strains persisted during processing and storage. Presumptive lactic acid bacteria found in started RYPs progressively decreased during storage, leading to a microbiota mainly consisting of autochthonous starters. Started RYPs showed rapid decrease of pH (<3.7), marked consumption of fermentable carbohydrates, and inhibition of total enterobacteria and yeasts. Unstarted RYPs were subjected to slight acidification (pH ca. 4.87) and considerable contamination by total enterobacteria and yeasts throughout storage. After 30 days of storage, started RYPs had significantly (P<0.05) higher firmness and colour indexes with respect to unstarted RYPs. The microbial and sensory features of started RYPs stored with sunflower seeds oil were almost similar to those of RYPs stored without suspending liquid.

Opportunistic Sampling of Roadkill as an Entry Point to Accessing Natural Products Assembled by Bacteria Associated with Non-anthropoidal Mammalian Microbiomes

PubMed Central

2016-01-01

Few secondary metabolites have been reported from mammalian microbiome bacteria despite the large numbers of diverse taxa that inhabit warm-blooded higher vertebrates. As a means to investigate natural products from these microorganisms, an opportunistic sampling protocol was developed, which focused on exploring bacteria isolated from roadkill mammals. This initiative was made possible through the establishment of a newly created discovery pipeline, which couples laser ablation electrospray ionization mass spectrometry (LAESIMS) with bioassay testing, to target biologically active metabolites from microbiome-associated bacteria. To illustrate this process, this report focuses on samples obtained from the ear of a roadkill opossum (Dideiphis virginiana) as the source of two bacterial isolates (Pseudomonas sp. and Serratia sp.) that produced several new and known cyclic lipodepsipeptides (viscosin and serrawettins, respectively). These natural products inhibited biofilm formation by the human pathogenic yeast Candida albicans at concentrations well below those required to inhibit yeast viability. Phylogenetic analysis of 16S rRNA gene sequence libraries revealed the presence of diverse microbial communities associated with different sites throughout the opossum carcass. A putative biosynthetic pathway responsible for the production of the new serrawettin analogues was identified by sequencing the genome of the Serratia sp. isolate. This study provides a functional roadmap to carrying out the systematic investigation of the genomic, microbiological, and chemical parameters related to the production of natural products made by bacteria associated with non-anthropoidal mammalian microbiomes. Discoveries emerging from these studies are anticipated to provide a working framework for efforts aimed at augmenting microbiomes to deliver beneficial natural products to a host. PMID:28335605

Yeast biotechnology: teaching the old dog new tricks.

PubMed

Mattanovich, Diethard; Sauer, Michael; Gasser, Brigitte

2014-03-06

Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature.

Phenotypic Diagnosis of Lineage and Differentiation During Sake Yeast Breeding

PubMed Central

Ohnuki, Shinsuke; Okada, Hiroki; Friedrich, Anne; Kanno, Yoichiro; Goshima, Tetsuya; Hasuda, Hirokazu; Inahashi, Masaaki; Okazaki, Naoto; Tamura, Hiroyasu; Nakamura, Ryo; Hirata, Dai; Fukuda, Hisashi; Shimoi, Hitoshi; Kitamoto, Katsuhiko; Watanabe, Daisuke; Schacherer, Joseph; Akao, Takeshi; Ohya, Yoshikazu

2017-01-01

Sake yeast was developed exclusively in Japan. Its diversification during breeding remains largely uncharacterized. To evaluate the breeding processes of the sake lineage, we thoroughly investigated the phenotypes and differentiation of 27 sake yeast strains using high-dimensional, single-cell, morphological phenotyping. Although the genetic diversity of the sake yeast lineage is relatively low, its morphological diversity has expanded substantially compared to that of the Saccharomyces cerevisiae species as a whole. Evaluation of the different types of breeding processes showed that the generation of hybrids (crossbreeding) has more profound effects on cell morphology than the isolation of mutants (mutation breeding). Analysis of phenotypic robustness revealed that some sake yeast strains are more morphologically heterogeneous, possibly due to impairment of cellular network hubs. This study provides a new perspective for studying yeast breeding genetics and micro-organism breeding strategies. PMID:28642365

A Method of Visualizing Three-Dimensional Distribution of Yeast in Bread Dough

NASA Astrophysics Data System (ADS)

Maeda, Tatsurou; Do, Gab-Soo; Sugiyama, Junichi; Oguchi, Kosei; Shiraga, Seizaburou; Ueda, Mitsuyoshi; Takeya, Koji; Endo, Shigeru

A novel technique was developed to monitor the change in three-dimensional (3D) distribution of yeast in frozen bread dough samples in accordance with the progress of mixing process. Application of a surface engineering technology allowed the identification of yeast in bread dough by bonding EGFP (Enhanced Green Fluorescent Protein) to the surface of yeast cells. The fluorescent yeast (a biomarker) was recognized as bright spots at the wavelength of 520 nm. A Micro-Slicer Image Processing System (MSIPS) with a fluorescence microscope was utilized to acquire cross-sectional images of frozen dough samples sliced at intervals of 1 μm. A set of successive two-dimensional images was reconstructed to analyze 3D distribution of yeast. Samples were taken from each of four normal mixing stages (i.e., pick up, clean up, development, and final stages) and also from over mixing stage. In the pick up stage yeast distribution was uneven with local areas of dense yeast. As the mixing progressed from clean up to final stages, the yeast became more evenly distributed throughout the dough sample. However, the uniformity in yeast distribution was lost in the over mixing stage possibly due to the breakdown of gluten structure within the dough sample.

Polyhexamethyl biguanide can eliminate contaminant yeasts from fuel-ethanol fermentation process.

PubMed

Elsztein, Carolina; de Menezes, João Assis Scavuzzi; de Morais, Marcos Antonio

2008-09-01

Industrial ethanol fermentation is a non-sterile process and contaminant microorganisms can lead to a decrease in industrial productivity and significant economic loss. Nowadays, some distilleries in Northeastern Brazil deal with bacterial contamination by decreasing must pH and adding bactericides. Alternatively, contamination can be challenged by adding a pure batch of Saccharomyces cerevisiae-a time-consuming and costly process. A better strategy might involve the development of a fungicide that kills contaminant yeasts while preserving S. cerevisiae cells. Here, we show that polyhexamethyl biguanide (PHMB) inhibits and kills the most important contaminant yeasts detected in the distilleries of Northeastern Brazil without affecting the cell viability and fermentation capacity of S. cerevisiae. Moreover, some physiological data suggest that PHMB acts through interaction with the yeast membrane. These results support the development of a new strategy for controlling contaminant yeast population whilst keeping industrial yields high.

Ogataea phyllophila sp. nov., Candida chumphonensis sp. nov. and Candida mattranensis sp. nov., three methylotrophic yeast species from phylloplane in Thailand.

PubMed

Koowadjanakul, Nampueng; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Limtong, Savitree

2011-08-01

Five strains (LN12, LN14(T), LN15(T), LN16 and LN17(T)) representing three novel methylotrophic yeast species were isolated from the external surface of plant leaves by three-consecutive enrichments. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, the sequence analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene and the phylogenetic analysis, the five strains were assigned to be one novel Ogataea species and two novel Candida species. Three strains (LN12, LN14(T) and LN16) represent a single novel species of the genus Ogataea, for which the name Ogataea phyllophila sp. nov. is proposed. The type strain is LN14(T) (= BCC 42666(T) = NBRC 107780(T) = CBS 12095(T)). Strain LN15(T) was assigned to be Candida chumphonensis sp. nov. (type strain LN15(T) = BCC 42667(T) = NBRC 107781(T) = CBS 12096(T)). Strain LN17(T) represented another novel species of Candida that was named Candida mattranensis sp. nov. (type strain LN17(T) = BCC 42668(T) = NBRC 107782(T) = CBS 12097(T)).

Candida wancherniae sp. nov. and Candida morakotiae sp. nov., two novel ascomycetous anamorphic yeast species found in Thailand.

PubMed

Nakase, Takashi; Jindamorakot, Sasitorn; Ninomiya, Shinya; Imanishi, Yumi; Kawasaki, Hiroko

2009-04-01

Seven yeast strains isolated from natural substrates of Thailand were found to represent two novel species of Candida, an ascomycetous anamorphic genus. Three strains, ST-233, ST-259 and ST-260, isolated from insect frass and plant leaves were found to represent a single novel species related to Metschnikowia agaves in a tree based on the D1/D2 domain sequences of the 26S rRNA genes. This species is clearly discriminated from M. agaves by the carbon assimilation patterns and required vitamins. The remaining four strains, ST-18, ST-261, ST-606 and ST-658, isolated from the fruit body of a mushroom, insect frass, decayed jack fruit and an unidentified flower, were found to represent a single species which is related to Candida corydali, a recently described insect-associated species, in a neighbor-joining tree based on the D1/D2 sequences. This species is clearly discriminated from C. corydali by the ability to assimilate propane-1,2-diol and the inability to assimilate glucono-delta-lactone. They are described as Candida wancherniae sp. nov. and Candida morakotiae sp. nov., respectively.

Reclassification of the Candida haemulonii complex as Candida haemulonii (C. haemulonii group I), C. duobushaemulonii sp. nov. (C. haemulonii group II), and C. haemulonii var. vulnera var. nov.: three multiresistant human pathogenic yeasts.

PubMed

Cendejas-Bueno, E; Kolecka, A; Alastruey-Izquierdo, A; Theelen, B; Groenewald, M; Kostrzewa, M; Cuenca-Estrella, M; Gómez-López, A; Boekhout, T

2012-11-01

The Candida haemulonii species complex is currently known as C. haemulonii groups I and II. Here we describe C. haemulonii group II as a new species, Candida duobushaemulonii sp. nov., and C. haemulonii var. vulnera as new a variety of C. haemulonii group I using phenotypic and molecular methods. These taxa and other relatives of C. haemulonii (i.e., Candida auris and Candida pseudohaemulonii) cannot be differentiated by the commercial methods now used for yeast identification. Four isolates (C. haemulonii var. vulnera) differed from the other isolates of C. haemulonii in the sequence of the internal transcribed spacer (ITS) regions of the nuclear rRNA gene operon. The new species and the new variety have a multiresistant antifungal profile, which includes high MICs of amphotericin B (geometric mean MIC, 1.18 mg/liter for C. haemulonii var. vulnera and 2 mg/liter for C. duobushaemulonii sp. nov) and cross-resistance to azole compounds. Identification of these species should be based on molecular methods, such as sequence analysis of ITS regions and matrix-assisted laser desorption ionization-time of flight mass spectrometry.

Kazachstania yasuniensis sp. nov., an ascomycetous yeast species found in mainland Ecuador and on the Galápagos.

PubMed

James, Stephen A; Carvajal Barriga, Enrique Javier; Portero Barahona, Patricia; Nueno-Palop, Carmen; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

2015-04-01

Seven strains representing a novel yeast species belonging to the genus Kazachstania were found at several collection sites on both mainland Ecuador (Yasuní National Park) and the Galápagos (Santa Cruz Island). Two strains (CLQCA 20-132(T) and CLQCA 24SC-045) were isolated from rotten wood samples, two further strains (CLQCA 20-280 and CLQCA 20-348) were isolated from soil samples, and three strains (CLQCA 20-198, CLQCA 20-374 and CLQCA 20-431) were isolated from decaying fruits. Sequence analyses of the D1/D2 domains of the LSU rRNA gene and ribosomal internal transcribed spacer (ITS) region indicated that the novel species is most closely related to Kazachstania servazzii and Kazachstania unispora. Although the strains could not be distinguished from one another based upon their differing geographical origins, they could be differentiated according to their isolation source (fruit, soil or wood) by ITS sequencing. The species name Kazachstania yasuniensis sp. nov. is proposed to accommodate these strains, with CLQCA 20-132(T) ( = CBS 13946(T) = NCYC 4008(T)) designated the type strain. © 2015 Institute of Food Research.

Isolation and characterization of an acrylamide-degrading yeast Rhodotorula sp. strain MBH23 KCTC 11960BP.

PubMed

Rahim, M B H; Syed, M A; Shukor, M Y

2012-10-01

As well as for chemical and environmental reasons, acrylamide is widely used in many industrial applications. Due to its carcinogenicity and toxicity, its discharge into the environment causes adverse effects on humans and ecology alike. In this study, a novel acrylamide-degrading yeast has been isolated. The isolate was identified as Rhodotorula sp. strain MBH23 using ITS rRNA analysis. The results showed that the best carbon source for growth was glucose at 1.0% (w/v). The optimum acrylamide concentration, being a nitrogen source for cellular growth, was at 500 mg l(-1). The highest tolerable concentration of acrylamide was 1500 mg l(-1) whereas growth was completely inhibited at 2000 mg l(-1). At 500 mg l(-1), the strain MBH completely degraded acrylamide on day 5. Acrylic acid as a metabolite was detected in the media. Strain MBH23 grew well between pH 6.0 and 8.0 and between 27 and 30 °C. Amides such as 2-chloroacetamide, methacrylamide, nicotinamide, acrylamide, acetamide, and propionamide supported growth. Toxic heavy metals such as mercury, chromium, and cadmium inhibited growth on acrylamide. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Polyphasic Microbial Analysis of Traditional Korean Jeung-Pyun Sourdough Fermented with Makgeolli.

PubMed

Lim, Sae Bom; Tingirikari, Jagan Mohan Rao; Kwon, Ye Won; Li, Ling; Kim, Grace E; Han, Nam Soo

2017-02-28

Jeung-pyun, a fermented rice cake, is prepared by fermenting rice sourdough using makgeolli, a traditional Korean rice wine, in the presence of yeast and lactic acid bacteria (LAB). The goal of this study was to conduct biochemical and microbial analyses of five different rice sourdoughs, each fermented with a different commercial makgeolli, using culture-dependent and culture-independent approaches. All sourdough samples fermented with different makgeolli for 6.5 h showed different profiles in pH, total titratable acidity, organic acid concentration, and microbial growth. LAB belonging to different genera were identified based on colony morphology on modified MRS and sourdough bacteria agar medium. PCR-denaturinggradient gel electrophoresis analyses of the five sourdoughs showed different bands corresponding to LAB and yeast. 16S/26S rRNA gene sequence analyses of the samples confirmed that the predominant LAB in the five fermented rice doughs was Lactobacillus plantarum , Lb. pentosus , and Lb. brevis . Various other Lactobacillus spp. and Saccharomyces cerevisiae were common in all five fermented samples. This study provides comprehensive and comparative information on the microflora involved in fermentation of rice sourdough and signifies the need to develop effective starters to enrich the quality of jeung-pyun.

The influence of heavy metals on the production of extracellular polymer substances in the processes of heavy metal ions elimination.

PubMed

Mikes, J; Siglova, M; Cejkova, A; Masak, J; Jirku, V

2005-01-01

Wastewaters from a chemical industry polluted by heavy metal ions represent a hazard for all living organisms. It can mean danger for ecosystems and human health. New methods are sought alternative to traditional chemical and physical processes. Active elimination process of heavy metals ions provided by living cells, their components and extracellular products represents a potential way of separating toxic heavy metals from industrial wastewaters. While the abilities of bacteria to remove metal ions in solution are extensively used, fungi have been recognized as a promising kind of low-cost adsorbents for removal of heavy-metal ions from aqueous waste sources. Yeasts and fungi differ from each other in their constitution and in their abilities to produce variety of extracellular polymeric substances (EPS) with different mechanisms of metal interactions. The accumulation of Cd(2+), Cr(6+), Pb(2+), Ni(2+) and Zn(2+) by yeasts and their EPS was screened at twelve different yeast species in microcultivation system Bioscreen C and in the shaking Erlenmayer's flasks. This results were compared with the production of yeast EPS and the composition of yeast cell walls. The EPS production was measured during the yeast growth and cell wall composition was studied during the cultivations in the shaking flasks. At the end of the process extracellular polymers and their chemical composition were isolated and amount of bound heavy metals was characterized. The variable composition and the amount of the EPS were found at various yeast strains. It was influenced by various compositions of growth medium and also by various concentrations of heavy metals. It is evident, that the amount of bound heavy metals was different. The work reviews the possibilities of usage of various yeast EPS and components of cell walls in the elimination processes of heavy metal ions. Further the structure and properties of yeasts cell wall and EPS were discussed. The finding of mechanisms mentioned above is necessary to identify the functional groups entered in the metals elimination processes.

The yeast Saccharomyces cerevisiae- the main character in beer brewing.

PubMed

Lodolo, Elizabeth J; Kock, Johan L F; Axcell, Barry C; Brooks, Martin

2008-11-01

Historically, mankind and yeast developed a relationship that led to the discovery of fermented beverages. Numerous inventions have led to improved technologies and capabilities to optimize fermentation technology on an industrial scale. The role of brewing yeast in the beer-making process is reviewed and its importance as the main character is highlighted. On considering the various outcomes of functions in a brewery, it has been found that these functions are focused on supporting the supply of yeast requirements for fermentation and ultimately to maintain the integrity of the product. The functions/processes include: nutrient supply to the yeast (raw material supply for brewhouse wort production); utilities (supply of water, heat and cooling); quality assurance practices (hygiene practices, microbiological integrity measures and other specifications); plant automation (vessels, pipes, pumps, valves, sensors, stirrers and centrifuges); filtration and packaging (product preservation until consumption); distribution (consumer supply); and marketing (consumer awareness). Considering this value chain of beer production and the 'bottle neck' during production, the spotlight falls on fermentation, the age-old process where yeast transforms wort into beer.

Yeast prions are useful for studying protein chaperones and protein quality control.

PubMed

Masison, Daniel C; Reidy, Michael

2015-01-01

Protein chaperones help proteins adopt and maintain native conformations and play vital roles in cellular processes where proteins are partially folded. They comprise a major part of the cellular protein quality control system that protects the integrity of the proteome. Many disorders are caused when proteins misfold despite this protection. Yeast prions are fibrous amyloid aggregates of misfolded proteins. The normal action of chaperones on yeast prions breaks the fibers into pieces, which results in prion replication. Because this process is necessary for propagation of yeast prions, even small differences in activity of many chaperones noticeably affect prion phenotypes. Several other factors involved in protein processing also influence formation, propagation or elimination of prions in yeast. Thus, in much the same way that the dependency of viruses on cellular functions has allowed us to learn much about cell biology, the dependency of yeast prions on chaperones presents a unique and sensitive way to monitor the functions and interactions of many components of the cell's protein quality control system. Our recent work illustrates the utility of this system for identifying and defining chaperone machinery interactions.

Immobilization: A Revolution in Traditional Brewing

NASA Astrophysics Data System (ADS)

Virkajärvi, Ilkka; Linko, Matti

In nature many micro-organisms tend to bind to solid surfaces. This tendency has long been utilized in a number of processes, for example in producing vinegar and acetic acid in bioreactors filled with wood shavings. Acetobacteria are attached to the surface of these shavings. In modern technical language: they are immobilized. Also yeast cells can be immobilized. In the brewing industry this has been the basis for maintaining efficient, continuous fermentation in bioreactors with very high yeast concentrations. The most dramatic change in brewing over recent years has been the replacement of traditional lagering of several weeks by a continuous process in which the residence time is only about 2h. Continuous primary fermentation is used on a commercial scale in New Zealand. In this process, instead of a carrier, yeast is retained in reactors by returning it partly after separation. In many pilot scale experiments the primary fermentation is shortened from about 1week to 1-2days using immobilized yeast reactors. When using certain genetically modified yeast strains no secondary fermentation is needed, and the total fermentation time in immobilized yeast reactors can therefore be shortened to only 2days.

Pilot-scale production and liquid formulation of Rhodotorula minuta, a potential biocontrol agent of mango anthracnose.

PubMed

Patiño-Vera, M; Jiménez, B; Balderas, K; Ortiz, M; Allende, R; Carrillo, A; Galindo, E

2005-01-01

To develop a pilot-plant fermentation process for the production of the yeast Rhodotorula minuta, to be used as a biocontrol agent of mango anthracnose, using a low-cost culture medium. To develop a stable liquid formulation that preserve high viability of the yeast stored at 4 degrees C. Keeping constant the volumetric power input, a fermentation process was scaled-up from shake flasks to a 100 l bioreactor. Preharvest applications of the yeast resulted in postharvest anthracnose severity equal or lower than that observed with a chemical fungicide. Glycerol was added to the formulation as water activity reducer and xanthan gum as a viscosity-enhancing agent. Yeast initial concentration of 10(10) CFU ml(-1) resulted in 4-5 orders of magnitude decrease after 1 month of storage at 4 degrees C, whereas when it was formulated at 10(9) CFU ml(-1), the decrease was of two orders of magnitude in 6 months. The fermentation process was successfully scaled-up using a low-cost culture medium. Postharvest anthracnose severity could be considerably reduced using this yeast. Formulating the yeast at 10(9) CFU ml(-1) and adding glycerol (20%) and xanthan (5 g l(-1)) avoided both contamination and yeast sedimentation and it was able to preserve up to 10(7) CFU ml(-1) after 6 months at 4 degrees C. The yeast R. minuta is reported as a novel antagonistic micro-organism against the pathogen Colletotrichum gloeosporioides. Pilot plant production of this yeast allowed us to conduct field tests in commercial orchards during three harvest seasons. Yeast suspensions applied to mango trees reduced the fruit anthracnose severity in levels similar or better than chemical fungicides.

Presence and changes in populations of yeasts on raw and processed poultry products stored at refrigeration temperature.

PubMed

Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R

2000-12-05

A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P < or = 0.05) in whole chicken, ground chicken, liver, heart and gizzard, and in ground turkey and turkey sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.

Genomic evolution of the ascomycetous yeasts

USDA-ARS?s Scientific Manuscript database

Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphr...

Yeast biotechnology: teaching the old dog new tricks

PubMed Central

2014-01-01

Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature. PMID:24602262

Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov. and Candida manassasensis sp. nov., novel yeasts associated with wood-ingesting insects, and their ecological and biofuel implications.

PubMed

Suh, Sung-Oui; Houseknecht, Janice L; Gujjari, Pushpa; Zhou, Jianlong J

2013-11-01

During a survey of yeasts associated with wood-ingesting insects, 69 strains in the Scheffersomyces clade and related taxa were isolated from passalid and tenebrionid beetles and the decayed wood inhabited by them. The majority of these yeasts was found to be capable of fermenting xylose, and was recognized as Scheffersomyces stipitis or its close relative Scheffersomyces illinoinensis, which are known to be associated with wood-decaying beetles and rotten wood. Yeasts in 'Scheffersomyces' ( = Candida) ergatensis and 'Scheffersomyces' ( = Candida) coipomoensis were also frequently isolated. The remaining six strains were identified as representing four novel species in the genera Scheffersomyces and Candida based on multilocus sequence analyses of nuclear rRNA genes and four protein-coding genes, as well as other taxonomic characteristics. Two xylose-fermenting species, Scheffersomyces parashehatae f.a., sp. nov. (type strain ATCC MYA-4653(T) = CBS 12535(T) = EH045(T); MycoBank MB805440) and Scheffersomyces xylosifermentans f.a., sp. nov. (type strain ATCC MYA-4859(T) = CBS 12540(T) = MY10-052(T); MycoBank MB805441), formed a clade with Scheffersomyces shehatae and related Scheffersomyces species. Interestingly, S. xylosifermentans can survive at 40 °C, which is a rare property among xylose-fermenting yeasts. Candida broadrunensis sp. nov. (type strain ATCC MYA-4650(T) = CBS 11838(T) = EH019(T); MycoBank MB805442) is a sister taxon of C. ergatensis, while Candida manassasensis sp. nov. (type strain ATCC MYA-4652(T) = CBS 12534(T) = EH030(T); MycoBank MB805443) is closely related to Candida palmioleophila in the Candida glaebosa clade. The multilocus DNA sequence comparisons in this study suggest that the genus Scheffersomyces needs to be circumscribed to the species near S. stipitis (type species) and S. shehatae that can be characterized by the ability to ferment xylose.

Yeast community associated with the solid state fermentation of traditional Chinese Maotai-flavor liquor.

PubMed

Wu, Qun; Chen, Liangqiang; Xu, Yan

2013-09-02

Yeasts are the most important group of microorganisms contributing to liquor quality in the solid-state fermentation process of Chinese Maotai-flavor liquor. There occurred a complex yeast community structure during this process, including stages of Daqu (the starter) making, stacking fermentation on the ground and liquor fermentation in the pits. In the Daqu making stage, few yeast strains accumulated. However, the stacking fermentation stage accumulated nine yeast species with different physio-biochemical characteristics. But only four species kept dominant until liquor fermentation, which were Zygosaccharomyces bailii, Saccharomyces cerevisiae, Pichia membranifaciens, and Schizosaccharomyces pombe, implying their important functions in liquor making. The four species tended to inhabit in different locations of the stack and pits during stacking and liquor fermentation, due to the condition heterogeneity of the solid-state fermentation, including the different fermentation temperature profiles and oxygen density in different locations. Moreover, yeast population was much larger in the upper layer than that in the middle and bottom layers in liquor fermentation, which was in accordance with the profile of reducing sugar consumption and ethanol production. This was a systematical investigation of yeast community structure dynamics in the Maotai-flavor liquor fermentation process. It would be of help to understand the fermentative mechanism in solid-state fermentation for Maotai-flavor liquor. © 2013.

Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4.

PubMed

Seo, Eunyoung; Woo, Jongchan; Park, Eunsook; Bertolani, Steven J; Siegel, Justin B; Choi, Doil; Dinesh-Kumar, Savithramma P

2016-11-01

Autophagy is important for degradation and recycling of intracellular components. In a diversity of genera and species, orthologs and paralogs of the yeast Atg4 and Atg8 proteins are crucial in the biogenesis of double-membrane autophagosomes that carry the cellular cargoes to vacuoles and lysosomes. Although many plant genome sequences are available, the ATG4 and ATG8 sequence analysis is limited to some model plants. We identified 28 ATG4 and 116 ATG8 genes from the available 18 different plant genome sequences. Gene structures and protein domain sequences of ATG4 and ATG8 are conserved in plant lineages. Phylogenetic analyses classified ATG8s into 3 subgroups suggesting divergence from the common ancestor. The ATG8 expansion in plants might be attributed to whole genome duplication, segmental and dispersed duplication, and purifying selection. Our results revealed that the yeast Atg4 processes Arabidopsis ATG8 but not human LC3A (HsLC3A). In contrast, HsATG4B can process yeast and plant ATG8s in vitro but yeast and plant ATG4s cannot process HsLC3A. Interestingly, in Nicotiana benthamiana plants the yeast Atg8 is processed compared to HsLC3A. However, HsLC3A is processed when coexpressed with HsATG4B in plants. Molecular modeling indicates that lack of processing of HsLC3A by plant and yeast ATG4 is not due to lack of interaction with HsLC3A. Our in-depth analyses of ATG4 and ATG8 in the plant lineage combined with results of cross-kingdom ATG8 processing by ATG4 further support the evolutionarily conserved maturation of ATG8. Broad ATG8 processing by HsATG4B and lack of processing of HsLC3A by yeast and plant ATG4s suggest that the cross-kingdom ATG8 processing is determined by ATG8 sequence rather than ATG4.

Inventions on baker's yeast storage and activation at the bakery plant.

PubMed

Gélinas, Pierre

2010-01-01

Baker's yeast is the gas-forming ingredient in bakery products. Methods have been invented to properly handle baker's yeast and optimize its activity at the bakery plant. Over the years, incentives for inventions on yeast storage and activation have greatly changed depending on trends in the baking industry. For example, retailer's devices for cutting bulk pressed yeast and techniques for activating dry yeast have now lost their importance. Review of patents for invention indicates that activation of baker's yeast activity has been a very important issue for bakers, for example, with baking ingredients called yeast foods. In the recent years and especially for highly automated bakeries, interest has moved to equipments and processes for optimized storage of liquid cream yeast to thoroughly control dough fermentation and bread quality.

Macromitophagy is a longevity assurance process that in chronologically aging yeast limited in calorie supply sustains functional mitochondria and maintains cellular lipid homeostasis

PubMed Central

Burstein, Michelle T.; Koupaki, Olivia; Gomez-Perez, Alejandra; Levy, Sean; Pluska, Lukas; Mattie, Sevan; Rafeh, Rami; Iouk, Tatiana; Sheibani, Sara; Greenwood, Michael; Vali, Hojatollah; Titorenko, Vladimir I.

2013-01-01

Macromitophagy controls mitochondrial quality and quantity. It involves the sequestration of dysfunctional or excessive mitochondria within double-membrane autophagosomes, which then fuse with the vacuole/lysosome to deliver these mitochondria for degradation. To investigate a physiological role of macromitophagy in yeast, we examined how the atg32Δ-dependent mutational block of this process influences the chronological lifespan of cells grown in a nutrient-rich medium containing low (0.2%) concentration of glucose. Under these longevity-extending conditions of caloric restriction (CR) yeast cells are not starving. We also assessed a role of macromitophagy in lifespan extension by lithocholic acid (LCA), a bile acid that prolongs yeast longevity under CR conditions. Our findings imply that macromitophagy is a longevity assurance process underlying the synergistic beneficial effects of CR and LCA on yeast lifespan. Our analysis of how the atg32Δ mutation influences mitochondrial morphology, composition and function revealed that macromitophagy is required to maintain a network of healthy mitochondria. Our comparative analysis of the membrane lipidomes of organelles purified from wild-type and atg32Δ cells revealed that macromitophagy is required for maintaining cellular lipid homeostasis. We concluded that macromitophagy defines yeast longevity by modulating vital cellular processes inside and outside of mitochondria. PMID:23553280

Characterization and Dynamic Behavior of Wild Yeast during Spontaneous Wine Fermentation in Steel Tanks and Amphorae

PubMed Central

Díaz, Cecilia; Molina, Ana María; Nähring, Jörg; Fischer, Rainer

2013-01-01

We studied the dynamic behavior of wild yeasts during spontaneous wine fermentation at a winery in the Valais region of Switzerland. Wild yeasts in the winery environment were characterized using a PCR-RFLP method. Up to 11 different yeast species were isolated from the vineyard air, whereas only seven were recovered from the grapes surface. We initially investigated a cultureindependent method in pilot-scale steel fermentation tanks and found a greater diversity of yeasts in the musts from two red grape varieties compared to three white grape varieties. We found that the yeasts Metschnikowia pulcherrima, Rhodotorula mucilaginosa, Pichia kluyveri, P. membranifaciens and Saccharomyces cerevisiae remained active at the end of the fermentation. We also studied the dynamic behavior of yeasts in Qvevris for the first time using a novel, highlysensitive quantitative real-time PCR method. We found that non-Saccharomyces yeasts were present during the entire fermentation process, with R. mucilaginosa and P. anomala the most prominent species. We studied the relationship between the predominance of different species and the output of the fermentation process. We identified so-called spoilage yeasts in all the fermentations, but high levels of acetic acid accumulated only in those fermentations with an extended lag phase. PMID:23738327

Extracellular vesicle-mediated export of fungal RNA

PubMed Central

Peres da Silva, Roberta; Puccia, Rosana; Rodrigues, Marcio L.; Oliveira, Débora L.; Joffe, Luna S.; César, Gabriele V.; Nimrichter, Leonardo; Goldenberg, Samuel; Alves, Lysangela R.

2015-01-01

Extracellular vesicles (EVs) play an important role in the biology of various organisms, including fungi, in which they are required for the trafficking of molecules across the cell wall. Fungal EVs contain a complex combination of macromolecules, including proteins, lipids and glycans. In this work, we aimed to describe and characterize RNA in EV preparations from the human pathogens Cryptococcus neoformans, Paracoccidiodes brasiliensis and Candida albicans, and from the model yeast Saccharomyces cerevisiae. The EV RNA content consisted mostly of molecules less than 250 nt long and the reads obtained aligned with intergenic and intronic regions or specific positions within the mRNA. We identified 114 ncRNAs, among them, six small nucleolar (snoRNA), two small nuclear (snRNA), two ribosomal (rRNA) and one transfer (tRNA) common to all the species considered, together with 20 sequences with features consistent with miRNAs. We also observed some copurified mRNAs, as suggested by reads covering entire transcripts, including those involved in vesicle-mediated transport and metabolic pathways. We characterized for the first time RNA molecules present in EVs produced by fungi. Our results suggest that RNA-containing vesicles may be determinant for various biological processes, including cell communication and pathogenesis. PMID:25586039

From drug to protein: using yeast genetics for high-throughput target discovery.

PubMed

Armour, Christopher D; Lum, Pek Yee

2005-02-01

The budding yeast Saccharomyces cerevisiae has long been an effective eukaryotic model system for understanding basic cellular processes. The genetic tractability and ease of manipulation in the laboratory make yeast well suited for large-scale chemical and genetic screens. Several recent studies describing the use of yeast genetics for high-throughput drug target identification are discussed in this review.

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

PubMed

Liang, Xue-Hai; Crooke, Stanley T

2011-06-01

Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

Fungus symbionts colonizing the galleries of the ambrosia beetle Platypus quercivorus.

PubMed

Endoh, Rikiya; Suzuki, Motofumi; Okada, Gen; Takeuchi, Yuko; Futai, Kazuyoshi

2011-07-01

Isolations were made to determine the fungal symbionts colonizing Platypus quercivorus beetle galleries of dead or dying Quercus laurifolia, Castanopsis cuspidata, Quercus serrata, Quercus crispula, and Quercus robur. For these studies, logs from oak wilt-killed trees were collected from Kyoto Prefecture, Japan. Fungi were isolated from the: (1) entrances of beetle galleries, (2) vertical galleries, (3) lateral galleries, and (4) the larval cradle of P. quercivorus in each host tree. Among the fungus colonies which appeared on YM agar plates, 1,219 were isolated as the representative isolates for fungus species inhabiting in the galleries based on their cultural characteristics. The validity of the visual classification of the fungus colonies was checked and if necessary properly corrected using microsatellite-primed PCR fingerprints. The nucleotide sequence of the D1/D2 region of the large subunit nuclear rRNA gene detected 38 fungus species (104 strains) of which three species, i.e., Candida sp. 3, Candida kashinagacola (both yeasts), and the filamentous fungus Raffaelea quercivora were isolated from all the tree species. The two yeasts were most prevalent in the interior of galleries, regardless of host tree species, suggesting their close association with the beetle. A culture-independent method, terminal restriction fragment length polymorphism (T-RFLP) analysis was also used to characterize the fungus flora of beetle galleries. T-RFLP patterns showed that yeast species belonging to the genus Ambrosiozyma frequently occurred on the gallery walls along with the two Candida species. Ours is the first report showing the specific fungi inhabiting the galleries of a platypodid ambrosia beetle.

GAMETOPHYTE DEFECTIVE 1, a putative subunit of RNases P/MRP, is essential for female gametogenesis and male competence in Arabidopsis.

PubMed

Wang, Si-Qi; Shi, Dong-Qiao; Long, Yan-Ping; Liu, Jie; Yang, Wei-Cai

2012-01-01

RNA biogenesis, including biosynthesis and maturation of rRNA, tRNA and mRNA, is a fundamental process that is critical for cell growth, division and differentiation. Previous studies showed that mutations in components involved in RNA biogenesis resulted in abnormalities in gametophyte and leaf development in Arabidopsis. In eukaryotes, RNases P/MRP (RNase mitochondrial RNA processing) are important ribonucleases that are responsible for processing of tRNA, and transcription of small non-coding RNAs. Here we report that Gametophyte Defective 1 (GAF1), a gene encoding a predicted protein subunit of RNases P/MRP, AtRPP30, plays a role in female gametophyte development and male competence. Embryo sacs were arrested at stages ranging from FG1 to FG7 in gaf1 mutant, suggesting that the progression of the gametophytic division during female gametogenesis was impaired in gaf1 mutant. In contrast, pollen development was not affected in gaf1. However, the fitness of the mutant pollen tube was weaker than that of the wild-type, leading to reduced transmission through the male gametes. GAF1 is featured as a typical RPP30 domain protein and interacts physically with AtPOP5, a homologue of RNases P/MRP subunit POP5 of yeast. Together, our data suggest that components of the RNases P/MRP family, such as RPP30, play important roles in gametophyte development and function in plants.

SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

PubMed

Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

2016-03-01

Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Yeast as a model for Ras signalling.

PubMed

Tisi, Renata; Belotti, Fiorella; Martegani, Enzo

2014-01-01

For centuries yeast species have been popular hosts for classical biotechnology processes, such as baking, brewing, and wine making, and more recently for recombinant proteins production, thanks to the advantages of unicellular organisms (i.e., ease of genetic manipulation and rapid growth) together with the ability to perform eukaryotic posttranslational modifications. Moreover, yeast cells have been used for few decades as a tool for identifying the genes and pathways involved in basic cellular processes such as the cell cycle, aging, and stress response. In the budding yeast S. cerevisiae the Ras/cAMP/PKA pathway is directly involved in the regulation of metabolism, cell growth, stress resistance, and proliferation in response to the availability of nutrients and in the adaptation to glucose, controlling cytosolic cAMP levels and consequently the cAMP-dependent protein kinase (PKA) activity. Moreover, Ras signalling has been identified in several pathogenic yeasts as a key controller for virulence, due to its involvement in yeast morphogenesis. Nowadays, yeasts are still useful for Ras-like proteins investigation, both as model organisms and as a test tube to study variants of heterologous Ras-like proteins.

The Yeast Saccharomyces cerevisiae as a Model for Understanding RAS Proteins and Their Role in Human Tumorigenesis

PubMed Central

Cazzanelli, Giulia; Francisco, Rita; Azevedo, Luísa; Carvalho, Patrícia Dias; Almeida, Ana; Côrte-Real, Manuela; Oliveira, Maria José; Lucas, Cândida; Sousa, Maria João

2018-01-01

The exploitation of the yeast Saccharomyces cerevisiae as a biological model for the investigation of complex molecular processes conserved in multicellular organisms, such as humans, has allowed fundamental biological discoveries. When comparing yeast and human proteins, it is clear that both amino acid sequences and protein functions are often very well conserved. One example of the high degree of conservation between human and yeast proteins is highlighted by the members of the RAS family. Indeed, the study of the signaling pathways regulated by RAS in yeast cells led to the discovery of properties that were often found interchangeable with RAS proto-oncogenes in human pathways, and vice versa. In this work, we performed an updated critical literature review on human and yeast RAS pathways, specifically highlighting the similarities and differences between them. Moreover, we emphasized the contribution of studying yeast RAS pathways for the understanding of human RAS and how this model organism can contribute to unveil the roles of RAS oncoproteins in the regulation of mechanisms important in the tumorigenic process, like autophagy. PMID:29463063

Cloning and expression analysis of tps, and cryopreservation research of trehalose from Antarctic strain Pseudozyma sp.

PubMed

Yin, Hua; Wang, Yibin; He, Yingying; Xing, Lei; Zhang, Xiufang; Wang, Shuai; Qi, Xiaoqing; Zheng, Zhou; Lu, Jian; Miao, Jinlai

2017-10-01

Trehalose is a non-reducing disaccharide sugar that widely exists in a variety of organisms, such as bacteria and eukaryotes except the vertebrates. It plays an important role in a number of critical metabolic functions especially in response to stressful environmental conditions. However, the biosynthetic pathways of trehalose in cold-adapted yeast and its responses to temperature and salinity changes remain little understood. In this study, the genome of Antarctic-isolated Pseudozyma sp. NJ7 was generated from which we identified the gene coding for trehalose phosphate synthase (TPS1) and trehalose phosphate phosphatase (TPS2), the two enzymes most critical for trehalose production. The whole draft genome length of Pseudozyma sp. NJ7 was 18,021,233 bp, and encoded at least 34 rRNA operons and 72 tRNAs. The open reading frame of tps1 contained 1827 nucleotide encoding 608 amino acids with a molecular weight of 67.64 kDa, and an isoelectric point of 5.54, while tps2 contained 3948 nucleotide encoding 1315 amino acids with a molecular weight of 144.47 kDa and an isoelectric point of 6.36. The TPS1 and TPS2 protein sequences were highly homologous to Moesziomyces antarcticus T-34, but TPS2 had obvious specificity and differently with others which suggest species specificity and different evolutionary history. Expression level of tps1 gene was strongly influenced by temperature and high salinity. In addition, addition of 0.5% trehalose preserved yeast cells in the short term but was not effective for cryopreservation for more than 5 days, but still suggesting that exogenous trehalose could indeed significantly improve the survival of yeast cells under freezing conditions. Our results provided new insights on the molecular basis of cold adaptations of Antarctic Pseudozyma sp., and also generated new information on the roles trehalose play in yeast tolerance to extreme conditions in the extreme Antarctic environments.

Description of Diutina gen. nov., Diutina siamensis, f.a. sp. nov., and reassignment of Candida catenulata, Candida mesorugosa, Candida neorugosa, Candida pseudorugosa, Candida ranongensis, Candida rugosa and Candida scorzettiae to the genus Diutina.

PubMed

Khunnamwong, Pannida; Lertwattanasakul, Noppon; Jindamorakot, Sasitorn; Limtong, Savitree; Lachance, Marc-André

2015-12-01

Three strains (DMKU-RE28, DMKU-RE43T and DMKU-RE123) of a novel anamorphic yeast species were isolated from rice leaf tissue collected in Thailand. DNA sequence analysis demonstrated that the species forms a sister pair with Candida ranongensis CBS 10861T but differs by 24-30 substitutions in the LSU rRNA gene D1/D2 domains and 30-35 substitutions in the ITS region. A phylogenetic analysis based on both the small and the large rRNA gene subunits confirmed this connection and demonstrated the presence of a clade that also includes Candida catenulata, Candida mesorugosa, Candida neorugosa, Candida pseudorugosa, Candida rugosa and Candida scorzettiae. The clade is not closely affiliated to any known teleomorphic genus, and forms a well-separated lineage from currently recognized genera of the Saccharomycetales. Hence, the genus Diutina gen. nov. is proposed to accommodate members of the clade, including Diutina siamensis f.a. sp. nov. and the preceding seven Candida species. The type strain is DMKU-RE43T ( = CBS 13388T = BCC 61183T = NBRC 109695T).

Legionella saoudiensis sp. nov., isolated from a sewage water sample.

PubMed

Bajrai, Leena Hussein; Azhar, Esam Ibraheem; Yasir, Muhammad; Jardot, Priscilla; Barrassi, Lina; Raoult, Didier; La Scola, Bernard; Pagnier, Isabelle

2016-11-01

A Gram-stain-negative, bacilli-shaped bacterial strain, LS-1T, was isolated from a sewage water sample collected in Jeddah, Saudi Arabia. The taxonomic position of strain LS-1T was investigated using a polyphasic taxonomic approach. Phylogenetic analysis based on 16S rRNA gene sequences and those of four other genes indicated that strain LS-1T belongs to the genus Legionella in the family Legionellaceae. Regarding the 16S rRNA gene, the most closely related species are Legionella rowbothamii LLAP-6T (98.6 %) and Legionella lytica L2T (98.5 %). The mip gene sequence of strain LS-1T showed 94 % sequence similarity with that of L. lytica L2T and 93 % similarity with that of L. rowbothamii LLAP-6T. Strain LS-1T grew optimally at a temperature of 32 °C on a buffered charcoal yeast extract (BCYE) agar plate in a 5 % CO2 atmosphere and had a flagellum. The combined phylogenetic, phenotypic and genomic sequence data suggest that strain LS-1T represents a novel species of the genus Legionella, for which the name Legionella saoudiensis sp. nov. is proposed. The type strain is LS-1T (=DSM 101682T=CSUR P2101T).

Culture-independent analysis of lactic acid bacteria diversity associated with mezcal fermentation.

PubMed

Narváez-Zapata, J A; Rojas-Herrera, R A; Rodríguez-Luna, I C; Larralde-Corona, C P

2010-11-01

Mezcal is an alcoholic beverage obtained from the distillation of fermented juices of cooked Agave spp. plant stalks (agave must), and each region in Mexico with denomination of origin uses defined Agave species to prepare mezcal with unique organoleptic characteristics. During fermentation to produce mezcal in the state of Tamaulipas, not only alcohol-producing yeasts are involved, but also a lactic acid bacterial community that has not been characterized yet. In order to address this lack of knowledge on this traditional Mexican beverage, we performed a DGGE-16S rRNA analysis of the lactic acid bacterial diversity and metabolite accumulation during the fermentation of a typical agave must that is rustically produced in San Carlos County (Tamaulipas, Mexico). The analysis of metabolite production indicated a short but important malolactic fermentation stage not previously described for mezcal. The denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA genes showed a distinctive lactic acid bacterial community composed mainly of Pediococcus parvulus, Lactobacillus brevis, Lactobacillus composti, Lactobacillus parabuchneri, and Lactobacillus plantarum. Some atypical genera such as Weissella and Bacillus were also found in the residual must. Our results suggest that the lactic acid bacteria could strongly be implicated in the organoleptic attributes of this traditional Mexican distilled beverage.

Peptoniphilus catoniae sp. nov., isolated from a human faecal sample from a traditional Peruvian coastal community

PubMed Central

Patel, Nisha B.; Tito, Raul Y.; Obregón-Tito, Alexandra J.; O'Neal, Lindsey; Trujillo-Villaroel, Omar; Marin-Reyes, Luis; Troncoso-Corzo, Luzmila; Guija-Poma, Emilio; Lewis, Cecil M.

2016-01-01

A novel Gram-stain-positive, coccus-shaped, obligately anaerobic bacterium was isolated from a faecal sample obtained from an individual in a traditional community located off the southern coast of Peru. Comparative 16S rRNA gene sequence analysis showed the novel bacterium belonged to the genus Peptoniphilus but showed no particular relationship with any species, demonstrating less than 91 % 16S rRNA gene sequence similarity with all members of the genus. The major cellular fatty acids of the novel isolate were determined to be C10 : 0, C14 : 0, C16 : 0, C18 : 1ω9c and C18 : 2ω6,9c/anteiso-C18 : 0. The DNA G+C content was 34.4 mol%. End-products of metabolism from peptone-yeast-glucose broth (PYG) were determined to be acetate and butyrate. Based on the phenotypic, chemotaxonomic and phylogenetic results, the organism represents a novel species of the genus Peptoniphilus, for which the name Peptoniphilus catoniae sp. nov. is proposed. The type strain is M6.X2DT ( = DSM 29874T = CCUG 66798T). PMID:26907921

Jonquetella anthropi gen. nov., sp. nov., the first member of the candidate phylum 'Synergistetes' isolated from man.

PubMed

Jumas-Bilak, Estelle; Carlier, Jean-Philippe; Jean-Pierre, Hélène; Citron, Diane; Bernard, Kathryn; Damay, Audrey; Gay, Bernard; Teyssier, Corinne; Campos, Josiane; Marchandin, Hélène

2007-12-01

Six clinical isolates of a hitherto unknown, strictly anaerobic, Gram-negative rod showing fastidious growth were subjected to a polyphasic taxonomic study, including phenotypic, genomic and phylogenetic feature analyses. 16S rRNA gene sequenced-based phylogeny revealed that the novel strains represent a homogeneous group distant from any recognized species in the candidate phylum 'Synergistetes'. The novel isolates were most closely related to species of the genus Dethiosulfovibrio, with 88.2-88.7 % 16S rRNA gene sequence similarity. Large-scale chromosome structure and DNA G+C content also differentiated the novel strains from members of the genus Dethiosulfovibrio. The novel strains were asaccharolytic. Major metabolic end products in trypticase/glucose/yeast extract broth were acetic, lactic, succinic and isovaleric acids and the major cellular fatty acids iso-C(15 : 0) and C(16 : 0). Based on the data presented here, a new genus, Jonquetella gen. nov., is proposed with one novel species, Jonquetella anthropi sp. nov. J. anthropi is the first characterized species of the candidate phylum 'Synergistetes' that includes human isolates. The G+C content of the DNA of the type strain of J. anthropi ADV 126(T) (=AIP 136.05(T)=CIP 109408(T)=CCUG 53819(T)) is 59.4 mol%.

Technological properties of bakers' yeasts in durum wheat semolina dough.

PubMed

Giannone, Virgilio; Longo, Chiara; Damigella, Arcangelo; Raspagliesi, Domenico; Spina, Alfio; Palumbo, Massimo

2010-04-01

Properties of 13 Saccharomyces cerevisiae strains isolated from different sources (traditional sourdoughs, industrial baking yeasts etc.) were studied in dough produced with durum wheat (Sicilian semolina, variety Mongibello). Durum wheat semolina and durum wheat flour are products prepared from grain of durum wheat (Triticum durum Desf.) by grinding or milling processes in which the bran and germ are essentially removed and the remainder is comminuted to a suitable degree of fineness. Acidification and leavening properties of the dough were evaluated. Strains isolated from traditional sourdoughs (DSM PST18864, DSM PST18865 and DSM PST18866) showed higher leavening power, valuable after the first and second hours of fermentation, than commercial baking yeasts. In particular the strain DSM PST 18865 has also been successfully tested in bakery companies for the improvement of production processes. Baking and staling tests were carried out on five yeast strains to evaluate their fermentation ability directly and their resistance to the staling process. Amplified fragment length polymorphism (fAFLP) was used to investigate genetic variations in the yeast strains. This study showed an appreciable biodiversity in the microbial populations of both wild and commercial yeast strains.

Comparative genomics of biotechnologically important yeasts

USDA-ARS?s Scientific Manuscript database

Saccharomyces cerevisiae, is used in the vast majority of the world’s bioprocesses, and its economic significance is unchallenged. It, however, represents only a small slice of yeast physiological diversity. Many other yeasts, are used in lesser known, but commercially important processes that take ...

Impact of osmotic stress and ethanol inhibition in yeast cells on process oscillation associated with continuous very-high-gravity ethanol fermentation

PubMed Central

2013-01-01

Background VHG fermentation is a promising process engineering strategy aiming at improving ethanol titer, and thus saving energy consumption for ethanol distillation and distillage treatment. However, sustained process oscillation was observed during continuous VHG ethanol fermentation, which significantly affected ethanol fermentation performance of the system. Results Sustained process oscillation was investigated in continuous VHG ethanol fermentation, and stresses exerted on yeast cells by osmotic pressure from unfermented sugars and ethanol inhibition developed within the fermentation system were postulated to be major factors triggering this phenomenon. In this article, steady state was established for continuous ethanol fermentation with LG medium containing 120 g/L glucose, and then 160 g/L non-fermentable xylose was supplemented into the LG medium to simulate the osmotic stress on yeast cells under the VHG fermentation condition, but the fermentation process was still at steady state, indicating that the impact of osmotic stress on yeast cells was not the main reason for the process oscillation. However, when 30 g/L ethanol was supplemented into the LG medium to simulate the ethanol inhibition in yeast cells under the VHG fermentation condition, process oscillation was triggered, which was augmented with extended oscillation period and exaggerated oscillation amplitude as ethanol supplementation was increased to 50 g/L, but the process oscillation was gradually attenuated when the ethanol supplementations were stopped, and the steady state was restored. Furthermore, gas stripping was incorporated into the continuous VHG fermentation system to in situ remove ethanol produced by Saccharomyces cerevisiae, and the process oscillation was also attenuated, but restored after the gas stripping was interrupted. Conclusions Experimental results indicated that ethanol inhibition rather than osmotic stress on yeast cells is one of the main factors triggering the process oscillation under the VHG fermentation condition, and in the meantime gas stripping was validated to be an effective strategy for attenuating the process oscillation. PMID:24041271

An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

PubMed Central

McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

1997-01-01

An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits

PubMed Central

Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.

2010-01-01

A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688

Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

PubMed Central

Patarca, R; Dorta, B; Ramirez, J L

1982-01-01

As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

In Situ Analysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

PubMed Central

Kong, Yu; Wu, Qun; Zhang, Yan

2014-01-01

The in situ metabolic characteristics of the yeasts involved in spontaneous fermentation process of Chinese light-style liquor are poorly understood. The covariation between metabolic profiles and yeast communities in Chinese light-style liquor was modeled using the partial least square (PLS) regression method. The diversity of yeast species was evaluated by sequence analysis of the 26S ribosomal DNA (rDNA) D1/D2 domains of cultivable yeasts, and the volatile compounds in fermented grains were analyzed by gas chromatography (GC)-mass spectrometry (MS). Eight yeast species and 58 volatile compounds were identified, respectively. The modulation of 16 of these volatile compounds was associated with variations in the yeast population (goodness of prediction [Q2] > 20%). The results showed that Pichia anomala was responsible for the characteristic aroma of Chinese liquor, through the regulation of several important volatile compounds, such as ethyl lactate, octanoic acid, and ethyl tetradecanoate. Correspondingly, almost all of the compounds associated with P. anomala were detected in a pure culture of this yeast. In contrast to the PLS regression results, however, ethyl lactate and ethyl isobutyrate were not detected in the same pure culture, which indicated that some metabolites could be generated by P. anomala only when it existed in a community with other yeast species. Furthermore, different yeast communities provided different volatile patterns in the fermented grains, which resulted in distinct flavor profiles in the resulting liquors. This study could help identify the key yeast species involved in spontaneous fermentation and provide a deeper understanding of the role of individual yeast species in the community. PMID:24727269

Isolation, selection and evaluation of yeasts for use in fermentation of coffee beans by the wet process.

PubMed

de Melo Pereira, Gilberto Vinícius; Soccol, Vanete Thomaz; Pandey, Ashok; Medeiros, Adriane Bianchi Pedroni; Andrade Lara, João Marcos Rodrigues; Gollo, André Luiz; Soccol, Carlos Ricardo

2014-10-01

During wet processing of coffee, the ripe cherries are pulped, then fermented and dried. This study reports an experimental approach for target identification and selection of indigenous coffee yeasts and their potential use as starter cultures during the fermentation step of wet processing. A total of 144 yeast isolates originating from spontaneously fermenting coffee beans were identified by molecular approaches and screened for their capacity to grow under coffee-associated stress conditions. According to ITS-rRNA gene sequencing, Pichia fermentans and Pichia kluyveri were the most frequent isolates, followed by Candida Candida glabrata, quercitrusa, Saccharomyces sp., Pichia guilliermondii, Pichia caribbica and Hanseniaspora opuntiae. Nine stress-tolerant yeast strains were evaluated for their ability to produce aromatic compounds in a coffee pulp simulation medium and for their pectinolytic activity. P. fermentans YC5.2 produced the highest concentrations of flavor-active ester compounds (viz., ethyl acetate and isoamyl acetate), while Saccharomyces sp. YC9.15 was the best pectinase-producing strain. The potential impact of these selected yeast strains to promote flavor development in coffee beverages was investigated for inoculating coffee beans during wet fermentation trials at laboratory scale. Inoculation of a single culture of P. fermentans YC5.2 and co-culture of P. fermentans YC5.2 and Saccharomyces sp. YC9.15 enhanced significantly the formation of volatile aroma compounds during the fermentation process compared to un-inoculated control. The sensory analysis indicated that the flavor of coffee beverages was influenced by the starter cultures, being rated as having the higher sensory scores for fruity, buttery and fermented aroma. This demonstrates a complementary role of yeasts associated with coffee quality through the synthesis of yeast-specific volatile constituents. The yeast strains P. fermentans YC5.2 and Saccharomyces sp. YC9.15 have a great potential for use as starter cultures in wet processing of coffee and may possibly help to control and standardize the fermentation process and produce coffee beverages with novel and desirable flavor profiles. Copyright © 2014. Published by Elsevier B.V.

Yeast fuel cell: Application for desalination

NASA Astrophysics Data System (ADS)

Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

2016-02-01

Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

Mitochondrial metabolism and stress response of yeast: Applications in fermentation technologies.

PubMed

Kitagaki, Hiroshi; Takagi, Hiroshi

2014-04-01

Mitochondria are sites of oxidative respiration. During sake brewing, sake yeasts are exposed to long periods of hypoxia; the structure, role, and metabolism of mitochondria of sake yeasts have not been studied in detail. It was first elucidated that the mitochondrial structure of sake yeast transforms from filamentous to dotted structure during sake brewing, which affects malate metabolism. Based on the information of yeast mitochondria during sake brewing, practical technologies have been developed; (i) breeding pyruvate-underproducing sake yeast by the isolation of a mutant resistant to an inhibitor of mitochondrial pyruvate transport; and (ii) modifying malate and succinate production by manipulating mitochondrial activity. During the bread-making process, baker's yeast cells are exposed to a variety of baking-associated stresses, such as freeze-thaw, air-drying, and high sucrose concentrations. These treatments induce oxidative stress generating reactive oxygen species due to mitochondrial damage. A novel metabolism of proline and arginine catalyzed by N-acetyltransferase Mpr1 in the mitochondria eventually leads to synthesis of nitric oxide, which confers oxidative stress tolerance on yeast cells. The enhancement of proline and arginine metabolism could be promising for breeding novel baker's yeast strains that are tolerant to multiple baking-associated stresses. These new and practical methods provide approaches to improve the processes in the field of industrial fermentation technologies. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Beta-glucan-depleted, glycopeptide-rich extracts from Brewer's and Baker's yeast (Saccharomyces cerevisiae) lower interferon-gamma production by stimulated human blood cells in vitro.

PubMed

Williams, Roderick; Dias, Daniel A; Jayasinghe, Nirupama; Roessner, Ute; Bennett, Louise E

2016-04-15

Regulation of the human immune system requires controlled pro- and anti-inflammatory responses for host defence against infection and disease states. Yeasts (Saccharomyces cerevisiae), as used in brewing and baking, are mostly known for ability to stimulate the human immune-system predominantly reflecting the pro-inflammatory cell wall β-glucans. However, in this study, using food-compatible processing methods, glycopeptide-enriched and β-glucan-depleted products were each prepared from Brewer's and Baker's yeasts, which suppressed production of interferon-γ (IFN-γ) in human whole blood cell assay, signifying that anti-inflammatory factors are also present in yeast. Anti-inflammatory bioactivities of products prepared from Brewer's and Baker's yeast were compared with the commercial yeast product, Epicor®. While unfractionated Epicor was inactive, the C18 resin-binding fractions of Brewer's and Baker's yeast products and Epicor dose-dependently lowered IFN-γ, demonstrating that Epicor also contained both pro-inflammatory (β-glucans) and anti-inflammatory components. Anti-inflammatory activity was attributed to C18 resin-binding species glyco-peptides in Epicor and experimental yeast products. This study demonstrated that pro- and anti-inflammatory factors could be resolved and enriched in yeasts by suitable processing, with potential to improve specific activities. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Yeast diversity and dynamics in the production processes of Norwegian dry-cured meat products.

PubMed

Asefa, Dereje T; Møretrø, Trond; Gjerde, Ragnhild O; Langsrud, Solveig; Kure, Cathrine F; Sidhu, Maan S; Nesbakken, Truls; Skaar, Ida

2009-07-31

This study investigate the diversity and dynamics of yeasts in the production processes of one unsmoked and two smoked dry-cured meat products of a Norwegian dry-cured meat production facility. A longitudinal observational study was performed to collect 642 samples from the meat, production materials, room installations and indoor and outdoor air of the production facility. Nutrient rich agar media were used to isolate the yeasts. Morphologically different isolates were re-cultivated in their pure culture forms. Both classical and molecular methods were employed for species identification. Totally, 401 yeast isolates belonging to 10 species of the following six genera were identified: Debaryomyces, Candida, Rhodotorula, Rhodosporidium, Cryptococcus and Sporidiobolus. Debaryomyces hansenii and Candida zeylanoides were dominant and contributed by 63.0% and 26.4% respectively to the total isolates recovered from both smoked and unsmoked products. The yeast diversity was higher at the pre-salting production processes with C. zeylanoides being the dominant. Later at the post-salting stages, D. hansenii occurred frequently. Laboratory studies showed that D. hansenii was more tolerant to sodium chloride and nitrite than C. zeylanoides. Smoking seems to have a killing or a temporary growth inhibiting effect on yeasts that extend to the start of the drying process. Yeasts were isolated only from 31.1% of the environmental samples. They belonged to six different species of which five of them were isolated from the meat samples too. Debaryomyces hansenii and Rhodotorula glutinis were dominant with a 62.6% and 22.0% contribution respectively. As none of the air samples contained D. hansenii, the production materials and room installations used in the production processes were believed to be the sources of contamination. The dominance of D. hansenii late in the production process replacing C. zeylanoides should be considered as a positive change both for the quality and safety of the products, as C. zeylanoides has been documented as an emerging pathogen.

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

Methods and materials for the production of L-lactic acid in yeast

DOEpatents

Hause, Ben [Jordan, MN; Rajgarhia, Vineet [Minnetonka, MN; Suominen, Pirkko [Maple Grove, MN

2009-05-19

Recombinant yeast are provided having, in one aspect, multiple exogenous LDH genes integrated into the genome, while leaving native PDC genes intact. In a second aspect, recombinant yeast are provided having an exogenous LDH gene integrated into its genome at the locus of a native PDC gene, with deletion of the native PDC gene. The recombinant yeast are useful in fermentation process for producing lactic acid.

RNase MRP and the RNA processing cascade in the eukaryotic ancestor.

PubMed

Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J

2007-02-08

Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches.

Elevated levels of Era GTPase improve growth, 16S rRNA processing, and 70S ribosome assembly of Escherichia coli lacking highly conserved multifunctional YbeY endoribonuclease.

PubMed

Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C

2018-06-18

YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.

Microbial biodiversity of Sardinian oleic ecosystems.

PubMed

Santona, Mario; Sanna, Maria Lina; Multineddu, Chiara; Fancello, Francesco; de la Fuente, Sara Audije; Dettori, Sandro; Zara, Severino

2018-04-01

The olives are rich in microorganisms that, during the extraction process may persist in the oils and can influence their physicochemical and sensory characteristics. In this work, and for the first time, we isolated and identified microbial species, yeast and bacteria, present during the production process in four Sardinian (Italy) oleic ecosystems. Among these varieties, we found that Nera di Gonnos was associated to the highest microbial biodiversity, which was followed by Bosana, Nocellara del Belice and Semidana. Among the different microbial species isolated, some are specific of olive ecological niches, such as Cryptococcus spp and Serratia spp; and others to olive oils such as Candida spp and Saccharomyces. Some other species identified in this work were not found before in oleic ecosystems. The enzymatic analyses of yeast and bacteria showed that they have good β-glucosidase activity and yeast also showed good β-glucanase activity. The majority of bacteria presented lipolytic and catalase activities while in yeast were species-specific. Interestingly, yeast and bacteria isolates presented a high resistance to bile acid, and about 65% of the yeast were able to resist at pH 2.5 for 2 h. Finally, bacteria showed no biofilm activity compared to yeast. Copyright © 2017 Elsevier Ltd. All rights reserved.

Incidence of osmophilic yeasts and Zygosaccharomyces rouxii during the production of concentrate grape juices.

PubMed

Rojo, M C; Torres Palazzolo, C; Cuello, R; González, M; Guevara, F; Ponsone, M L; Mercado, L A; Martínez, C; Combina, M

2017-06-01

Zygosaccharomyces rouxii is the main spoilage yeast of grape juice concentrates. Detection and identification of Z. rouxii during the production of grape juice concentrate is critical to prevent spoilage in the final product. In this work, three grape juice concentrate processing plants were assessed by identifying osmophilic yeasts in juices and surfaces during different stages of a complete production line. Subsequently, molecular typing of Z. rouxii isolates was done to determine the strain distribution of this spoilage yeast. Osmotolerant yeast species, other than Z. rouxii, were mainly recovered from processing plant environments. Z. rouxii was only isolated from surface samples with grape juice remains. Z. rouxii was largely isolated from grape juice samples with some degree of concentration. Storage of grape juice pre-concentrate and concentrate allowed an increase in the Z. rouxii population. A widely distributed dominant molecular Z. rouxii pattern was found in samples from all three processing plants, suggesting resident microbes inside the plant. Copyright © 2016 Elsevier Ltd. All rights reserved.

Designing industrial yeasts for the consolidated bioprocessing of starchy biomass to ethanol

PubMed Central

Favaro, Lorenzo; Jooste, Tania; Basaglia, Marina; Rose, Shaunita H.; Saayman, Maryna; Görgens, Johann F.; Casella, Sergio; van Zyl, Willem H.

2013-01-01

Consolidated bioprocessing (CBP), which integrates enzyme production, saccharification and fermentation into a one step process, is a promising strategy for the effective ethanol production from cheap lignocellulosic and starchy materials. CBP requires a highly engineered microbial strain able to both hydrolyze biomass with enzymes produced on its own and convert the resulting simple sugars into high-titer ethanol. Recently, heterologous production of cellulose and starch-degrading enzymes has been achieved in yeast hosts, which has realized direct processing of biomass to ethanol. However, essentially all efforts aimed at the efficient heterologous expression of saccharolytic enzymes in yeast have involved laboratory strains and much of this work has to be transferred to industrial yeasts that provide the fermentation capacity and robustness desired for large scale bioethanol production. Specifically, the development of an industrial CBP amylolytic yeast would allow the one-step processing of low-cost starchy substrates into ethanol. This article gives insight in the current knowledge and achievements on bioethanol production from starchy materials with industrial engineered S. cerevisiae strains. PMID:22989992

Effect of the bread-making process on zearalenone levels.

PubMed

Heidari, Sara; Milani, Jafar; Nazari, Seyed Saman Seyed Jafar

2014-01-01

The effects of the bread-making process including fermentation with Saccharomyces cerevisiae and lactic acid bacteria (Lactobacillus casei, Lactobacillus rhamnosus, Lactobacillus acidophilus and Lactobacillus fermentum) and baking at 200°C on zearalenone (ZEA) levels were investigated. Standard solutions of ZEA were added to flour and then loaves of bread were prepared. Sourdough and three types of yeast including active dry yeast, instant dry yeast and compressed yeast were used for the fermentation of dough. ZEA levels in flour, dough and bread were determined by HPLC with fluorescence detection after extraction and clean-up on an immunoaffinity column. The highest reduction in levels of ZEA was found in the first fermentation (first proof), while the lowest reduction was observed in the baking stage. In addition, the results showed that compressed yeast had the maximum reduction potential on ZEA levels even at the baking stage.

[Process development for continuous ethanol fermentation by the flocculating yeast under stillage backset conditions].

PubMed

Zi, Lihan; Liu, Chenguang; Bai, Fengwu

2014-02-01

Propionic acid, a major inhibitor to yeast cells, was accumulated during continuous ethanol fermentation from corn meal hydrolysate by the flocculating yeast under stillage backset conditions. Based on its inhibition mechanism in yeast cells, strategies were developed for alleviating this effect. Firstly, high temperature processes such as medium sterilization generated more propionic acid, which should be avoided. Propionic acid was reduced significantly during ethanol fermentation without medium sterilization, and concentrations of biomass and ethanol increased by 59.3% and 7.4%, respectively. Secondly, the running time of stillage backset should be controlled so that propionic acid accumulated would be lower than its half inhibition concentration IC50 (40 mmol/L). Finally, because low pH augmented propionic acid inhibition in yeast cells, a higher pH of 5.5 was validated to be suitable for ethanol fermentation under the stillage backset condition.

Candida northwykensis sp. nov., a novel yeast isolated from the gut of the click beetle Melanotus villosus.

PubMed

Ravella, Sreenivas Rao; Donovan, Neil; James, Stephen A; Shivaji, Sisinthy; Arunasri, Kotakonda; Bond, Christopher J; Roberts, Ian N; Hobbs, Phil J

2011-08-01

Two yeast morphotypes, BET 4(T) and BET 7, were isolated from the gut of click beetle Melanotus villosus. Click beetles were collected from the decaying timber within the woodlands of North Wyke Research, South West England, UK (latitude, 50°46'29″N; longitude, 3°55'23″W). Morphotype BET 7 was identified as Debaryomyces hansenii, and the other morphotype, BET 4(T), was found to differ from Priceomyces castillae and Priceomyces haplophilus, its closest phylogenetic neighbours, by 5.0% with respect to the nucleotide sequence of the D1/D2 domain of the large-subunit (LSU) rRNA gene, and by 8.0% with respect to the ribosomal internal-transcribed spacer (ITS) region. BET 4(T) also differ from P. castillae and P. haplophilus in a number of different phenotypic characteristics. Thus, based on the unique nucleotide sequences of its D1/D2 domain and ITS region, its physiological characteristics and an inability to sporulate, strain BET 4(T) is assigned the status of a new species of Candida, for which the name Candida northwykensis sp. nov., is proposed. The type strain is BET 4(T) (NCYC 3525(T) = CBS 11370(T)).

Diphosphates at the 5' end of the positive strand of yeast L-A double-stranded RNA virus as a molecular self-identity tag.

PubMed

Fujimura, Tsutomu; Esteban, Rosa

2016-10-01

The 5'end of RNA conveys important information on self-identity. In mammalian cells, double-stranded RNA (dsRNA) with 5'di- or triphosphates generated during virus infection is recognized as foreign and elicits the host innate immune response. Here, we analyze the 5' ends of the dsRNA genome of the yeast L-A virus. The positive strand has largely diphosphates with a minor amount of triphosphates, while the negative strand has only diphosphates. Although the virus can produce capped transcripts by cap snatching, neither strand carried a cap structure, suggesting that only non-capped transcripts serve as genomic RNA for encapsidation. We also found that the 5' diphosphates of the positive but not the negative strand within the dsRNA genome are crucial for transcription in vitro. Furthermore, the presence of a cap structure in the dsRNA abrogated its template activity. Given that the 5' diphosphates of the transcripts are also essential for cap acquisition and that host cytosolic RNAs (mRNA, rRNA, and tRNA) are uniformly devoid of 5' pp-structures, the L-A virus takes advantage of its 5' terminal diphosphates, using them as a self-identity tag to propagate in the host cytoplasm. © 2016 John Wiley & Sons Ltd.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or translation factors, and areas related to translation fidelity, were found to undergo significant metal-induced conformational alterations, leading either to loosening of their structure or to more compact folding. These modifications were associated with parallel alterations in the translation process at multiple levels, a fact suggesting that structural perturbations in ribosomes, caused by metals, pose significant hurdles in translational efficiency and fidelity. Copyright © 2017 Elsevier B.V. All rights reserved.

Quasi-programmed aging of budding yeast: a trade-off between programmed processes of cell proliferation, differentiation, stress response, survival and death defines yeast lifespan

PubMed Central

Arlia-Ciommo, Anthony; Piano, Amanda; Leonov, Anna; Svistkova, Veronika; Titorenko, Vladimir I

2014-01-01

Recent findings suggest that evolutionarily distant organisms share the key features of the aging process and exhibit similar mechanisms of its modulation by certain genetic, dietary and pharmacological interventions. The scope of this review is to analyze mechanisms that in the yeast Saccharomyces cerevisiae underlie: (1) the replicative and chronological modes of aging; (2) the convergence of these 2 modes of aging into a single aging process; (3) a programmed differentiation of aging cell communities in liquid media and on solid surfaces; and (4) longevity-defining responses of cells to some chemical compounds released to an ecosystem by other organisms populating it. Based on such analysis, we conclude that all these mechanisms are programs for upholding the long-term survival of the entire yeast population inhabiting an ecological niche; however, none of these mechanisms is a ʺprogram of agingʺ - i.e., a program for progressing through consecutive steps of the aging process. PMID:25485579

Hydroponic potato production on nutrients derived from anaerobically-processed potato plant residues

NASA Astrophysics Data System (ADS)

Mackowiak, C. L.; Stutte, G. W.; Garland, J. L.; Finger, B. W.; Ruffe, L. M.

1997-01-01

Bioregenerative methods are being developed for recycling plant minerals from harvested inedible biomass as part of NASA's Advanced Life Support (ALS) research. Anaerobic processing produces secondary metabolites, a food source for yeast production, while providing a source of water soluble nutrients for plant growth. Since NH_4-N is the nitrogen product, processing the effluent through a nitrification reactor was used to convert this to NO_3-N, a more acceptable form for plants. Potato (Solanum tuberosum L.) cv. Norland plants were used to test the effects of anaerobically-produced effluent after processing through a yeast reactor or nitrification reactor. These treatments were compared to a mixed-N treatment (75:25, NO_3:NH_4) or a NO_3-N control, both containing only reagent-grade salts. Plant growth and tuber yields were greatest in the NO_3-N control and yeast reactor effluent treatments, which is noteworthy, considering the yeast reactor treatment had high organic loading in the nutrient solution and concomitant microbial activity.

Wine yeasts for the future.

PubMed

Fleet, Graham H

2008-11-01

International competition within the wine market, consumer demands for newer styles of wines and increasing concerns about the environmental sustainability of wine production are providing new challenges for innovation in wine fermentation. Within the total production chain, the alcoholic fermentation of grape juice by yeasts is a key process where winemakers can creatively engineer wine character and value through better yeast management and, thereby, strategically tailor wines to a changing market. This review considers the importance of yeast ecology and yeast metabolic reactions in determining wine quality, and then discusses new directions for exploiting yeasts in wine fermentation. It covers criteria for selecting and developing new commercial strains, the possibilities of using yeasts other than those in the genus of Saccharomyces, the prospects for mixed culture fermentations and explores the possibilities for high cell density, continuous fermentations.

Aroma formation by immobilized yeast cells in fermentation processes.

PubMed

Nedović, V; Gibson, B; Mantzouridou, T F; Bugarski, B; Djordjević, V; Kalušević, A; Paraskevopoulou, A; Sandell, M; Šmogrovičová, D; Yilmaztekin, M

2015-01-01

Immobilized cell technology has shown a significant promotional effect on the fermentation of alcoholic beverages such as beer, wine and cider. However, genetic, morphological and physiological alterations occurring in immobilized yeast cells impact on aroma formation during fermentation processes. The focus of this review is exploitation of existing knowledge on the biochemistry and the biological role of flavour production in yeast for the biotechnological production of aroma compounds of industrial importance, by means of immobilized yeast. Various types of carrier materials and immobilization methods proposed for application in beer, wine, fruit wine, cider and mead production are presented. Engineering aspects with special emphasis on immobilized cell bioreactor design, operation and scale-up potential are also discussed. Ultimately, examples of products with improved quality properties within the alcoholic beverages are addressed, together with identification and description of the future perspectives and scope for cell immobilization in fermentation processes. Copyright © 2014 John Wiley & Sons, Ltd.

Sourdough microbial community dynamics: An analysis during French organic bread-making processes.

PubMed

Lhomme, Emilie; Urien, Charlotte; Legrand, Judith; Dousset, Xavier; Onno, Bernard; Sicard, Delphine

2016-02-01

Natural sourdoughs are commonly used in bread-making processes, especially for organic bread. Despite its role in bread flavor and dough rise, the stability of the sourdough microbial community during and between bread-making processes is debated. We investigated the dynamics of lactic acid bacteria (LAB) and yeast communities in traditional organic sourdoughs of five French bakeries during the bread-making process and several months apart using classical and molecular microbiology techniques. Sourdoughs were sampled at four steps of the bread-making process with repetition. The analysis of microbial density over 68 sourdough/dough samples revealed that both LAB and yeast counts changed along the bread-making process and between bread-making runs. The species composition was less variable. A total of six LAB and nine yeast species was identified from 520 and 1675 isolates, respectively. The dominant LAB species was Lactobacillus sanfranciscensis, found for all bakeries and each bread-making run. The dominant yeast species changed only once between bread-making processes but differed between bakeries. They mostly belonged to the Kazachstania clade. Overall, this study highlights the change of population density within the bread-making process and between bread-making runs and the relative stability of the sourdough species community during bread-making process. Copyright © 2014 Elsevier Ltd. All rights reserved.

Engineered yeast for enhanced CO2 mineralization†

PubMed Central

Barbero, Roberto; Carnelli, Lino; Simon, Anna; Kao, Albert; Monforte, Alessandra d’Arminio; Riccò, Moreno; Bianchi, Daniele; Belcher, Angela

2014-01-01

In this work, a biologically catalyzed CO2 mineralization process for the capture of CO2 from point sources was designed, constructed at a laboratory scale, and, using standard chemical process scale-up protocols, was modeled and evaluated at an industrial scale. A yeast display system in Saccharomyces cerevisae was used to screen several carbonic anhydrase isoforms and mineralization peptides for their impact on CO2 hydration, CaCO3 mineralization, and particle settling rate. Enhanced rates for each of these steps in the CaCO3 mineralization process were confirmed using quantitative techniques in lab-scale measurements. The effect of these enhanced rates on the CO2 capture cost in an industrial scale CO2 mineralization process using coal fly ash as the CaO source was evaluated. The model predicts a process using bCA2- yeast and fly ash is ~10% more cost effective per ton of CO2 captured than a process with no biological molecules, a savings not realized by wild-type yeast and high-temperature stable recombinant CA2 alone or in combination. The levelized cost of electricity for a power plant using this process was calculated and scenarios in which this process compares favorably to CO2 capture by MEA absorption process are presented. PMID:25289021

Internal amino acid state modulates yeast taste neurons to support protein homeostasis in Drosophila

PubMed Central

Itskov, Pavel M; Baltazar, Célia; Moreira, José-Maria

2018-01-01

To optimize fitness, animals must dynamically match food choices to their current needs. For drosophilids, yeast fulfills most dietary protein and micronutrient requirements. While several yeast metabolites activate known gustatory receptor neurons (GRNs) in Drosophila melanogaster, the chemosensory channels mediating yeast feeding remain unknown. Here we identify a class of proboscis GRNs required for yeast intake. Within this class, taste peg GRNs are specifically required to sustain yeast feeding. Sensillar GRNs, however, mediate feeding initiation. Furthermore, the response of yeast GRNs, but not sweet GRNs, is enhanced following deprivation from amino acids, providing a potential basis for protein-specific appetite. Although nutritional and reproductive states synergistically increase yeast appetite, reproductive state acts independently of nutritional state, modulating processing downstream of GRNs. Together, these results suggest that different internal states act at distinct levels of a dedicated gustatory circuit to elicit nutrient-specific appetites towards a complex, ecologically relevant protein source. PMID:29393045

Brewing characteristics of piezosensitive sake yeasts

NASA Astrophysics Data System (ADS)

Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru

2018-04-01

Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.

[Isolation and characterization of Thermopirellula anaerolimosa gen. nov., sp. nov., an obligate anaerobic hydrogen-producing bacterium of the phylum Planctomycetes].

PubMed

Liu, Dongying; Liu, Yi; Men, Xuehui; Guo, Qunqun; Guo, Rongbo; Qiu, Yanling

2012-08-04

To cultivate various yet-to-be cultured heterotrophs from anaerobic granule sludge, we used a selective culture medium with low concentrations of substrates supplemented a variety of antibiotics. An obligate anaerobic, thermophilic, hydrogen-producing bacterium, strain VM20-7(T), was isolated from an upflow anaerobic sludge blanket (UASB) reactor treating high-strength organic wastewater from isomerized sugar production processes. Cells of strain VM20-7(T) are non-motile, spherical, pear or teardrop shaped, occurring singly(o)r as aggregates (0.7 - 2.0 microm x 0.7 - 2.0 microm). Spore formation was not observed. Growth temperature ranges from 35 - 50 degrees C (optimum 45 degrees C), pH ranges from 6.0 - 8.3 (optimum 7.0 - 7.5) , NaCl tolerant concentration ranges from 0% - 0.5% (w/v, optimum 0% ). Nitrate, sulfate, thiosulfate, sulfite, elemental sulfur and Fe (III)-NTA were not used as terminal electron acceptors. Strain VM20-7(T) utilizes a wide range of carbohydrates, including glucose, maltose, ribose, xylose, sucrose, galactose, mannose, raffinose, pectin, yeast extract and xylan. Acetate and H2 are the main end products of glucose fermentation. The G + C content of the genomic DNA was 60.9 mol%. 16S rRNA gene sequence analysis revealed that it is related to the Pirellula-Rhodopirellula-Blastopirellula (PRB) clade within the order Planctomycetales (82.7 - 84.3% similarity with 16S rRNA genes of other known related species). The first obligate anaerobic bacterium within the phylum Planctomycetes was isolated with low concentration of carbohydrates and antibiotics. On the basis of the physiological and phylogenetic data, the name Thermopirellula anaerolimosa gen. nov. , sp. nov. is proposed for strain VM20-7(T) (= CGMCC 1.5169(T) = JCM 17478(T) = DSM 24165(T)).

Process strategies for high titers of lipid production by oleaginous yeasts in undetoxified hydrolyzates of lignocellulosic biomass

USDA-ARS?s Scientific Manuscript database

Oleaginous yeasts can accumulate up to 70% of cell biomass as lipid, predominantly as triacylglycerols. Yeast lipid fatty acid profiles have been reported to be similar to that of vegetable oils and consist primarily of oleic, palmitic, stearic, and linoleic acids. This capability provides the oppor...

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2014-01-07

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Process strategies to maximize lipid accumulations of novel yeast in acid and base treated hydrolyzates

USDA-ARS?s Scientific Manuscript database

Oleaginous yeasts can accumulate up to 70% of cell biomass as lipids, predominantly as triacylglycerols. Yeast lipid fatty acid profiles have been reported to be similar to that of vegetable oils and consist primarily of oleic, palmitic, stearic, and linoleic acids. This capability provides the oppo...

Formation of In Vitro Mixed-Species Biofilms by Lactobacillus pentosus and Yeasts Isolated from Spanish-Style Green Table Olive Fermentations.

PubMed

León-Romero, Ángela; Domínguez-Manzano, Jesús; Garrido-Fernández, Antonio; Arroyo-López, Francisco Noé; Jiménez-Díaz, Rufino

2016-01-15

The present work details the in vitro interactions between Lactobacillus pentosus and yeast strains isolated from table olive processing to form mixed biofilms. Among the different pairs assayed, the strongest biofilms were obtained from L. pentosus and Candida boidinii strain cocultures. However, biofilm formation was inhibited in the presence of d-(+)-mannose. In addition, biofilm formation by C. boidinii monoculture was stimulated in the absence of cell-cell contact with L. pentosus. Scanning electron microscopy revealed that a sort of "sticky" material formed by the yeasts contributed to substrate adherence. Hence, the data obtained in this work suggest that yeast-lactobacilli biofilms may be favored by the presence of a specific mate of yeast and L. pentosus, and that more than one mechanism might be implicated in the biofilm formation. This knowledge will help in the design of appropriate mixed starter cultures of L. pentosus-yeast species pairs that are able to improve the quality and safety of Spanish-style green table olive processing. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Improving conversion yield of fermentable sugars into fuel ethanol in 1st generation yeast-based production processes.

PubMed

Gombert, Andreas K; van Maris, Antonius J A

2015-06-01

Current fuel ethanol production using yeasts and starch or sucrose-based feedstocks is referred to as 1st generation (1G) ethanol production. These processes are characterized by the high contribution of sugar prices to the final production costs, by high production volumes, and by low profit margins. In this context, small improvements in the ethanol yield on sugars have a large impact on process economy. Three types of strategies used to achieve this goal are discussed: engineering free-energy conservation, engineering redox-metabolism, and decreasing sugar losses in the process. Whereas the two former strategies lead to decreased biomass and/or glycerol formation, the latter requires increased process and/or yeast robustness. Copyright © 2014 Elsevier Ltd. All rights reserved.

Yeast derived from lignocellulosic biomass as a sustainable feed resource for use in aquaculture.

PubMed

Øverland, Margareth; Skrede, Anders

2017-02-01

The global expansion in aquaculture production implies an emerging need of suitable and sustainable protein sources. Currently, the fish feed industry is dependent on high-quality protein sources of marine and plant origin. Yeast derived from processing of low-value and non-food lignocellulosic biomass is a potential sustainable source of protein in fish diets. Following enzymatic hydrolysis, the hexose and pentose sugars of lignocellulosic substrates and supplementary nutrients can be converted into protein-rich yeast biomass by fermentation. Studies have shown that yeasts such as Saccharomyces cerevisiae, Candida utilis and Kluyveromyces marxianus have favourable amino acid composition and excellent properties as protein sources in diets for fish, including carnivorous species such as Atlantic salmon and rainbow trout. Suitable downstream processing of the biomass to disrupt cell walls is required to secure high nutrient digestibility. A number of studies have shown various immunological and health benefits from feeding fish low levels of yeast and yeast-derived cell wall fractions. This review summarises current literature on the potential of yeast from lignocellulosic biomass as an alternative protein source for the aquaculture industry. It is concluded that further research and development within yeast production can be important to secure the future sustainability and economic viability of intensive aquaculture. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

A novel bread making process using salt-stressed Baker's yeast.

PubMed

Yeh, Lien-Te; Charles, Albert Linton; Ho, Chi-Tang; Huang, Tzou-Chi

2009-01-01

By adjusting the mixing order of ingredients in traditional formula, an innovative bread making process was developed. The effect of salt-stressed Baker's yeast on bread dough of different sugar levels was investigated. Baker's yeast was stressed in 7% salt solution then mixed into dough, which was then evaluated for fermentation time, dough fermentation producing gas, dough expansion, bread specific volumes, and sensory and physical properties. The results of this study indicated that salt-stressed Baker's yeast shortened fermentation time in 16% and 24% sugar dough. Forty minutes of salt stress produced significant amount of gas and increased bread specific volumes. The bread was softer and significantly improved sensory properties for aroma, taste, and overall acceptability were obtained.

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

Matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) for rapid identification of micro-organisms in the routine clinical microbiology laboratory.

PubMed

Wattal, C; Oberoi, J K; Goel, N; Raveendran, R; Khanna, S

2017-05-01

The study evaluates the utility of matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) Vitek MS for identification of microorganisms in the routine clinical microbiology laboratory. From May 2013 to April 2014, microbial isolates recovered from various clinical samples were identified by Vitek MS. In case of failure to identify by Vitek MS, the isolate was identified using the Vitek 2 system (bioMerieux, France) and serotyping wherever applicable or otherwise by nucleic acid-mediated methods. All the moulds were identified by Lactophenol blue mounts, and mycobacterial isolates were identified by molecular identification systems including AccuProbe (bioMerieux, France) or GenoType Mycobacterium CM (Hain Lifescience, Germany). Out of the 12,003 isolates, the Vitek MS gave a good overall ID at the genus and or species level up to 97.7% for bacterial isolates, 92.8% for yeasts and 80% for filamentous fungi. Of the 26 mycobacteria tested, only 42.3% could be identified using the Saramis RUO (Research Use Only) database. VITEK MS could not identify 34 of the 35 yeast isolates identified as C. haemulonii by Vitek 2. Subsequently, 17 of these isolates were identified as Candida auris (not present in the Vitek MS database) by 18S rRNA sequencing. Using these strains, an in-house superspectrum of C. auris was created in the VITEK MS database. Use of MALDI-TOF MS allows a rapid identification of aerobic bacteria and yeasts in clinical practice. However, improved sample extraction protocols and database upgrades with inclusion of locally representative strains is required, especially for moulds.

Diversity of spoilage fungi associated with various French dairy products.

PubMed

Garnier, Lucille; Valence, Florence; Pawtowski, Audrey; Auhustsinava-Galerne, Lizaveta; Frotté, Nicolas; Baroncelli, Riccardo; Deniel, Franck; Coton, Emmanuel; Mounier, Jérôme

2017-01-16

Yeasts and molds are responsible for dairy product spoilage, resulting in significant food waste and economic losses. Yet, few studies have investigated the diversity of spoilage fungi encountered in dairy products. In the present study, 175 isolates corresponding to 105 from various spoiled dairy products and 70 originating from dairy production environments, were identified using sequencing of the ITS region, the partial β-tubulin, calmodulin and/or EFα genes, and the D1-D2 domain of the 26S rRNA gene for filamentous fungi and yeasts, respectively. Among the 41 species found in spoiled products, Penicillium commune and Penicillium bialowiezense were the most common filamentous fungi, representing around 10% each of total isolates while Meyerozyma guilliermondii and Trichosporon asahii were the most common yeasts (4.8% each of total isolates). Several species (e.g. Penicillium antarcticum, Penicillium salamii and Cladosporium phyllophilum) were identified for the first time in dairy products or their environment. In addition, numerous species were identified in both spoiled products and their corresponding dairy production environment suggesting that the latter acts as a primary source of contamination. Secondly, the resistance to chemical preservatives (sodium benzoate, calcium propionate, potassium sorbate and natamycin) of 10 fungal isolates representative of the observed biodiversity was also evaluated. Independently of the fungal species, natamycin had the lowest minimum inhibitory concentration (expressed in gram of preservative/l), followed by potassium sorbate, sodium benzoate and calcium propionate. In the tested conditions, Cladosporium halotolerans and Didymella pinodella were the most sensitive fungi while Yarrowia lipolytica and Candida parapsilosis were the most resistant towards the tested preservatives. This study provides interesting information on the occurrence of fungal contaminants in dairy products and environments that may help developing adequate strategies for fungal spoilage control. Copyright © 2016 Elsevier B.V. All rights reserved.

Candida alocasiicola sp. nov., Candida hainanensis sp. nov., Candida heveicola sp. nov. and Candida musiphila sp. nov., novel anamorphic, ascomycetous yeast species isolated from plants.

PubMed

Wang, Shi-An; Jia, Jian-Hua; Bai, Feng-Yan

2008-08-01

In a taxonomic study on the ascomycetous yeasts isolated from plant materials collected in tropical forests in Yunnan and Hainan Provinces, southern China, four strains isolated from tree sap (YJ2E(T)) and flowers (YF9E(T), YWZH3C(T) and YYF2A(T)) were revealed to represent four undescribed yeast species. Molecular phylogenetic analysis based on the large subunit (26S) rRNA gene D1/D2 domain sequences showed that strain YJ2E(T) was located in a clade together with Candida haemulonii and C. pseudohaemulonii. Strain YF9E(T) was most closely related to C. azyma and strain YWZH3C(T) to C. sorbophila and C. spandovensis. Strain YYF2A(T) was clustered in a clade containing small-spored Metschnikowia species and related anamorphic Candida species. The new strains differed from their closely related described species by more than 10% mismatches in the D1/D2 domain. No sexual states were observed for the four strains on various sporulation media. The new species are therefore assigned to the genus Candida and described as Candida alocasiicola sp. nov. (type strain, YF9E(T) = AS 2.3484(T) = CBS 10702(T)), Candida hainanensis sp. nov. (type strain, YYF2A(T) = AS 2.3478(T) = CBS 10696(T)), Candida heveicola sp. nov. (type strain, YJ2E(T) = AS 2.3483(T) = CBS 10701(T)) and Candida musiphila sp. nov. (type strain, YWZH3C(T) = AS 2.3479(T) = CBS 10697(T)).

Carboxydothermus siderophilus sp. nov., a thermophilic, hydrogenogenic, carboxydotrophic, dissimilatory Fe(III)-reducing bacterium from a Kamchatka hot spring.

PubMed

Slepova, Tatiana V; Sokolova, Tatyana G; Kolganova, Tatyana V; Tourova, Tatyana P; Bonch-Osmolovskaya, Elizaveta A

2009-02-01

A novel anaerobic, thermophilic, Fe(III)-reducing, CO-utilizing bacterium, strain 1315(T), was isolated from a hot spring of Geyser Valley on the Kamchatka Peninsula. Cells of the new isolate were Gram-positive, short rods. Growth was observed at 52-70 degrees C, with an optimum at 65 degrees C, and at pH 5.5-8.5, with an optimum at pH 6.5-7.2. In the presence of Fe(III) or 9,10-anthraquinone 2,6-disulfonate (AQDS), the bacterium was capable of growth with CO and yeast extract (0.2 g l(-1)); during growth under these conditions, strain 1315(T) produced H(2) and CO(2) and Fe(II) or AQDSH(2), respectively. Strain 1315(T) also grew by oxidation of yeast extract, glucose, xylose or lactate under a N(2) atmosphere, reducing Fe(III) or AQDS. Yeast extract (0.2 g l(-1)) was required for growth. Isolate 1315(T) grew exclusively with Fe(III) or AQDS as an electron acceptor. The generation time under optimal conditions with CO as growth substrate was 9.3 h. The G+C content of the DNA was 41.5+/-0.5 mol%. 16S rRNA gene sequence analysis placed the organism in the genus Carboxydothermus (97.8 % similarity with the closest relative). On the basis of physiological features and phylogenetic analysis, it is proposed that strain 1315(T) should be assigned to a novel species, Carboxydothermus siderophilus sp. nov., with the type strain 1315(T) (=VKPM 9905B(T) =VKM B-2474(T) =DSM 21278(T)).

Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast.

PubMed

Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi; Kitagaki, Hiroshi

2017-12-15

The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast ( Saccharomyces cerevisiae ) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their "petite" strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic of increased mitochondrial activity. This novel discovery will enable the selection of favorable brewery yeasts by monitoring the copy numbers of specific chromosomes through a process that does not involve generation/use of genetically modified organisms. Copyright © 2017 American Society for Microbiology.

Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast

PubMed Central

Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi

2017-01-01

ABSTRACT The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast (Saccharomyces cerevisiae) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their “petite” strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic of increased mitochondrial activity. This novel discovery will enable the selection of favorable brewery yeasts by monitoring the copy numbers of specific chromosomes through a process that does not involve generation/use of genetically modified organisms. PMID:28986374

Genetic Polymorphism in Wine Yeasts: Mechanisms and Methods for Its Detection

PubMed Central

Guillamón, José M.; Barrio, Eladio

2017-01-01

The processes of yeast selection for using as wine fermentation starters have revealed a great phenotypic diversity both at interspecific and intraspecific level, which is explained by a corresponding genetic variation among different yeast isolates. Thus, the mechanisms involved in promoting these genetic changes are the main engine generating yeast biodiversity. Currently, an important task to understand biodiversity, population structure and evolutionary history of wine yeasts is the study of the molecular mechanisms involved in yeast adaptation to wine fermentation, and on remodeling the genomic features of wine yeast, unconsciously selected since the advent of winemaking. Moreover, the availability of rapid and simple molecular techniques that show genetic polymorphisms at species and strain levels have enabled the study of yeast diversity during wine fermentation. This review will summarize the mechanisms involved in generating genetic polymorphisms in yeasts, the molecular methods used to unveil genetic variation, and the utility of these polymorphisms to differentiate strains, populations, and species in order to infer the evolutionary history and the adaptive evolution of wine yeasts, and to identify their influence on their biotechnological and sensorial properties. PMID:28522998

Thermotolerant Yeast Strains Adapted by Laboratory Evolution Show Trade-Off at Ancestral Temperatures and Preadaptation to Other Stresses.

PubMed

Caspeta, Luis; Nielsen, Jens

2015-07-21

A major challenge for the production of ethanol from biomass-derived feedstocks is to develop yeasts that can sustain growth under the variety of inhibitory conditions present in the production process, e.g., high osmolality, high ethanol titers, and/or elevated temperatures (≥ 40 °C). Using adaptive laboratory evolution, we previously isolated seven Saccharomyces cerevisiae strains with improved growth at 40 °C. Here, we show that genetic adaptations to high temperature caused a growth trade-off at ancestral temperatures, reduced cellular functions, and improved tolerance of other stresses. Thermotolerant yeast strains showed horizontal displacement of their thermal reaction norms to higher temperatures. Hence, their optimal and maximum growth temperatures increased by about 3 °C, whereas they showed a growth trade-off at temperatures below 34 °C. Computational analysis of the physical properties of proteins showed that the lethal temperature for yeast is around 49 °C, as a large fraction of the yeast proteins denature above this temperature. Our analysis also indicated that the number of functions involved in controlling the growth rate decreased in the thermotolerant strains compared with the number in the ancestral strain. The latter is an advantageous attribute for acquiring thermotolerance and correlates with the reduction of yeast functions associated with loss of respiration capacity. This trait caused glycerol overproduction that was associated with the growth trade-off at ancestral temperatures. In combination with altered sterol composition of cellular membranes, glycerol overproduction was also associated with yeast osmotolerance and improved tolerance of high concentrations of glucose and ethanol. Our study shows that thermal adaptation of yeast is suitable for improving yeast resistance to inhibitory conditions found in industrial ethanol production processes. Yeast thermotolerance can significantly reduce the production costs of biomass conversion to ethanol. However, little information is available about the underlying genetic changes and physiological functions required for yeast thermotolerance. We recently revealed the genetic changes of thermotolerance in thermotolerant yeast strains (TTSs) generated through adaptive laboratory evolution. Here, we examined these TTSs' physiology and computed their proteome stability over the entire thermal niche, as well as their preadaptation to other stresses. Using this approach, we showed that TTSs exhibited evolutionary trade-offs in the ancestral thermal niche, as well as reduced numbers of growth functions and preadaptation to other stresses found in ethanol production processes. This information will be useful for rational engineering of yeast thermotolerance for the production of biofuels and chemicals. Copyright © 2015 Caspeta and Nielsen.

The Treasure of the Humble: Lessons from Baker's Yeast

ERIC Educational Resources Information Center

Sitaraman, Ramakrishnan

2011-01-01

The study of model organisms is a powerful and proven experimental strategy for understanding biological processes. This paper describes an attempt to utilize advances in yeast molecular biology to enhance student understanding by presenting a more comprehensive view of several interconnected molecular processes in the overall functioning of an…

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

An Investigation into Rumen Fungal and Protozoal Diversity in Three Rumen Fractions, during High-Fiber or Grain-Induced Sub-Acute Ruminal Acidosis Conditions, with or without Active Dry Yeast Supplementation

PubMed Central

Ishaq, Suzanne L.; AlZahal, Ousama; Walker, Nicola; McBride, Brian

2017-01-01

Sub-acute ruminal acidosis (SARA) is a gastrointestinal functional disorder in livestock characterized by low rumen pH, which reduces rumen function, microbial diversity, host performance, and host immune function. Dietary management is used to prevent SARA, often with yeast supplementation as a pH buffer. Almost nothing is known about the effect of SARA or yeast supplementation on ruminal protozoal and fungal diversity, despite their roles in fiber degradation. Dairy cows were switched from a high-fiber to high-grain diet abruptly to induce SARA, with and without active dry yeast (ADY, Saccharomyces cerevisiae) supplementation, and sampled from the rumen fluid, solids, and epimural fractions to determine microbial diversity using the protozoal 18S rRNA and the fungal ITS1 genes via Illumina MiSeq sequencing. Diet-induced SARA dramatically increased the number and abundance of rare fungal taxa, even in fluid fractions where total reads were very low, and reduced protozoal diversity. SARA selected for more lactic-acid utilizing taxa, and fewer fiber-degrading taxa. ADY treatment increased fungal richness (OTUs) but not diversity (Inverse Simpson, Shannon), but increased protozoal richness and diversity in some fractions. ADY treatment itself significantly (P < 0.05) affected the abundance of numerous fungal genera as seen in the high-fiber diet: Lewia, Neocallimastix, and Phoma were increased, while Alternaria, Candida Orpinomyces, and Piromyces spp. were decreased. Likewise, for protozoa, ADY itself increased Isotricha intestinalis but decreased Entodinium furca spp. Multivariate analyses showed diet type was most significant in driving diversity, followed by yeast treatment, for AMOVA, ANOSIM, and weighted UniFrac. Diet, ADY, and location were all significant factors for fungi (PERMANOVA, P = 0.0001, P = 0.0452, P = 0.0068, Monte Carlo correction, respectively, and location was a significant factor (P = 0.001, Monte Carlo correction) for protozoa. Diet-induced SARA shifts diversity of rumen fungi and protozoa and selects against fiber-degrading species. Supplementation with ADY mitigated this reduction in protozoa, presumptively by triggering microbial diversity shifts (as seen even in the high-fiber diet) that resulted in pH stabilization. ADY did not recover the initial community structure that was seen in pre-SARA conditions. PMID:29067009

An Investigation into Rumen Fungal and Protozoal Diversity in Three Rumen Fractions, during High-Fiber or Grain-Induced Sub-Acute Ruminal Acidosis Conditions, with or without Active Dry Yeast Supplementation.

PubMed

Ishaq, Suzanne L; AlZahal, Ousama; Walker, Nicola; McBride, Brian

2017-01-01

Sub-acute ruminal acidosis (SARA) is a gastrointestinal functional disorder in livestock characterized by low rumen pH, which reduces rumen function, microbial diversity, host performance, and host immune function. Dietary management is used to prevent SARA, often with yeast supplementation as a pH buffer. Almost nothing is known about the effect of SARA or yeast supplementation on ruminal protozoal and fungal diversity, despite their roles in fiber degradation. Dairy cows were switched from a high-fiber to high-grain diet abruptly to induce SARA, with and without active dry yeast (ADY, Saccharomyces cerevisiae ) supplementation, and sampled from the rumen fluid, solids, and epimural fractions to determine microbial diversity using the protozoal 18S rRNA and the fungal ITS1 genes via Illumina MiSeq sequencing. Diet-induced SARA dramatically increased the number and abundance of rare fungal taxa, even in fluid fractions where total reads were very low, and reduced protozoal diversity. SARA selected for more lactic-acid utilizing taxa, and fewer fiber-degrading taxa. ADY treatment increased fungal richness (OTUs) but not diversity (Inverse Simpson, Shannon), but increased protozoal richness and diversity in some fractions. ADY treatment itself significantly ( P < 0.05) affected the abundance of numerous fungal genera as seen in the high-fiber diet: Lewia, Neocallimastix , and Phoma were increased, while Alternaria, Candida Orpinomyces , and Piromyces spp. were decreased. Likewise, for protozoa, ADY itself increased Isotricha intestinalis but decreased Entodinium furca spp. Multivariate analyses showed diet type was most significant in driving diversity, followed by yeast treatment, for AMOVA, ANOSIM, and weighted UniFrac. Diet, ADY, and location were all significant factors for fungi (PERMANOVA, P = 0.0001, P = 0.0452, P = 0.0068, Monte Carlo correction, respectively, and location was a significant factor ( P = 0.001, Monte Carlo correction) for protozoa. Diet-induced SARA shifts diversity of rumen fungi and protozoa and selects against fiber-degrading species. Supplementation with ADY mitigated this reduction in protozoa, presumptively by triggering microbial diversity shifts (as seen even in the high-fiber diet) that resulted in pH stabilization. ADY did not recover the initial community structure that was seen in pre-SARA conditions.

Phenotypic evaluation and characterization of 21 industrial Saccharomyces cerevisiae yeast strains.

PubMed

Kong, In Iok; Turner, Timothy Lee; Kim, Heejin; Kim, Soo Rin; Jin, Yong-Su

2018-02-01

Microorganisms have been studied and used extensively to produce value-added fuels and chemicals. Yeasts, specifically Saccharomyces cerevisiae, receive industrial attention because of their well-known ability to ferment glucose and produce ethanol. Thousands of natural or genetically modified S. cerevisiae have been found in industrial environments for various purposes. These industrial strains are isolated from industrial fermentation sites, and they are considered as potential host strains for superior fermentation processes. In many cases, industrial yeast strains have higher thermotolerance, increased resistances towards fermentation inhibitors and increased glucose fermentation rates under anaerobic conditions when compared with laboratory yeast strains. Despite the advantages of industrial strains, they are often not well characterized. Through screening and phenotypic characterization of commercially available industrial yeast strains, industrial fermentation processes requiring specific environmental conditions may be able to select an ideal starting yeast strain to be further engineered. Here, we have characterized and compared 21 industrial S. cerevisiae strains under multiple conditions, including their tolerance to varying pH conditions, resistance to fermentation inhibitors, sporulation efficiency and ability to ferment lignocellulosic sugars. These data may be useful for the selection of a parental strain for specific biotechnological applications of engineered yeast. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The secretory pathway: exploring yeast diversity.

PubMed

Delic, Marizela; Valli, Minoska; Graf, Alexandra B; Pfeffer, Martin; Mattanovich, Diethard; Gasser, Brigitte

2013-11-01

Protein secretion is an essential process for living organisms. In eukaryotes, this encompasses numerous steps mediated by several hundred cellular proteins. The core functions of translocation through the endoplasmic reticulum membrane, primary glycosylation, folding and quality control, and vesicle-mediated secretion are similar from yeasts to higher eukaryotes. However, recent research has revealed significant functional differences between yeasts and mammalian cells, and even among diverse yeast species. This review provides a current overview of the canonical protein secretion pathway in the model yeast Saccharomyces cerevisiae, highlighting differences to mammalian cells as well as currently unresolved questions, and provides a genomic comparison of the S. cerevisiae pathway to seven other yeast species where secretion has been investigated due to their attraction as protein production platforms, or for their relevance as pathogens. The analysis of Candida albicans, Candida glabrata, Kluyveromyces lactis, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, and Schizosaccharomyces pombe reveals that many - but not all - secretion steps are more redundant in S. cerevisiae due to duplicated genes, while some processes are even absent in this model yeast. Recent research obviates that even where homologous genes are present, small differences in protein sequence and/or differences in the regulation of gene expression may lead to quite different protein secretion phenotypes. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Visualization and quantification of three-dimensional distribution of yeast in bread dough.

PubMed

Maeda, Tatsuro; DO, Gab-Soo; Sugiyama, Junichi; Araki, Tetsuya; Tsuta, Mizuki; Shiraga, Seizaburo; Ueda, Mitsuyoshi; Yamada, Masaharu; Takeya, Koji; Sagara, Yasuyuki

2009-07-01

A three-dimensional (3-D) bio-imaging technique was developed for visualizing and quantifying the 3-D distribution of yeast in frozen bread dough samples in accordance with the progress of the mixing process of the samples, applying cell-surface engineering to the surfaces of the yeast cells. The fluorescent yeast was recognized as bright spots at the wavelength of 520 nm. Frozen dough samples were sliced at intervals of 1 microm by an micro-slicer image processing system (MSIPS) equipped with a fluorescence microscope for acquiring cross-sectional images of the samples. A set of successive two-dimensional images was reconstructed to analyze the 3-D distribution of the yeast. The average shortest distance between centroids of enhanced green fluorescent protein (EGFP) yeasts was 10.7 microm at the pick-up stage, 9.7 microm at the clean-up stage, 9.0 microm at the final stage, and 10.2 microm at the over-mixing stage. The results indicated that the distribution of the yeast cells was the most uniform in the dough of white bread at the final stage, while the heterogeneous distribution at the over-mixing stage was possibly due to the destruction of the gluten network structure within the samples.

Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals.

PubMed

Borodina, Irina; Nielsen, Jens

2014-05-01

Yeast Saccharomyces cerevisiae is an important industrial host for production of enzymes, pharmaceutical and nutraceutical ingredients and recently also commodity chemicals and biofuels. Here, we review the advances in modeling and synthetic biology tools and how these tools can speed up the development of yeast cell factories. We also present an overview of metabolic engineering strategies for developing yeast strains for production of polymer monomers: lactic, succinic, and cis,cis-muconic acids. S. cerevisiae has already firmly established itself as a cell factory in industrial biotechnology and the advances in yeast strain engineering will stimulate development of novel yeast-based processes for chemicals production. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Yeasts: providing questions and answers for modern biology.

PubMed

Dickinson, J R

2000-01-01

Yeasts are to be found in virtually every conceivable niche on this planet and are amazingly varied in their shapes ('morphologies'), life cycles, metabolic capabilities, potentials for use in industrial processes, abilities to spoil food and drink or to act as dangerous human pathogens. This review describes four very different species of yeast to illustrate some of the diversity which exists and, in the case of one of them, Saccharomyces cerevisiae (the familiar baker's or brewer's yeast), the extent of both our knowledge and ignorance.

7 CFR 205.605 - Nonagricultural (nonorganic) substances allowed as ingredients in or on processed products...

Code of Federal Regulations, 2014 CFR

2014-01-01

...—nonsynthetic (Carnauba wax; and Wood resin). Yeast—When used as food or a fermentation agent in products labeled as “organic,” yeast must be organic if its end use is for human consumption; nonorganic yeast may be used when organic yeast is not commercially available. Growth on petrochemical substrate and...

7 CFR 205.605 - Nonagricultural (nonorganic) substances allowed as ingredients in or on processed products...

Code of Federal Regulations, 2013 CFR

2013-01-01

...—nonsynthetic (Carnauba wax; and Wood resin). Yeast—When used as food or a fermentation agent in products labeled as “organic,” yeast must be organic if its end use is for human consumption; nonorganic yeast may be used when organic yeast is not commercially available. Growth on petrochemical substrate and...

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2013-05-14

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2017-09-12

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2011-05-17

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2016-08-09

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Potential benefits of the application of yeast starters in table olive processing.

PubMed

Arroyo-López, Francisco N; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio

2012-01-01

Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.

Potential benefits of the application of yeast starters in table olive processing

PubMed Central

Arroyo-López, Francisco N.; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio

2012-01-01

Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.

MAL73, a novel regulator of maltose fermentation, is functionally impaired by single nucleotide polymorphism in sake brewing yeast.

PubMed

Ohdate, Takumi; Omura, Fumihiko; Hatanaka, Haruyo; Zhou, Yan; Takagi, Masami; Goshima, Tetsuya; Akao, Takeshi; Ono, Eiichiro

2018-01-01

For maltose fermentation, budding yeast Saccharomyces cerevisiae operates a mechanism that involves transporters (MALT), maltases (MALS) and regulators (MALR) collectively known as MAL genes. However, functional relevance of MAL genes during sake brewing process remains largely elusive, since sake yeast is cultured under glucose-rich condition achieved by the co-culture partner Aspergillus spp.. Here we isolated an ethyl methane sulfonate (EMS)-mutagenized sake yeast strain exhibiting enhanced maltose fermentation compared to the parental strain. The mutant carried a single nucleotide insertion that leads to the extension of the C-terminal region of a previously uncharacterized MALR gene YPR196W-2, which was renamed as MAL73. Introduction of the mutant allele MAL73L with extended C-terminal region into the parental or other sake yeast strains enhanced the growth rate when fed with maltose as the sole carbon source. In contrast, disruption of endogenous MAL73 in the sake yeasts decreased the maltose fermentation ability of sake yeast, confirming that the original MAL73 functions as a MALR. Importantly, the MAL73L-expressing strain fermented more maltose in practical condition compared to the parental strain during sake brewing process. Our data show that MAL73(L) is a novel MALR gene that regulates maltose fermentation, and has been functionally attenuated in sake yeast by single nucleotide deletion during breeding history. Since the MAL73L-expressing strain showed enhanced ability of maltose fermentation, MAL73L might also be a valuable tool for enhancing maltose fermentation in yeast in general.

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

An Evolutionary Perspective on Yeast Mating-Type Switching

PubMed Central

Hanson, Sara J.; Wolfe, Kenneth H.

2017-01-01

Cell differentiation in yeast species is controlled by a reversible, programmed DNA-rearrangement process called mating-type switching. Switching is achieved by two functionally similar but structurally distinct processes in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe. In both species, haploid cells possess one active and two silent copies of the mating-type locus (a three-cassette structure), the active locus is cleaved, and synthesis-dependent strand annealing is used to replace it with a copy of a silent locus encoding the opposite mating-type information. Each species has its own set of components responsible for regulating these processes. In this review, we summarize knowledge about the function and evolution of mating-type switching components in these species, including mechanisms of heterochromatin formation, MAT locus cleavage, donor bias, lineage tracking, and environmental regulation of switching. We compare switching in these well-studied species to others such as Kluyveromyces lactis and the methylotrophic yeasts Ogataea polymorpha and Komagataella phaffii. We focus on some key questions: Which cells switch mating type? What molecular apparatus is required for switching? Where did it come from? And what is the evolutionary purpose of switching? PMID:28476860

Nuclear export of the small ribosomal subunit requires the Ran–GTPase cycle and certain nucleoporins

PubMed Central

Moy, Terence I.; Silver, Pamela A.

1999-01-01

After their assembly in the nucleolus, ribosomal subunits are exported from the nucleus to the cytoplasm. After export, the 20S rRNA in the small ribosomal subunit is cleaved to yield 18S rRNA and the small 5′ ITS1 fragment. The 5′ ITS1 RNA is normally degraded by the cytoplasmic Xrn1 exonuclease, but in strains lacking XRN1, the 5′ ITS1 fragment accumulates in the cytoplasm. Using the cytoplasmic localization of the 5′ ITS1 fragment as an indicator for the export of the small ribosomal subunit, we have identified genes that are required for ribosome export. Ribosome export is dependent on the Ran–GTPase as mutations in Ran or its regulators caused 5′ ITS1 to accumulate in the nucleoplasm. Mutations in the genes encoding the nucleoporin Nup82 and in the NES exporter Xpo1/Crm1 also caused the nucleoplasmic accumulation of 5′ ITS1. Mutants in a subset of nucleoporins and in the nuclear transport factors Srp1, Kap95, Pse1, Cse1, and Mtr10 accumulate the 5′ ITS1 in the nucleolus and affect ribosome assembly. In contrast, we did not detect nuclear accumulation of 5′ ITS1 in 28 yeast strains that have mutations in other genes affecting nuclear trafficking. PMID:10465789

Selection of reference genes for quantitative real-time RT-PCR assays in different morphological forms of dimorphic zygomycetous fungus Benjaminiella poitrasii.

PubMed

Pathan, Ejaj K; Ghormade, Vandana; Deshpande, Mukund V

2017-01-01

Benjaminiella poitrasii, a dimorphic non-pathogenic zygomycetous fungus, exhibits a morphological yeast (Y) to hypha (H) reversible transition in the vegetative phase, sporangiospores (S) in the asexual phase and zygospores (Z) in the sexual phase. To study the gene expression across these diverse morphological forms, suitable reference genes are required. In the present study, 13 genes viz. ACT, 18S rRNA, eEF1α, eEF-Tu,eIF-1A, Tub-α, Tub-b, Ubc, GAPDH, Try, WS-21, NADGDH and NADPGDH were evaluated for their potential as a reference, particularly for studying gene expression during the Y-H reversible transition and also for other asexual and sexual life stages of B. poitrasii. Analysis of RT-qPCR data using geNorm, normFinder and BestKeeper software revealed that genes such as Ubc, 18S rRNA and WS-21 were expressed at constant levels in each given subset of RNA samples from all the morphological phases of B. poitrasii. Therefore, these reference genes can be used to elucidate the role of morpho-genes in B. poitrasii. Further, use of the two most stably expressed genes (Ubc and WS-21) to normalize the expression of the ornithine decarboxylase gene (Bpodc) in different morphological forms of B. poitrasii, generated more reliable results, indicating that our selection of reference genes was appropriate.

Integrated approach for selecting efficient Saccharomyces cerevisiae for industrial lignocellulosic fermentations: Importance of yeast chassis linked to process conditions.

PubMed

Costa, Carlos E; Romaní, Aloia; Cunha, Joana T; Johansson, Björn; Domingues, Lucília

2017-03-01

In this work, four robust yeast chassis isolated from industrial environments were engineered with the same xylose metabolic pathway. The recombinant strains were physiologically characterized in synthetic xylose and xylose-glucose medium, on non-detoxified hemicellulosic hydrolysates of fast-growing hardwoods (Eucalyptus and Paulownia) and agricultural residues (corn cob and wheat straw) and on Eucalyptus hydrolysate at different temperatures. Results show that the co-consumption of xylose-glucose was dependent on the yeast background. Moreover, heterogeneous results were obtained among different hydrolysates and temperatures for each individual strain pointing to the importance of designing from the very beginning a tailor-made yeast considering the specific raw material and process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rational design and evolutional fine tuning of Saccharomyces cerevisiae for biomass breakdown.

PubMed

Hasunuma, Tomohisa; Ishii, Jun; Kondo, Akihiko

2015-12-01

Conferring biomass hydrolysis activity on yeast through genetic engineering has paved the way for the development of groundbreaking processes for producing liquid fuels and commodity chemicals from lignocellulosic biomass. However, the overproduction and misfolding of heterologous and endogenous proteins can trigger cellular stress, increasing the metabolic burden and retarding growth. Improving the efficiency of lignocellulosic breakdown requires engineering of yeast secretory pathway based on system-wide metabolic analysis as well as DNA constructs for enhanced cellulase gene expression with advanced molecular biology tools. Also, yeast is subjected to severe stress due to toxic compounds generated during lignocellulose pretreatment in consolidated saccharification and fermentation processes. The prospect for development of robust yeast strains makes combining evolutionary and rational engineering strategies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of Agave tequilana age, cultivation field location and yeast strain on tequila fermentation process.

PubMed

Pinal, L; Cornejo, E; Arellano, M; Herrera, E; Nuñez, L; Arrizon, J; Gschaedler, A

2009-05-01

The effect of yeast strain, the agave age and the cultivation field location of agave were evaluated using kinetic parameters and volatile compound production in the tequila fermentation process. Fermentations were carried out with Agave juice obtained from two cultivation fields (CF1 and CF2), as well as two ages (4 and 8 years) and two Saccharomyces cerevisiae yeast strains (GU3 and AR5) isolated from tequila fermentation must. Sugar consumption and ethanol production varied as a function of cultivation field and agave age. The production of ethyl acetate, 1-propanol, isobutanol and amyl alcohols were influenced in varying degrees by yeast strain, agave age and cultivation field. Methanol production was only affected by the agave age and 2-phenylethanol was influenced only by yeast strain. This work showed that the use of younger Agave tequilana for tequila fermentation resulted in differences in sugar consumption, ethanol and volatile compounds production at the end of fermentation, which could affect the sensory quality of the final product.

Biofortification of folates in white wheat bread by selection of yeast strain and process.

PubMed

Hjortmo, Sofia; Patring, Johan; Jastrebova, Jelena; Andlid, Thomas

2008-09-30

We here demonstrate that folate content in yeast fermented food can be dramatically increased by using a proper (i) yeast strain and (ii) cultivation procedure for the selected strain prior to food fermentation. Folate levels were 3 to 5-fold higher in white wheat bread leavened with a Saccharomyces cerevisiae strain CBS7764, cultured in defined medium and harvested in the respiro-fermentative phase of growth prior to dough preparation (135-139 microg/100 dry matter), compared to white wheat bread leavened with commercial Baker's yeast (27-43 microg/100 g). The commercial Baker's yeast strain had been industrially produced, using a fed-batch process, thereafter compressed and stored in the refrigerator until bakings were initiated. This strategy is an attractive alternative to fortification of bread with synthetically produced folic acid. By using a high folate producing strain cultured a suitable way folate levels obtained were in accordance with folic acid content in fortified cereal products.

Adsorption of Ag (I) from aqueous solution by waste yeast: kinetic, equilibrium and mechanism studies.

PubMed

Zhao, Yufeng; Wang, Dongfang; Xie, Hezhen; Won, Sung Wook; Cui, Longzhe; Wu, Guiping

2015-01-01

One type of biosorbents, brewer fermentation industry waste yeast, was developed to adsorb the Ag (I) in aqueous solution. The result of FTIR analysis of waste yeast indicated that the ion exchange, chelating and reduction were the main binding mechanisms between the silver ions and the binding sites on the surface of the biomass. Furthermore, TEM, XRD and XPS results suggested that Ag(0) nanoparticles were deposited on the surface of yeast. The kinetic experiments revealed that sorption equilibrium could reach within 60 min, and the removal efficiency of Ag (I) could be still over 93 % when the initial concentration of Ag (I) was below 100 mg/L. Thermodynamic parameters of the adsorption process (ΔG, ΔH and ΔS) identified that the adsorption was a spontaneous and exothermic process. The waste yeast, playing a significant role in the adsorption of the silver ions, is useful to fast adsorb Ag (I) from low concentration.

Accelerated biodegradation of BPA in water-sediment microcosms with Bacillus sp. GZB and the associated bacterial community structure.

PubMed

Xiong, Jukun; An, Taicheng; Li, Guiying; Peng, Ping'an

2017-10-01

Bisphenol A (BPA) is a synthetic chemical primarily used to produce polycarbonate plastics and epoxy resins. Significant industrial and consumer's consumption of BPA-containing products has contributed to extensive contamination in different environmental matrices. In this study, microcosms bioaugmented with Bacillus sp. GZB were constructed to investigate BPA biodegradation, identify the main bacterial community, and evaluate bacterial community responses in the microcosms. Under aerobic conditions, BPA was quickly depleted as a result of bioaugmentation with Bacillus sp. GZB in water-sediment contaminated with pollutants. The pollutants used were generally associated with the electronic wastes (mobile phones, computers, televisions) dismantling process. Adding BPA affected the bacterial community composition in the water-sediment. Furthermore, BPA biodegradation was enhanced by adding electron donors/co-substrates: humic acid, NaCl, glucose, and yeast extract. Metagenomic analysis of the total 16S rRNA genes from the BPA-degrading microcosms with bioaugmentation illustrated that the genera Bacillus, Thiobacillus, Phenylobacterium, and Cloacibacterium were dominant after a 7-week incubation period. A consortium of microorganisms from different bacterial genera may be involved in BPA biodegradation in electronic waste contaminated water-sediment. This study provides new insights about BPA bioaugmentation and bacterial ecology in the BPA-degrading environment. Copyright © 2017 Elsevier Ltd. All rights reserved.

Optimization of Culture Conditions for Production of the Anti-Leukemic Glutaminase Free L-Asparaginase by Newly Isolated Streptomyces olivaceus NEAE-119 Using Response Surface Methodology.

PubMed

El-Naggar, Noura El-Ahmady; Moawad, Hassan; El-Shweihy, Nancy M; El-Ewasy, Sara M

2015-01-01

Among the antitumor drugs, bacterial enzyme L-asparaginase has been employed as the most effective chemotherapeutic agent in pediatric oncotherapy especially for acute lymphoblastic leukemia. Glutaminase free L-asparaginase producing actinomycetes were isolated from soil samples collected from Egypt. Among them, a potential culture, strain NEAE-119, was selected and identified on the basis of morphological, cultural, physiological, and biochemical properties together with 16S rRNA sequence as Streptomyces olivaceus NEAE-119 and sequencing product (1509 bp) was deposited in the GenBank database under accession number KJ200342. The optimization of different process parameters for L-asparaginase production by Streptomyces olivaceus NEAE-119 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables (temperature, pH, incubation time, inoculum size, inoculum age, agitation speed, dextrose, starch, L-asparagine, KNO3, yeast extract, K2HPO4, MgSO4·7H2O, NaCl, and FeSO4·7H2O) were screened using Plackett-Burman experimental design. The most positive significant independent variables affecting enzyme production (temperature, inoculum age, and agitation speed) were further optimized by the face-centered central composite design-response surface methodology.

Optimization of Culture Conditions for Production of the Anti-Leukemic Glutaminase Free L-Asparaginase by Newly Isolated Streptomyces olivaceus NEAE-119 Using Response Surface Methodology

PubMed Central

El-Naggar, Noura El-Ahmady; Moawad, Hassan; El-Shweihy, Nancy M.; El-Ewasy, Sara M.

2015-01-01

Among the antitumor drugs, bacterial enzyme L-asparaginase has been employed as the most effective chemotherapeutic agent in pediatric oncotherapy especially for acute lymphoblastic leukemia. Glutaminase free L-asparaginase producing actinomycetes were isolated from soil samples collected from Egypt. Among them, a potential culture, strain NEAE-119, was selected and identified on the basis of morphological, cultural, physiological, and biochemical properties together with 16S rRNA sequence as Streptomyces olivaceus NEAE-119 and sequencing product (1509 bp) was deposited in the GenBank database under accession number KJ200342. The optimization of different process parameters for L-asparaginase production by Streptomyces olivaceus NEAE-119 using Plackett-Burman experimental design and response surface methodology was carried out. Fifteen variables (temperature, pH, incubation time, inoculum size, inoculum age, agitation speed, dextrose, starch, L-asparagine, KNO3, yeast extract, K2HPO4, MgSO4·7H2O, NaCl, and FeSO4·7H2O) were screened using Plackett-Burman experimental design. The most positive significant independent variables affecting enzyme production (temperature, inoculum age, and agitation speed) were further optimized by the face-centered central composite design-response surface methodology. PMID:26180806

Water-network percolation transitions in hydrated yeast

NASA Astrophysics Data System (ADS)

Sokołowska, Dagmara; Król-Otwinowska, Agnieszka; Mościcki, Józef K.

2004-11-01

We discovered two percolation processes in succession in dc conductivity of bulk baker’s yeast in the course of dehydration. Critical exponents characteristic for the three-dimensional network for heavily hydrated system, and two dimensions in the light hydration limit, evidenced a dramatic change of the water network dimensionality in the dehydration process.

Antioxidant defense parameters as predictive biomarkers for fermentative capacity of active dried wine yeast.

PubMed

Gamero-Sandemetrio, Esther; Gómez-Pastor, Rocío; Matallana, Emilia

2014-08-01

The production of active dried yeast (ADY) is a common practice in industry for the maintenance of yeast starters and as a means of long term storage. The process, however, causes multiple cell injuries, with oxidative damage being one of the most important stresses. Consequentially, dehydration tolerance is a highly appreciated property in yeast for ADY production. In this study we analyzed the cellular redox environment in three Saccharomyces cerevisiae wine strains, which show markedly different fermentative capacities after dehydration. To measure/quantify the effect of dehydration on the S. cerevisiae strains, we used: (i) fluorescent probes; (ii) antioxidant enzyme activities; (ii) intracellular damage; (iii) antioxidant metabolites; and (iv) gene expression, to select a minimal set of biochemical parameters capable of predicting desiccation tolerance in wine yeasts. Our results show that naturally enhanced antioxidant defenses prevent oxidative damage after wine yeast biomass dehydration and improve fermentative capacity. Based on these results we chose four easily assayable parameters/biomarkers for the selection of industrial yeast strains of interest for ADY production: trehalose and glutathione levels, and glutathione reductase and catalase enzymatic activities. Yeast strains selected in accordance with this process display high levels of trehalose, low levels of oxidized glutathione, a high induction of glutathione reductase activity, as well as a high basal level and sufficient induction of catalase activity, which are properties inherent in superior ADY strains. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genomics and the making of yeast biodiversity.

PubMed

Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

2015-12-01

Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Systemic Infection of an Immunocompromised Patient with Methylobacterium zatmanii

PubMed Central

Hornei, B.; Lüneberg, E.; Schmidt-Rotte, H.; Maaß, M.; Weber, K.; Heits, F.; Frosch, M.; Solbach, W.

1999-01-01

We describe the identification of Methylobacterium zatmanii as the causative agent of bacteremia and fever in an immunocompromised patient. The patient, a 60-year-old man, had a 5-month history of acute myeloid leukemia and had been on chemotherapy throughout this period. Seven days after the onset of neutropenia, the patient developed fever. The combination of ciprofloxacin, co-trimoxazole, imipenem, amikacin, and vancomycin led to a complete defervescence. On subculture from six positive blood cultures, the organism grew only on buffered charcoal yeast extract agar and not on standard agars. Identification by universal PCR and subsequent sequence analysis of the amplified 16S rRNA gene segment was achieved. This identification by molecular biology techniques was confirmed by conventional biochemical tests. To our knowledge, this is the first description of M. zatmanii isolated from patient material. PMID:9854105

Yeasts Diversity in Fermented Foods and Beverages

NASA Astrophysics Data System (ADS)

Tamang, Jyoti Prakash; Fleet, Graham H.

People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

Application of cell-surface engineering for visualization of yeast in bread dough: development of a fluorescent bio-imaging technique in the mixing process of dough.

PubMed

Maeda, Tatsuro; Shiraga, Seizaburo; Araki, Tetsuya; Ueda, Mitsuyoshi; Yamada, Masaharu; Takeya, Koji; Sagara, Yasuyuki

2009-07-01

Cell-surface engineering (Ueda et al., 2000) has been applied to develop a novel technique to visualize yeast in bread dough. Enhanced green fluorescent protein (EGFP) was bonded to the surface of yeast cells, and 0.5% EGFP yeasts were mixed into the dough samples at four different mixing stages. The samples were placed on a cryostat at -30 degrees C and sliced at 10 microm. The sliced samples were observed at an excitation wavelength of 480 nm and a fluorescent wavelength of 520 nm. The results indicated that the combination of the EGFP-displayed yeasts, rapid freezing, and cryo-sectioning made it possible to visualize 2-D distribution of yeast in bread dough to the extent that the EGFP yeasts could be clearly distinguished from the auto-fluorescent background of bread dough.

The price of independence: cell separation in fission yeast.

PubMed

Martín-García, Rebeca; Santos, Beatriz

2016-04-01

The ultimate goal of cell division is to give rise to two viable independent daughter cells. A tight spatial and temporal regulation between chromosome segregation and cytokinesis ensures the viability of the daughter cells. Schizosaccharomyces pombe, commonly known as fission yeast, has become a leading model organism for studying essential and conserved mechanisms of the eukaryotic cell division process. Like many other eukaryotic cells it divides by binary fission and the cleavage furrow undergoes ingression due to the contraction of an actomyosin ring. In contrast to mammalian cells, yeasts as cell-walled organisms, also need to form a division septum made of cell wall material to complete the process of cytokinesis. The division septum is deposited behind the constricting ring and it will constitute the new ends of the daughter cells. Cell separation also involves cell wall degradation and this process should be precisely regulated to avoid cell lysis. In this review, we will give a brief overview of the whole cytokinesis process in fission yeast, from the positioning and assembly of the contractile ring to the final step of cell separation, and the problems generated when these processes are not precise.

A survey of the mycobiota associated with larvae of the black soldier fly (Hermetia illucens) reared for feed production.

PubMed

Varotto Boccazzi, Ilaria; Ottoboni, Matteo; Martin, Elena; Comandatore, Francesco; Vallone, Lisa; Spranghers, Thomas; Eeckhout, Mia; Mereghetti, Valeria; Pinotti, Luciano; Epis, Sara

2017-01-01

Feed security, feed quality and issues surrounding the safety of raw materials are always of interest to all livestock farmers, feed manufacturers and competent authorities. These concerns are even more important when alternative feed ingredients, new product developments and innovative feeding trends, like insect-meals, are considered. The black soldier fly (Hermetia illucens) is considered a good candidate to be used as feed ingredient for aquaculture and other farm animals, mainly as an alternative protein source. Data on transfer of contaminants from different substrates to the insects, as well as the possible occurrence of toxin-producing fungi in the gut of non-processed insects are very limited. Accordingly, we investigated the impact of the substrate/diet on the intestinal mycobiota of H. illucens larvae using culture-dependent approaches (microbiological analyses, molecular identification through the typing of isolates and the sequencing of the 26S rRNA D1/D2 domain) and amplicon-based next-generation sequencing (454 pyrosequencing). We fed five groups of H. illucens larvae at the third growing stage on two substrates: chicken feed and/or vegetable waste, provided at different timings. The obtained results indicated that Pichia was the most abundant genus associated with the larvae fed on vegetable waste, whereas Trichosporon, Rhodotorula and Geotrichum were the most abundant genera in the larvae fed on chicken feed only. Differences in the fungal communities were highlighted, suggesting that the type of substrate selects diverse yeast and mold genera, in particular vegetable waste is associated with a greater diversity of fungal species compared to chicken feed only. A further confirmation of the significant influence of diet on the mycobiota is the fact that no operational taxonomic unit common to all groups of larvae was detected. Finally, the killer phenotype of isolated yeasts was tested, showing the inhibitory activity of just one species against sensitive strains, out of the 11 tested species.

A survey of the mycobiota associated with larvae of the black soldier fly (Hermetia illucens) reared for feed production

PubMed Central

Varotto Boccazzi, Ilaria; Ottoboni, Matteo; Martin, Elena; Comandatore, Francesco; Vallone, Lisa; Spranghers, Thomas; Eeckhout, Mia; Mereghetti, Valeria; Pinotti, Luciano

2017-01-01

Feed security, feed quality and issues surrounding the safety of raw materials are always of interest to all livestock farmers, feed manufacturers and competent authorities. These concerns are even more important when alternative feed ingredients, new product developments and innovative feeding trends, like insect-meals, are considered. The black soldier fly (Hermetia illucens) is considered a good candidate to be used as feed ingredient for aquaculture and other farm animals, mainly as an alternative protein source. Data on transfer of contaminants from different substrates to the insects, as well as the possible occurrence of toxin-producing fungi in the gut of non-processed insects are very limited. Accordingly, we investigated the impact of the substrate/diet on the intestinal mycobiota of H. illucens larvae using culture-dependent approaches (microbiological analyses, molecular identification through the typing of isolates and the sequencing of the 26S rRNA D1/D2 domain) and amplicon-based next-generation sequencing (454 pyrosequencing). We fed five groups of H. illucens larvae at the third growing stage on two substrates: chicken feed and/or vegetable waste, provided at different timings. The obtained results indicated that Pichia was the most abundant genus associated with the larvae fed on vegetable waste, whereas Trichosporon, Rhodotorula and Geotrichum were the most abundant genera in the larvae fed on chicken feed only. Differences in the fungal communities were highlighted, suggesting that the type of substrate selects diverse yeast and mold genera, in particular vegetable waste is associated with a greater diversity of fungal species compared to chicken feed only. A further confirmation of the significant influence of diet on the mycobiota is the fact that no operational taxonomic unit common to all groups of larvae was detected. Finally, the killer phenotype of isolated yeasts was tested, showing the inhibitory activity of just one species against sensitive strains, out of the 11 tested species. PMID:28771577

The TORMOZ Gene Encodes a Nucleolar Protein Required for Regulated Division Planes and Embryo Development in Arabidopsis[W

PubMed Central

Griffith, Megan E.; Mayer, Ulrike; Capron, Arnaud; Ngo, Quy A.; Surendrarao, Anandkumar; McClinton, Regina; Jürgens, Gerd; Sundaresan, Venkatesan

2007-01-01

Embryogenesis in Arabidopsis thaliana is marked by a predictable sequence of oriented cell divisions, which precede cell fate determination. We show that mutation of the TORMOZ (TOZ) gene yields embryos with aberrant cell division planes and arrested embryos that appear not to have established normal patterning. The defects in toz mutants differ from previously described mutations that affect embryonic cell division patterns. Longitudinal division planes of the proembryo are frequently replaced by transverse divisions and less frequently by oblique divisions, while divisions of the suspensor cells, which divide only transversely, appear generally unaffected. Expression patterns of selected embryo patterning genes are altered in the mutant embryos, implying that the positional cues required for their proper expression are perturbed by the misoriented divisions. The TOZ gene encodes a nucleolar protein containing WD repeats. Putative TOZ orthologs exist in other eukaryotes including Saccharomyces cerevisiae, where the protein is predicted to function in 18S rRNA biogenesis. We find that disruption of the Sp TOZ gene results in cell division defects in Schizosaccharomyces pombe. Previous studies in yeast and animal cells have identified nucleolar proteins that regulate the exit from M phase and cytokinesis, including factors involved in pre-rRNA processing. Our study suggests that in plant cells, nucleolar functions might interact with the processes of regulated cell divisions and influence the selection of longitudinal division planes during embryogenesis. PMID:17616738

Evaluation of Matrix-Assisted Laser Desorption Ionization−Time of Flight Mass Spectrometry for Identification of Mycobacterium species, Nocardia species, and Other Aerobic Actinomycetes

PubMed Central

Buckwalter, S. P.; Olson, S. L.; Connelly, B. J.; Lucas, B. C.; Rodning, A. A.; Walchak, R. C.; Deml, S. M.; Wohlfiel, S. L.

2015-01-01

The value of matrix-assisted laser desorption ionization−time of flight mass spectrometry (MALDI-TOF MS) for the identification of bacteria and yeasts is well documented in the literature. Its utility for the identification of mycobacteria and Nocardia spp. has also been reported in a limited scope. In this work, we report the specificity of MALDI-TOF MS for the identification of 162 Mycobacterium species and subspecies, 53 Nocardia species, and 13 genera (totaling 43 species) of other aerobic actinomycetes using both the MALDI-TOF MS manufacturer's supplied database(s) and a custom database generated in our laboratory. The performance of a simplified processing and extraction procedure was also evaluated, and, similar to the results in an earlier literature report, our viability studies confirmed the ability of this process to inactivate Mycobacterium tuberculosis prior to analysis. Following library construction and the specificity study, the performance of MALDI-TOF MS was directly compared with that of 16S rRNA gene sequencing for the evaluation of 297 mycobacteria isolates, 148 Nocardia species isolates, and 61 other aerobic actinomycetes isolates under routine clinical laboratory working conditions over a 6-month period. MALDI-TOF MS is a valuable tool for the identification of these groups of organisms. Limitations in the databases and in the ability of MALDI-TOF MS to rapidly identify slowly growing mycobacteria are discussed. PMID:26637381

Freeze-drying of yeast cultures.

PubMed

Bond, Chris

2007-01-01

A method is described that allows yeast species to be stored using a variation on the standard freeze-drying method, which employs evaporative cooling in a two-stage process. Yeast cultures are placed in glass ampoules after having been mixed with a lyoprotectant. Primary drying is carried out using a centrifuge head connected to a standard freeze-dryer. Once the centrifuge head is running, air is removed and evaporated liquid is captured in the freeze-dryer. Centrifugation continues for 15 min and primary drying for a further 3 h. The ampoules are constricted using a glass blowing torch. They are then placed on the freeze-dryer manifold for secondary drying under vacuum overnight, using phosphorus pentoxide as a desiccant. The ampoules are sealed and removed from the manifold by melting the constricted section. Although the process causes an initial large drop in viability, further losses after storage are minimal. Yeast strains have remained viable for more than 30 yr when stored using this method and sufficient cells are recovered to produce new working stocks. Although survival rates are strain specific, nearly all National Collection of Yeast Cultures strains covering most yeast genera, have been successfully stored with little or no detectable change in strain characteristics.

Use of CHROMagar Candida for genital specimens in the diagnostic laboratory.

PubMed Central

Houang, E T; Chu, K C; Koehler, A P; Cheng, A F

1997-01-01

OBJECTIVE: To evaluate CHROMagar Candida (CA), a new yeast differential medium, for yeast isolation in a clinical laboratory for the routine examination of high vaginal swabs. METHODS: Results of high vaginal swab cultures processed in a standard manner on plates containing equal halves of Sabouraud dextrose agar (SDA) and CA were compared. Non-Candida albicans yeast isolates were further speciated with API 20C AUX or API 32C. To assess the ease of use of CA, laboratory staff lacking in experience of the medium were asked to identify 23 unlabelled yeast cultures on CA by referring to six labelled reference plates. RESULTS: Of the 1784 swab cultures processed, yeasts were isolated from 373 SDA and 368 CA. Of the 78 non-albicans isolates further speciated, CA identified correctly all cultures of C krusei and C tropicalis, and 82% of C glabrata. All the 38 inexperienced laboratory staff achieved 100% accuracy for C albicans and over 90% for C krusei and C tropicalis. CONCLUSIONS: CA is a satisfactory isolation medium for genital specimens, allowing immediate and correct identification of the commonly encountered yeasts and easy recognition of mixed cultures. Images PMID:9306935

Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

PubMed Central

Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

2012-01-01

Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast density and species composition. When yeast densities were compared in pieces of the same fruits assigned to different treatments, fruits that developed low yeast densities in the absence of flies developed significantly higher yeast densities when exposed to larvae. Across all of the fruits, larvae regulated yeast densities within narrow limits, as compared to a much wider range of yeast densities that developed in pieces of the same fruits not exposed to flies. Larvae also affected yeast species composition, dramatically reducing species diversity across fruits, reducing variation in yeast communities from one fruit to the next (beta diversity), and encouraging the consistent development of a yeast community composed of three species of yeast (Candida californica, C. zemplinina, and Pichia kluvyeri), all of which were palatable to larvae. Larvae excreted viable cells of these three yeast species in their fecal pools, and discouraged the growth of filamentous fungi, processes which may have contributed to their effects on the yeast communities in banana fruits. These and other findings suggest that D. melanogaster adults and their larval offspring together engage in ‘niche construction’, facilitating a predictable microbial environment in the fruit substrates in which the larvae live and develop. PMID:22860093

Improvement of Saccharomyces yeast strains used in brewing, wine making and baking.

PubMed

Donalies, Ute E B; Nguyen, Huyen T T; Stahl, Ulf; Nevoigt, Elke

2008-01-01

Yeast was the first microorganism domesticated by mankind. Indeed, the production of bread and alcoholic beverages such as beer and wine dates from antiquity, even though the fact that the origin of alcoholic fermentation is a microorganism was not known until the nineteenth century. The use of starter cultures in yeast industries became a common practice after methods for the isolation of pure yeast strains were developed. Moreover, effort has been undertaken to improve these strains, first by classical genetic methods and later by genetic engineering. In general, yeast strain development has aimed at improving the velocity and efficiency of the respective production process and the quality of the final products. This review highlights the achievements in genetic engineering of Saccharomyces yeast strains applied in food and beverage industry.

The yeast stands alone: the future of protein biologic production.

PubMed

Love, Kerry R; Dalvie, Neil C; Love, J Christopher

2017-12-22

Yeasts are promising alternative hosts for the manufacturing of recombinant protein therapeutics because they simply and efficiently meet needs for both platform and small-market drugs. Fast accumulation of biomass and low-cost media reduce the cost-of-goods when using yeast, which in turn can enable agile, small-volume manufacturing facilities. Small, tractable yeast genomes are amenable to rapid process development, facilitating strain and product quality by design. Specifically, Pichia pastoris is becoming a widely accepted yeast for biopharmaceutical manufacturing in much of the world owing to a clean secreted product and the rapidly expanding understanding of its cell biology as a host organism. We advocate for a near term partnership spanning industry and academia to promote open source, timely development of yeast hosts. Copyright © 2017. Published by Elsevier Ltd.

Synergic treatment for monosodium glutamate wastewater by Saccharomyces cerevisiae and Coriolus versicolor.

PubMed

Jia, Cuiying; Kang, Ruijuan; Zhang, Yuhui; Cong, Wei; Cai, Zhaoling

2007-03-01

Biodegradation and decolorization of monosodium glutamate wastewater were carried out by using an acidophilus yeast strain of Saccharomyces cerevisiae and Coriolus versicolor. For the yeast treatment, the highest COD removal and reducing sugar removal efficiency were 76.6% and 80.2%, respectively. The color removal was only 2%. For C. versicolor treatment, the highest COD removal, color removal and reducing sugar removal efficiencies were 78.7%, 56.5% and 90.9%, respectively. The synergic treatment process, in which the yeast and C. versicolor were successively applied,exhibited great advantage over the individual process.

Improvement of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of Saccharomyces cerevisiae yeasts isolated during ethanol process.

PubMed

Paulino de Souza, Jonas; Dias do Prado, Cleiton; Eleutherio, Elis C A; Bonatto, Diego; Malavazi, Iran; Ferreira da Cunha, Anderson

2018-06-01

In Brazil, bioethanol is produced by sucrose fermentation from sugarcane by Saccharomyces cerevisiae in a fed-batch process that uses high density of yeast cells (15-25 % of wet weight/v) and high sugar concentration (18-22 % of total sugars). Several research efforts have been employed to improve the efficiency of this process through the isolation of yeasts better adapted to the Brazilian fermentation conditions. Two important wild strains named CAT-1 and PE-2 were isolated during the fermentation process and were responsible for almost 60 % of the total ethanol production in Brazil. However, in the last decade the fermentative substrate composition was much modified, since new sugar cane crops were developed, the use of molasses instead of sugar cane juice increase and with the prohibition of burning of sugarcane prior harvest. As consequence, these previously isolated strains are being replaced by new wild yeasts in most of ethanol plants. In this new scenario the isolation of novel better adapted yeasts with improved fermentative characteristics is still a big challenge. Here, we discuss the main aspects of Brazilian ethanol production and the efforts for the selection, characterization and genetic modifications of new strains with important phenotypic traits such as thermotolerance. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Caloric restriction delays yeast chronological aging by remodeling carbohydrate and lipid metabolism, altering peroxisomal and mitochondrial functionalities, and postponing the onsets of apoptotic and liponecrotic modes of regulated cell death

PubMed Central

Arlia-Ciommo, Anthony; Leonov, Anna; Beach, Adam; Richard, Vincent R.; Bourque, Simon D.; Burstein, Michelle T.; Kyryakov, Pavlo; Gomez-Perez, Alejandra; Koupaki, Olivia; Feldman, Rachel; Titorenko, Vladimir I.

2018-01-01

A dietary regimen of caloric restriction delays aging in evolutionarily distant eukaryotes, including the budding yeast Saccharomyces cerevisiae. Here, we assessed how caloric restriction influences morphological, biochemical and cell biological properties of chronologically aging yeast advancing through different stages of the aging process. Our findings revealed that this low-calorie diet slows yeast chronological aging by mechanisms that coordinate the spatiotemporal dynamics of various cellular processes before entry into a non-proliferative state and after such entry. Caloric restriction causes a stepwise establishment of an aging-delaying cellular pattern by tuning a network that assimilates the following: 1) pathways of carbohydrate and lipid metabolism; 2) communications between the endoplasmic reticulum, lipid droplets, peroxisomes, mitochondria and the cytosol; and 3) a balance between the processes of mitochondrial fusion and fission. Through different phases of the aging process, the caloric restriction-dependent remodeling of this intricate network 1) postpones the age-related onsets of apoptotic and liponecrotic modes of regulated cell death; and 2) actively increases the chance of cell survival by supporting the maintenance of cellular proteostasis. Because caloric restriction decreases the risk of cell death and actively increases the chance of cell survival throughout chronological lifespan, this dietary intervention extends longevity of chronologically aging yeast. PMID:29662634

Assessment of Multi Fragment Melting Analysis System (MFMAS) for the Identification of Food-Borne Yeasts.

PubMed

Kesmen, Zülal; Büyükkiraz, Mine E; Özbekar, Esra; Çelik, Mete; Özkök, F Özge; Kılıç, Özge; Çetin, Bülent; Yetim, Hasan

2018-06-01

Multi Fragment Melting Analysis System (MFMAS) is a novel approach that was developed for the species-level identification of microorganisms. It is a software-assisted system that performs concurrent melting analysis of 8 different DNA fragments to obtain a fingerprint of each strain analyzed. The identification is performed according to the comparison of these fingerprints with the fingerprints of known yeast species recorded in a database to obtain the best possible match. In this study, applicability of the yeast version of the MFMAS (MFMAS-yeast) was evaluated for the identification of food-associated yeast species. For this purpose, in this study, a total of 145 yeast strains originated from foods and beverages and 19 standard yeast strains were tested. The DNAs isolated from these yeast strains were analyzed by the MFMAS, and their species were successfully identified with a similarity rate of 95% or higher. It was shown that the strains belonged to 43 different yeast species that are widely found in the foods. A clear discrimination was also observed in the phylogenetically related species. In conclusion, it might be suggested that the MFMAS-yeast seems to be a highly promising approach for a rapid, accurate, and one-step identification of the yeasts isolated from food products and/or their processing environments.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

PubMed

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507

PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

NASA Astrophysics Data System (ADS)

Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo

2017-04-01

A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles.

Differentiation of yeasts growing on dry-cured Iberian ham by mitochondrial DNA restriction analysis, RAPD-PCR and their volatile compounds production.

PubMed

Andrade, M J; Rodríguez, M; Casado, E M; Bermúdez, E; Córdoba, J J

2009-09-01

The efficiency of mitochondrial DNA (mtDNA) restriction analysis, RAPD-PCR and volatile compounds analysis to differentiate yeast biotypes involved in flavour development of dry-cured Iberian ham throughout the ripening process is evaluated. For this purpose, 86 yeasts isolated from Iberian hams in the main ripening stages at different industries of the four Protected Designations of Origin of this product, were used. The combination of mtDNA restriction analysis and RAPD-PCR using the primer (GACA)4 showed a higher variability in the yeast species detected than obtained using only mtDNA restriction analysis. Only two species, Debaryomyces hansenii and Candida zeylanoides, were identified throughout the whole ripening process and a wide diversity of biotypes was found in these two species, with those of D. hansenii predominating. Clear differences between biotypes were detected in the generation of volatile compounds, with the biotype C2-2 of D. hansenii showing the highest concentrations of volatiles. The combined use of mtDNA restriction analysis and RAPD-PCR distinguishes yeast biotypes with different production of volatile compounds. In addition, analysis of the production profile of volatile compounds is needed to differentiate yeast strains of the same biotype recovered at different stages of ripening. Thus, the combination of these three methods could be very useful to select or monitor yeasts as starter cultures in dry-cured meat products.

Selection of Yeast Strains for Tequila Fermentation Based on Growth Dynamics in Combined Fructose and Ethanol Media.

PubMed

Aldrete-Tapia, J A; Miranda-Castilleja, D E; Arvizu-Medrano, S M; Hernández-Iturriaga, M

2018-02-01

The high concentration of fructose in agave juice has been associated with reduced ethanol tolerance of commercial yeasts used for tequila production and low fermentation yields. The selection of autochthonous strains, which are better adapted to agave juice, could improve the process. In this study, a 2-step selection process of yeasts isolated from spontaneous fermentations for tequila production was carried out based on analysis of the growth dynamics in combined conditions of high fructose and ethanol. First, yeast isolates (605) were screened to identify strains tolerant to high fructose (20%) and to ethanol (10%), yielding 89 isolates able to grow in both conditions. From the 89 isolates, the growth curves under 8 treatments of combined fructose (from 20% to 5%) and ethanol (from 0% to 10%) were obtained, and the kinetic parameters were analyzed with principal component analysis and k-means clustering. The resulting yeast strain groups corresponded to the fast, medium and slow growers. A second clustering of only the fast growers led to the selection of 3 Saccharomyces strains (199, 230, 231) that were able to grow rapidly in 4 out of the 8 conditions evaluated. This methodology differentiated strains phenotypically and could be further used for strain selection in other processes. A method to select yeast strains for fermentation taking into account the natural differences of yeast isolates. This methodology is based on the cell exposition to combinations of sugar and ethanol, which are the most important stress factors in fermentation. This strategy will help to identify the most tolerant strain that could improve ethanol yield and reduce fermentation time. © 2018 Institute of Food Technologists®.

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

Yeast 5 – an expanded reconstruction of the Saccharomyces cerevisiae metabolic network

PubMed Central

2012-01-01

Background Efforts to improve the computational reconstruction of the Saccharomyces cerevisiae biochemical reaction network and to refine the stoichiometrically constrained metabolic models that can be derived from such a reconstruction have continued since the first stoichiometrically constrained yeast genome scale metabolic model was published in 2003. Continuing this ongoing process, we have constructed an update to the Yeast Consensus Reconstruction, Yeast 5. The Yeast Consensus Reconstruction is a product of efforts to forge a community-based reconstruction emphasizing standards compliance and biochemical accuracy via evidence-based selection of reactions. It draws upon models published by a variety of independent research groups as well as information obtained from biochemical databases and primary literature. Results Yeast 5 refines the biochemical reactions included in the reconstruction, particularly reactions involved in sphingolipid metabolism; updates gene-reaction annotations; and emphasizes the distinction between reconstruction and stoichiometrically constrained model. Although it was not a primary goal, this update also improves the accuracy of model prediction of viability and auxotrophy phenotypes and increases the number of epistatic interactions. This update maintains an emphasis on standards compliance, unambiguous metabolite naming, and computer-readable annotations available through a structured document format. Additionally, we have developed MATLAB scripts to evaluate the model’s predictive accuracy and to demonstrate basic model applications such as simulating aerobic and anaerobic growth. These scripts, which provide an independent tool for evaluating the performance of various stoichiometrically constrained yeast metabolic models using flux balance analysis, are included as Additional files 1, 2 and 3. Conclusions Yeast 5 expands and refines the computational reconstruction of yeast metabolism and improves the predictive accuracy of a stoichiometrically constrained yeast metabolic model. It differs from previous reconstructions and models by emphasizing the distinction between the yeast metabolic reconstruction and the stoichiometrically constrained model, and makes both available as Additional file 4 and Additional file 5 and at http://yeast.sf.net/ as separate systems biology markup language (SBML) files. Through this separation, we intend to make the modeling process more accessible, explicit, transparent, and reproducible. PMID:22663945

Experimental Systems to Study Yeast Pexophagy.

PubMed

Yamashita, Shun-Ichi; Oku, Masahide; Sakai, Yasuyoshi; Fujiki, Yukio

2017-01-01

Peroxisome abundance is tightly regulated according to the physiological contexts, through regulations of both proliferation and degradation of the organelles. Here, we describe detailed methods to analyze processes for autophagic degradation of peroxisomes, termed pexophagy, in yeast organisms. The assay systems include a method for biochemical detection of pexophagy completion, and one for microscopic visualization of specialized membrane structures acting in pexophagy. As a model yeast organism utilized in studies of pexophagy, the methylotrophic yeast Komagataella phaffii (Pichia pastoris) is referred to in this chapter and related information on the studies with baker's yeast (Saccharomyces cerevisiae) is also included. The described techniques facilitate elucidation of molecular machineries for pexophagy and understanding of peroxisome-selective autophagic pathways.

Process design considerations for optimal production of ethanol from lignocellulose using available yeasts, including natural pentose-fermenting yeasts, and their derivatives

USDA-ARS?s Scientific Manuscript database

To expand the biomass to fuel ethanol industry, process strategies are needed to foster the production and utilization of microorganisms which can survive and ferment both hexose (C6) and pentose (C5) sugars while exposed to inhibitors (such as ethanol, furfural, and hydroxymethylfurfural, or HMF). ...

Taggiasca extra virgin olive oil colonization by yeasts during the extraction process.

PubMed

Ciafardini, G; Cioccia, G; Zullo, B A

2017-04-01

The opalescent appearance of the newly produced olive oil is due to the presence of solid particles and microdrops of vegetation water in which the microorganisms from the olives' carposphere are trapped. Present research has demonstrated that the microbiota of the fresh extracted olive oil, produced in the mills, is mainly composed of yeasts and to a lesser extent of molds. The close link between the composition of the microbiota of the olives' carposphere undergoing to processing, and that of the microbiota of the newly produced olive oil, concerns only the yeasts and molds, given that the bacterial component is by and large destroyed mainly in the kneaded paste during the malaxation process. Six physiologically homogenous yeast groups were highlighted in the wash water, kneaded paste and newly produced olive oil from the Taggiasca variety which had been collected in mills located in the Liguria region. The more predominant yeasts of each group belonged to a single species called respectively: Kluyveromyces marxianus, Candida oleophila, Candida diddensiae, Candida norvegica, Wickerhamomyces anomalus and Debaryomyces hansenii. Apart from K. marxianus, which was found only in the wash water, all the other species were found in the wash water and in the kneaded paste as well as in the newly produced olive oil, while in the six-month stored olive oil, was found only one physiologically homogeneous group of yeast represented by the W. anomalus specie. These findings in according to our previous studies carried out on other types of mono varietal olive oils, confirms that the habitat of the Taggiascas' extra virgin olive oil, had a strong selective pressure on the yeast biota, allowing only to a few member of yeast species, contaminating the fresh product, to survive and reproduce in it during storage. Copyright © 2016 Elsevier Ltd. All rights reserved.

21 CFR 172.884 - Odorless light petroleum hydrocarbons.

Code of Federal Regulations, 2014 CFR

2014-04-01

... in processing beet sugar and yeast Complying with § 173.340 of this chapter. As a float on... wild yeast contamination during fermentation In an amount not to exceed good manufacturing practice. In...

Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

PubMed

Guo, Yi-Cheng; Zhang, Lin; Dai, Shao-Xing; Li, Wen-Xing; Zheng, Jun-Juan; Li, Gong-Hua; Huang, Jing-Fei

2016-01-01

Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya). However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD) but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase) function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts

PubMed Central

Dai, Shao-Xing; Li, Wen-Xing; Zheng, Jun-Juan; Li, Gong-Hua; Huang, Jing-Fei

2016-01-01

Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya). However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD) but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase) function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage. PMID:27152421

Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

PubMed

Wieckowski, Yana; Schiefelbein, John

2012-07-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

PubMed Central

Wieckowski, Yana; Schiefelbein, John

2012-01-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

Distribution and abundance of fungi in the soils of Taylor Valley, Antarctica

USGS Publications Warehouse

Connell, L.; Redman, R.; Craig, S.; Rodriguez, R.

2006-01-01

The occurrence and distribution of culturable fungi in Taylor Valley, Antarctica was assessed in terms of soil habitat. Soil transects throughout the valley revealed differential habitat utilization between filamentous and non-filamentous (yeast and yeast-like) fungi. In addition, there were significant differences in species distribution patterns with respect to soil pH, moisture, distance from marine coastline, carbon, chlorophyll a, salinity, elevation and solar inputs. Filamentous fungal abundance is most closely associated with habitats having higher pH, and soil moistures. These close associations were not found with yeast and yeast-like fungi demonstrating that yeast and yeast-like fungi utilize a broader range of habitat. An intensive survey of the Victoria Land is necessary to gain a better understanding of their role in soil functioning and nutrient cycling processes. ?? 2006 Elsevier Ltd. All rights reserved.

Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities.

PubMed

Didychuk, Allison L; Montemayor, Eric J; Carrocci, Tucker J; DeLaitsch, Andrew T; Lucarelli, Stefani E; Westler, William M; Brow, David A; Hoskins, Aaron A; Butcher, Samuel E

2017-09-08

U6 small nuclear ribonucleoprotein (snRNP) biogenesis is essential for spliceosome assembly, but not well understood. Here, we report structures of the U6 RNA processing enzyme Usb1 from yeast and a substrate analog bound complex from humans. Unlike the human ortholog, we show that yeast Usb1 has cyclic phosphodiesterase activity that leaves a terminal 3' phosphate which prevents overprocessing. Usb1 processing of U6 RNA dramatically alters its affinity for cognate RNA-binding proteins. We reconstitute the post-transcriptional assembly of yeast U6 snRNP in vitro, which occurs through a complex series of handoffs involving 10 proteins (Lhp1, Prp24, Usb1 and Lsm2-8) and anti-cooperative interactions between Prp24 and Lhp1. We propose a model for U6 snRNP assembly that explains how evolutionarily divergent and seemingly antagonistic proteins cooperate to protect and chaperone the nascent snRNA during its journey to the spliceosome.The mechanism of U6 small nuclear ribonucleoprotein (snRNP) biogenesis is not well understood. Here the authors characterize the enzymatic activities and structures of yeast and human U6 RNA processing enzyme Usb1, reconstitute post-transcriptional assembly of yeast U6 snRNP in vitro, and propose a model for U6 snRNP assembly.

Cytoplasmic peptide:N-glycanase cleaves N-glycans on a carboxypeptidase Y mutant during ERAD in Saccharomyces cerevisiae.

PubMed

Hosomi, Akira; Suzuki, Tadashi

2015-04-01

Endoplasmic reticulum (ER)-associated degradation (ERAD) is a pathway by which misfolded or improperly assembled proteins in the ER are directed to degradation. The cytoplasmic peptide:N-glycanase (PNGase) is a deglycosylating enzyme that cleaves N-glycans from misfolded glycoproteins during the ERAD process. The mutant form of yeast carboxypeptidase Y (CPY*) is an ERAD model substrate that has been extensively studied in yeast. While a delay in the degradation of CPY* in yeast cells lacking the cytoplasmic PNGase (Png1 in yeast) was evident, the in vivo action of PNGase on CPY* has not been detected. We constructed new ERAD substrates derived from CPY*, bearing epitope tags at both N- and C-termini and examined the degradation intermediates observed in yeast cells with compromised proteasome activity. The occurrence of the PNGase-mediated deglycosylation of intact CPY* and its degradation intermediates was evident. A major endoproteolytic reaction on CPY* appears to occur between amino acid 400 and 404. The findings reported herein clearly indicate that PNGase indeed releases N-glycans from CPY* during the ERAD process in vivo. This report implies that the PNGase-mediated deglycosylation during the ERAD process may occur more abundantly than currently envisaged. Copyright © 2014 Elsevier B.V. All rights reserved.

Biological conversion of pyrolytic products to ethanol and lipids

NASA Astrophysics Data System (ADS)

Lian, Jieni

Pyrolysis is a promising technology that can convert up to 75 % of lignocellulosic biomass into crude bio-oil. However, due to the complex chemical compositions of bio-oil, its further refining into fuels and high value chemicals faces great challenges. This dissertation research proposed new technologies for biological conversion of pyrolytic products derived from cellulose and hemicellulose, such as anhydrosugars and carbolic acids to fuels and chemicals. First, the pyrolytic anhydrosugars (chiefly levoglucosan (LG)) were hydrolysed into glucose followed by neutralization, detoxification and fermentation to produce ethanol by ethanogenetic yeast and lipids by oleaginous yeasts. Second, a novel process for the conversion of C1-C4 pyrolytic products to lipid with oleaginous yeasts was investigated. Third, oleaginous yeasts that can directly convert LG to lipids were studied and a recombined yeast with LG kinase was constructed for the direct convertion of LG into lipids. This allowed a reduction of existing process for LG fermentation from four steps into two steps and eliminated the need for acids and bases as well as the disposal of chemicals. The development of genetic modified organisms with LG kinase opens a promising avenue for the direct LG fermentation to produce a wide range of fuels and chemicals. The simplification of LG utilization process would enhance the economic viability of this technology.

A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

NASA Technical Reports Server (NTRS)

Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.

1993-01-01

A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

Yeast culture dietary supplementation modulates gut microbiota, growth and biochemical parameters of grass carp.

PubMed

Liu, Han; Li, Juntao; Guo, Xianwu; Liang, Yunxiang; Wang, Weimin

2018-05-01

Gut microbiota contributes positively to the physiology of their host. Some feed additives have been suggested to improve livestock health and stimulate growth performance by modulating gut bacteria species. Here, we fed grass carp with 0 (control), 8% (Treat1), 10% (Treat2), 12% (Treat3) and 16% (Treat4) of yeast culture (YC) for 10 weeks. The gut microbiota was analysed by 16S rRNA gene V3-4 region via an Illumina MiSeq platform. PCoA test showed that gut bacterial communities in the control and Treat3 formed distinctly separate clusters. Although all the groups shared a large size of OTUs as a core microbiota community, a strong distinction existed at genus level. Treat3 contained the highest proportion of the beneficial bacteria and obviously enhanced the capacity of amino acid, lipid metabolism and digestive system. In addition, Treat3 significantly improved the fish growth and increased the liver and serum T-SOD activities while dramatically decreased the liver GPT and GOT. Collectively, these findings demonstrate the beneficial effects of YC feeding on gut microbiota, growth and biochemical parameters and Treat3 might be the optimal supplementation amount for grass carp, which opens up the possibility that a new feed additive can be developed for healthy aquaculture. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Torulaspora quercuum sp. nov. and Candida pseudohumilis sp. nov., novel yeasts from human and forest habitats.

PubMed

Wang, Qi-Ming; Xu, Jianping; Wang, Huamin; Li, Juan; Bai, Feng-Yan

2009-12-01

Strains XZ-46A, XZ-105, XZ-129 and XZ-281(T) isolated from the oral cavities of healthy Tibetan volunteers were revealed to represent two novel ascomycetous yeast species by molecular taxonomic characterizations. Strain XZ-281(T) was most closely related to Candida humilis, but differed from the type strain of the species by eight (1.2%) substitutions in the 26S rRNA gene D1/D2 domain and by >100 (>20%) mismatches in the internal transcribed spacer (ITS) region. Strains XZ-46A, XZ-105 and XZ-129 had identical or similar D1/D2 and ITS sequences with each other and with strain 17YF(T) isolated from a leaf of an oak tree (Quercus sp.). The closest relative of this group was Torulaspora microellipsoides. They differed from the type strain of the species by five (0.9%) substitutions in the D1/D2 domain and >70 (>15%) mismatches in the ITS region. A sexual state was observed in strain 17YF(T), but not in the other four oral strains. An anamorphic name Candida pseudohumilis sp. nov. is proposed for strain XZ-281(T) (=AS 2.3956(T)=CBS 11404(T)) and a teleomorphic name Torulaspora quercuum sp. nov. is proposed for strain 17YF(T) (=AS 2.3768(T)=CBS 11403(T)) and the other three oral strains.

Evidence that tRNA modifying enzymes are important in vivo targets for 5-fluorouracil in yeast

PubMed Central

Gustavsson, Marie; Ronne, Hans

2008-01-01

We have screened a collection of haploid yeast knockout strains for increased sensitivity to 5-fluorouracil (5-FU). A total of 138 5-FU sensitive strains were found. Mutants affecting rRNA and tRNA maturation were particularly sensitive to 5-FU, with the tRNA methylation mutant trm10 being the most sensitive mutant. This is intriguing since trm10, like many other tRNA modification mutants, lacks a phenotype under normal conditions. However, double mutants for nonessential tRNA modification enzymes are frequently temperature sensitive, due to destabilization of hypomodified tRNAs. We therefore tested if the sensitivity of our mutants to 5-FU is affected by the temperature. We found that the cytotoxic effect of 5-FU is strongly enhanced at 38°C for tRNA modification mutants. Furthermore, tRNA modification mutants show similar synthetic interactions for temperature sensitivity and sensitivity to 5-FU. A model is proposed for how 5-FU kills these mutants by reducing the number of tRNA modifications, thus destabilizing tRNA. Finally, we found that also wild-type cells are temperature sensitive at higher concentrations of 5-FU. This suggests that tRNA destabilization contributes to 5-FU cytotoxicity in wild-type cells and provides a possible explanation why hyperthermia can enhance the effect of 5-FU in cancer therapy. PMID:18314501

Wickerhamomyces arborarius f.a., sp. nov., an ascomycetous yeast species found in arboreal habitats on three different continents.

PubMed

James, Stephen A; Barriga, Enrique Javier Carvajal; Barahona, Patricia Portero; Harrington, Thomas C; Lee, Ching-Fu; Bond, Christopher J; Roberts, Ian N

2014-03-01

Five strains representing a novel yeast species belonging to the genus Wickerhamomyces were independently isolated from Ecuador, Taiwan and the USA. One strain (CLQCA 10-161(T)) was isolated from the white flower of an unidentified plant species collected in the Maquipucuna cloud forest reserve, near Quito, in Ecuador. A second strain (GY7L12) was isolated from the leaf of a Chinese sumac or nutgall tree (Rhus chinensis 'roxburghiana') collected in the Taoyuan mountain area, Kachsiung, in Taiwan. Three additional strains (A543, A546 and A563) were isolated from two species of wood-boring beetle (Xyleborus glabratus and Xyleborinus saxeseni) collected near Clyo, Georgia, USA. Analysis of the D1/D2 domains of the LSU rRNA gene indicated that the novel species belongs to the genus Wickerhamomyces, and is most closely related to Wickerhamomyces sydowiorum, an insect-associated species predominantly found in South Africa. The North American and Taiwanese strains have identical internal transcribed spacer (ITS) sequences and can be distinguished from the Ecuadorian strain based on a single nucleotide substitution in the ITS1 region. The species name of Wickerhamomyces arborarius f.a., sp. nov. is proposed to accommodate these strains, with CLQCA 10-161(T) ( = CBS 12941(T) = NCYC 3743(T)) designated the type strain.

Isolation and identification of a Candida digboiensis strain from an extreme acid mine drainage of the Lignite Mine, Gujarat.

PubMed

Patel, Mitesh J; Tipre, Devayani R; Dave, Shailesh R

2009-12-01

An extremely acidic mine drainage (AMD) water sample was collected in 1998 and 2008 from Panandhro lignite mine, Gujarat, India. The yeast isolated from this sample was identified using mini API identification system, as a member of genus Candida. The major cellular fatty acids detected by FAME from the isolate are C(16:0) and C(18:2) (cis 9,12)/C(18:0alpha) as 25.23 and 19.5%, respectively. The isolate was identified as Candida digboiensis by 18S rRNA gene sequence analysis and designated as Candida digboiensis SRDyeast1. Phylogenetic analysis using D1/D2 variable domains showed that the closest relative of this strain is Candida blankii with 3% divergence. This organism has been reported for the first time from the lignite mine AMD sample, and for cellular fatty acid analysis. This yeast is able to survive in the AMD sample preserved at 10-42 degrees C temperature since last 10 years along with iron oxidizing microorganisms. It can grow in the presence of 40% glucose, 10% NaCl and in the pH range of 1 to 10. The isolate is capable of producing enzymes like protease and lipase. This isolate differs from the type strain Candida digboiensis in as many as six physiological and metabolic characteristics.

Volatilization and precipitation of tellurium by aerobic, tellurite-resistant marine microbes.

PubMed

Ollivier, Patrick R L; Bahrou, Andrew S; Marcus, Sarah; Cox, Talisha; Church, Thomas M; Hanson, Thomas E

2008-12-01

Microbial resistance to tellurite, an oxyanion of tellurium, is widespread in the biosphere, but the geochemical significance of this trait is poorly understood. As some tellurite resistance markers appear to mediate the formation of volatile tellurides, the potential contribution of tellurite-resistant microbial strains to trace element volatilization in salt marsh sediments was evaluated. Microbial strains were isolated aerobically on the basis of tellurite resistance and subsequently examined for their capacity to volatilize tellurium in pure cultures. The tellurite-resistant strains recovered were either yeasts related to marine isolates of Rhodotorula spp. or gram-positive bacteria related to marine strains within the family Bacillaceae based on rRNA gene sequence comparisons. Most strains produced volatile tellurides, primarily dimethyltelluride, though there was a wide range of the types and amounts of species produced. For example, the Rhodotorula spp. produced the greatest quantities and highest diversity of volatile tellurium compounds. All strains also produced methylated sulfur compounds, primarily dimethyldisulfide. Intracellular tellurium precipitates were a major product of tellurite metabolism in all strains tested, with nearly complete recovery of the tellurite initially provided to cultures as a precipitate. Different strains appeared to produce different shapes and sizes of tellurium containing nanostructures. These studies suggest that aerobic marine yeast and Bacillus spp. may play a greater role in trace element biogeochemistry than has been previously assumed, though additional work is needed to further define and quantify their specific contributions.

Biogas Production from Brewer’s Yeast Using an Anaerobic Sequencing Batch Reactor

PubMed Central

2017-01-01

Summary Renewable energy sources are becoming increasingly important in the beverage and food industries. In the brewing industry, a significant percentage of the used raw materials finishes the process as secondary resource or waste. The research on the anaerobic digestion of brewer’s yeast has been scarce until recent years. One of the reasons for this is its use as a secondary resource in the food industry and as cattle feed. Additionally, market value of brewer’s yeast is higher than its energy value. Due to the increase of energy prices, brewer’s yeast has become of interest as energy substrate despite its difficult degradability in anaerobic conditions. The anaerobic co-digestion of brewer’s yeast and anaerobically treated brewery wastewater was studied using a pilot-scale anaerobic sequencing batch reactor (ASBR) seeded with granular biomass. The experiments showed very good and stable operation with an organic loading rate of up to 8.0 kg/(m3·day), and with a maximum achieved organic loading rate of 13.6 kg/(m3·day) in a single cycle. A specific biogas productivity of over 0.430 m3/kg of the total chemical oxygen demand (COD) inserted, and total COD removal efficiencies of over 90% were achieved. This study suggests that the brewer’s yeast can be successfully digested in an ASBR without adverse effects on the biogas production from brewer’s yeast/wastewater mixtures of up to 8% (by volume). By using the brewer’s yeast in the ASBR process, the biogas production from brewery wastewater could be increased by 50%. PMID:28867948

Sunxiuqinia faeciviva sp. nov., a facultatively anaerobic organoheterotroph of the Bacteroidetes isolated from deep subseafloor sediment.

PubMed

Takai, Ken; Abe, Mariko; Miyazaki, Masayuki; Koide, Osamu; Nunoura, Takuro; Imachi, Hiroyuki; Inagaki, Fumio; Kobayashi, Tohru

2013-05-01

A facultatively anaerobic organoheterotroph, designated JAM-BA0302(T), was isolated from a deep subseafloor sediment at a depth of 247.1 m below the seafloor off the Shimokita Peninsula of Japan in the north-western Pacific Ocean (Site C9001 , water depth 1180 m). Cells of strain JAM-BA0302(T) showed gliding motility and were thin, long rods with peritrichous fimbriae-like structures. Growth occurred at 4-37 °C (optimum 30 °C; doubling time 8 h), at pH 5.4-8.3 (optimum pH 7.5) and with 5-60 g NaCl l(-1) (optimum 20-25 g l(-1)). The isolate utilized proteinaceous substrates such as yeast extract, tryptone, casein and Casamino acids with O2 respiration or fermentation. Strain JAM-BA0302(T) was a piezotolerant bacterium that could grow at pressures as high as 25 MPa under aerobic conditions and 10 MPa under anaerobic conditions. The G+C content of the genomic DNA was 43.2 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain JAM-BA0302(T) was most closely related to yet-undescribed strains recently isolated from various marine sedimentary environments (>99.6 % 16S rRNA gene sequence similarity) and was moderately related to Sunxiuqinia elliptica DQHS-4(T), isolated from a sea cucumber farm sediment (95.5 % 16S rRNA gene sequence similarity) within the Bacteroidetes. The phylogenetic analysis suggested that the isolate should belong to the genus Sunxiuqinia. However, low DNA-DNA relatedness (<11 %) and many physiological and molecular properties differentiated the isolate from those previously describedhttp://dx.doi.org/10.1601/nm.22746. We propose here a novel species of the genus Sunxiuqinia, with the name Sunxiuqinia faeciviva sp. nov. The type strain is JAM-BA0302(T) ( = JCM 15547(T)  = NCIMB 14481(T)).

Nonenzymatic microorganism identification based on ribosomal RNA

NASA Astrophysics Data System (ADS)

Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

1999-11-01

Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Characterization of winemaking yeast by cell number-size distribution analysis through flow field-flow fractionation with multi-wavelength turbidimetric detection.

PubMed

Zattoni, Andrea; Melucci, Dora; Reschiglian, Pierluigi; Sanz, Ramsés; Puignou, Lluís; Galceran, Maria Teresa

2004-10-29

Yeasts are widely used in several areas of food industry, e.g. baking, beer brewing, and wine production. Interest in new analytical methods for quality control and characterization of yeast cells is thus increasing. The biophysical properties of yeast cells, among which cell size, are related to yeast cell capabilities to produce primary and secondary metabolites during the fermentation process. Biophysical properties of winemaking yeast strains can be screened by field-flow fractionation (FFF). In this work we present the use of flow FFF (FlFFF) with turbidimetric multi-wavelength detection for the number-size distribution analysis of different commercial winemaking yeast varieties. The use of a diode-array detector allows to apply to dispersed samples like yeast cells the recently developed method for number-size (or mass-size) analysis in flow-assisted separation techniques. Results for six commercial winemaking yeast strains are compared with data obtained by a standard method for cell sizing (Coulter counter). The method here proposed gives, at short analysis time, accurate information on the number of cells of a given size, and information on the total number of cells.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Januszyk, Kurt; Liu, Quansheng; Lima, Christopher D.

The eukaryotic RNA exosome is a highly conserved multi-subunit complex that catalyzes degradation and processing of coding and noncoding RNA. A noncatalytic nine-subunit exosome core interacts with Rrp44 and Rrp6, two subunits that possess processive and distributive 3'-to-5' exoribonuclease activity, respectively. While both Rrp6 and Rrp44 are responsible for RNA processing in budding yeast, Rrp6 may play a more prominent role in processing, as it has been demonstrated to be inhibited by stable RNA secondary structure in vitro and because the null allele in budding yeast leads to the buildup of specific structured RNA substrates. Human RRP6, otherwise known asmore » PM/SCL-100 or EXOSC10, shares sequence similarity to budding yeast Rrp6 and is proposed to catalyze 3'-to-5' exoribonuclease activity on a variety of nuclear transcripts including ribosomal RNA subunits, RNA that has been poly-adenylated by TRAMP, as well as other nuclear RNA transcripts destined for processing and/or destruction. To characterize human RRP6, we expressed the full-length enzyme as well as truncation mutants that retain catalytic activity, compared their activities to analogous constructs for Saccharomyces cerevisiae Rrp6, and determined the X-ray structure of a human construct containing the exoribonuclease and HRDC domains that retains catalytic activity. Structural data show that the human active site is more exposed when compared to the yeast structure, and biochemical data suggest that this feature may play a role in the ability of human RRP6 to productively engage and degrade structured RNA substrates more effectively than the analogous budding yeast enzyme.« less

Optimization of the simultaneous saccharification and fermentation process using thermotolerant yeasts.

PubMed

Ballesteros, I; Oliva, J M; Ballesteros, M; Carrasco, J

1993-01-01

Different treatments to improve the thermotolerance of fermenting yeasts for simultaneous ethanol saccharification and fermentation process of cellulosic materials have been examined. Yeasts of the genera Saccharomyces and Kluyveromyces were tested for growth and fermentation at progressively higher temperatures in the range of 42-47 degrees C. The best results were obtained with K. marxianus LG, which was then submitted to different treatments in order to achieve thermotolerant clones. A total of 35 new clones were obtained that dramatically improved the SSF of 10% Solka-floc substrate at 45 degrees C when compared to the original strain, some with ethanol concentrations as high as 33 g/L.

Soft x-ray-controlled dose deposition in yeast cells: techniques, model, and biological assessment

NASA Astrophysics Data System (ADS)

Milani, Marziale; Batani, Dimitri; Conti, Aldo; Masini, Alessandra; Costato, Michele; Pozzi, Achille; Turcu, I. C. Edmond

1996-12-01

A procedure is presented to release soft x-rays onto yeast cell membrane allegedly damaging the resident enzymatic processes connected with fermentation. The damage is expected to be restricted to regulating fermentation processes without interference with respiration. By this technique fermentation is followed leading to CO2 production, and respiration resulting in global pressure measurements. A solid state pressure sensor system has been developed linked to a data acquisition system. Yeast cells cultures have been investigated at different concentrations and with different nutrients. A non-monotone response in CO2 production as a function of the delivered x-ray dose is observed.

Efficient Sporulation of Saccharomyces cerevisiae in a 96 Multiwell Format.

PubMed

Paulissen, Scott M; Huang, Linda S

2016-09-17

During times of nutritional stress, Saccharomyces cerevisiae undergoes gametogenesis, known as sporulation. Diploid yeast cells that are starved for nitrogen and carbon will initiate the sporulation process. The process of sporulation includes meiosis followed by spore formation, where the haploid nuclei are packaged into environmentally resistant spores. We have developed methods for the efficient sporulation of budding yeast in 96 multiwell plates, to increase the throughput of screening yeast cells for sporulation phenotypes. These methods are compatible with screening with yeast containing plasmids requiring nutritional selection, when appropriate minimal media is used, or with screening yeast with genomic alterations, when a rich presporulation regimen is used. We find that for this method, aeration during sporulation is critical for spore formation, and have devised techniques to ensure sufficient aeration that are compatible with the 96 multiwell plate format. Although these methods do not achieve the typical ~80% level of sporulation that can be achieved in large-volume flask based experiments, these methods will reliably achieve about 50-60% level of sporulation in small-volume multiwell plates.

A multivariate approach using attenuated total reflectance mid-infrared spectroscopy to measure the surface mannoproteins and β-glucans of yeast cell walls during wine fermentations.

PubMed

Moore, John P; Zhang, Song-Lei; Nieuwoudt, Hélène; Divol, Benoit; Trygg, Johan; Bauer, Florian F

2015-11-18

Yeast cells possess a cell wall comprising primarily glycoproteins, mannans, and glucan polymers. Several yeast phenotypes relevant for fermentation, wine processing, and wine quality are correlated with cell wall properties. To investigate the effect of wine fermentation on cell wall composition, a study was performed using mid-infrared (MIR) spectroscopy coupled with multivariate methods (i.e., PCA and OPLS-DA). A total of 40 yeast strains were evaluated, including Saccharomyces strains (laboratory and industrial) and non-Saccharomyces species. Cells were fermented in both synthetic MS300 and Chardonnay grape must to stationery phase, processed, and scanned in the MIR spectrum. PCA of the fingerprint spectral region showed distinct separation of Saccharomyces strains from non-Saccharomyces species; furthermore, industrial wine yeast strains separated from laboratory strains. PCA loading plots and the use of OPLS-DA to the data sets suggested that industrial strains were enriched with cell wall proteins (e.g., mannoproteins), whereas laboratory strains were composed mainly of mannan and glucan polymers.

Actin and Endocytosis in Budding Yeast

PubMed Central

Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

2015-01-01

Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

Spent brewer's yeast extract as an ingredient in cooked hams.

PubMed

Pancrazio, Gaston; Cunha, Sara C; de Pinho, Paula Guedes; Loureiro, Mónica; Meireles, Sónia; Ferreira, Isabel M P L V O; Pinho, Olívia

2016-11-01

This work describes the effect of the incorporation of 1% spent yeast extract into cooked hams. Physical/chemical/sensorial characteristics and changes during 12 and 90days storage were evaluated on control and treated cooked hams processed for 1.5, 2.0, 2.5 or 3h. Spent yeast extract addition increased hardness, chewiness, ash, protein and free amino acid content. Similar volatile profiles were obtained, although there were some quantitative differences. No advantages were observed for increased cooking time. No significant differences were observed for physical and sensorial parameters of cooked hams with spent yeast extract at 12 and 90days post production, but His, aldehydes and esters increased at the end of storage. This behaviour was similar to that observed for control hams. The higher hardness of cooked ham with 1% yeast extract was due to the stronger gel formed during cooking and was maintained during storage. This additive acts as gel stabilizer for cooked ham production and could potentially improve other processing characteristics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

PubMed

Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

2015-06-01

Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation between spliced rRNA expression levels, possibly due to changes in rRNA processing, which requires further investigation.

Fed-batch hydrolysate addition and cell separation by settling in high cell density lignocellulosic ethanol fermentations on AFEX™ corn stover in the Rapid Bioconversion with Integrated recycling Technology process.

PubMed

Sarks, Cory; Jin, Mingjie; Balan, Venkatesh; Dale, Bruce E

2017-09-01

The Rapid Bioconversion with Integrated recycling Technology (RaBIT) process uses enzyme and yeast recycling to improve cellulosic ethanol production economics. The previous versions of the RaBIT process exhibited decreased xylose consumption using cell recycle for a variety of different micro-organisms. Process changes were tested in an attempt to eliminate the xylose consumption decrease. Three different RaBIT process changes were evaluated in this work including (1) shortening the fermentation time, (2) fed-batch hydrolysate addition, and (3) selective cell recycling using a settling method. Shorting the RaBIT fermentation process to 11 h and introducing fed-batch hydrolysate addition eliminated any xylose consumption decrease over ten fermentation cycles; otherwise, decreased xylose consumption was apparent by the third cell recycle event. However, partial removal of yeast cells during recycle was not economical when compared to recycling all yeast cells.

Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

NASA Astrophysics Data System (ADS)

Sakharkar, Kishore R.; Sakharkar, Meena K.

The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

Global Gene Expression Analysis of Yeast Cells during Sake Brewing▿ †

PubMed Central

Wu, Hong; Zheng, Xiaohong; Araki, Yoshio; Sahara, Hiroshi; Takagi, Hiroshi; Shimoi, Hitoshi

2006-01-01

During the brewing of Japanese sake, Saccharomyces cerevisiae cells produce a high concentration of ethanol compared with other ethanol fermentation methods. We analyzed the gene expression profiles of yeast cells during sake brewing using DNA microarray analysis. This analysis revealed some characteristics of yeast gene expression during sake brewing and provided a scaffold for a molecular level understanding of the sake brewing process. PMID:16997994

Mitochondrial origin of extracelullar transferred electrons in yeast-based biofuel cells.

PubMed

Hubenova, Yolina; Mitov, Mario

2015-12-01

The influence of mitochondrial electron transport chain inhibitors on the electricity outputs of Candida melibiosica yeast-based biofuel cell was investigated. The addition of 30 μM rotenone or antimycin A to the yeast suspension results in a decrease in the current generation, corresponding to 25.7±1.3%, respectively 38.8±1.9% reduction in the electric charge passed through the bioelectrochemical system. The latter percentage coincides with the share of aerobic respiration in the yeast catabolic processes, determined by the decrease of the ethanol production during cultivation in the presence of oxygen compared with that obtained under strict anaerobic conditions. It was established that the presence of both inhibitors leads to almost complete mitochondrial dysfunction, expressed by inactivation of cytochrome c oxidase and NADH:ubiquinone oxidoreductase as well as reduced electrochemical activity of isolated yeast mitochondria. It was also found that methylene blue partially neutralized the rotenone poisoning, probably serving as alternative intracellular electron shuttle for by-passing the complex I blockage. Based on the obtained results, we suppose that electrons generated through the aerobic respiration processes in the mitochondria participate in the extracellular electron transfer from the yeast cells to the biofuel cell anode, which contributes to higher current outputs at aerobic conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

Implication of Ca2+ in the regulation of replicative life span of budding yeast.

PubMed

Tsubakiyama, Ryohei; Mizunuma, Masaki; Gengyo, Anri; Yamamoto, Josuke; Kume, Kazunori; Miyakawa, Tokichi; Hirata, Dai

2011-08-19

In eukaryotic cells, Ca(2+)-triggered signaling pathways are used to regulate a wide variety of cellular processes. Calcineurin, a highly conserved Ca(2+)/calmodulin-dependent protein phosphatase, plays key roles in the regulation of diverse biological processes in organisms ranging from yeast to humans. We isolated a mutant of the SIR3 gene, implicated in the regulation of life span, as a suppressor of the Ca(2+) sensitivity of zds1Δ cells in the budding yeast Saccharomyces cerevisiae. Therefore, we investigated a relationship between Ca(2+) signaling and life span in yeast. Here we show that Ca(2+) affected the replicative life span (RLS) of yeast. Increased external and intracellular Ca(2+) levels caused a reduction in their RLS. Consistently, the increase in calcineurin activity by either the zds1 deletion or the constitutively activated calcineurin reduced RLS. Indeed, the shortened RLS of zds1Δ cells was suppressed by the calcineurin deletion. Further, the calcineurin deletion per se promoted aging without impairing the gene silencing typically observed in short-lived sir mutants, indicating that calcineurin plays an important role in a regulation of RLS even under normal growth condition. Thus, our results indicate that Ca(2+) homeostasis/Ca(2+) signaling are required to regulate longevity in budding yeast.

Genome-wide expression analyses of the stationary phase model of ageing in yeast.

PubMed

Wanichthanarak, Kwanjeera; Wongtosrad, Nutvadee; Petranovic, Dina

2015-07-01

Ageing processes involved in replicative lifespan (RLS) and chronological lifespan (CLS) have been found to be conserved among many organisms, including in unicellular Eukarya such as yeast Saccharomyces cerevisiae. Here we performed an integrated approach of genome wide expression profiles of yeast at different time points, during growth and starvation. The aim of the study was to identify transcriptional changes in those conditions by using several different computational analyses in order to propose transcription factors, biological networks and metabolic pathways that seem to be relevant during the process of chronological ageing in yeast. Specifically, we performed differential gene expression analysis, gene-set enrichment analysis and network-based analysis, and we identified pathways affected in the stationary phase and specific transcription factors driving transcriptional adaptations. The results indicate signal propagation from G protein-coupled receptors through signaling pathway components and other stress and nutrient-induced transcription factors resulting in adaptation of yeast cells to the lack of nutrients by activating metabolism associated with aerobic metabolism of carbon sources such as ethanol, glycerol and fatty acids. In addition, we found STE12, XBP1 and TOS8 as highly connected nodes in the subnetworks of ageing yeast. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Direct concentration and viability measurement of yeast in corn mash using a novel imaging cytometry method.

PubMed

Chan, Leo L; Lyettefi, Emily J; Pirani, Alnoor; Smith, Tim; Qiu, Jean; Lin, Bo

2011-08-01

Worldwide awareness of fossil-fuel depletion and global warming has been increasing over the last 30 years. Numerous countries, including the USA and Brazil, have introduced large-scale industrial fermentation facilities for bioethanol, biobutanol, or biodiesel production. Most of these biofuel facilities perform fermentation using standard baker's yeasts that ferment sugar present in corn mash, sugar cane, or other glucose media. In research and development in the biofuel industry, selection of yeast strains (for higher ethanol tolerance) and fermentation conditions (yeast concentration, temperature, pH, nutrients, etc.) can be studied to optimize fermentation performance. Yeast viability measurement is needed to identify higher ethanol-tolerant yeast strains, which may prolong the fermentation cycle and increase biofuel output. In addition, yeast concentration may be optimized to improve fermentation performance. Therefore, it is important to develop a simple method for concentration and viability measurement of fermenting yeast. In this work, we demonstrate an imaging cytometry method for concentration and viability measurements of yeast in corn mash directly from operating fermenters. It employs an automated cell counter, a dilution buffer, and staining solution from Nexcelom Bioscience to perform enumeration. The proposed method enables specific fluorescence detection of viable and nonviable yeasts, which can generate precise results for concentration and viability of yeast in corn mash. This method can provide an essential tool for research and development in the biofuel industry and may be incorporated into manufacturing to monitor yeast concentration and viability efficiently during the fermentation process.

Safety and regulation of yeasts used for biocontrol or biopreservation in the food or feed chain.

PubMed

Sundh, Ingvar; Melin, Petter

2011-01-01

Yeasts have been important components of spontaneous fermentations in food and beverage processing for millennia. More recently, the potential of utilising antagonistic yeasts, e.g. Pichia anomala and Candida spp., for post-harvest biological control of spoilage fungi during storage of plant-derived produce ('biopreservation') has been clearly demonstrated. Although some yeast species are among the safest microorganisms known, several have been reported in opportunistic infections in humans, including P. anomala and bakers' yeast, Saccharomyces cerevisiae. More research is needed about the dominant pathogenicity and virulence factors in opportunistic yeasts, and whether increased utilisation of biopreservative yeasts in general could contribute to an increased prevalence of yeast infections. The regulatory situation for yeasts used in post-harvest biocontrol is complex and the few products that have reached the market are mainly registered as biological pesticides. The qualified presumption of safety (QPS) approach to safety assessments of microorganisms intentionally added to food or feed, recently launched by the European Food Safety Authority, can lead to more efficient evaluations of new products containing microbial species with a sufficient body of knowledge or long-term experience on their safety. P. anomala is one of several yeast species that have been given QPS status, although the status is restricted to use of this yeast for enzyme and metabolite production purposes. With regard to authorisation of new biopreservative yeasts, we recommend that the possibility to regulate microorganisms for food biopreservation as food additives be considered.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

NASA Astrophysics Data System (ADS)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Performance evaluation of startup for a yeast membrane bioreactor (MBRy) treating landfill leachate.

PubMed

Amaral, Míriam C S; Gomes, Rosimeire F; Brasil, Yara L; Oliveira, Sílvia M A; Moravia, Wagner G

2017-12-06

The startup process of a membrane bioreactor inoculated with yeast biomass (Saccharomyces cerevisiae) and used in the treatment of landfill leachate was evaluated. The yeast membrane bioreactor (MBRy) was inoculated with an exogenous inoculum, a granulated active dry commercial bakers' yeast. The MBRy was successfully started up with a progressive increase in the landfill leachate percentage in the MBRy feed and the use of Sabouraud Dextrose Broth. The membrane plays an important role in the startup phase because of its full biomass retention and removal of organic matter. MBRy is a suitable and promising process to treat recalcitrant landfill leachate. After the acclimation period, the COD and NH 3 removal efficiency reached values of 72 ± 3% and 39 ± 2% respectively. MBRy shows a low membrane-fouling potential. The membrane fouling was influenced by soluble microbial products, extracellular polymeric substances, sludge particle size, and colloidal dissolved organic carbon.

Brettanomyces bruxellensis yeasts: impact on wine and winemaking.

PubMed

Agnolucci, Monica; Tirelli, Antonio; Cocolin, Luca; Toffanin, Annita

2017-09-21

Yeasts belonging to the Brettanomyces/Dekkera genus are non-conventional yeasts, which affect winemaking by causing wine spoilage all over the world. This mini-review focuses on recent results concerning the presence of Brettanomyces bruxellensis throughout the wine processing chain. Here, culture-dependent and independent methods to detect this yeast on grapes and at the very early stage of wine production are encompassed. Chemical, physical and biological tools, devised for the prevention and control of such a detrimental species during winemaking are also presented. Finally, the mini-review identifies future research areas relevant to the improvement of wine safety and sensory profiles.

Study of the counts, species and characteristics of the yeast population during the manufacture of dry-cured "lacón". Effect of salt level.

PubMed

Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M

2013-05-01

The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.

Multicenter Evaluation of the Bruker MALDI Biotyper CA System for the Identification of Clinically Important Bacteria and Yeasts.

PubMed

Wilson, Deborah A; Young, Stephen; Timm, Karen; Novak-Weekley, Susan; Marlowe, Elizabeth M; Madisen, Neil; Lillie, Jennifer L; Ledeboer, Nathan A; Smith, Rebecca; Hyke, Josh; Griego-Fullbright, Christen; Jim, Patricia; Granato, Paul A; Faron, Matthew L; Cumpio, Joven; Buchan, Blake W; Procop, Gary W

2017-06-01

A report on the multicenter evaluation of the Bruker MALDI Biotyper CA System (MBT-CA; Bruker Daltonics, Billerica, MA) for the identification of clinically important bacteria and yeasts. In total, 4,399 isolates of medically important bacteria and yeasts were assessed in the MBT-CA. These included 2,262 aerobic gram-positive (AGP) bacteria, 792 aerobic gram-negative (AGN) bacteria 530 anaerobic (AnA) bacteria, and 815 yeasts (YSTs). Three processing methods were assesed. Overall, 98.4% (4,329/4,399) of all bacterial and yeast isolates were correctly identified to the genus and species/species complex level, and 95.7% of isolates were identified with a high degree of confidence. The percentage correctly identified and the percentage identified correctly with a high level of confidence, respectively, were as follows: AGP bacteria (98.6%/96.5%), AGN bacteria (98.5%/96.8%), AnA bacteria (98.5%/97.4%), and YSTs (97.8%/87.6%). The extended direct transfer method was only minimally superior to the direct transfer method for bacteria (89.9% vs 86.8%, respectively) but significantly superior for yeast isolates (74.0% vs 48.9%, respectively). The Bruker MALDI Biotyper CA System accurately identifies most clinically important bacteria and yeasts and has optional processing methods to improve isolate characterization. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Yeast as a model system for mammalian seven-transmembrane segment receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeansonne, N.E.

1994-05-01

Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomalmore » location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.« less

Construction of a recombinant wine yeast strain expressing beta-(1,4)-endoglucanase and its use in microvinification processes.

PubMed Central

Pérez-González, J A; González, R; Querol, A; Sendra, J; Ramón, D

1993-01-01

A genetic transformation system for an industrial wine yeast strain is presented here. The system is based on the acquisition of cycloheximide resistance and is a direct adaptation of a previously published procedure for brewing yeasts (L. Del Pozo, D. Abarca, M. G. Claros, and A. Jiménez, Curr. Genet. 19:353-358, 1991). Transformants arose at an optimal frequency of 0.5 transformant per microgram of DNA, are stable in the absence of selective pressure, and produce wine in the same way as the untransformed industrial strain. By using this transformation protocol, a filamentous fungal beta-(1,4)-endoglucanase gene has been expressed in an industrial wine yeast under the control of the yeast actin gene promoter. Endoglucanolytic wine yeast secretes the fungal enzyme to the must, producing a wine with an increased fruity aroma. Images PMID:8215355

Evolutionary History of Ascomyceteous Yeasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haridas, Sajeet; Riley, Robert; Salamov, Asaf

2014-06-06

Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with amore » large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.« less

Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

PubMed

Duina, Andrea A; Miller, Mary E; Keeney, Jill B

2014-05-01

The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.