Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

PubMed

Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

2014-10-17

RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

Complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus).

PubMed

Li, Linmiao; Li, Min; Wu, Zhengjun; Chen, Jinping

2015-01-01

We have characterized the complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus) and described its organization in this study. The total length of C. sphinx complete mitochondrial genome was 16,895 bp with the base composition of 32.54% A, 14.05% G, 25.82% T and 27.59% C. The complete mitochondrial genome included 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA) and 1 control region (D-loop). The control region was 1435 bp long with the sequence CATACG repeat 64 times. Three protein-coding genes (ND1, COI and ND4) were ended with incomplete stop codon TA or T.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

PubMed Central

Ryals, J; Little, R; Bremer, H

1982-01-01

The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

PubMed

Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

2017-12-05

Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

Influence of the stringent control system on the transcription of ribosomal ribonucleic acid and ribosomal protein genes in Escherichia coli.

PubMed Central

Dennis, P P

1977-01-01

The fraction of the total ribonucleic acid (RNA) synthesis rate that is messenger RNA (mRNA) for ribosomal protein (r-protein) and ribosomal RNA (rRNA) has been estimated in valS(Ts) rel+ stringent and valS(Ts) relA1 relaxed strains of Escherichia coli during a partial inhibition of valyl-transfer RNA aminoacylation. The partial inhibition was accomplished by shifting the strains from the permissive growth temperature of 29.5 degrees C to the semipermissive temperature of 35.5 degrees C. The RNA synthesized at the elevated temperature was pulse labeled with [3H]uracil. The fraction of the total incorpoarted 3H radioactivity in r-protein mRNA or in rRNA was estimated by specific hybridization to the transducing phages gammaspc1, which carries about 15 r-protein genes and lambdailv5, which carries an rRNA transcription unit. The results clearly demonstrate that the rel gene influences the fraction of the total RNA synthesis rate that is r protein mRNA and rRNA; in the rel+ strain they are significantly increased relative to control cultures. This indicates that the expression of the genes coding for the RNA and protein component of the ribosome are most likely regulated at the level of transcription. Furthermore, it appears that the distribution of functioning RNA polymerase between rRNA genes, r-protein genes, and other types of genes is influenced by the rel gene control system; presumably this influence is mediated through the unusual nucleotide guanosine tetraphosphate. PMID:320185

Hybrid-denovo: a de novo OTU-picking pipeline integrating single-end and paired-end 16S sequence tags.

PubMed

Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun

2018-03-01

Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.

The complete mitochondrial genome of Chrysopa pallens (Insecta, Neuroptera, Chrysopidae).

PubMed

He, Kun; Chen, Zhe; Yu, Dan-Na; Zhang, Jia-Yong

2012-10-01

The complete mitochondrial genome of Chrysopa pallens (Neuroptera, Chrysopidae) was sequenced. It consists of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA (rRNA) genes, and a control region (AT-rich region). The total length of C. pallens mitogenome is 16,723 bp with 79.5% AT content, and the length of control region is 1905 bp with 89.1% AT content. The non-coding regions of C. pallens include control region between 12S rRNA and trnI genes, and a 75-bp space region between trnI and trnQ genes.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characteristics of complete mitogenome of the lesser short-nosed fruit bat Cynopterus brachyotis (Chiroptera: Pteropodidae) in Malaysia.

PubMed

Yoon, Kwang Bae; Kim, Ji Young; Park, Yung Chul

2016-05-01

We describe the characteristics of complete mitogenome of C. brachyotis in this article. The complete mitogenome of C. brachyotis is 16,701 bp long with a total base composition of 32.4% A, 25.7% T, 27.7% C and 14.2% G. The mitogenome consists of 13 protein-coding genes (11,408 bp), (KM659865) two rRNA (12S rRNA and 16S rRNA) genes (2,539 bp), 22 tRNA genes (1518 bp) and one control region (1239 bp).

Response of estuarine biofilm microbial community development to changes in dissolved oxygen and nutrient concentrations.

PubMed

Nocker, Andreas; Lepo, Joe Eugene; Martin, Linda Lin; Snyder, Richard Allan

2007-10-01

The information content and responsiveness of microbial biofilm community structure, as an integrative indicator of water quality, was assessed against short-term changes in oxygen and nutrient loading in an open-water estuarine setting. Biofilms were grown for 7-day periods on artificial substrates in the Pensacola Bay estuary, Florida, in the vicinity of a wastewater treatment plant (WWTP) outfall and a nearby reference site. Substrates were deployed floating at the surface and near the benthos in 5.4 m of water. Three sampling events covered a 1-month period coincident with declining seasonal WWTP flow and increasing dissolved oxygen (DO) levels in the bottom waters. Biomass accumulation in benthic biofilms appeared to be controlled by oxygen rather than nutrients. The overriding effect of DO was also seen in DNA fingerprints of community structure by terminal restriction fragment length polymorphism (T-RFLP) of amplified 16S rRNA genes. Ribotype diversity in benthic biofilms at both sites dramatically increased during the transition from hypoxic to normoxic. Terminal restriction fragment length polymorphism patterns showed pronounced differences between benthic and surface biofilm communities from the same site in terms of signal type, strength, and diversity, but minor differences between sites. Sequencing of 16S rRNA gene clone libraries from benthic biofilms at the WWTP site suggested that low DO levels favored sulfate-reducing prokaryotes (SRP), which decreased with rising oxygen levels and increasing overall diversity. A 91-bp ribotype in the CfoI-restricted 16S rRNA gene T-RFLP profiles, indicative of SRP, tracked the decrease in relative SRP abundance over time.

Ribosomal RNA maturation in Schizosaccharomyces pombe is dependent on a large ribonucleoprotein complex of the internal transcribed spacer 1.

PubMed

Lalev, A I; Abeyrathne, P D; Nazar, R N

2000-09-08

The interdependency of steps in the processing of pre-rRNA in Schizosaccharomyces pombe suggests that RNA processing, at least in part, acts as a quality control mechanism which helps assure that only functional RNA is incorporated into mature ribosomes. To determine further the role of the transcribed spacer regions in rRNA processing and to detect interactions which underlie the interdependencies, the ITS1 sequence was examined for its ability to form ribonucleoprotein complexes with cellular proteins. When incubated with protein extract, the spacer formed a specific large RNP. This complex was stable to fractionation by agarose or polyacrylamide gel electrophoresis. Modification exclusion analyses indicated that the proteins interact with a helical domain which is conserved in the internal transcribed spacers. Mutagenic analyses confirmed an interaction with this sequence and indicated that this domain is critical to the efficient maturation of the precursor RNA. The protein constituents, purified by affinity chromatography using the ITS1 sequence, retained an ability to form stable RNP. Protein analyses of gel purified complex, prepared with affinity-purified proteins, indicated at least 20 protein components ranging in size from 20-200 kDa. Peptide mapping by Maldi-Toff mass spectroscopy identified eight hypothetical RNA binding proteins which included four different RNA-binding motifs. Another protein was putatively identified as a pseudouridylate synthase. Additional RNA constituents were not detected. The significance of this complex with respect to rRNA maturation and interdependence in rRNA processing is discussed. Copyright 2000 Academic Press.

Ribosomal RNA and ribosomal proteins in corynebacteria.

PubMed

Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

2003-09-04

Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

PubMed

Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

2018-05-03

The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

CHARACTERIZATION OF PRECURSOR 165 RRNA FOR AEROMONAS HYDROPHILA

EPA Science Inventory

Current strategies for monitoring drinking water quality involve culture-based methods to detect the presence of microbial indicators. However, these methods are insensitive when the organisms have undergone physiological changes such as injury and starvation that can occur in h...

Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

PubMed

Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

2015-06-01

Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation between spliced rRNA expression levels, possibly due to changes in rRNA processing, which requires further investigation.

CHARACTERIZATION OF PRECURSOR FOR 16S rRNA FOR AEROMONAS HYDROPHILA

EPA Science Inventory

Current strategies for monitoring drinking water quality involve culture-based methods to detect the presence of microbial indicators. However, these methods are insensitive when the organisms have undergone physiological changes such as injury and starvation that can occur in h...

A rapid and efficient SDS-based RNA isolation protocol from different tissues of coffee.

PubMed

Huded, Arun Kumar C; Jingade, Pavankumar; Mishra, Manoj Kumar

2018-03-01

Isolation of high-quality RNA from coffee is challenging because of high level of polysaccharides, polyphenols and other secondary metabolites. In the present study, a rapid and efficient RNA extraction protocol from different tissues of coffee was optimized. Sufficiently high quality and quantity (225.6-454.8 µg/g) of RNA was obtained by using the optimized protocol. The presence of two distinct bands of 28S rRNA and 18S rRNA in agarose gel proved the intactness of the RNA samples. The average spectrophotometric values of the isolated RNA ranged from 1.96 to 2.02 ( A 260/280 ) and 1.95 to 2.14 ( A 260/230 ), indicating the high quality of RNA devoid of polyphenols, polysaccharides and protein contamination. In the optimized protocol, addition of PVPP to the extraction buffer and a brief incubation of samples at 65 °C and subsequent purification with potassium acetate resulted in good-quality RNA isolation. The suitability of RNA for downstream processing was confirmed by PCR amplification with cytochrome c oxidase gene-specific primers. The amplification of a single 392 bp fragment using cDNA and 1.5 kb fragment using genomic DNA samples confirmed the absence of DNA contamination. The present protocol is rapid and yielded good quality and quantity of RNA suitable for functional genomics studies.

Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

PubMed

Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

2008-01-15

The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

PubMed

Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

2018-06-27

All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)

NASA Astrophysics Data System (ADS)

Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina

2014-09-01

Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.

The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

PubMed Central

Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

2013-01-01

Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

Phylogenetic analyses of bacteria associated with the processing of iru and ogiri condiments.

PubMed

Ademola, Oluwatoyin M; Adeyemi, Taiwo E; Ezeokoli, Obinna T; Ayeni, Kolawole I; Obadina, Adewale O; Somorin, Yinka M; Omemu, Adebukola M; Adeleke, Rasheed A; Nwangburuka, Cyril C; Oluwafemi, Flora; Oyewole, Olusola B; Ezekiel, Chibundu N

2018-06-27

Analysis of the bacterial community dynamics during the production of traditional fermented condiments is important for food safety assessment, quality control and development of starter culture technology. In this study, bacteria isolated during the processing of iru and ogiri, two commonly consumed condiments in Nigeria, were characterised based on phylogenetic analyses of the bacterial 16S rRNA gene. A total of 227 isolates were obtained and clustered into 12 operational taxonomic units (OTUs) based on 97% 16S rRNA gene similarity. The OTUs spanned three phyla (Firmicutes, Actinobacteria and Proteobacteria), and nine genera: Acinetobacter, Aerococcus, Bacillus, Enterococcus, Enterobacter, Lysinibacillus, Micrococcus, Proteus and Staphylococcus. OTUs closely related to species of Bacillus dominated the processing stages of both condiments. Although no single OTU occurred throughout iru processing stages, an OTU (mostly related to B. safensis) dominated the ogiri processing stages indicating potentials for the development of starter culture. However, other isolates such as those of Enterococcus spp. and Lysinibacillus spp. may be potential starters for iru fermentation. Presumptive foodborne pathogens were also detected at some stages of the condiments' processing, possibly due to poor hygienic practices. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station

NASA Technical Reports Server (NTRS)

Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri

2005-01-01

Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

Cancer.gov

Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

Complete mitochondrial genome of a wild Siberian tiger.

PubMed

Sun, Yujiao; Lu, Taofeng; Sun, Zhaohui; Guan, Weijun; Liu, Zhensheng; Teng, Liwei; Wang, Shuo; Ma, Yuehui

2015-01-01

In this study, the complete mitochondrial genome of Siberian tiger (Panthera tigris altaica) was sequenced, using muscle tissue obtained from a male wild tiger. The total length of the mitochondrial genome is 16,996 bp. The genome structure of this tiger is in accordance with other Siberian tigers and it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes, and 1 control region.

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

Development and Evaluation of a Quantitative PCR Assay Targeting Sandhill Crane (Grus canadensis) Fecal Pollution

EPA Science Inventory

While the microbial water quality in the Platte River is seasonally impacted by excreta from migrating cranes, there are no methods available to study crane fecal contamination. Here we characterized microbial populations in crane feces using phylogenetic analysis of 16S rRNA gen...

Drinking Water Microbiome as a Screening Tool for Nitrification in Chloraminated Drinking Water Distribution Systems (abstract)

EPA Science Inventory

Many water utilities in the US using chloramine as disinfectant treatment in their distribution systems have experienced nitrification episodes, which detrimentally impact the water quality. Here, we used 16S rRNA sequencing data to generate high-resolution taxonomic profiles of...

A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

PubMed

Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

2010-05-01

To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

Bacterial flora analysis of coliforms in sewage, river water, and ground water using MALDI-TOF mass spectrometry.

PubMed

Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi

2018-01-28

The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.

Active fungi amidst a marine subsurface RNA paleome

NASA Astrophysics Data System (ADS)

Orsi, W.; Biddle, J.; Edgcomb, V.

2012-12-01

The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Since extracellular DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA signatures by amplicon pyrosequencing, metazoan, plant, and diatom rRNA signatures were recovered from marine sediments up to 2.7 million years old, suggesting that rRNA may be much more stable than previously considered in the marine subsurface. This finding confirms the concept of a paleome, extending it to include rRNA. Within the same dataset, unique profiles of fungi were found across a range of marine subsurface provinces exhibiting statistically significant correlations with total organic carbon (TOC), sulfide, and dissolved inorganic carbon (DIC). Sequences from metazoans, plants and diatoms showed different correlation patterns, consistent with a depth-controlled paleome. The fungal correlations with geochemistry allow the inference that some fungi are active and adapted for survival in the marine subsurface. A metatranscriptomic analysis of fungal derived mRNA confirms that fungi are metabolically active and utilize a range of organic and inorganic substrates in the marine subsurface.

Optimizing preservation protocols to extract high-quality RNA from different tissues of echinoderms for next-generation sequencing.

PubMed

Pérez-Portela, Rocío; Riesgo, Ana

2013-09-01

Transcriptomic information provides fundamental insights into biological processes. Extraction of quality RNA is a challenging step, and preservation and extraction protocols need to be adjusted in many cases. Our objectives were to optimize preservation protocols for isolation of high-quality RNA from diverse echinoderm tissues and to compare the utility of parameters as absorbance ratios and RIN values to assess RNA quality. Three different tissues (gonad, oesophagus and coelomocytes) were selected from the sea urchin Arbacia lixula. Solid tissues were flash-frozen and stored at -80 °C until processed. Four preservation treatments were applied to coelomocytes: flash freezing and storage at -80 °C, RNAlater and storage at -20 °C, preservation in TRIzol reagent and storage at -80 °C and direct extraction with TRIzol from fresh cells. Extractions of total RNA were performed with a modified TRIzol protocol for all tissues. Our results showed high values of RNA quantity and quality for all tissues, showing nonsignificant differences among them. However, while flash freezing was effective for solid tissues, it was inadequate for coelomocytes because of the low quality of the RNA extractions. Coelomocytes preserved in RNAlater displayed large variability in RNA integrity and insufficient RNA amount for further isolation of mRNA. TRIzol was the most efficient system for stabilizing RNA which resulted on high RNA quality and quantity. We did not detect correlation between absorbance ratios and RNA integrity. The best strategies for assessing RNA integrity was the visualization of 18S rRNA and 28S rRNA bands in agarose gels and estimation of RIN values with Agilent Bioanalyzer chips. © 2013 John Wiley & Sons Ltd.

The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

PubMed

Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2016-01-01

In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

PubMed

Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

2013-01-01

Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

Electrokinetic Stringency Control in Self-Assembled Monolayer-based Biosensors for Multiplex Urinary Tract Infection Diagnosis

PubMed Central

Liu, Tingting; Sin, Mandy L. Y.; Pyne, Jeff D.; Gau, Vincent; Liao, Joseph C.; Wong, Pak Kin

2013-01-01

Rapid detection of bacterial pathogens is critical toward judicious management of infectious diseases. Herein, we demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis. The in situ electrokinetic stringency control technique generates Joule heating induced temperature rise and electrothermal fluid motion directly on the sensor to improve its performance for detecting bacterial 16S rRNA, a phylogenetic biomarker. The dependence of the hybridization efficiency reveals that in situ electrokinetic stringency control is capable of discriminating single-base mismatches. With electrokinetic stringency control, the background noise due to the matrix effects of clinical urine samples can be reduced by 60%. The applicability of the system is demonstrated by multiplex detection of three uropathogenic clinical isolates with similar 16S rRNA sequences. The results demonstrate that electrokinetic stringency control can significantly improve the signal-to-noise ratio of the biosensor for multiplex urinary tract infection diagnosis. PMID:23891989

Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

PubMed

Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

2005-06-01

We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

Archaeal community diversity and abundance changes along a natural salinity gradient in estuarine sediments

PubMed Central

Webster, Gordon; O'Sullivan, Louise A.; Meng, Yiyu; Williams, Angharad S.; Sass, Andrea M.; Watkins, Andrew J.; Parkes, R. John; Weightman, Andrew J.

2014-01-01

Archaea are widespread in marine sediments, but their occurrence and relationship with natural salinity gradients in estuarine sediments is not well understood. This study investigated the abundance and diversity of Archaea in sediments at three sites [Brightlingsea (BR), Alresford (AR) and Hythe (HY)] along the Colne Estuary, using quantitative real-time PCR (qPCR) of 16S rRNA genes, DNA hybridization, Archaea 16S rRNA and mcrA gene phylogenetic analyses. Total archaeal 16S rRNA abundance in sediments were higher in the low-salinity brackish sediments from HY (2–8 × 107 16S rRNA gene copies cm−3) than the high-salinity marine sites from BR and AR (2 × 104–2 × 107 and 4 × 106–2 × 107 16S rRNA gene copies cm−3, respectively), although as a proportion of the total prokaryotes Archaea were higher at BR than at AR or HY. Phylogenetic analysis showed that members of the ‘Bathyarchaeota’ (MCG), Thaumarchaeota and methanogenic Euryarchaeota were the dominant groups of Archaea. The composition of Thaumarchaeota varied with salinity, as only ‘marine’ group I.1a was present in marine sediments (BR). Methanogen 16S rRNA genes from low-salinity sediments at HY were dominated by acetotrophic Methanosaeta and putatively hydrogentrophic Methanomicrobiales, whereas the marine site (BR) was dominated by mcrA genes belonging to methylotrophic Methanococcoides, versatile Methanosarcina and methanotrophic ANME-2a. Overall, the results indicate that salinity and associated factors play a role in controlling diversity and distribution of Archaea in estuarine sediments. PMID:25764553

Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

PubMed

Pegels, N; González, I; Fernández, S; García, T; Martín, R

2012-01-01

A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

PubMed

Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

2012-01-01

In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira.

PubMed

Carrillo-Casas, Erika Margarita; Hernández-Castro, Rigoberto; Suárez-Güemes, Francisco; de la Peña-Moctezuma, Alejandro

2008-06-01

Analysis of gene expression requires sensitive, precise, and reproducible measurements for specific mRNA sequences. To avoid bias, real-time RT-PCR is referred to one or several internal control genes. Here, we sought to identify a gene to be used as normalizer by analyzing three functional distinct housekeeping genes (lipL41, flaB, and 16S rRNA) for their expression level and stability in temperature treated Leptospira cultures. Leptospira interrogans serovar Hardjo subtype Hardjoprajitno was cultured at 30 degrees C for 7 days until a density of 10(6) cells/ml was reached and then shifted to physiological temperatures (37 degrees C and 42 degrees C) and to environmental temperatures (25 degrees C and 30 degrees C) during a 24 h period. cDNA was amplified by quantitative PCR using SYBR Green I technology and gene-specific primers for lipL41, flaB, and 16S rRNA. Expression stability (M) was assessed by geNorm and Normfinder v.18. 16S rRNA registered an average expression stability of M = 1.1816, followed by flaB (M = 1.682) and lipL41 (M = 1.763). 16S rRNA was identified as the most stable gene and can be used as a normalizer, as it showed greater expression stability than lipL41 and flaB in the four temperature treatments. Hence, comparisons of gene expression will have a higher sensitivity and specificity.

Illuminating Anaerobic Microbial Community and Cooccurrence Patterns across a Quality Gradient in Chinese Liquor Fermentation Pit Muds

PubMed Central

Hu, Xiaolong; Du, Hai; Ren, Cong

2016-01-01

Fermentation pit mud, an important reservoir of diverse anaerobic microorganisms, is essential for Chinese strong-aroma liquor production. Pit mud quality, according to its sensory characteristics, can be divided into three grades: degraded, normal, and high quality. However, the relationship between pit mud microbial community and pit mud quality is poorly understood, as are microbial associations within the pit mud ecosystem. Here, microbial communities at these grades were compared using Illumina MiSeq sequencing of the variable region V4 of the 16S rRNA gene. Our results revealed that the pit mud microbial community was correlated with its quality and environmental factors. Species richness, biodiversity, and relative and/or absolute abundances of Clostridia, Clostridium kluyveri, Bacteroidia, and Methanobacteria significantly increased, with corresponding increases in levels of pH, NH4+, and available phosphorus, from degraded to high-quality pit muds, while levels of Lactobacillus, dissolved organic carbon, and lactate significantly decreased, with normal samples in between. Furthermore, 271 pairs of significant and robust correlations (cooccurrence and negative) were identified from 76 genera using network analysis. Thirteen hubs of cooccurrence patterns, mainly under the Clostridia, Bacteroidia, Methanobacteria, and Methanomicrobia, may play important roles in pit mud ecosystem stability, which may be destroyed with rapidly increased levels of lactic acid bacteria (Lactobacillus, Pediococcus, and Streptococcus). This study may help clarify the relationships among microbial community, environmental conditions, and pit mud quality, allow the improvement of pit mud quality by using bioaugmentation and controlling environmental factors, and shed more light on the ecological rules guiding community assembly in pit mud. PMID:26896127

A BASIN-WIDE ANALYSIS OF THE DYNAMICS OF FECAL CONTAMINATION AND FECAL SOURCE IDENTIFICATION IN TILLAMOOK BAY, OREGON

EPA Science Inventory

The objectives of this study were to determine if spatial and temporal dynamics exist in source-specific Bacteroidales 16S rRNA genetic marker data across a watershed, to study these in relation to fecal indicator counts, general measurements of water quality, and climat...

Deep 16S rRNA Pyrosequencing Reveals a Bacterial Community Associated with Banana Fusarium Wilt Disease Suppression Induced by Bio-Organic Fertilizer Application

PubMed Central

Ruan, Yunze; Xue, Chao; Zhang, Jian; Li, Rong; Shen, Qirong

2014-01-01

Our previous work demonstrated that application of a bio-organic fertilizer (BIO) to a banana mono-culture orchard with serious Fusarium wilt disease effectively decreased the number of soil Fusarium sp. and controlled the soil-borne disease. Because bacteria are an abundant and diverse group of soil organisms that responds to soil health, deep 16 S rRNA pyrosequencing was employed to characterize the composition of the bacterial community to investigate how it responded to BIO or the application of other common composts and to explore the potential correlation between bacterial community, BIO application and Fusarium wilt disease suppression. After basal quality control, 137,646 sequences and 9,388 operational taxonomic units (OTUs) were obtained from the 15 soil samples. Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria were the most frequent phyla and comprised up to 75.3% of the total sequences. Compared to the other soil samples, BIO-treated soil revealed higher abundances of Gemmatimonadetes and Acidobacteria, while Bacteroidetes were found in lower abundance. Meanwhile, on genus level, higher abundances compared to other treatments were observed for Gemmatimonas and Gp4. Correlation and redundancy analysis showed that the abundance of Gemmatimonas and Sphingomonas and the soil total nitrogen and ammonium nitrogen content were higher after BIO application, and they were all positively correlated with disease suppression. Cumulatively, the reduced Fusarium wilt disease incidence that was seen after BIO was applied for 1-year might be attributed to the general suppression based on a shift within the bacteria soil community, including specific enrichment of Gemmatimonas and Sphingomonas. PMID:24871319

Response of Bacterial Communities to Different Detritus Compositions in Arctic Deep-Sea Sediments.

PubMed

Hoffmann, Katy; Hassenrück, Christiane; Salman-Carvalho, Verena; Holtappels, Moritz; Bienhold, Christina

2017-01-01

Benthic deep-sea communities are largely dependent on particle flux from surface waters. In the Arctic Ocean, environmental changes occur more rapidly than in other ocean regions, and have major effects on the export of organic matter to the deep sea. Because bacteria constitute the majority of deep-sea benthic biomass and influence global element cycles, it is important to better understand how changes in organic matter input will affect bacterial communities at the Arctic seafloor. In a multidisciplinary ex situ experiment, benthic bacterial deep-sea communities from the Long-Term Ecological Research Observatory HAUSGARTEN were supplemented with different types of habitat-related detritus (chitin, Arctic algae) and incubated for 23 days under in situ conditions. Chitin addition caused strong changes in community activity, while community structure remained similar to unfed control incubations. In contrast, the addition of phytodetritus resulted in strong changes in community composition, accompanied by increased community activity, indicating the need for adaptation in these treatments. High-throughput sequencing of the 16S rRNA gene and 16S rRNA revealed distinct taxonomic groups of potentially fast-growing, opportunistic bacteria in the different detritus treatments. Compared to the unfed control, Colwelliaceae, Psychromonadaceae , and Oceanospirillaceae increased in relative abundance in the chitin treatment, whereas Flavobacteriaceae, Marinilabiaceae , and Pseudoalteromonadaceae increased in the phytodetritus treatments. Hence, these groups may constitute indicator taxa for the different organic matter sources at this study site. In summary, differences in community structure and in the uptake and remineralization of carbon in the different treatments suggest an effect of organic matter quality on bacterial diversity as well as on carbon turnover at the seafloor, an important feedback mechanism to be considered in future climate change scenarios.

Response of Bacterial Communities to Different Detritus Compositions in Arctic Deep-Sea Sediments

PubMed Central

Hoffmann, Katy; Hassenrück, Christiane; Salman-Carvalho, Verena; Holtappels, Moritz; Bienhold, Christina

2017-01-01

Benthic deep-sea communities are largely dependent on particle flux from surface waters. In the Arctic Ocean, environmental changes occur more rapidly than in other ocean regions, and have major effects on the export of organic matter to the deep sea. Because bacteria constitute the majority of deep-sea benthic biomass and influence global element cycles, it is important to better understand how changes in organic matter input will affect bacterial communities at the Arctic seafloor. In a multidisciplinary ex situ experiment, benthic bacterial deep-sea communities from the Long-Term Ecological Research Observatory HAUSGARTEN were supplemented with different types of habitat-related detritus (chitin, Arctic algae) and incubated for 23 days under in situ conditions. Chitin addition caused strong changes in community activity, while community structure remained similar to unfed control incubations. In contrast, the addition of phytodetritus resulted in strong changes in community composition, accompanied by increased community activity, indicating the need for adaptation in these treatments. High-throughput sequencing of the 16S rRNA gene and 16S rRNA revealed distinct taxonomic groups of potentially fast-growing, opportunistic bacteria in the different detritus treatments. Compared to the unfed control, Colwelliaceae, Psychromonadaceae, and Oceanospirillaceae increased in relative abundance in the chitin treatment, whereas Flavobacteriaceae, Marinilabiaceae, and Pseudoalteromonadaceae increased in the phytodetritus treatments. Hence, these groups may constitute indicator taxa for the different organic matter sources at this study site. In summary, differences in community structure and in the uptake and remineralization of carbon in the different treatments suggest an effect of organic matter quality on bacterial diversity as well as on carbon turnover at the seafloor, an important feedback mechanism to be considered in future climate change scenarios. PMID:28286496

A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA

PubMed Central

Brehm, Maria A.; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W.; Shears, Stephen B.

2013-01-01

Summary Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K ‘moonlights’ as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number. PMID:23203802

A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA.

PubMed

Brehm, Maria A; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W; Shears, Stephen B

2013-01-15

Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K 'moonlights' as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number.

Archaeal community diversity and abundance changes along a natural salinity gradient in estuarine sediments.

PubMed

Webster, Gordon; O'Sullivan, Louise A; Meng, Yiyu; Williams, Angharad S; Sass, Andrea M; Watkins, Andrew J; Parkes, R John; Weightman, Andrew J

2015-02-01

Archaea are widespread in marine sediments, but their occurrence and relationship with natural salinity gradients in estuarine sediments is not well understood. This study investigated the abundance and diversity of Archaea in sediments at three sites [Brightlingsea (BR), Alresford (AR) and Hythe (HY)] along the Colne Estuary, using quantitative real-time PCR (qPCR) of 16S rRNA genes, DNA hybridization, Archaea 16S rRNA and mcrA gene phylogenetic analyses. Total archaeal 16S rRNA abundance in sediments were higher in the low-salinity brackish sediments from HY (2-8 × 10(7) 16S rRNA gene copies cm(-3)) than the high-salinity marine sites from BR and AR (2 × 10(4)-2 × 10(7) and 4 × 10(6)-2 × 10(7) 16S rRNA gene copies cm(-3), respectively), although as a proportion of the total prokaryotes Archaea were higher at BR than at AR or HY. Phylogenetic analysis showed that members of the 'Bathyarchaeota' (MCG), Thaumarchaeota and methanogenic Euryarchaeota were the dominant groups of Archaea. The composition of Thaumarchaeota varied with salinity, as only 'marine' group I.1a was present in marine sediments (BR). Methanogen 16S rRNA genes from low-salinity sediments at HY were dominated by acetotrophic Methanosaeta and putatively hydrogentrophic Methanomicrobiales, whereas the marine site (BR) was dominated by mcrA genes belonging to methylotrophic Methanococcoides, versatile Methanosarcina and methanotrophic ANME-2a. Overall, the results indicate that salinity and associated factors play a role in controlling diversity and distribution of Archaea in estuarine sediments. © The Author 2014. Published by Oxford University Press on behalf of Federation of European Microbiological Society.

Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

PubMed

Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

2014-01-01

Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

PubMed Central

Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

2016-01-01

ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

PubMed

Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

2002-10-15

Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

Validation of housekeeping genes as internal controls for studying gene expression during Pacific oyster (Crassostrea gigas) development by quantitative real-time PCR.

PubMed

Du, Yishuai; Zhang, Linlin; Xu, Fei; Huang, Baoyu; Zhang, Guofan; Li, Li

2013-03-01

Hatchery-reared larvae of the Pacific oyster (Crassostrea gigas) often suffer from massive mortality induced by Ostreid herpesvirus 1 (OsHV-1) infection, indicating the importance of better understanding of oyster immune defense systems. The accuracy of measurements of gene expression levels based on quantitative real-time PCR assays relies on the use of housekeeping genes as internal controls; however, few studies have focused on the selection of such internal controls. In this study, we conducted a comprehensive investigation of internal control genes during oyster development in virus-infected and uninfected samples. Transcriptome data for 38 developmental stages were downloaded and the gene expression patterns were classified into 30 clusters. A total of 317 orthologs of classical housekeeping genes in the oyster genome were annotated. After combining the expression profiles and oyster housekeeping gene dataset, 14 candidate internal controls were selected for further investigation: Elongation factor-1α (EF-1α), 18S rRNA (18S), 28S rRNA (28S), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), β-actin (ACT), Ribosomal protein L7 (RL7), Ribosomal protein L27 (RL27), Ribosomal protein L36 (RL36), Ribosomal protein S18 (RS18), Heterogeneous nuclear ribonucleoprotein A2/B1 (RO21), Eukaryotic translation elongation factor 2 (EF2), Ubiquitin-conjugating enzyme E2D2 (UBCD1), S-phase kinase-associated protein 1 (SKP1) and Heterogeneous nuclear ribonucleoprotein Q (HNRPQ). RNA was extracted from oyster larvae infected with OsHV-1 (group A; GA), and OsHV-1 free larvae (group B; GB). The expression levels of the 14 candidate internal controls were studied in GA and GB larvae by real-time PCR. Their expression stabilities were further analyzed using the GeNorm program. RL7 and RS18 were the most stable genes in both OsHV-1 infected (GA) and uninfected (GB) larvae. These results suggest that RL7 and RS18 could be used as internal controls for studying gene expression in normal growing oyster larvae and in OsHV-1 infected larvae. These high quality internal controls will be a valuable resource in future studies of oyster larval mortality. Copyright © 2012 Elsevier Ltd. All rights reserved.

Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

NASA Astrophysics Data System (ADS)

MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

2012-12-01

Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal flow. There was no consistent isotopic difference between rRNAs captured by the two probes, although RNA recoveries were too low for isotopic determinations at depths where methanogens and methane oxidizers are expected. Our prediction that rRNA stable carbon isotopic composition would correlate with methane supply was borne out by the comparison between background and mat sediments, but may be an oversimplification for sites within hydrothermal features. Future work will include the isotopic characterization of other potential carbon substrates, such as acetate. We are also investigating cold-seep sediments and brine pools in the Gulf of Mexico, where methane is significantly more 13C-depleted than at Guaymas Basin and may therefore leave a stronger imprint on microbial biomass.table carbon isotopes of rRNA captured with Bacterial and Archaeal probes at mat transect and background sites.

Diagnosis and follow-up of Whipple's disease by amplification of the 16S rRNA gene of Tropheryma whippelii.

PubMed

Pron, B; Poyart, C; Abachin, E; Fest, T; Belanger, C; Bonnet, C; Capelle, P; Bretagne, J F; Fabianek, A; Girard, L; Hagège, H; Berche, P

1999-01-01

Amplification of the 16S rRNA gene of Tropheryma whippelii was performed in eight patients with Whipple's disease and 34 control patients to confirm a diagnosis of Whipple's disease and to monitor the course of disease. Polymerase chain reaction (PCR) tests were positive before treatment in 13 of 15 tissue samples from Whipple's disease patients (gut 8/8; lymph nodes 2/2; bone marrow 1/2; peripheral blood 2/3), in contrast to none of 54 tissue samples from controls. PCR tests converted to negative within 4-6 months in six of the Whipple's disease patients undergoing therapy. These results show that PCR is a reliable and useful tool for diagnosis of Whipple's disease and for monitoring bacterial elimination during antibiotic therapy.

Determining Fungi rRNA Copy Number by PCR

EPA Science Inventory

The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within ...

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

Characterization of the fecal microbiome in different swine groups by high-throughput sequencing.

PubMed

Park, Soo-Je; Kim, Jinu; Lee, Jong-Soo; Rhee, Sung-Keun; Kim, Hongik

2014-08-01

Swine have a complex microbial community within their gastrointestinal tract that plays a critical role in both health and disease. High-throughput 16S rRNA gene-based pyrosequencing was used to identify the possible core microorganisms in the gut of swine groups that differ in meat quality and weight grades (level 1 as higher meat quality and level 2 as lower meat quality). Samples were taken from the rectum and/or stool from ten animals, DNA was extracted, and the V1-V3 regions of the 16S rRNA gene were amplified. Two bacterial populations (Bacteroidetes and Firmicutes) dominated and were shared between the two groups. Significant differences between the groups were found at the genus level. The genera Lactobacillus and Oscillibacter were found in slightly higher proportions in the level 2 group (12.6 and 12.4% of the classified reads, respectively) than those of level 1 (9.6 and 7.7%, respectively). By contrast, the proportion of reads assigned to the genus Roseburia in the level 1 group (13.0%) was higher than that of level 2 (4.8%). The largest differences were related to the genera Clostridium, Oscillibacter, and Roseburia as core microorganisms. Moreover, two genera, Roseburia and Clostridium, related to level 1 produced linoleic acid or short chain fatty acids that might contribute to swine health and development. In conclusion, the presence of core bacteria in the swine gut is associated with meat quality with reduced body fat in swine. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genotypic and phenotypic diversity of Alicyclobacillus acidocaldarius isolates.

PubMed

Félix-Valenzuela, L; Guardiola-Avila, I; Burgara-Estrella, A; Ibarra-Zavala, M; Mata-Haro, V

2015-10-01

The fruit juice industry recognizes Alicyclobacillus as a major quality control target micro-organism. In this study, we analysed 19 bacterial isolates to identify Alicyclobacillus species by polymerase chain reaction (PCR) and sequencing analyses. Phenotypic and genomic diversity among isolates were investigated by API 50CHB system and ERIC-PCR (enterobacterial repetitive intergenic consensus-PCR) respectively. All bacterial isolates were identified as Alicyclobacillus acidocaldarius, and almost all showed identical DNA sequences according to their 16S rRNA (rDNA) gene partial sequences. Only few carbohydrates were fermented by A. acidocaldarius isolates, and there was little variability in the biochemical profile. Genotypic fingerprinting of the A. acidocaldarius isolates showed high diversity, and clusters by ERIC-PCR were distinct to those obtained from the 16S rRNA gene phylogenetic tree. There was no correlation between phenotypic and genotypic variability in the A. acidocaldarius isolates analysed in this study. Detection of Alicyclobacillus strains is imperative in fruit concentrates and juices due to the production of guaiacol. Identification of the genera originates rejection of the product by processing industry. However, not all the Alicyclobacillus species are deteriorative and hence the importance to differentiate among them. In this study, partial 16S ribosomal RNA sequence alignment allowed the differentiation of species. In addition, ERIC-PCR was introduced for the genotypic characterization of Alicyclobacillus, as an alternative for differentiation among isolates from the same species. © 2015 The Society for Applied Microbiology.

Spontaneous organic cocoa bean box fermentations in Brazil are characterized by a restricted species diversity of lactic acid bacteria and acetic acid bacteria.

PubMed

Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc

2011-10-01

Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm. Copyright © 2011 Elsevier Ltd. All rights reserved.

Structure and variation of the mitochondrial genome of fishes.

PubMed

Satoh, Takashi P; Miya, Masaki; Mabuchi, Kohji; Nishida, Mutsumi

2016-09-07

The mitochondrial (mt) genome has been used as an effective tool for phylogenetic and population genetic analyses in vertebrates. However, the structure and variability of the vertebrate mt genome are not well understood. A potential strategy for improving our understanding is to conduct a comprehensive comparative study of large mt genome data. The aim of this study was to characterize the structure and variability of the fish mt genome through comparative analysis of large datasets. An analysis of the secondary structure of proteins for 250 fish species (248 ray-finned and 2 cartilaginous fishes) illustrated that cytochrome c oxidase subunits (COI, COII, and COIII) and a cytochrome bc1 complex subunit (Cyt b) had substantial amino acid conservation. Among the four proteins, COI was the most conserved, as more than half of all amino acid sites were invariable among the 250 species. Our models identified 43 and 58 stems within 12S rRNA and 16S rRNA, respectively, with larger numbers than proposed previously for vertebrates. The models also identified 149 and 319 invariable sites in 12S rRNA and 16S rRNA, respectively, in all fishes. In particular, the present result verified that a region corresponding to the peptidyl transferase center in prokaryotic 23S rRNA, which is homologous to mt 16S rRNA, is also conserved in fish mt 16S rRNA. Concerning the gene order, we found 35 variations (in 32 families) that deviated from the common gene order in vertebrates. These gene rearrangements were mostly observed in the area spanning the ND5 gene to the control region as well as two tRNA gene cluster regions (IQM and WANCY regions). Although many of such gene rearrangements were unique to a specific taxon, some were shared polyphyletically between distantly related species. Through a large-scale comparative analysis of 250 fish species mt genomes, we elucidated various structural aspects of the fish mt genome and the encoded genes. The present results will be important for understanding functions of the mt genome and developing programs for nucleotide sequence analysis. This study demonstrated the significance of extensive comparisons for understanding the structure of the mt genome.

Illuminating Anaerobic Microbial Community and Cooccurrence Patterns across a Quality Gradient in Chinese Liquor Fermentation Pit Muds.

PubMed

Hu, Xiaolong; Du, Hai; Ren, Cong; Xu, Yan

2016-04-01

Fermentation pit mud, an important reservoir of diverse anaerobic microorganisms, is essential for Chinese strong-aroma liquor production. Pit mud quality, according to its sensory characteristics, can be divided into three grades: degraded, normal, and high quality. However, the relationship between pit mud microbial community and pit mud quality is poorly understood, as are microbial associations within the pit mud ecosystem. Here, microbial communities at these grades were compared using Illumina MiSeq sequencing of the variable region V4 of the 16S rRNA gene. Our results revealed that the pit mud microbial community was correlated with its quality and environmental factors. Species richness, biodiversity, and relative and/or absolute abundances of Clostridia,Clostridium kluyveri, Bacteroidia, and Methanobacteria significantly increased, with corresponding increases in levels of pH, NH4 (+), and available phosphorus, from degraded to high-quality pit muds, while levels of Lactobacillus, dissolved organic carbon, and lactate significantly decreased, with normal samples in between. Furthermore, 271 pairs of significant and robust correlations (cooccurrence and negative) were identified from 76 genera using network analysis. Thirteen hubs of cooccurrence patterns, mainly under the Clostridia,Bacteroidia,Methanobacteria, and Methanomicrobia, may play important roles in pit mud ecosystem stability, which may be destroyed with rapidly increased levels of lactic acid bacteria (Lactobacillus,Pediococcus, and Streptococcus). This study may help clarify the relationships among microbial community, environmental conditions, and pit mud quality, allow the improvement of pit mud quality by using bioaugmentation and controlling environmental factors, and shed more light on the ecological rules guiding community assembly in pit mud. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Bacterial Community Dynamics during Production of Registered Designation of Origin Salers Cheese as Evaluated by 16S rRNA Gene Single-Strand Conformation Polymorphism Analysis

PubMed Central

Duthoit, Frédérique; Godon, Jean-Jacques; Montel, Marie-Christine

2003-01-01

Microbial dynamics during processing and ripening of traditional cheeses such as registered designation of origin Salers cheese, an artisanal cheese produced in France, play an important role in the elaboration of sensory qualities. The aim of the present study was to obtain a picture of the dynamics of the microbial ecosystem of RDO Salers cheese by using culture-independent methods. This included DNA extraction, PCR, and single-strand conformation polymorphism (SSCP) analysis. Bacterial and high-GC% gram-positive bacterial primers were used to amplify V2 or V3 regions of the 16S rRNA gene. SSCP patterns revealed changes during the manufacturing of the cheese. Patterns of the ecosystems of cheeses that were provided by three farmers were also quite different. Cloning and sequencing of the 16S rRNA gene revealed sequences related to lactic acid bacteria (Lactococcus lactis, Streptococcus thermophilus, Enterococcus faecium, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Lactobacillus plantarum, and Lactobacillus pentosus), which were predominant during manufacturing and ripening. Bacteria belonging to the high-GC% gram-positive group (essentially corynebacteria) were found by using specific primers. The present molecular approach can effectively describe the ecosystem of artisanal dairy products. PMID:12839752

Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

PubMed Central

Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

2016-01-01

Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Shifts in soil biodiversity-A forensic comparison between Sus scrofa domesticus and vegetation decomposition.

PubMed

Olakanye, Ayodeji O; Thompson, Tim; Ralebitso-Senior, T Komang

2015-12-01

In a forensic context, microbial-mediated cadaver decomposition and nutrient recycling cannot be overlooked. As a result, forensic ecogenomics research has intensified to gain a better understanding of cadaver/soil ecology interactions as a powerful potential tool for forensic practitioners. For this study, domestic pig (Sus scrofa domesticus) (4g) and grass (Agrostis/Festuca spp) cuttings (4g) were buried (July 2013 to July 2014) in sandy clay loam (80 g) triplicates in sealed microcosms (127 ml; 50 × 70 cm) with parallel soil only controls. The effects of the two carbon sources were determined by monitoring key environmental factors and changes in soil bacterial (16S rRNA gene) and fungal (18S rRNA gene) biodiversity. Soil pH changes showed statistically significant differences (p<0.05) between the treatments. The measured ecological diversity indices (Shannon-Wiener, HꞋ; Simpson, D; and richness, S) of the 16S rRNA and 18S rRNA gene profiles also revealed differences between the treatments, with bacterial and fungal community dominance recorded in the presence of S. scrofa domesticus and grass trimming decomposition, respectively. In contrast, no statistically significant difference in evenness (p>0.05) was observed between the treatments. Copyright © 2015 The Chartered Society of Forensic Sciences. Published by Elsevier Ireland Ltd. All rights reserved.

Clinorotation influences rDNA and NopA100 localization in nucleoli

NASA Astrophysics Data System (ADS)

Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

PubMed

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

A framework for human microbiome research

PubMed Central

Methé, Barbara A.; Nelson, Karen E.; Pop, Mihai; Creasy, Heather H.; Giglio, Michelle G.; Huttenhower, Curtis; Gevers, Dirk; Petrosino, Joseph F.; Abubucker, Sahar; Badger, Jonathan H.; Chinwalla, Asif T.; Earl, Ashlee M.; FitzGerald, Michael G.; Fulton, Robert S.; Hallsworth-Pepin, Kymberlie; Lobos, Elizabeth A.; Madupu, Ramana; Magrini, Vincent; Martin, John C.; Mitreva, Makedonka; Muzny, Donna M.; Sodergren, Erica J.; Versalovic, James; Wollam, Aye M.; Worley, Kim C.; Wortman, Jennifer R.; Young, Sarah K.; Zeng, Qiandong; Aagaard, Kjersti M.; Abolude, Olukemi O.; Allen-Vercoe, Emma; Alm, Eric J.; Alvarado, Lucia; Andersen, Gary L.; Anderson, Scott; Appelbaum, Elizabeth; Arachchi, Harindra M.; Armitage, Gary; Arze, Cesar A.; Ayvaz, Tulin; Baker, Carl C.; Begg, Lisa; Belachew, Tsegahiwot; Bhonagiri, Veena; Bihan, Monika; Blaser, Martin J.; Bloom, Toby; Vivien Bonazzi, J.; Brooks, Paul; Buck, Gregory A.; Buhay, Christian J.; Busam, Dana A.; Campbell, Joseph L.; Canon, Shane R.; Cantarel, Brandi L.; Chain, Patrick S.; Chen, I-Min A.; Chen, Lei; Chhibba, Shaila; Chu, Ken; Ciulla, Dawn M.; Clemente, Jose C.; Clifton, Sandra W.; Conlan, Sean; Crabtree, Jonathan; Cutting, Mary A.; Davidovics, Noam J.; Davis, Catherine C.; DeSantis, Todd Z.; Deal, Carolyn; Delehaunty, Kimberley D.; Dewhirst, Floyd E.; Deych, Elena; Ding, Yan; Dooling, David J.; Dugan, Shannon P.; Dunne, Wm. Michael; Durkin, A. Scott; Edgar, Robert C.; Erlich, Rachel L.; Farmer, Candace N.; Farrell, Ruth M.; Faust, Karoline; Feldgarden, Michael; Felix, Victor M.; Fisher, Sheila; Fodor, Anthony A.; Forney, Larry; Foster, Leslie; Di Francesco, Valentina; Friedman, Jonathan; Friedrich, Dennis C.; Fronick, Catrina C.; Fulton, Lucinda L.; Gao, Hongyu; Garcia, Nathalia; Giannoukos, Georgia; Giblin, Christina; Giovanni, Maria Y.; Goldberg, Jonathan M.; Goll, Johannes; Gonzalez, Antonio; Griggs, Allison; Gujja, Sharvari; Haas, Brian J.; Hamilton, Holli A.; Harris, Emily L.; Hepburn, Theresa A.; Herter, Brandi; Hoffmann, Diane E.; Holder, Michael E.; Howarth, Clinton; Huang, Katherine H.; Huse, Susan M.; Izard, Jacques; Jansson, Janet K.; Jiang, Huaiyang; Jordan, Catherine; Joshi, Vandita; Katancik, James A.; Keitel, Wendy A.; Kelley, Scott T.; Kells, Cristyn; Kinder-Haake, Susan; King, Nicholas B.; Knight, Rob; Knights, Dan; Kong, Heidi H.; Koren, Omry; Koren, Sergey; Kota, Karthik C.; Kovar, Christie L.; Kyrpides, Nikos C.; La Rosa, Patricio S.; Lee, Sandra L.; Lemon, Katherine P.; Lennon, Niall; Lewis, Cecil M.; Lewis, Lora; Ley, Ruth E.; Li, Kelvin; Liolios, Konstantinos; Liu, Bo; Liu, Yue; Lo, Chien-Chi; Lozupone, Catherine A.; Lunsford, R. Dwayne; Madden, Tessa; Mahurkar, Anup A.; Mannon, Peter J.; Mardis, Elaine R.; Markowitz, Victor M.; Mavrommatis, Konstantinos; McCorrison, Jamison M.; McDonald, Daniel; McEwen, Jean; McGuire, Amy L.; McInnes, Pamela; Mehta, Teena; Mihindukulasuriya, Kathie A.; Miller, Jason R.; Minx, Patrick J.; Newsham, Irene; Nusbaum, Chad; O’Laughlin, Michelle; Orvis, Joshua; Pagani, Ioanna; Palaniappan, Krishna; Patel, Shital M.; Pearson, Matthew; Peterson, Jane; Podar, Mircea; Pohl, Craig; Pollard, Katherine S.; Priest, Margaret E.; Proctor, Lita M.; Qin, Xiang; Raes, Jeroen; Ravel, Jacques; Reid, Jeffrey G.; Rho, Mina; Rhodes, Rosamond; Riehle, Kevin P.; Rivera, Maria C.; Rodriguez-Mueller, Beltran; Rogers, Yu-Hui; Ross, Matthew C.; Russ, Carsten; Sanka, Ravi K.; Pamela Sankar, J.; Sathirapongsasuti, Fah; Schloss, Jeffery A.; Schloss, Patrick D.; Schmidt, Thomas M.; Scholz, Matthew; Schriml, Lynn; Schubert, Alyxandria M.; Segata, Nicola; Segre, Julia A.; Shannon, William D.; Sharp, Richard R.; Sharpton, Thomas J.; Shenoy, Narmada; Sheth, Nihar U.; Simone, Gina A.; Singh, Indresh; Smillie, Chris S.; Sobel, Jack D.; Sommer, Daniel D.; Spicer, Paul; Sutton, Granger G.; Sykes, Sean M.; Tabbaa, Diana G.; Thiagarajan, Mathangi; Tomlinson, Chad M.; Torralba, Manolito; Treangen, Todd J.; Truty, Rebecca M.; Vishnivetskaya, Tatiana A.; Walker, Jason; Wang, Lu; Wang, Zhengyuan; Ward, Doyle V.; Warren, Wesley; Watson, Mark A.; Wellington, Christopher; Wetterstrand, Kris A.; White, James R.; Wilczek-Boney, Katarzyna; Wu, Yuan Qing; Wylie, Kristine M.; Wylie, Todd; Yandava, Chandri; Ye, Liang; Ye, Yuzhen; Yooseph, Shibu; Youmans, Bonnie P.; Zhang, Lan; Zhou, Yanjiao; Zhu, Yiming; Zoloth, Laurie; Zucker, Jeremy D.; Birren, Bruce W.; Gibbs, Richard A.; Highlander, Sarah K.; Weinstock, George M.; Wilson, Richard K.; White, Owen

2012-01-01

A variety of microbial communities and their genes (microbiome) exist throughout the human body, playing fundamental roles in human health and disease. The NIH funded Human Microbiome Project (HMP) Consortium has established a population-scale framework which catalyzed significant development of metagenomic protocols resulting in a broad range of quality-controlled resources and data including standardized methods for creating, processing and interpreting distinct types of high-throughput metagenomic data available to the scientific community. Here we present resources from a population of 242 healthy adults sampled at 15 to 18 body sites up to three times, which to date, have generated 5,177 microbial taxonomic profiles from 16S rRNA genes and over 3.5 Tb of metagenomic sequence. In parallel, approximately 800 human-associated reference genomes have been sequenced. Collectively, these data represent the largest resource to date describing the abundance and variety of the human microbiome, while providing a platform for current and future studies. PMID:22699610

Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

PubMed

Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

2014-01-01

Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

PubMed

Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

2015-01-01

Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

Structural insights into cell cycle control by essential GTPase Era.

PubMed

Ji, Xinhua

Era (Escherichia coli Ras-like protein), essential for bacterial cell viability, is composed of an N-terminal GTPase domain and a C-terminal KH domain. In bacteria, it is required for the processing of 16S ribosomal RNA (rRNA) and maturation of 30S (small) ribosomal subunit. Era recognizes 10 nucleotides ( 1530 GAUCACCUCC 1539 ) near the 3' end of 16S rRNA and interacts with helix 45 (h45, nucleotides 1506-1529). GTP binding enables Era to bind RNA, RNA binding stimulates Era's GTP-hydrolyzing activity, and GTP hydrolysis releases Era from matured 30S ribosomal subunit. As such, Era controls cell growth rate via regulating the maturation of the 30S ribosomal subunit. Ribosomes manufacture proteins in all living organisms. The GAUCA sequence and h45 are highly conserved in all three kingdoms of life. Homologues of Era are present in eukaryotic cells. Hence, the mechanism of bacterial Era action also sheds light on the cell cycle control of eukaryotes.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

NASA Astrophysics Data System (ADS)

Antonielli, Livio; Sessitsch, Angela

2016-04-01

Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

PubMed

Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2015-01-01

In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

Accuracy of Conventional PCR Targeting the 16S rRNA Gene with the Ot-16sRF1 and Ot-16sRR1 Primers for Diagnosis of Scrub Typhus: a Case-Control Study

PubMed Central

Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon

2015-01-01

We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

PubMed

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Isolation of PCR quality microbial community DNA from heavily contaminated environments.

PubMed

Gunawardana, Manjula; Chang, Simon; Jimenez, Abraham; Holland-Moritz, Daniel; Holland-Moritz, Hannah; La Val, Taylor P; Lund, Craig; Mullen, Madeline; Olsen, John; Sztain, Terra A; Yoo, Jennifer; Moss, John A; Baum, Marc M

2014-07-01

Asphalts, biochemically degraded oil, contain persistent, water-soluble compounds that pose a significant challenge to the isolation of PCR quality DNA. The adaptation of existing DNA purification protocols and commercial kits proved unsuccessful at overcoming this hurdle. Treatment of aqueous asphalt extracts with a polyamide resin afforded genomic microbial DNA templates that could readily be amplified by PCR. Physicochemically distinct asphalt samples from five natural oil seeps successfully generated the expected 291 bp amplicons targeting a region of the 16S rRNA gene, illustrating the robustness of the method. DNA recovery yields were in the 50-80% range depending on how the asphalt sample was seeded with exogenous DNA. The scope of the new method was expanded to include soil with high humic acid content. DNA from soil samples spiked with a range of humic acid concentrations was extracted with a commercial kit followed by treatment with the polyamide resin. The additional step significantly improved the purity of the DNA templates, especially at high humic acid concentrations, based on qPCR analysis of the bacterial 16S rRNA genes. The new method has the advantages of being inexpensive, simple, and rapid and should provide a valuable addition to protocols in the field of petroleum and soil microbiology. Copyright © 2014 Elsevier B.V. All rights reserved.

Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring

PubMed Central

Vierheilig, J.; Savio, D.; Ley, R. E.; Mach, R. L.; Farnleitner, A. H.

2016-01-01

The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multicompartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

Temperature and nutrient effects on periphyton associated ...

EPA Pesticide Factsheets

Nutrient pollution is a leading cause of water quality impairments and degraded aquatic ecosystem condition. Reliable and reproducible indicators of ecosystem condition are needed to help manage nutrient pollution. The diatom component of periphyton has been used as a water quality indicator due to identifiable cell morphology and existence of relationships between nutrient concentration and diatom community composition. However, morphological identification of diatoms requires highly specialized personnel, is very time consuming, and can produce variable results, suggesting the need for alternative methods that are less expensive and more reproducible. DNA sequencing of the bacterial 16S rRNA gene is well documented and provides genus-level resolution of the community structure. The goal of this study was to evaluate the effects of nutrient loading and temperature on periphyton-associated bacterial communities using standard periphytometer techniques and next generation sequencing technologies. Continuous flow mesocosms were established in an eight tank system consisting of two temperature conditions (10°C and 20°C) and four nutrient conditions (1x to 6x ambient concentrations). Experimental conditions were replicated in July/August 2013 and September 2013. Replicate DNA samples were extracted and the 16S rRNA gene was sequenced using universal Bacterial primers. Initial analyses revealed strong differences in community structure based on temperature (p <

Helicobacter pylori: a Eubacterium Lacking the Stringent Response

PubMed Central

Scoarughi, Gian Luca; Cimmino, Carmen; Donini, Pierluigi

1999-01-01

Accumulation of 16S rRNA and production of guanosine polyphosphates (pppGpp and ppGpp) were studied during amino acid starvation in three wild-type strains of Helicobacter pylori. All strains exhibit a relaxed phenotype with respect to accumulation of 16S rRNA. This constitutes the first example of a wild-type eubacterium showing a relaxed phenotype. The guanosine polyphosphate levels do not rise as a result of amino acid starvation, as expected for relaxed organisms. However, in both growing and starved cells, basal levels of the two polyphosphates appeared to be present, demonstrating that the enzymatic machinery for guanosine polyphosphate production is present in this organism. These findings are discussed within the framework of the hypothesis that stringent control is a physiological control mechanism more important for the fitness of prokaryotes growing in the general environment than for those that inhabit protected niches. PMID:9882669

Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique.

PubMed

Yin, R H; Bai, W L; Wang, J M; Wu, C D; Dou, Q L; Yin, R L; He, J B; Luo, G B

2009-09-01

Yak meat is of good quality with fine texture, high protein and low fat content, and rich in amino acids compared with that of cattle, and it lacks anabolic steroids or other drugs. In general terms, however, the meat yield of yak is relatively low compared with that of the cattle. In order to prevent possible adulteration of yak meat with cattle meat, based on the sequence of mitochondrial 12S rRNA gene, a multiplex PCR-based approach was proposed for rapid identification of the meat from yak and cattle using three primers designed in this work. Through the combinatorial usage of three primers with a single reaction set, two fragments of 290 and 159bp were amplified from the cattle meat DNA, whereas only a fragment of 290bp was obtained from the yak meat DNA. Using the assay described, satisfactory amplification was accomplished in the analysis of raw and heat-treated binary meat mixtures of yak/cattle with a detection limit of 0.1% for cattle meat. The technique is fast and straightforward. It might be a useful tool in the quality control of yak meat and meat products.

RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription.

PubMed

Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen

2016-09-16

The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

PubMed

Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

2017-02-01

To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

Prediction of functional profiles of gut microbiota from 16S rRNA metagenomic data provides a more robust evaluation of gut dysbiosis occurring in Japanese type 2 diabetic patients.

PubMed

Inoue, Ryo; Ohue-Kitano, Ryuji; Tsukahara, Takamitsu; Tanaka, Masashi; Masuda, Shinya; Inoue, Takayuki; Yamakage, Hajime; Kusakabe, Toru; Hasegawa, Koji; Shimatsu, Akira; Satoh-Asahara, Noriko

2017-11-01

We assessed whether gut microbial functional profiles predicted from 16S rRNA metagenomics differed in Japanese type 2 diabetic patients. A total of 22 Japanese subjects were recruited from our outpatient clinic in an observational study. Fecal samples were obtained from 12 control and 10 type 2 diabetic subjects. 16S rRNA metagenomic data were generated and functional profiles predicted using "Phylogenetic Investigation of Communities by Reconstruction of Unobserved States" software. We measured the parameters of glucose metabolism, gut bacterial taxonomy and functional profile, and examined the associations in a cross-sectional manner. Eleven of 288 "Kyoto Encyclopedia of Genes and Genomes" pathways were significantly enriched in diabetic patients compared with control subjects ( p <0.05, q<0.1). The relative abundance of almost all pathways, including the Insulin signaling pathway and Glycolysis/Gluconeogenesis , showed strong, positive correlations with hemoglobin A 1c (HbA 1c ) and fasting plasma glucose (FPG) levels. Bacterial taxonomic analysis showed that genus Blautia significantly differed between groups and had negative correlations with HbA 1c and FPG levels. Our findings suggest a novel pathophysiological relationship between gut microbial communities and diabetes, further highlighting the significance and utility of combining prediction of functional profiles with ordinal bacterial taxonomic analysis (UMIN Clinical Trails Registry number: UMIN000026592).

Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

USGS Publications Warehouse

Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

2007-01-01

We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

Structure-seq2: sensitive and accurate genome-wide profiling of RNA structure in vivo

PubMed Central

Ritchey, Laura E.; Su, Zhao; Tang, Yin; Tack, David C.

2017-01-01

Abstract RNA serves many functions in biology such as splicing, temperature sensing, and innate immunity. These functions are often determined by the structure of RNA. There is thus a pressing need to understand RNA structure and how it changes during diverse biological processes both in vivo and genome-wide. Here, we present Structure-seq2, which provides nucleotide-resolution RNA structural information in vivo and genome-wide. This optimized version of our original Structure-seq method increases sensitivity by at least 4-fold and improves data quality by minimizing formation of a deleterious by-product, reducing ligation bias, and improving read coverage. We also present a variation of Structure-seq2 in which a biotinylated nucleotide is incorporated during reverse transcription, which greatly facilitates the protocol by eliminating two PAGE purification steps. We benchmark Structure-seq2 on both mRNA and rRNA structure in rice (Oryza sativa). We demonstrate that Structure-seq2 can lead to new biological insights. Our Structure-seq2 datasets uncover hidden breaks in chloroplast rRNA and identify a previously unreported N1-methyladenosine (m1A) in a nuclear-encoded Oryza sativa rRNA. Overall, Structure-seq2 is a rapid, sensitive, and unbiased method to probe RNA in vivo and genome-wide that facilitates new insights into RNA biology. PMID:28637286

Characterization of a new marine nitrite oxidizing bacterium, Nitrospina watsonii sp. nov., a member of the newly proposed phylum "Nitrospinae".

PubMed

Spieck, Eva; Keuter, Sabine; Wenzel, Thilo; Bock, Eberhard; Ludwig, Wolfgang

2014-05-01

Nitrite oxidizing bacteria are an integral part of the nitrogen cycle in marine waters, but the knowledge about their diversity is limited. Recently, a high abundance of Nitrospina-like 16S rRNA gene sequences has been detected in oceanic habitats with low oxygen content by molecular methods. Here, we describe a new strain of Nitrospina, which was sampled in 100m depth from the Black Sea. It coexisted with a not-yet cultivated chemoorganotrophic gammaproteobacterium and could be purified by classical isolation methods including Percoll density gradient centrifugation. The new Nitrospina-like bacterium grew lithoautotrophically at 28°C in diluted seawater supplemented with inorganic salts and nitrite. Gram-negative rods were characterized morphologically, physiologically and partly biochemically. The 16S rRNA gene of the new strain of Nitrospina is 97.9% similar to the described species N. gracilis and DNA/DNA hybridization experiments revealed a relatedness of 30.0%. The data from both Nitrospina species and environmental clones were used for an extensive 16S rRNA based phylogenetic study applying high quality filtering. Treeing analyses confirm the newly defined phylum status for "Nitrospinae" [18]. The results of phylogenetic and genotypic analyses support the proposal of a novel species Nitrospina watsonii sp. nov. (type strain 347(T), LMG 27401(T), NCIMB 14887(T)). Copyright © 2014 Elsevier GmbH. All rights reserved.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Defining the RNA-Protein Interactions in the Trypanosome Preribosomal Complex

PubMed Central

Wang, Lei; Ciganda, Martin

2013-01-01

In eukaryotes, 5S rRNA is transcribed in the nucleoplasm and requires the ribosomal protein L5 to deliver it to the nucleolus for ribosomal assembly. The trypanosome-specific proteins P34 and P37 form a novel preribosomal complex with the eukaryotic conserved L5-5S rRNA complex in the nucleoplasm. Previous results suggested that P34 acts together with L5 to bridge the interaction with 5S rRNA and thus to stabilize 5S rRNA, an important role in the early steps of ribosomal biogenesis. Here, we have delineated the domains of the two protein components, L5 and P34, and regions of the RNA partner, 5S rRNA, that are critical for protein-RNA interactions within the complex. We found that the L18 domain of L5 and the N terminus and RNA recognition motif of P34 bind 5S rRNA. We showed that Trypanosoma brucei L5 binds the β arm of 5S rRNA, while P34 binds loop A/stem V of 5S rRNA. We demonstrated that 5S rRNA is able to enhance the association between the protein components of the complex, L5 and P34. Both loop A/stem V and the β arm of 5S rRNA can separately enhance the protein-protein association, but their effects are neither additive nor synergistic. Domains in the two proteins for protein-protein and protein-RNA interactions overlap or are close to each other. This suggests that 5S rRNA binding might cause conformational changes in L5 and P34 and might also bridge the interactions, thus enhancing binding between the protein partners of this novel complex. PMID:23397568

Mechanisms for ribotoxin-induced ribosomal RNA cleavage

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Kaiyu; Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824; Zhou, Hui-Ren

The Type B trichothecene deoxynivalenol (DON), a ribotoxic mycotoxin known to contaminate cereal-based foods, induces ribosomal RNA (rRNA) cleavage in the macrophage via p38-directed activation of caspases. Here we employed the RAW 264.7 murine macrophage model to test the hypothesis that this rRNA cleavage pathway is similarly induced by other ribotoxins. Capillary electrophoresis confirmed that the antibiotic anisomycin (≥ 25 ng/ml), the macrocylic trichothecene satratoxin G (SG) (≥ 10 ng/ml) and ribosome-inactivating protein ricin (≥ 300 ng/ml) induced 18s and 28s rRNA fragmentation patterns identical to that observed for DON. Also, as found for DON, inhibition of p38, double-stranded RNA-activatedmore » kinase (PKR) and hematopoietic cell kinase (Hck) suppressed MAPK anisomycin-induced rRNA cleavage, while, in contrast, their inhibition did not affect SG- and ricin-induced rRNA fragmentation. The p53 inhibitor pifithrin-μ and pan caspase inhibitor Z-VAD-FMK suppressed rRNA cleavage induced by anisomycin, SG and ricin, indicating that these ribotoxins shared with DON a conserved downstream pathway. Activation of caspases 8, 9 and 3 concurrently with apoptosis further suggested that rRNA cleavage occurred in parallel with both extrinsic and intrinsic pathways of programmed cell death. When specific inhibitors of cathepsins L and B (lysosomal cysteine cathepsins active at cytosolic neutral pH) were tested, only the former impaired anisomycin-, SG-, ricin- and DON-induced rRNA cleavage. Taken together, the data suggest that (1) all four ribotoxins induced p53-dependent rRNA cleavage via activation of cathepsin L and caspase 3, and (2) activation of p53 by DON and anisomycin involved p38 whereas SG and ricin activated p53 by an alternative mechanism. Highlights: ► Deoxynivalenol (DON) anisomycin, satratoxin G (SG) and ricin are ribotoxins. ► Ribotoxins induce 18s and 28s rRNA cleavage in the RAW 264.7 macrophage model. ► Ribotoxins induce rRNA cleavage via activation of p53, caspases and cathepsins. ► DON- and anisomycin-triggered rRNA cleavage is p38-dependent. ► SG- and ricin-induced rRNA cleavage is p38-independent.« less

Microbial source tracking in highly vulnerable karst drinking water resources.

PubMed

Diston, D; Robbi, R; Baumgartner, A; Felleisen, R

2018-02-01

Water resources situated in areas with underlying karst geology are particularly vulnerable to fecal pollution. In such vulnerable systems, microbial source tracking (MST) methods are useful tools to elucidate the pathways of both animal and human fecal pollution, leading to more accurate water use risk assessments. Here, we describe the application of a MST toolbox using both culture-dependent bacteriophage and molecular-dependent 16S rRNA assays at spring and well sites in the karstic St Imier Valley, Switzerland. Culture-dependent and molecular-dependent marker performance varied significantly, with the 16S rRNA assays displaying greater sensitivity than their phage counterpart; HF183 was the best performing human wastewater-associated marker while Rum2Bac was the best performing ruminant marker. Differences were observed in pollution regimes between the well and spring sampling sites, with the spring water being more degraded than the well site. Our results inform the choice of marker selection for MST studies and highlight differences in microbial water quality between well and spring karst sites.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

PubMed Central

Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

2013-01-01

There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Response of soybean rhizosphere communities to human hygiene water addition as determined by community level physiological profiling (CLPP) and terminal restriction fragment length polymorphism (TRFLP) analysis

NASA Technical Reports Server (NTRS)

Kerkhof, L.; Santoro, M.; Garland, J.

2000-01-01

In this report, we describe an experiment conducted at Kennedy Space Center in the biomass production chamber (BPC) using soybean plants for purification and processing of human hygiene water. Specifically, we tested whether it was possible to detect changes in the root-associated bacterial assemblage of the plants and ultimately to identify the specific microorganism(s) which differed when plants were exposed to hygiene water and other hydroponic media. Plants were grown in hydroponics media corresponding to four different treatments: control (Hoagland's solution), artificial gray water (Hoagland's+surfactant), filtered gray water collected from human subjects on site, and unfiltered gray water. Differences in rhizosphere microbial populations in all experimental treatments were observed when compared to the control treatment using both community level physiological profiles (BIOLOG) and molecular fingerprinting of 16S rRNA genes by terminal restriction fragment length polymorphism analysis (TRFLP). Furthermore, screening of a clonal library of 16S rRNA genes by TRFLP yielded nearly full length SSU genes associated with the various treatments. Most 16S rRNA genes were affiliated with the Klebsiella, Pseudomonas, Variovorax, Burkholderia, Bordetella and Isosphaera groups. This molecular approach demonstrated the ability to rapidly detect and identify microorganisms unique to experimental treatments and provides a means to fingerprint microbial communities in the biosystems being developed at NASA for optimizing advanced life support operations.

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches in the expansion segments 7, 15, and 27 of human 28S rRNA appear as candidates for general interaction with mRNAs, especially those associated with intracellular matrices such as the endoplasmic reticulum. PMID:29563925

Efficient simultaneous partial nitrification, anammox and denitrification (SNAD) system equipped with a real-time dissolved oxygen (DO) intelligent control system and microbial community shifts of different substrate concentrations.

PubMed

Wen, Xin; Gong, Benzhou; Zhou, Jian; He, Qiang; Qing, Xiaoxia

2017-08-01

Simultaneous partial nitrification, anammox and denitrification (SNAD) process was studied in a sequencing batch biofilm reactor (SBBR) fed with synthetic wastewater in a range of 2200 mgN/L ∼ 50 mgN/L. Important was an external real-time precision dissolved oxygen (DO) intelligent control system that consisted of feed forward control system and feedback control system. This DO control system permitted close control of oxygen supply according to influent concentration, effluent quality and other environmental factors in the reactor. In this study the operation was divided into six phases according to influent nitrogen applied. SNAD system was successfully set up after adding COD into a CANON system. And the presence of COD enabled the survival of denitrifiers, and made Thauera and Pseudomonas predominant as functional denitrifiers in this system. Denaturing gradient gel electrophoresis (DGGE), fluorescence in situ hybridization (FISH) and 16S rRNA amplicon pyrosequencing were used to analyze the microbial variations of different substrate concentrations. Results indicated that the relative population of ammonia oxidizing bacteria (AOB) members decreased when influent ammonia concentration decreased from 2200 mg/L to 50 mg/L, while no dramatic drop of the percent of anammox bacteria was seen. And Nitrosomonas europaea was the predominant AOB in SNAD system treating sewage, while Candidatus Brocadia was the dominant anammox bacteria. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nitrite oxidizing bacteria for water treatment in coastal aquaculture system

NASA Astrophysics Data System (ADS)

Noorak, S.; Rakkhiaw, S.; Limjirakhajornt, K.; Uppabullung, A.; Keawtawee, T.; Sangnoi, Y.

2018-04-01

This research aimed to isolate and characterize nitrite oxidizing bacteria and to study their capability for water quality improvement. Fourteen strains of bacteria with nitrite-oxidizing character were isolated after 21 days of enrichment in Pep-Beef-NOB medium contained NaNO2. Two strains, SF-1 and SF-5, showed highest nitrite removal rate for 42.42% and 37.2%, respectively. These strains were determined an efficiency of open-system wastewater treatment for 14 days. The results showed that control, SF-1 and SF-5 had remove ammonia from day 1 to day 6. At the end of the study, ammonia was removed by the control, SF-1 and SF-5 for 81.27%, 70.1% and 69.82%, respectively. Nitrite concentration was lowest at day 8 with removal rate of 98.73%, 98.3% and 97.24% from control, SF-1 and SF-5, respectively. However, nitrite concentration in control experiment was increased again at day 11 whereas in SF-1 and SF-5 were increased at day 13. Chemical Oxygen Demand (COD) was decreased by 77.78%, 73.50% and 78.63% in the control, SF-1 and SF-5, respectively. Biological Oxygen Demand (BOD) in the control, SF-1 and SF-5 were reduced by 85.92%, 79.53% and 82.09%, respectively. Based on 16S rRNA gene, SF-1 and SF-5 were identified as Bacillus vietnamensis and B. firmus, respectively.

Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

PubMed

Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

2012-11-20

The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities

PubMed Central

2012-01-01

The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources. PMID:23168231

Biocorrosion and biofilm formation in a nutrient limited heating system subjected to alternating microaerophilic conditions.

PubMed

Kjellerup, B V; Kjeldsen, K U; Lopes, F; Abildgaard, L; Ingvorsen, K; Frølund, B; Sowers, K R; Nielsen, P H

2009-11-01

Severe biofilm formation and biocorrosion have been observed in heating systems even when the water quality complied with existing standards. The coupling between water chemistry, biofilm formation, species composition, and biocorrosion in a heating system was investigated by adding low concentrations of nutrients and oxygen under continuous and alternating dosing regimes. Molecular analysis of 16S rRNA gene fragments demonstrated that the amendments did not cause changes in the overall bacterial community composition. The combined alternating dosing of nutrients and oxygen caused increased rates of pitting (bio-) corrosion. Detection of bacteria involved in sulfide production and oxidation by retrieval of the functional dsrAB and apsA genes revealed the presence of Gram-positive sulfate- and sulfite-reducers and an unknown sulfur-oxidizer. Therefore, to control biocorrosion, sources of oxygen and nutrients must be limited, since the effect of the alternating operational conditions apparently is more important than the presence of potentially corrosive biofilm bacteria.

Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

PubMed Central

2016-01-01

The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Comparison of MI, Chromocult® coliform, and Compass CC chromogenic culture-based methods to detect Escherichia coli and total coliforms in water using 16S rRNA sequencing for colony identification.

PubMed

Maheux, Andrée F; Bouchard, Sébastien; Bérubé, Ève; Bergeron, Michel G

2017-06-01

The MI, Chromocult ® coliform, and Compass CC chromogenic culture-based methods used to assess water quality by the detection of Escherichia coli and total coliforms were compared in terms of their specificity and sensitivity, using 16S rRNA sequencing for colony identification. A sewage water sample was divided in 2-μL subsamples for testing by all three culture-based methods. All growing colonies were harvested and subjected to 16S rRNA sequencing. Test results showed that all E. coli colonies were correctly identified by all three methods, for a specificity and a sensitivity of 100%. However, for the total coliform detection, the MI agar, Chromocult ® coliform agar, and Compass CC agar were specific for only 69.2% (9/13), 47.2% (25/53), and 40.5% (17/42), whereas sensitive for 97.8% (45/46), 97.5% (39/40), and 85.7% (24/28), respectively. Thus, given the low level of specificity of these methods for the detection of total coliforms, confirming the identity of total coliform colonies could help to take public health decisions, in particular for cities connected to a public drinking water distribution system since the growth of few putative total coliform colonies on chromogenic agar is problematic and can lead to unnecessary and costly boiling notices from public health authorities.

The roles of SSU processome components and surveillance factors in the initial processing of human ribosomal RNA

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Schneider, Claudia; Watkins, Nicholas J.

2014-01-01

During eukaryotic ribosome biogenesis, three of the mature ribosomal (r)RNAs are released from a single precursor transcript (pre-rRNA) by an ordered series of endonucleolytic cleavages and exonucleolytic processing steps. Production of the 18S rRNA requires the removal of the 5′ external transcribed spacer (5′ETS) by endonucleolytic cleavages at sites A0 and A1/site 1. In metazoans, an additional cleavage in the 5′ETS, at site A′, upstream of A0, has also been reported. Here, we have investigated how A′ processing is coordinated with assembly of the early preribosomal complex. We find that only the tUTP (UTP-A) complex is critical for A′ cleavage, while components of the bUTP (UTP-B) and U3 snoRNP are important, but not essential, for efficient processing at this site. All other factors involved in the early stages of 18S rRNA processing that were tested here function downstream from this processing step. Interestingly, we show that the RNA surveillance factors XRN2 and MTR4 are also involved in A′ cleavage in humans. A′ cleavage is largely bypassed when XRN2 is depleted, and we also discover that A′ cleavage is not always the initial processing event in all cell types. Together, our data suggest that A′ cleavage is not a prerequisite for downstream pre-rRNA processing steps and may, in fact, represent a quality control step for initial pre-rRNA transcripts. Furthermore, we show that components of the RNA surveillance machinery, including the exosome and TRAMP complexes, also play key roles in the recycling of excised spacer fragments and degradation of aberrant pre-rRNAs in human cells. PMID:24550520

Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota

PubMed Central

Li, Xiufen; Guo, Juan; Ji, Kailong; Zhang, Ping

2016-01-01

Dietary fiber has been shown to prevent high-fat diet induced obesity through modulating the gut microbiota; however, quality difference in fiber type is largely unknown. We performed a 6 week study on C57BL/6J mice fed a macronutrient matched high-fat diet with different fiber types including cellulose (HFC), bamboo shoot fiber (HFBS) and several other commonly consumed fibers. Our results showed that the HFBS group exhibited the lowest weight gain among all diet groups and had improved lipid profiles and glycemic control compared with the HFC group. As revealed by 16S rRNA gene sequencing, loss of diversity in the gut microbiota induced by the HFC diet was largely prevented by the HFBS diet. Moreover, compared with the HFC diet, the HFBS diet resulted in markedly increased relative abundance of Bacteroidetes and strong inhibition of Verrucomicrobia, two divisions strongly correlated with body weight. In conclusion, the present study provides evidence of a quality difference among different types of dietary fibers and shows that bamboo shoot fiber is the most effective in suppressing high-fat diet induced obesity. Our findings indicate that bamboo shoot fiber is a potential prebiotic fiber which modulates the gut microbiota and improves host metabolism. PMID:27599699

A HIGHLY SELECTIVE PCR PROTOCOL FOR DETECTING 16S RRNA GENES OF THE GENUS PSEUDOMONAS (SENSU STRICTO) IN ENVIRONMENTAL SAMPLES

EPA Science Inventory

Pseudomonas species are plant, animal, and human pathogens; exhibit plant pathogen-suppressing properties useful in biological control; or express metabolic versatilities valued in biotechnology and bioremediation. Specific detection of Pseudomonas species in the environment may ...

The investigation of Helicobacter pylori in the dental biofilm and saliva samples of children with dyspeptic complaints.

PubMed

Aksit Bıcak, Damla; Akyuz, Serap; Kıratlı, Binnur; Usta, Merve; Urganci, Nafiye; Alev, Burcin; Yarat, Aysen; Sahin, Fikrettin

2017-03-21

The oral cavity can be an extra-gastric reservoir for Helicobacter pylori (H.pylori). This can play a role in the pathogenesis of halitosis, glossitis, recurrent aphthous stomatitis, and dental caries. The present study was conducted to detect the presence of H.pylori within the dental biofilm and in saliva samples collected from children suffering from dyspepsia and children without any gastrointestinal complaints. Associations with gastric infection, halitosis, and some oral parameters were also evaluated. Seventy children (aged between 5-16) with dyspepsia were selected for the study group and control group composed of 30 healthy children without dyspepsia were also included in the study. After detailed oral and clinical examinations for oral parameters, saliva, and supragingival dental biofilm samples were collected for 16S rRNA and 23S rRNA genes detection by real-time polymerase chain reaction (RT-PCR). The presence of gastric H.pylori was evaluated in endoscopic biopsy specimens histopathologically. Halitosis was evaluated by benzoyl-DL-arginine-naphthylamid (BANA) test. Salivary S.mutans and Lactobacilli sp. counts were also carried out by commercial kits. H.pylori was histopathologically detected amongst 83% of the children with the dyspeptic condition. The detection rate of this bacteria in dental biofilm and saliva samples and halitosis were found relatively higher in the dyspeptic children rather than the control group (p < 0.01). Halitosis was not significantly different between dyspeptic children and those detected with H.pylori (p > 0.05). In the gastric H.pylori positive group with dyspepsia, DMFT/S and dmft/s numbers and plaque indices were found higher than the control group (p < 0.01). Only plaque indices of gastric H.pylori negative group with dyspepsia were found higher than the control group (p < 0.01). S.mutans and Lactobacilli sp. counts were not significantly different between gastric H.pylori positive and negative groups (p > 0.05). Comparing to those with negative for both genes, in children whose dental biofilm and saliva samples were positive for both 16S rRNA and 23S rRNA genes, significantly higher results for halitosis, and DMFS numbers and significantly lower results for dmfs numbers and pH values were found (p < 0.01). Helicobacter pylori can occur in the oral cavity aside and independently from the stomach. However, the high number of bacteria in the oral cavities of children with gastric H.pylori, an association between the presence of H.pylori and halitosis, DMFS, and pH were found.

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Influence of essential oils in diet and life-stage on gut microbiota and fillet quality of rainbow trout (Oncorhynchus mykiss).

PubMed

Ceppa, Florencia; Faccenda, Filippo; De Filippo, Carlotta; Albanese, Davide; Pindo, Massimo; Martelli, Roberta; Marconi, Paola; Lunelli, Fernando; Fava, Francesca; Parisi, Giuliana

2018-05-01

Developing fish farming to meet the demands of food security and sustainability in the 21st century will require new farming systems and improved feeds. Diet and microbe interactions in the gut is an important variable with the potential to make a significant impact on future fish farming diets and production systems. It was monitored the gut microbiota of farmed rainbow trout using 16S rRNA profiling over 51 weeks during standard rearing conditions and feeding diet with supplementation of an essential oils (MixOil) mixture from plants (at a concentration in diet of 200 mg/kg). Gut microbiota 16S rRNA profiling indicated that the fish gut was dominated by Actinobacteria, Proteobacteria, Bacteroidetes and Firmicutes. Although the dietary supplementation with MixOil had no impact on either the composition or architecture of gut microbiota, significant changes in alpha and beta diversity and relative abundance of groups of gut bacteria were evident during growth stages on test feeds, especially upon prolonged growth on finishing feed. Fish fillet quality to guarantee palatability and safety for human consumption was also evaluated. Significant differences within the gut microbiota of juvenile and adult trout under the same rearing conditions were observed, The addition of essential oil blend affected some physicochemical characteristics of trout fillets, including their resistance to oxidative damage and their weight loss (as liquid loss and water holding capacity) during the first period of storage, that are two important parameters related to product shelf life and susceptibility to spoilage. The results highlighted the need for further studies concern dietary microbiome modulation at different life stages and its influence on animal health, growth performance and final product quality.

Microbial community structures in foaming and nonfoaming full-scale wastewater treatment plants.

PubMed

de los Reyes, Francis L; Rothauszky, Dagmar; Raskin, Lutgarde

2002-01-01

A survey of full-scale activated-sludge plants in Illinois revealed that filamentous foaming is a widespread problem in the state, and that the causes and consequences of foaming control strategies are not fully understood. To link microbial community structure to foam occurrence, microbial populations in eight foaming and nine nonfoaming full-scale activated-sludge systems were quantified using oligonucleotide hybridization probes targeting the ribosomal RNA (rRNA) of the mycolata; Gordonia spp.; Gordonia amarae; "Candidatus Microthrix parvicella"; the alpha-, beta-, and gamma-subclasses of the Proteobacteria, and members of the Cytophaga-Flavobacteria. Parallel measurements of microbial population abundance using hybridization of extracted RNA and fluorescence in situ hybridization (FISH) showed that the levels of mycolata, particularly Gordonia spp., were higher in most foaming systems compared with nonfoaming systems. Fluorescence in situ hybridization and microscopy suggested the involvement of "Candidatus Microthrix parvicella" and Skermania piniformis in foam formation in other plants. Finally, high numbers of "Candidatus Microthrix parvicella" were detected by FISH in foam and mixed liquor samples of one plant, whereas the corresponding levels of rRNA were low. This finding implies that inactive "Candidatus Microthrix parvicella" cells (i.e., cells with low rRNA levels) can cause foaming.

A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'

PubMed Central

Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

2016-01-01

Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum (‘Ca. P. prunorum’) detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor ‘Ca. P. prunorum’ infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect ‘Ca. P. prunorum’ and Plum pox virus (PPV) in Prunus. PMID:26742106

Poly(ADP-Ribose) Polymerase 1 (PARP-1) Regulates Ribosomal Biogenesis in Drosophila Nucleoli

PubMed Central

Boamah, Ernest K.; Kotova, Elena; Garabedian, Mikael; Jarnik, Michael; Tulin, Alexei V.

2012-01-01

Poly(ADP-ribose) polymerase 1 (PARP1), a nuclear protein, utilizes NAD to synthesize poly(AD-Pribose) (pADPr), resulting in both automodification and the modification of acceptor proteins. Substantial amounts of PARP1 and pADPr (up to 50%) are localized to the nucleolus, a subnuclear organelle known as a region for ribosome biogenesis and maturation. At present, the functional significance of PARP1 protein inside the nucleolus remains unclear. Using PARP1 mutants, we investigated the function of PARP1, pADPr, and PARP1-interacting proteins in the maintenance of nucleolus structure and functions. Our analysis shows that disruption of PARP1 enzymatic activity caused nucleolar disintegration and aberrant localization of nucleolar-specific proteins. Additionally, PARP1 mutants have increased accumulation of rRNA intermediates and a decrease in ribosome levels. Together, our data suggests that PARP1 enzymatic activity is required for targeting nucleolar proteins to the proximity of precursor rRNA; hence, PARP1 controls precursor rRNA processing, post-transcriptional modification, and pre-ribosome assembly. Based on these findings, we propose a model that explains how PARP1 activity impacts nucleolar functions and, consequently, ribosomal biogenesis. PMID:22242017

Bacterial community and arsenic functional genes diversity in arsenic contaminated soils from different geographic locations

PubMed Central

Gu, Yunfu; D. Van Nostrand, Joy; Wu, Liyou; He, Zhili; Qin, Yujia; Zhao, Fang-Jie; Zhou, Jizhong

2017-01-01

To understand how soil microbial communities and arsenic (As) functional genes respond to soil arsenic (As) contamination, five soils contaminated with As at different levels were collected from diverse geographic locations, incubated for 54 days under flooded conditions, and examined by both MiSeq sequencing of 16S rRNA gene amplicons and functional gene microarray (GeoChip 4.0). The results showed that both bacterial community structure and As functional gene structure differed among geographical locations. The diversity of As functional genes correlated positively with the diversity of 16S rRNA genes (P< 0.05). Higher diversities of As functional genes and 16S rRNA genes were observed in the soils with higher available As. Soil pH, phosphate-extractable As, and amorphous Fe content were the most important factors in shaping the bacterial community structure and As transformation functional genes. Geographic location was also important in controlling both the bacterial community and As transformation functional potential. These findings provide insights into the variation of As transformation functional genes in soils contaminated with different levels of As at different geographic locations, and the impact of environmental As contamination on the soil bacterial community. PMID:28475654

Enhanced NOLC1 promotes cell senescence and represses hepatocellular carcinoma cell proliferation by disturbing the organization of nucleolus.

PubMed

Yuan, Fuwen; Zhang, Yu; Ma, Liwei; Cheng, Qian; Li, Guodong; Tong, Tanjun

2017-08-01

The nucleolus is a key organelle that is responsible for the synthesis of rRNA and assembly of ribosomal subunits, which is also the center of metabolic control because of the critical role of ribosomes in protein synthesis. Perturbations of rRNA biogenesis are closely related to cell senescence and tumor progression; however, the underlying molecular mechanisms are not well understood. Here, we report that cellular senescence-inhibited gene (CSIG) knockdown up-regulated NOLC1 by stabilizing the 5'UTR of NOLC1 mRNA, and elevated NOLC1 induced the retention of NOG1 in the nucleolus, which is responsible for rRNA processing. Besides, the expression of NOLC1 was negatively correlated with CSIG in the aged mouse tissue and replicative senescent 2BS cells, and the down-regulation of NOLC1 could rescue CSIG knockdown-induced 2BS senescence. Additionally, NOLC1 expression was decreased in human hepatocellular carcinoma (HCC) tissue, and the ectopic expression of NOLC1 repressed the proliferation of HCC cells and tumor growth in a HCC xenograft model. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren

2011-01-01

Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g.more » Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.« less

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Quo vadis? Microbial profiling revealed strong effects of cleanroom maintenance and routes of contamination in indoor environments

DOE PAGES

Moissl-Eichinger, Christine; Auerbach, Anna K.; Probst, Alexander J.; ...

2015-03-17

Space agencies maintain highly controlled cleanrooms to ensure the demands of planetary protection. To study potential effects of microbiome control, we analyzed microbial communities in two particulate-controlled cleanrooms (ISO 5 and ISO 8) and two vicinal uncontrolled areas (office, changing room) by cultivation and 16S rRNA gene amplicon analysis (cloning, pyrotagsequencing, and PhyloChip G3 analysis). Maintenance procedures affected the microbiome on total abundance and microbial community structure concerning richness, diversity and relative abundance of certain taxa. Cleanroom areas were found to be mainly predominated by potentially human-associated bacteria; archaeal signatures were detected in every area. Results indicate that microorganisms weremore » mainly spread from the changing room (68%) into the cleanrooms, potentially carried along with human activity. The numbers of colony forming units were reduced by up to ~400 fold from the uncontrolled areas towards the ISO 5 cleanroom, accompanied with a reduction of the living portion of microorganisms from 45% (changing area) to 1% of total 16S rRNA gene signatures as revealed via propidium monoazide treatment of the samples. Our results demonstrate the strong effects of cleanroom maintenance on microbial communities in indoor environments and can be used to improve the design and operation of biologically controlled cleanrooms.« less

Quo vadis? Microbial profiling revealed strong effects of cleanroom maintenance and routes of contamination in indoor environments

PubMed Central

Moissl-Eichinger, Christine; Auerbach, Anna K.; Probst, Alexander J.; Mahnert, Alexander; Tom, Lauren; Piceno, Yvette; Andersen, Gary L.; Venkateswaran, Kasthuri; Rettberg, Petra; Barczyk, Simon; Pukall, Rüdiger; Berg, Gabriele

2015-01-01

Space agencies maintain highly controlled cleanrooms to ensure the demands of planetary protection. To study potential effects of microbiome control, we analyzed microbial communities in two particulate-controlled cleanrooms (ISO 5 and ISO 8) and two vicinal uncontrolled areas (office, changing room) by cultivation and 16S rRNA gene amplicon analysis (cloning, pyrotagsequencing, and PhyloChip G3 analysis). Maintenance procedures affected the microbiome on total abundance and microbial community structure concerning richness, diversity and relative abundance of certain taxa. Cleanroom areas were found to be mainly predominated by potentially human-associated bacteria; archaeal signatures were detected in every area. Results indicate that microorganisms were mainly spread from the changing room (68%) into the cleanrooms, potentially carried along with human activity. The numbers of colony forming units were reduced by up to ~400 fold from the uncontrolled areas towards the ISO 5 cleanroom, accompanied with a reduction of the living portion of microorganisms from 45% (changing area) to 1% of total 16S rRNA gene signatures as revealed via propidium monoazide treatment of the samples. Our results demonstrate the strong effects of cleanroom maintenance on microbial communities in indoor environments and can be used to improve the design and operation of biologically controlled cleanrooms. PMID:25778463

Quo vadis? Microbial profiling revealed strong effects of cleanroom maintenance and routes of contamination in indoor environments

NASA Astrophysics Data System (ADS)

Moissl-Eichinger, Christine; Auerbach, Anna K.; Probst, Alexander J.; Mahnert, Alexander; Tom, Lauren; Piceno, Yvette; Andersen, Gary L.; Venkateswaran, Kasthuri; Rettberg, Petra; Barczyk, Simon; Pukall, Rüdiger; Berg, Gabriele

2015-03-01

Space agencies maintain highly controlled cleanrooms to ensure the demands of planetary protection. To study potential effects of microbiome control, we analyzed microbial communities in two particulate-controlled cleanrooms (ISO 5 and ISO 8) and two vicinal uncontrolled areas (office, changing room) by cultivation and 16S rRNA gene amplicon analysis (cloning, pyrotagsequencing, and PhyloChip G3 analysis). Maintenance procedures affected the microbiome on total abundance and microbial community structure concerning richness, diversity and relative abundance of certain taxa. Cleanroom areas were found to be mainly predominated by potentially human-associated bacteria; archaeal signatures were detected in every area. Results indicate that microorganisms were mainly spread from the changing room (68%) into the cleanrooms, potentially carried along with human activity. The numbers of colony forming units were reduced by up to ~400 fold from the uncontrolled areas towards the ISO 5 cleanroom, accompanied with a reduction of the living portion of microorganisms from 45% (changing area) to 1% of total 16S rRNA gene signatures as revealed via propidium monoazide treatment of the samples. Our results demonstrate the strong effects of cleanroom maintenance on microbial communities in indoor environments and can be used to improve the design and operation of biologically controlled cleanrooms.

Quo vadis? Microbial profiling revealed strong effects of cleanroom maintenance and routes of contamination in indoor environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moissl-Eichinger, Christine; Auerbach, Anna K.; Probst, Alexander J.

Space agencies maintain highly controlled cleanrooms to ensure the demands of planetary protection. To study potential effects of microbiome control, we analyzed microbial communities in two particulate-controlled cleanrooms (ISO 5 and ISO 8) and two vicinal uncontrolled areas (office, changing room) by cultivation and 16S rRNA gene amplicon analysis (cloning, pyrotagsequencing, and PhyloChip G3 analysis). Maintenance procedures affected the microbiome on total abundance and microbial community structure concerning richness, diversity and relative abundance of certain taxa. Cleanroom areas were found to be mainly predominated by potentially human-associated bacteria; archaeal signatures were detected in every area. Results indicate that microorganisms weremore » mainly spread from the changing room (68%) into the cleanrooms, potentially carried along with human activity. The numbers of colony forming units were reduced by up to ~400 fold from the uncontrolled areas towards the ISO 5 cleanroom, accompanied with a reduction of the living portion of microorganisms from 45% (changing area) to 1% of total 16S rRNA gene signatures as revealed via propidium monoazide treatment of the samples. Our results demonstrate the strong effects of cleanroom maintenance on microbial communities in indoor environments and can be used to improve the design and operation of biologically controlled cleanrooms.« less

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

Spatial and temporal dynamics of the microbial community in the Hanford unconfined aquifer

PubMed Central

Lin, Xueju; McKinley, James; Resch, Charles T; Kaluzny, Rachael; Lauber, Christian L; Fredrickson, James; Knight, Rob; Konopka, Allan

2012-01-01

Pyrosequencing analysis of 16S rRNA genes was used to study temporal dynamics of groundwater bacteria and archaea over 10 months within three well clusters separated by ∼30 m and located 250 m from the Columbia River on the Hanford Site, WA. Each cluster contained three wells screened at different depths ranging from 10 to 17 m that differed in hydraulic conductivities. Representative samples were selected for analyses of prokaryotic 16S and eukaryotic 18S rRNA gene copy numbers. Temporal changes in community composition occurred in all nine wells over the 10-month sampling period. However, there were particularly strong effects near the top of the water table when the seasonal rise in the Columbia River caused river water intrusion at the top of the aquifer. The occurrence and disappearance of some microbial assemblages (such as Actinobacteria ACK-M1) were correlated with river water intrusion. This seasonal impact on microbial community structure was greater in the shallow saturated zone than deeper zone in the aquifer. Spatial and temporal patterns for several 16S rRNA gene operational taxonomic units associated with particular physiological functions (for example, methane oxidizers and metal reducers) suggests dynamic changes in fluxes of electron donors and acceptors over an annual cycle. In addition, temporal dynamics in eukaryotic 18S rRNA gene copies and the dominance of protozoa in 18S clone libraries suggest that bacterial community dynamics could be affected not only by the physical and chemical environment but also by top-down biological control. PMID:22456444

Spatial and temporal dynamics of the microbial community in the Hanford unconfined aquifer.

PubMed

Lin, Xueju; McKinley, James; Resch, Charles T; Kaluzny, Rachael; Lauber, Christian L; Fredrickson, James; Knight, Rob; Konopka, Allan

2012-09-01

Pyrosequencing analysis of 16S rRNA genes was used to study temporal dynamics of groundwater bacteria and archaea over 10 months within three well clusters separated by ~30 m and located 250 m from the Columbia River on the Hanford Site, WA. Each cluster contained three wells screened at different depths ranging from 10 to 17 m that differed in hydraulic conductivities. Representative samples were selected for analyses of prokaryotic 16S and eukaryotic 18S rRNA gene copy numbers. Temporal changes in community composition occurred in all nine wells over the 10-month sampling period. However, there were particularly strong effects near the top of the water table when the seasonal rise in the Columbia River caused river water intrusion at the top of the aquifer. The occurrence and disappearance of some microbial assemblages (such as Actinobacteria ACK-M1) were correlated with river water intrusion. This seasonal impact on microbial community structure was greater in the shallow saturated zone than deeper zone in the aquifer. Spatial and temporal patterns for several 16S rRNA gene operational taxonomic units associated with particular physiological functions (for example, methane oxidizers and metal reducers) suggests dynamic changes in fluxes of electron donors and acceptors over an annual cycle. In addition, temporal dynamics in eukaryotic 18S rRNA gene copies and the dominance of protozoa in 18S clone libraries suggest that bacterial community dynamics could be affected not only by the physical and chemical environment but also by top-down biological control.

Whole transcriptome analysis of the poultry red mite Dermanyssus gallinae (De Geer, 1778).

PubMed

Schicht, Sabine; Qi, Weihong; Poveda, Lucy; Strube, Christina

2014-03-01

SUMMARY Although the poultry red mite Dermanyssus gallinae (De Geer, 1778) is the major parasitic pest in poultry farming causing substantial economic losses every year, nucleotide data are rare in the public databases. Therefore, de novo sequencing covering the transcriptome of D. gallinae was carried out resulting in a dataset of 232 097 singletons and 42 130 contiguous sequences (contigs) which were subsequently clustered into 24 140 isogroups consisting of 35 788 isotigs. After removal of sequences possibly originating from bacteria or the chicken host, 267 464 sequences (231 657 singletons, 56 contigs and 35 751 isotigs) remained, of which 10·3% showed homology to proteins derived from other organisms. The most significant Blast top-hit species was the mite Metaseiulus occidentalis followed by the tick Ixodes scapularis. To gain functional knowledge of D. gallinae transcripts, sequences were mapped to Gene Ontology terms, Kyoto Encyclopedia of Gene and Genomes (KEGG) pathways and parsed to InterProScan. The transcriptome dataset provides new insights in general mite genetics and lays a foundation for future studies on stage-specific transcriptomics as well as genomic, proteomic, and metabolomic explorations and might provide new perspectives to control this parasitic mite by identifying possible drug targets or vaccine candidates. It is also worth noting that in different tested species of the class Arachnida no 28S rRNA was detectable in the rRNA profile, indicating that 28S rRNA might consists of two separate, hydrogen-bonded fragments, whose (heat-induced) disruption may led to co-migration with 18S rRNA.

Electrokinetic stringency control in self-assembled monolayer-based biosensors for multiplex urinary tract infection diagnosis.

PubMed

Liu, Tingting; Sin, Mandy L Y; Pyne, Jeff D; Gau, Vincent; Liao, Joseph C; Wong, Pak Kin

2014-01-01

Rapid detection of bacterial pathogens is critical toward judicious management of infectious diseases. Herein, we demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis. The in situ electrokinetic stringency control technique generates Joule heating induced temperature rise and electrothermal fluid motion directly on the sensor to improve its performance for detecting bacterial 16S rRNA, a phylogenetic biomarker. The dependence of the hybridization efficiency reveals that in situ electrokinetic stringency control is capable of discriminating single-base mismatches. With electrokinetic stringency control, the background noise due to the matrix effects of clinical urine samples can be reduced by 60%. The applicability of the system is demonstrated by multiplex detection of three uropathogenic clinical isolates with similar 16S rRNA sequences. The results demonstrate that electrokinetic stringency control can significantly improve the signal-to-noise ratio of the biosensor for multiplex urinary tract infection diagnosis. Urinary tract infections remain a significant cause of mortality and morbidity as secondary conditions often related to chronic diseases or to immunosuppression. Rapid and sensitive identification of the causative organisms is critical in the appropriate management of this condition. These investigators demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis, establishing that such an approach significantly improves the biosensor's signal-to-noise ratio. © 2013.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

PubMed Central

Chen, Z. Jeffrey; Pikaard, Craig S.

1997-01-01

Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

Archaeal homologs of eukaryotic methylation guide small nucleolar RNAs: lessons from the Pyrococcus genomes.

PubMed

Gaspin, C; Cavaillé, J; Erauso, G; Bachellerie, J P

2000-04-07

Ribose methylation is a prevalent type of nucleotide modification in rRNA. Eukaryotic rRNAs display a complex pattern of ribose methylations, amounting to 55 in yeast Saccharomyces cerevisiae and about 100 in vertebrates. Ribose methylations of eukaryotic rRNAs are each guided by a cognate small RNA, belonging to the family of box C/D antisense snoRNAs, through transient formation of a specific base-pairing at the rRNA modification site. In prokaryotes, the pattern of rRNA ribose methylations has been fully characterized in a single species so far, Escherichia coli, which contains only four ribose methylated rRNA nucleotides. However, the hyperthermophile archaeon Sulfolobus solfataricus contains, like eukaryotes, a large number of (yet unmapped) rRNA ribose methylations and homologs of eukaryotic box C/D small nucleolar ribonuclear proteins have been identified in archaeal genomes. We have therefore searched archaeal genomes for potential homologs of eukaryotic methylation guide small nucleolar RNAs, by combining searches for structured motifs with homology searches. We have identified a family of 46 small RNAs, conserved in the genomes of three hyperthermophile Pyrococcus species, which we have experimentally characterized in Pyrococcus abyssi. The Pyrococcus small RNAs, the first reported homologs of methylation guide small nucleolar RNAs in organisms devoid of a nucleus, appear as a paradigm of minimalist box C/D antisense RNAs. They differ from their eukaryotic homologs by their outstanding structural homogeneity, extended consensus box motifs and the quasi-systematic presence of two (instead of one) rRNA antisense elements. Remarkably, for each small RNA the two antisense elements always match rRNA sequences close to each other in rRNA structure, suggesting an important role in rRNA folding. Only a few of the predicted P. abyssi rRNA ribose methylations have been detected so far. Further analysis of these archaeal small RNAs could provide new insights into the origin and functions of methylation guide small nucleolar RNAs and illuminate the still elusive role of rRNA ribose methylations. Copyright 2000 Academic Press.

Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

PubMed

Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

2017-06-01

We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues. Interestingly, many bacterial species associated with postpartum uterine disease (i.e., Trueperella spp., Acinetobacter spp., Fusobacteria spp., Proteus spp., Prevotella spp., and Peptostreptococcus spp.) were also present in the uterus of virgin heifers and of pregnant cows. The presence of 16S rRNA gene sequence reads in the samples from the current study suggests that the uterine microbiome is established by the time a female reaches reproductive maturity, and that pregnancies are established and maintained in the presence of a uterine microbiome. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

PubMed

Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

2017-11-02

One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

Cyclin-dependent Kinase 9 Links RNA Polymerase II Transcription to Processing of Ribosomal RNA*

PubMed Central

Burger, Kaspar; Mühl, Bastian; Rohrmoser, Michaela; Coordes, Britta; Heidemann, Martin; Kellner, Markus; Gruber-Eber, Anita; Heissmeyer, Vigo; Strässer, Katja; Eick, Dirk

2013-01-01

Ribosome biogenesis is a process required for cellular growth and proliferation. Processing of ribosomal RNA (rRNA) is highly sensitive to flavopiridol, a specific inhibitor of cyclin-dependent kinase 9 (Cdk9). Cdk9 has been characterized as the catalytic subunit of the positive transcription elongation factor b (P-TEFb) of RNA polymerase II (RNAPII). Here we studied the connection between RNAPII transcription and rRNA processing. We show that inhibition of RNAPII activity by α-amanitin specifically blocks processing of rRNA. The block is characterized by accumulation of 3′ extended unprocessed 47 S rRNAs and the entire inhibition of other 47 S rRNA-specific processing steps. The transcription rate of rRNA is moderately reduced after inhibition of Cdk9, suggesting that defective 3′ processing of rRNA negatively feeds back on RNAPI transcription. Knockdown of Cdk9 caused a strong reduction of the levels of RNAPII-transcribed U8 small nucleolar RNA, which is essential for 3′ rRNA processing in mammalian cells. Our data demonstrate a pivotal role of Cdk9 activity for coupling of RNAPII transcription with small nucleolar RNA production and rRNA processing. PMID:23744076

Fluctuations and synchrony of RNA synthesis in nucleoli.

PubMed

Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

2015-06-01

Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Detection of rabbit and hare processed material in compound feeds by TaqMan real-time PCR.

PubMed

Pegels, N; López-Calleja, I; García, T; Martín, R; González, I

2013-01-01

Food and feed traceability has become a priority for governments due to consumer demand for comprehensive and integrated safety policies. In the present work, a TaqMan real-time PCR assay targeting the mitochondrial 12S rRNA gene was developed for specific detection of rabbit and hare material in animal feeds and pet foods. The technique is based on the use of three species-specific primer/probe detection systems targeting three 12S rRNA gene fragments: one from rabbit species, another one from hare species and a third fragment common to rabbit and hare (62, 102 and 75 bp length, respectively). A nuclear 18S rRNA PCR system, detecting a 77-bp amplicon, was used as positive amplification control. Assay performance and sensitivity were assessed through the analysis of a batch of laboratory-scale feeds treated at 133°C at 3 bar for 20 min to reproduce feed processing conditions dictated by European regulations. Successful detection of highly degraded rabbit and hare material was achieved at the lowest target concentration assayed (0.1%). Furthermore, the method was applied to 96 processed commercial pet food products to determine whether correct labelling had been used at the market level. The reported real-time PCR technique detected the presence of rabbit tissues in 80 of the 96 samples analysed (83.3%), indicating a possible labelling fraud in some pet foods. The real-time PCR method reported may be a useful tool for traceability purposes within the framework of feed control.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Changes in microbial community structure in the wake of Hurricanes Katrina and Rita.

PubMed

Amaral-Zettler, Linda A; Rocca, Jennifer D; Lamontagne, Michael G; Dennett, Mark R; Gast, Rebecca J

2008-12-15

Hurricanes have the potential to alter the structures of coastal ecosystems and generate pathogen-laden floodwaters thatthreaten public health. To examine the impact of hurricanes on urban systems, we compared microbial community structures in samples collected after Hurricane Katrina and before and after Hurricane Rita. We extracted environmental DNA and sequenced small-subunit rRNA (SSU rRNA) gene clone libraries to survey microbial communities in floodwater, water, and sediment samples collected from Lake Charles, Lake Pontchartrain, the 17th Street and Industrial Canals in New Orleans, and raw sewage. Correspondence analysis showed that microbial communities associated with sediments formed one cluster while communities associated with lake and Industrial Canal water formed a second. Communities associated with water from the 17th Street Canal and floodwaters collected in New Orleans showed similarity to communities in raw sewage and contained a number of sequences associated with possible pathogenic microbes. This suggests that a distinct microbial community developed in floodwaters following Hurricane Katrina and that microbial community structures as a whole might be sensitive indicators of ecosystem health and serve as "sentinels" of water quality in the environment.

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Identification of RNA species in the RNA-toxin complex and structure of the complex in Clostridium botulinum type E.

PubMed

Kitamura, Masaru

2002-02-15

Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).

The Diversity of Pea Microsymbionts in Various Types of Soils and Their Effects on Plant Host Productivity

PubMed Central

Wielbo, Jerzy; Podleśna, Anna; Kidaj, Dominika; Podleśny, Janusz; Skorupska, Anna

2015-01-01

The growth and yield of peas cultivated on eight different soils, as well as the diversity of pea microsymbionts derived from these soils were investigated in the present study. The experimental plot was composed of soils that were transferred from different parts of Poland more than a century ago. The soils were located in direct vicinity of each other in the experimental plot. All soils examined contained pea microsymbionts, which were suggested to belong to Rhizobium leguminosarum sv. viciae based on the nucleotide sequence of the partial 16S rRNA gene. PCR-RFLP analyses of the 16S-23S rRNA gene ITS region and nodD alleles revealed the presence of numerous and diversified groups of pea microsymbionts and some similarities between the tested populations, which may have been the result of the spread or displacement of strains. However, most populations retained their own genetic distinction, which may have been related to the type of soil. Most of the tested populations comprised low-effective strains for the promotion of pea growth. No relationships were found between the characteristics of soil and symbiotic effectiveness of rhizobial populations; however, better seed yield was obtained for soil with medium biological productivity inhabited by high-effective rhizobial populations than for soil with high agricultural quality containing medium-quality pea microsymbionts, and these results showed the importance of symbiosis for plant hosts. PMID:26370165

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

Phylogenetic comparisons of a coastal bacterioplankton community with its counterparts in open ocean and freshwater systems.

PubMed

Rappé; Vergin; Giovannoni

2000-09-01

In order to extend previous comparisons between coastal marine bacterioplankton communities and their open ocean and freshwater counterparts, here we summarize and provide new data on a clone library of 105 SSU rRNA genes recovered from seawater collected over the western continental shelf of the USA in the Pacific Ocean. Comparisons to previously published data revealed that this coastal bacterioplankton clone library was dominated by SSU rRNA gene phylotypes originally described from surface waters of the open ocean, but also revealed unique SSU rRNA gene lineages of beta Proteobacteria related to those found in clone libraries from freshwater habitats. beta Proteobacteria lineages common to coastal and freshwater samples included members of a clade of obligately methylotrophic bacteria, SSU rRNA genes affiliated with Xylophilus ampelinus, and a clade related to the genus Duganella. In addition, SSU rRNA genes were recovered from such previously recognized marine bacterioplankton SSU rRNA gene clone clusters as the SAR86, SAR11, and SAR116 clusters within the class Proteobacteria, the Roseobacter clade of the alpha subclass of the Proteobacteria, the marine group A/SAR406 cluster, and the marine Actinobacteria clade. Overall, these results support and extend previous observations concerning the global distribution of several marine planktonic prokaryote SSU rRNA gene phylotypes, but also show that coastal bacterioplankton communities contain SSU rRNA gene lineages (and presumably bacterioplankton) shown previously to be prevalent in freshwater habitats.

Molecular method for detection of total coliforms in drinking water samples.

PubMed

Maheux, Andrée F; Boudreau, Dominique K; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G; Rodriguez, Manuel J

2014-07-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Molecular Method for Detection of Total Coliforms in Drinking Water Samples

PubMed Central

Boudreau, Dominique K.; Bisson, Marc-Antoine; Dion-Dupont, Vanessa; Bouchard, Sébastien; Nkuranga, Martine; Bergeron, Michel G.; Rodriguez, Manuel J.

2014-01-01

This work demonstrates the ability of a bacterial concentration and recovery procedure combined with three different PCR assays targeting the lacZ, wecG, and 16S rRNA genes, respectively, to detect the presence of total coliforms in 100-ml samples of potable water (presence/absence test). PCR assays were first compared to the culture-based Colilert and MI agar methods to determine their ability to detect 147 coliform strains representing 76 species of Enterobacteriaceae encountered in fecal and environmental settings. Results showed that 86 (58.5%) and 109 (74.1%) strains yielded a positive signal with Colilert and MI agar methods, respectively, whereas the lacZ, wecG, and 16S rRNA PCR assays detected 133 (90.5%), 111 (75.5%), and 146 (99.3%) of the 147 total coliform strains tested. These assays were then assessed by testing 122 well water samples collected in the Québec City region of Canada. Results showed that 97 (79.5%) of the samples tested by culture-based methods and 95 (77.9%), 82 (67.2%), and 98 (80.3%) of samples tested using PCR-based methods contained total coliforms, respectively. Consequently, despite the high genetic variability of the total coliform group, this study demonstrated that it is possible to use molecular assays to detect total coliforms in potable water: the 16S rRNA molecular assay was shown to be as efficient as recommended culture-based methods. This assay might be used in combination with an Escherichia coli molecular assay to assess drinking water quality. PMID:24771030

The effect of column purification on cDNA indirect labelling for microarrays

PubMed Central

Molas, M Lia; Kiss, John Z

2007-01-01

Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

The effect of column purification on cDNA indirect labelling for microarrays.

PubMed

Molas, M Lia; Kiss, John Z

2007-06-27

The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Molecular exploration of fecal microbiome in quinoa-supplemented obese mice.

PubMed

Garcia-Mazcorro, Jose F; Mills, David; Noratto, Giuliana

2016-07-01

Diet affects gut microorganisms and dietary interventions can help treat obesity and overweight. Our aim was to investigate the effect of quinoa supplementation on fecal microbial ecology of obese diabetic mice. Obese db/db mice were fed commercial diets with and without quinoa supplementation for eight weeks; non-obese mice consuming non-supplemented diet served as lean-control. Fecal bacterial communities were analyzed using marker gene sequencing of 16S rRNA genes. Over 300 000 good-quality sequences were studied and assigned to 5774 different bacterial species (Operational Taxonomic Units at 97% similarity). Significant differences in bacterial abundances were found among the treatment groups, including some associated specifically with quinoa consumption. Analysis of weighted UniFrac distances revealed a distinctive clustering of lean microbial communities independently from obese-control and quinoa-supplemented mice (Analysis of Similarities, P < 0.01). Predicted functional profiles showed significant differences in 38 metabolic functions but most were due to a difference between lean samples compared to both obese-control and quinoa. Quinoa supplementation was associated with lower butyrate and succinic acid concentrations in cecum that were not necessarily more similar to those concentrations in lean mice. This study provides insight into the complex interactions between nutritional supplements and the gut microbiota thus informing future molecular analysis of the health benefits. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

PubMed Central

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2016-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage.

PubMed

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2014-08-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in trans in the presence of distant chromosome breaks.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

PubMed

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

A technical assessment of the porcine ejaculated spermatozoa for a sperm-specific RNA-seq analysis.

PubMed

Gòdia, Marta; Mayer, Fabiana Quoos; Nafissi, Julieta; Castelló, Anna; Rodríguez-Gil, Joan Enric; Sánchez, Armand; Clop, Alex

2018-04-26

The study of the boar sperm transcriptome by RNA-seq can provide relevant information on sperm quality and fertility and might contribute to animal breeding strategies. However, the analysis of the spermatozoa RNA is challenging as these cells harbor very low amounts of highly fragmented RNA, and the ejaculates also contain other cell types with larger amounts of non-fragmented RNA. Here, we describe a strategy for a successful boar sperm purification, RNA extraction and RNA-seq library preparation. Using these approaches our objectives were: (i) to evaluate the sperm recovery rate (SRR) after boar spermatozoa purification by density centrifugation using the non-porcine-specific commercial reagent BoviPure TM ; (ii) to assess the correlation between SRR and sperm quality characteristics; (iii) to evaluate the relationship between sperm cell RNA load and sperm quality traits and (iv) to compare different library preparation kits for both total RNA-seq (SMARTer Universal Low Input RNA and TruSeq RNA Library Prep kit) and small RNA-seq (NEBNext Small RNA and TailorMix miRNA Sample Prep v2) for high-throughput sequencing. Our results show that pig SRR (~22%) is lower than in other mammalian species and that it is not significantly dependent of the sperm quality parameters analyzed in our study. Moreover, no relationship between the RNA yield per sperm cell and sperm phenotypes was found. We compared a RNA-seq library preparation kit optimized for low amounts of fragmented RNA with a standard kit designed for high amount and quality of input RNA and found that for sperm, a protocol designed to work on low-quality RNA is essential. We also compared two small RNA-seq kits and did not find substantial differences in their performance. We propose the methodological workflow described for the RNA-seq screening of the boar spermatozoa transcriptome. FPKM: fragments per kilobase of transcript per million mapped reads; KRT1: keratin 1; miRNA: micro-RNA; miscRNA: miscellaneous RNA; Mt rRNA: mitochondrial ribosomal RNA; Mt tRNA: mitochondrial transference RNA; OAZ3: ornithine decarboxylase antizyme 3; ORT: osmotic resistance test; piRNA: Piwi-interacting RNA; PRM1: protamine 1; PTPRC: protein tyrosine phosphatase receptor type C; rRNA: ribosomal RNA; snoRNA: small nucleolar RNA; snRNA: small nuclear RNA; SRR: sperm recovery rate; tRNA: transfer RNA.

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial.

PubMed

Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul

2018-04-01

Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.

Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial

PubMed Central

Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul

2018-01-01

Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337

Archaeal and bacterial communities respond differently to environmental gradients in anoxic sediments of a California hypersaline lake, the Salton Sea.

PubMed

Swan, Brandon K; Ehrhardt, Christopher J; Reifel, Kristen M; Moreno, Lilliana I; Valentine, David L

2010-02-01

Sulfidic, anoxic sediments of the moderately hypersaline Salton Sea contain gradients in salinity and carbon that potentially structure the sedimentary microbial community. We investigated the abundance, community structure, and diversity of Bacteria and Archaea along these gradients to further distinguish the ecologies of these domains outside their established physiological range. Quantitative PCR was used to enumerate 16S rRNA gene abundances of Bacteria, Archaea, and Crenarchaeota. Community structure and diversity were evaluated by terminal restriction fragment length polymorphism (T-RFLP), quantitative analysis of gene (16S rRNA) frequencies of dominant microorganisms, and cloning and sequencing of 16S rRNA. Archaea were numerically dominant at all depths and exhibited a lesser response to environmental gradients than that of Bacteria. The relative abundance of Crenarchaeota was low (0.4 to 22%) at all depths but increased with decreased carbon content and increased salinity. Salinity structured the bacterial community but exerted no significant control on archaeal community structure, which was weakly correlated with total carbon. Partial sequencing of archaeal 16S rRNA genes retrieved from three sediment depths revealed diverse communities of Euryarchaeota and Crenarchaeota, many of which were affiliated with groups previously described from marine sediments. The abundance of these groups across all depths suggests that many putative marine archaeal groups can tolerate elevated salinity (5.0 to 11.8% [wt/vol]) and persist under the anaerobic conditions present in Salton Sea sediments. The differential response of archaeal and bacterial communities to salinity and carbon patterns is consistent with the hypothesis that adaptations to energy stress and availability distinguish the ecologies of these domains.

Target of Rapamycin Regulates Development and Ribosomal RNA Expression through Kinase Domain in Arabidopsis1[W][OA

PubMed Central

Ren, Maozhi; Qiu, Shuqing; Venglat, Prakash; Xiang, Daoquan; Feng, Li; Selvaraj, Gopalan; Datla, Raju

2011-01-01

Target of rapamycin (TOR) is a central regulator of cell growth, cell death, nutrition, starvation, hormone, and stress responses in diverse eukaryotes. However, very little is known about TOR signaling and the associated functional domains in plants. We have taken a genetic approach to dissect TOR functions in Arabidopsis (Arabidopsis thaliana) and report here that the kinase domain is essential for the role of TOR in embryogenesis and 45S rRNA expression. Twelve new T-DNA insertion mutants, spanning 14.2 kb of TOR-encoding genomic region, have been characterized. Nine of these share expression of defective kinase domain and embryo arrest at 16 to 32 cell stage. However, three T-DNA insertion lines affecting FATC domain displayed normal embryo development, indicating that FATC domain was dispensable in Arabidopsis. Genetic complementation showed that the TOR kinase domain alone in tor-10/tor-10 mutant background can rescue early embryo lethality and restore normal development. Overexpression of full-length TOR or kinase domain in Arabidopsis displayed developmental abnormalities in meristem, leaf, root, stem, flowering time, and senescence. We further show that TOR, especially the kinase domain, plays a role in ribosome biogenesis by activating 45S rRNA production. Of the six putative nuclear localization sequences in the kinase domain, nuclear localization sequence 6 was identified to confer TOR nuclear targeting in transient expression assays. Chromatin immunoprecipitation studies revealed that the HEAT repeat domain binds to 45S rRNA promoter and the 5′ external transcribed spacer elements motif. Together, these results show that TOR controls the embryogenesis, postembryonic development, and 45S rRNA production through its kinase domain in Arabidopsis. PMID:21266656

First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea.

PubMed

Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi

2016-07-01

In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.

Presence and mechanisms of acquired antimicrobial resistance in Belgian Brachyspira hyodysenteriae isolates belonging to different clonal complexes.

PubMed

Mahu, M; Pasmans, F; Vranckx, K; De Pauw, N; Vande Maele, L; Vyt, Philip; Vandersmissen, Tamara; Martel, A; Haesebrouck, F; Boyen, F

2017-08-01

Swine dysentery (SD) is an economically important disease for which antimicrobial treatment still occupies an important place to control outbreaks. However, acquired antimicrobial resistance is increasingly observed in Brachyspira hyodysenteriae. In this study, the Minimal Inhibitory Concentrations (MIC) of six antimicrobial compounds for 30 recent Belgian B. hyodysenteriae isolates were determined using a broth microdilution method. In addition, relevant regions of the 16S rRNA, 23S rRNA and the L3 protein encoding genes were sequenced to reveal mutations associated with acquired resistance. Finally, a phylogeny was reconstructed using minimal spanning tree analysis of multi locus sequence typing of the isolates. For lincomycin, doxycycline, tylosin and tylvalosin, at least 70% of the isolates did not belong to the wild-type population and were considered to have acquired resistance. For valnemulin and tiamulin, this was over 50%. In all isolates with acquired resistance to doxycycline, the G1058C mutation was present in their 16S rRNA gene. All isolates showing acquired resistance to lincomycin and both macrolides displayed the A2058T mutation in their 23S rRNA gene. Other mutations in this gene and the N148S mutation in the L3 protein were present in both wild-type isolates and isolates considered to have acquired resistance. Multi locus sequence analysis revealed a previously undescribed clonal complex, with 4 novel sequence types in which the majority of isolates showed acquired resistance to all tested antimicrobial products. In conclusion, acquired antimicrobial resistance is widespread among Belgian B. hyodysenteriae isolates. The emergence of multi-resistant clonal complexes can pose a threat to swine industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils

PubMed Central

Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.

2006-01-01

Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

Niche partitioning of marine group I Crenarchaeota in the euphotic and upper mesopelagic zones of the East China Sea.

PubMed

Hu, Anyi; Jiao, Nianzhi; Zhang, Rui; Yang, Zao

2011-11-01

Marine group I Crenarchaeota (MGI) represents a ubiquitous and numerically predominant microbial population in marine environments. An understanding of the spatial dynamics of MGI and its controlling mechanisms is essential for an understanding of the role of MGI in energy and element cycling in the ocean. In the present study, we investigated the diversity and abundance of MGI in the East China Sea (ECS) by analysis of crenarchaeal 16S rRNA gene, the ammonia monooxygenase gene amoA, and the biotin carboxylase gene accA. Quantitative PCR analyses revealed that these genes were higher in abundance in the mesopelagic than in the euphotic zone. In addition, the crenarchaeal amoA gene was positively correlated with the copy number of the MGI 16S rRNA gene, suggesting that most of the MGI in the ECS are nitrifiers. Furthermore, the ratios of crenarchaeal accA to amoA or to MGI 16S rRNA genes increased from the euphotic to the mesopelagic zone, suggesting that the role of MGI in carbon cycling may change from the epipelagic to the mesopelagic zones. Denaturing gradient gel electrophoretic profiling of the 16S rRNA genes revealed depth partitioning in MGI community structures. Clone libraries of the crenarchaeal amoA and accA genes showed both "shallow" and "deep" groups, and their relative abundances varied in the water column. Ecotype simulation analysis revealed that MGI in the upper ocean could diverge into special ecotypes associated with depth to adapt to the light gradient across the water column. Overall, our results showed niche partitioning of the MGI population and suggested a shift in their ecological functions between the euphotic and mesopelagic zones of the ECS.

Colorectal Cancer and the Human Gut Microbiome: Reproducibility with Whole-Genome Shotgun Sequencing

PubMed Central

Hua, Xing; Zeller, Georg; Sunagawa, Shinichi; Voigt, Anita Y.; Hercog, Rajna; Goedert, James J.; Shi, Jianxin; Bork, Peer; Sinha, Rashmi

2016-01-01

Accumulating evidence indicates that the gut microbiota affects colorectal cancer development, but previous studies have varied in population, technical methods, and associations with cancer. Understanding these variations is needed for comparisons and for potential pooling across studies. Therefore, we performed whole-genome shotgun sequencing on fecal samples from 52 pre-treatment colorectal cancer cases and 52 matched controls from Washington, DC. We compared findings from a previously published 16S rRNA study to the metagenomics-derived taxonomy within the same population. In addition, metagenome-predicted genes, modules, and pathways in the Washington, DC cases and controls were compared to cases and controls recruited in France whose specimens were processed using the same platform. Associations between the presence of fecal Fusobacteria, Fusobacterium, and Porphyromonas with colorectal cancer detected by 16S rRNA were reproduced by metagenomics, whereas higher relative abundance of Clostridia in cancer cases based on 16S rRNA was merely borderline based on metagenomics. This demonstrated that within the same sample set, most, but not all taxonomic associations were seen with both methods. Considering significant cancer associations with the relative abundance of genes, modules, and pathways in a recently published French metagenomics dataset, statistically significant associations in the Washington, DC population were detected for four out of 10 genes, three out of nine modules, and seven out of 17 pathways. In total, colorectal cancer status in the Washington, DC study was associated with 39% of the metagenome-predicted genes, modules, and pathways identified in the French study. More within and between population comparisons are needed to identify sources of variation and disease associations that can be reproduced despite these variations. Future studies should have larger sample sizes or pool data across studies to have sufficient power to detect associations that are reproducible and significant after correction for multiple testing. PMID:27171425

Key Markers of mTORC1-Dependent and mTORC1-Independent Signaling Pathways Regulating Protein Synthesis in Rat Soleus Muscle During Early Stages of Hindlimb Unloading.

PubMed

Mirzoev, Timur; Tyganov, Sergey; Vilchinskaya, Natalia; Lomonosova, Yulia; Shenkman, Boris

2016-01-01

The purpose of the study was to assess the amount of rRNA and phosphorylation status of the key markers of mTORC1-dependent (70s6k, 4E-BP1) and mTORC1-independent (GSK-3β, AMPK) signaling pathways controlling protein synthesis in rat soleus during early stages of mechanical unloading (hindlimb suspension (HS) for 1-, 3- and 7 days). The content of the key signaling molecules of various anabolic signaling pathways was determined by Western-blotting. The amount of 28S rRNA was evaluated by RT-PCR. The rate of protein synthesis was assessed using in-vivo SUnSET technique. HS for 3 and 7 days induced a significant (p<0.05) decrease in the rate of global protein synthesis in soleus muscle in comparison with control. HS within 24 hours resulted in a significant (p<0.05) decrease in p-4E-BP1 content, p-AMPK content and increase in p-p70s6k content in rat soleus muscle. Following three days of HS the content of p-AKT was decreased (p<0.05). After 7 days of HS the phosphorylation level of AKT and GSK-3beta was significantly reduced (p<0.05) compared to control. We also observed a significant decrease in the amount of 28S rRNA in rat soleus following 1, 3 and 7 days of HS. Taken together, the results of our study suggest that a decline in the global rate of protein synthesis in rat soleus during early stages of simulated microgravity is associated with impaired ribosome biogenesis as well as reduced activity of mTORC1-independent signaling pathways. © 2016 The Author(s) Published by S. Karger AG, Basel.

Real-Time Quantitative PCR (QPCR) and Reverse Transcription-QPCR for Detection and Enumeration of Total Yeasts in Wine▿

PubMed Central

Hierro, Núria; Esteve-Zarzoso, Braulio; González, Ángel; Mas, Albert; Guillamón, Jose M.

2006-01-01

Real-time PCR, or quantitative PCR (QPCR), has been developed to rapidly detect and quantify the total number of yeasts in wine without culturing. Universal yeast primers were designed from the variable D1/D2 domains of the 26S rRNA gene. These primers showed good specificity with all the wine yeasts tested, and they did not amplify the most representative wine species of acetic acid bacteria and lactic acid bacteria. Numerous standard curves were constructed with different strains and species grown in yeast extract-peptone-dextrose medium or incubated in wine. The small standard errors with these replicas proved that the assay is reproducible and highly robust. This technique was validated with artificially contaminated and natural wine samples. We also performed a reverse transcription-QPCR (RT-QPCR) assay from rRNA for total viable yeast quantification. This technique had a low detection limit and was more accurate than QPCR because the dead cells were not quantified. As far as we know, this is the first time that RT-QPCR has been performed to quantify viable yeasts from rRNA. RT-QPCR is a rapid and accurate technique for enumerating yeasts during industrial wine fermentation and controlling the risk of wine spoilage. PMID:17088381

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

PubMed Central

Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

2006-01-01

Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

PubMed

Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

2012-07-17

In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

PubMed Central

Triman, K L

1995-01-01

Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

Peracetic acid disinfection kinetics for combined sewer overflows: indicator organisms, antibiotic resistance genes, and microbial community.

PubMed

Eramo, Alessia; Medina, William Morales; Fahrenfeld, Nicole L

2017-01-01

Combined sewer overflows (CSOs) degrade water quality and end-of-pipe treatment is one potential solution for retrofitting this outdated infrastructure. The goal of this research was to evaluate peracetic acid (PAA) as a disinfectant for CSOs using viability based molecular methods for antibiotic resistance genes (ARGs), indicator organism marker gene BacHum, and 16S rRNA genes. Simulated CSO effluent was prepared using 23-40% wastewater, representing the higher end of the range of wastewater concentrations reported in CSO effluent. PAA residual following disinfection was greatest for samples with the lowest initial COD. Treatment of simulated CSO effluent (23% wastewater) with 100 mg∙min/L PAA (5 mg/L PAA, 20 min) was needed to reduce viable cell sul 1, tet (G), and BacHum (1.0±0.63-3.2±0.25-log) while 25 to 50 mg•min/L PAA (5 mg/L PAA, 5-10 min) was needed to reduce viable cell loads (0.62±0.56-1.6±0.08-log) in 40% wastewater from a different municipal treatment plant. Increasing contact time after the initial decrease in viable cell gene copies did not significantly improve treatment. A much greater applied Ct of 1200 mg∙min/L PAA (20 mg/L PAA, 60 min) was required for significant log reduction of 16S rRNA genes (3.29±0.13-log). No significant losses of mex B were observed during the study. Data were fitted to a Chick-Watson model and resulting inactivation constants for sul 1 and tet (G) > BacHum > 16S rRNA. Amplicon sequencing of the 16S rRNA gene indicated the initial viable and total microbial communities were distinct and that treatment with PAA resulted in marked increases of the relative abundance of select phyla, particularly Clostridia which increased by 1-1.5 orders of magnitude. Results confirm that membrane disruption is a mechanism for PAA disinfection and further treatment is needed to reduce total ARGs in CSO effluent.

Extrachromosomal Nucleolus-Like Compartmentalization by a Plasmid-Borne Ribosomal RNA Operon and Its Role in Nucleoid Compaction.

PubMed

Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun

2018-01-01

In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Nucleolar-nucleoplasmic shuttling of TARG1 and its control by DNA damage-induced poly-ADP-ribosylation and by nucleolar transcription.

PubMed

Bütepage, Mareike; Preisinger, Christian; von Kriegsheim, Alexander; Scheufen, Anja; Lausberg, Eva; Li, Jinyu; Kappes, Ferdinand; Feederle, Regina; Ernst, Sabrina; Eckei, Laura; Krieg, Sarah; Müller-Newen, Gerhard; Rossetti, Giulia; Feijs, Karla L H; Verheugd, Patricia; Lüscher, Bernhard

2018-04-30

Macrodomains are conserved protein folds associated with ADP-ribose binding and turnover. ADP-ribosylation is a posttranslational modification catalyzed primarily by ARTD (aka PARP) enzymes in cells. ARTDs transfer either single or multiple ADP-ribose units to substrates, resulting in mono- or poly-ADP-ribosylation. TARG1/C6orf130 is a macrodomain protein that hydrolyzes mono-ADP-ribosylation and interacts with poly-ADP-ribose chains. Interactome analyses revealed that TARG1 binds strongly to ribosomes and proteins associated with rRNA processing and ribosomal assembly factors. TARG1 localized to transcriptionally active nucleoli, which occurred independently of ADP-ribose binding. TARG1 shuttled continuously between nucleoli and nucleoplasm. In response to DNA damage, which activates ARTD1/2 (PARP1/2) and promotes synthesis of poly-ADP-ribose chains, TARG1 re-localized to the nucleoplasm. This was dependent on the ability of TARG1 to bind to poly-ADP-ribose. These findings are consistent with the observed ability of TARG1 to competitively interact with RNA and PAR chains. We propose a nucleolar role of TARG1 in ribosome assembly or quality control that is stalled when TARG1 is re-located to sites of DNA damage.

RNA polymerase I transcription in a Brassica interspecific hybrid and its progenitors: Tests of transcription factor involvement in nucleolar dominance.

PubMed Central

Frieman, M; Chen, Z J; Saez-Vasquez, J; Shen, L A; Pikaard, C S

1999-01-01

In interspecific hybrids or allopolyploids, often one parental set of ribosomal RNA genes is transcribed and the other is silent, an epigenetic phenomenon known as nucleolar dominance. Silencing is enforced by cytosine methylation and histone deacetylation, but the initial discrimination mechanism is unknown. One hypothesis is that a species-specific transcription factor is inactivated, thereby silencing one set of rRNA genes. Another is that dominant rRNA genes have higher binding affinities for limiting transcription factors. A third suggests that selective methylation of underdominant rRNA genes blocks transcription factor binding. We tested these hypotheses using Brassica napus (canola), an allotetraploid derived from B. rapa and B. oleracea in which only B. rapa rRNA genes are transcribed. B. oleracea and B. rapa rRNA genes were active when transfected into protoplasts of the other species, which argues against the species-specific transcription factor model. B. oleracea and B. rapa rRNA genes also competed equally for the pol I transcription machinery in vitro and in vivo. Cytosine methylation had no effect on rRNA gene transcription in vitro, which suggests that transcription factor binding was unimpaired. These data are inconsistent with the prevailing models and point to discrimination mechanisms that are likely to act at a chromosomal level. PMID:10224274

Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

PubMed

Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

2014-07-24

The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Variations in gut microbiota and fecal metabolic phenotype associated with depression by 16S rRNA gene sequencing and LC/MS-based metabolomics.

PubMed

Yu, Meng; Jia, Hongmei; Zhou, Chao; Yang, Yong; Zhao, Yang; Yang, Maohua; Zou, Zhongmei

2017-05-10

As a prevalent, life-threatening and highly recurrent psychiatric illness, depression is characterized by a wide range of pathological changes; however, its etiology remains incompletely understood. Accumulating evidence supports that gut microbiota affects not only gastrointestinal physiology but also central nervous system (CNS) function and behavior through the microbiota-gut-brain axis. To assess the impact of gut microbiota on fecal metabolic phenotype in depressive conditions, an integrated approach of 16S rRNA gene sequencing combined with ultra high-performance liquid chromatography-mass spectrometry (UHPLC-MS) based metabolomics was performed in chronic variable stress (CVS)-induced depression rat model. Interestingly, depression led to significant gut microbiota changes, at the phylum and genus levels in rats treated with CVS compared to controls. The relative abundances of the bacterial genera Marvinbryantia, Corynebacterium, Psychrobacter, Christensenella, Lactobacillus, Peptostreptococcaceae incertae sedis, Anaerovorax, Clostridiales incertae sedis and Coprococcus were significantly decreased, whereas Candidatus Arthromitus and Oscillibacter were markedly increased in model rats compared with normal controls. Meanwhile, distinct changes in fecal metabolic phenotype of depressive rats were also found, including lower levels of amino acids, and fatty acids, and higher amounts of bile acids, hypoxanthine and stercobilins. Moreover, there were substantial associations of perturbed gut microbiota genera with the altered fecal metabolites, especially compounds involved in the metabolism of tryptophan and bile acids. These results showed that the gut microbiota was altered in association with fecal metabolism in depressive conditions. These findings suggest that the 16S rRNA gene sequencing and LC-MS based metabolomics approach can be further applied to assess pathogenesis of depression. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of Microbiomes between Red Poultry Mite Populations (Dermanyssus gallinae): Predominance of Bartonella-like Bacteria.

PubMed

Hubert, Jan; Erban, Tomas; Kopecky, Jan; Sopko, Bruno; Nesvorna, Marta; Lichovnikova, Martina; Schicht, Sabine; Strube, Christina; Sparagano, Olivier

2017-11-01

Blood feeding red poultry mites (RPM) serve as vectors of pathogenic bacteria and viruses among vertebrate hosts including wild birds, poultry hens, mammals, and humans. The microbiome of RPM has not yet been studied by high-throughput sequencing. RPM eggs, larvae, and engorged adult/nymph samples obtained in four poultry houses in Czechia were used for microbiome analyses by Illumina amplicon sequencing of the 16S ribosomal RNA (rRNA) gene V4 region. A laboratory RPM population was used as positive control for transcriptome analysis by pyrosequencing with identification of sequences originating from bacteria. The samples of engorged adult/nymph stages had 100-fold more copies of 16S rRNA gene copies than the samples of eggs and larvae. The microbiome composition showed differences among the four poultry houses and among observed developmental stadia. In the adults' microbiome 10 OTUs comprised 90 to 99% of all sequences. Bartonella-like bacteria covered between 30 and 70% of sequences in RPM microbiome and 25% bacterial sequences in transcriptome. The phylogenetic analyses of 16S rRNA gene sequences revealed two distinct groups of Bartonella-like bacteria forming sister groups: (i) symbionts of ants; (ii) Bartonella genus. Cardinium, Wolbachia, and Rickettsiella sp. were found in the microbiomes of all tested stadia, while Spiroplasma eriocheiris and Wolbachia were identified in the laboratory RPM transcriptome. The microbiomes from eggs, larvae, and engorged adults/nymphs differed. Bartonella-like symbionts were found in all stadia and sampling sites. Bartonella-like bacteria was the most diversified group within the RPM microbiome. The presence of identified putative pathogenic bacteria is relevant with respect to human and animal health issues while the identification of symbiontic bacteria can lead to new control methods targeting them to destabilize the arthropod host.

Prokaryotic diversity and biochemical properties in aging artificial pit mud used for the production of Chinese strong flavor liquor.

PubMed

Sun, Zhongke; Chen, Can; Hou, Xiaoge; Zhang, Jie; Tian, Fengshou; Li, Chengwei

2017-10-01

At present, artificial pit mud (APM) is widely used in Chinese liquor-making industry and plays a particular role in the production of Chinese strong flavor liquor (CSFL). However, APM frequently ages during fermentation, thus becoming unsuitable for sustainable use due to its low-quality. The reasons behind, and results of, APM aging during the production of CSFL are not yet understood. Sequencing the V4 region of the 16S rRNA gene shows that prokaryotic diversity is significantly decreased (Shannon's diversity index, P  < 0.01) and community composition is distinctly changed (from 1197 to 865 OTUs) in aging APM. On the phylum level, the increase of Firmicutes and decrease of Proteobacteria are the main consequences of APM aging during the production of CSFL. The counting of cultivatable bacteria confirmed that there was a large increase in Lactobacilli and aerobic spore-forming bacteria in aging low-quality APM (more than twofold). Unexpectedly, the total number of caproic acid-producing bacteria, mainly Clostridia , did not change significantly between the two kinds of APM. Furthermore, biochemical analysis indicates that the pH and the levels of NH 4 + and K + are decreased in aging low-quality APM ( P  < 0.01). The results obtained in this study support the possibility that environmental factors (pH, nutrients) induce the decrease of prokaryotic diversity, and the changed community composition influences the environmental properties. Therefore, through interfering with the cycle, APM aging can be controlled potentially by adjustment of environmental factors and/or supplementation of diminished or missed microorganisms.

Improving the fermentation quality of wheat straw silage stored at low temperature by psychrotrophic lactic acid bacteria.

PubMed

Zhang, Miao; Lv, Haoxin; Tan, Zhongfang; Li, Ya; Wang, Yanping; Pang, Huili; Li, Zongwei; Jiao, Zhen; Jin, Qingsheng

2017-02-01

This study aimed to explore the feasible approaches to develop a silage production technique in regions with low temperatures. An effective low-temperature silage technology system was constructed and two frigostable Lactobacillus (L.) strains isolated from alpine pastures were selected and proved to be available for wheat straw silage at 5°C. The strains QZ227 and QZ887 were both identified as L. plantarum according to the phenotype, 16S rRNA, and RecA gene analysis. QZ227, QZ887 and a commercial inoculant FG1 consisting of L. plantarum were effective for improving the fermentation quality of wheat straws silage at 5°C for 30 days as indicated by the higher content of lactic acid and for 60 days by lower pH values, while the control with sterile water instead conferred reduced benefits. Additionally, silages fermented at low temperature proved to be acceptable for feeding livestock after being placed in a simulated environmental temperature of 20°C for 14 days to detect its edibility during the early spring when the temperature begins to rise. Both QZ227 and QZ887 showed potential applications of silage making in frigid areas and were effective inoculants in a low-temperature silage technology system. © 2016 Japanese Society of Animal Science.

Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

PubMed

Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

2015-03-10

One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the parasites. Conclusive functional proof of different rRNAs in regulating parasite development, however, is still absent or controversial. Here we functionally demonstrate for the first time that a stage-specifically expressed D-type small-subunit rRNA gene (D-ssu) is essential for oocyst development of the malaria parasite Plasmodium yoelii in the mosquito. This study also shows that variations in D-ssu sequence and/or the timing of transcription may have profound effects on parasite oocyst development. The results show that in addition to protein translation, rRNAs of malaria parasites also regulate parasite development and differentiation in a strain-specific manner, which can be explored for controlling parasite transmission. Copyright © 2015 Qi et al.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or translation factors, and areas related to translation fidelity, were found to undergo significant metal-induced conformational alterations, leading either to loosening of their structure or to more compact folding. These modifications were associated with parallel alterations in the translation process at multiple levels, a fact suggesting that structural perturbations in ribosomes, caused by metals, pose significant hurdles in translational efficiency and fidelity. Copyright © 2017 Elsevier B.V. All rights reserved.

Pyrosequencing analysis of oral microbiota in children with severe early childhood dental caries.

PubMed

Jiang, Wen; Zhang, Jie; Chen, Hui

2013-11-01

Severe early childhood caries are a prevalent public health problem among preschool children throughout the world. However, little is known about the microbiota found in association with severe early childhood caries. Our study aimed to explore the bacterial microbiota of dental plaques to study the etiology of severe early childhood caries through pyrosequencing analysis based on 16S rRNA gene V1-V3 hypervariable regions. Forty participants were enrolled in the study, and we obtained twenty samples of supragingival plaque from caries-free subjects and twenty samples from subjects with severe early childhood caries. A total of 175,918 reads met the quality control standards, and the bacteria found belonged to fourteen phyla and sixty-three genera. Our results show the overall structure and microbial composition of oral bacterial communities, and they suggest that these bacteria may present a core microbiome in the dental plaque microbiota. Three genera, Streptococcus, Granulicatella, and Actinomyces, were increased significantly in children with severe dental cavities. These data may facilitate improvements in the prevention and treatment of severe early childhood caries.

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

Detection of Aggregatibacter actinomycetemcomitans leukotoxin and fimbria-associated protein gene genotypes among periodontitis patients and healthy controls: A case–control study

PubMed Central

Mahalakshmi, Krishnan; Krishnan, Padma; Chandrasekaran, S. C.

2018-01-01

Background: Aggregatibacter actinomycetemcomitans has been reported in higher proportions in subgingival microbiota of individuals with aggressive periodontitis (AgP) compared with those with chronic periodontitis (ChP) and healthy controls. The major virulence factors are the ones that help in colonization and evasion of host's defenses. Hence, this study was aimed to assess the prevalence of A. actinomycetemcomitans 16S rRNA and its virulent genotypes (leukotoxin [lktA] and fimbria-associated protein [fap]). Materials and Methods: In this case– control study We performed periodontal examination and measured probing depth and clinical attachment level (CAL). Subgingival plaque samples from 200 (ChP: n = 128 and AgP: n = 72) periodontitis patients and 200 healthy controls were screened for the presence of A. actinomycetemcomitans 16S rRNA, lktA, and fap genotypes by polymerase chain reaction. The prevalence of genotypes between periodontitis patients and healthy controls was compared with Pearson's Chi-square test. P < 0.05 was considered statistically significant. Results: Mean pocket probing depth and CAL were high as compared to the healthy controls. The prevalence of A. actinomycetemcomitans in ChP (n = 128), AgP (n = 72), and healthy individuals (n = 200) was 32.0%, 61.1%, and 2.5%, respectively. A. actinomycetemcomitans lktA genotype prevalence was 71.8% among periodontitis patients, while A. actinomycetemcomitans fap genotype showed 31.8% prevalence. The prevalence of these genotypes was insignificant in healthy controls. Conclusion: The high odds ratio for A. actinomycetemcomitans prevalence suggests its strong link to periodontitis. Detection of A. actinomycetemcomitans lktA + genotype may be a useful marker for AgP as its prevalence was found to be high in AgP. PMID:29922337

The Ecological Dynamics of Fecal Contamination and Salmonella Typhi and Salmonella Paratyphi A in Municipal Kathmandu Drinking Water

PubMed Central

Walker, Alan W.; Thompson, Corinne N.; Torres, Andres; Dongol, Sabina; Tran Vu Thieu, Nga; Pham Thanh, Duy; Tran Thi Ngoc, Dung; Voong Vinh, Phat; Singer, Andrew C.; Parkhill, Julian; Thwaites, Guy; Basnyat, Buddha; Ferguson, Neil; Baker, Stephen

2016-01-01

One of the UN sustainable development goals is to achieve universal access to safe and affordable drinking water by 2030. It is locations like Kathmandu, Nepal, a densely populated city in South Asia with endemic typhoid fever, where this goal is most pertinent. Aiming to understand the public health implications of water quality in Kathmandu we subjected weekly water samples from 10 sources for one year to a range of chemical and bacteriological analyses. We additionally aimed to detect the etiological agents of typhoid fever and longitudinally assess microbial diversity by 16S rRNA gene surveying. We found that the majority of water sources exhibited chemical and bacterial contamination exceeding WHO guidelines. Further analysis of the chemical and bacterial data indicated site-specific pollution, symptomatic of highly localized fecal contamination. Rainfall was found to be a key driver of this fecal contamination, correlating with nitrates and evidence of S. Typhi and S. Paratyphi A, for which DNA was detectable in 333 (77%) and 303 (70%) of 432 water samples, respectively. 16S rRNA gene surveying outlined a spectrum of fecal bacteria in the contaminated water, forming complex communities again displaying location-specific temporal signatures. Our data signify that the municipal water in Kathmandu is a predominant vehicle for the transmission of S. Typhi and S. Paratyphi A. This study represents the first extensive spatiotemporal investigation of water pollution in an endemic typhoid fever setting and implicates highly localized human waste as the major contributor to poor water quality in the Kathmandu Valley. PMID:26735696

The Ecological Dynamics of Fecal Contamination and Salmonella Typhi and Salmonella Paratyphi A in Municipal Kathmandu Drinking Water.

PubMed

Karkey, Abhilasha; Jombart, Thibaut; Walker, Alan W; Thompson, Corinne N; Torres, Andres; Dongol, Sabina; Tran Vu Thieu, Nga; Pham Thanh, Duy; Tran Thi Ngoc, Dung; Voong Vinh, Phat; Singer, Andrew C; Parkhill, Julian; Thwaites, Guy; Basnyat, Buddha; Ferguson, Neil; Baker, Stephen

2016-01-01

One of the UN sustainable development goals is to achieve universal access to safe and affordable drinking water by 2030. It is locations like Kathmandu, Nepal, a densely populated city in South Asia with endemic typhoid fever, where this goal is most pertinent. Aiming to understand the public health implications of water quality in Kathmandu we subjected weekly water samples from 10 sources for one year to a range of chemical and bacteriological analyses. We additionally aimed to detect the etiological agents of typhoid fever and longitudinally assess microbial diversity by 16S rRNA gene surveying. We found that the majority of water sources exhibited chemical and bacterial contamination exceeding WHO guidelines. Further analysis of the chemical and bacterial data indicated site-specific pollution, symptomatic of highly localized fecal contamination. Rainfall was found to be a key driver of this fecal contamination, correlating with nitrates and evidence of S. Typhi and S. Paratyphi A, for which DNA was detectable in 333 (77%) and 303 (70%) of 432 water samples, respectively. 16S rRNA gene surveying outlined a spectrum of fecal bacteria in the contaminated water, forming complex communities again displaying location-specific temporal signatures. Our data signify that the municipal water in Kathmandu is a predominant vehicle for the transmission of S. Typhi and S. Paratyphi A. This study represents the first extensive spatiotemporal investigation of water pollution in an endemic typhoid fever setting and implicates highly localized human waste as the major contributor to poor water quality in the Kathmandu Valley.

Mitochondrial DNA variants observed in Alzheimer disease and Parkinson disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoffner, J.M.; Brown, M.D.; Torroni, A.

1993-07-01

Mitochondrial DNA (mtDNA) variants associated with Alzheimer disease (AD) and Parkinson disease (PD) were sought by restriction endonuclease analysis in a cohort of 71 late-onset Caucasian patients. A tRNA[sup Gln] gene variant at nucleotide pair (np) 4336 that altered a moderately conserved nucleotide was present in 9/173 (5.2%) of the patients surveyed but in only 0.7% of the general Caucasian controls. One of these patients harbored an additional novel 12S rRNA 5-nucleotide insertion at np 956-965, while a second had a missense variant at np 3397 that converted a highly conserved methionine to a valine. This latter mutation was alsomore » found in an independent AD + PD patient, as was a heteroplasmic 16S rRNA variant at np 3196. Additional studies will be required to determine the significance, if any, of these mutations. 122 refs., 4 figs., 2 tabs.« less

Advanced Protein Crystallization Facility (APCF)

NASA Technical Reports Server (NTRS)

1998-01-01

This section of the Life and Microgravity Spacelab (LMS) publication contains articles entitled: (1) Crystallization of EGFR-EGF; (2) Crystallization of Apocrustacyanin C1; (3) Crystallization and X-ray Analysis of 5S rRNA and the 5S rRNA Domain A; (4) Growth of Lysozyme Crystals at Low Nucleation Density; (5) Comparative Analysis of Aspartyl tRNA-synthetase and Thaumatin Crystals Grown on Earth and In Microgravity; (6) Lysosome Crystal Growth in the Advanced Protein Crystallization Facility Monitored via Mach-Zehnder Interferometry and CCD Video; (7) Analysis of Thaumatin Crystals Grown on Earth and in Microgravity; (8) Crystallization of the Nucleosome Core Particle; (9) Crystallization of Photosystem I; (10) Mechanism of Membrane Protein Crystal Growth: Bacteriorhodopsin-mixed Micelle Packing at the Consolution Boundary, Stabilized in Microgravity; (11) Crystallization in a Microgravity Environment of CcdB, a Protein Involved in the Control of Cell Death; and (12) Crystallization of Sulfolobus Solfataricus

Microbial Analysis of Bite Marks by Sequence Comparison of Streptococcal DNA

PubMed Central

Kennedy, Darnell M.; Stanton, Jo-Ann L.; García, José A.; Mason, Chris; Rand, Christy J.; Kieser, Jules A.; Tompkins, Geoffrey R.

2012-01-01

Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA) gene, 16S–23S intergenic spacer (ITS) and RNA polymerase beta subunit (rpoB). High throughput sequencing (GS FLX 454), followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants. PMID:23284761

Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

DOE PAGES

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

2015-02-06

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

PubMed Central

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

2015-01-01

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

Microbial profiles of a drinking water resource based on different 16S rRNA V regions during a heavy cyanobacterial bloom in Lake Taihu, China.

PubMed

Zhang, Junyi; Zhu, Congming; Guan, Rui; Xiong, Zhipeng; Zhang, Wen; Shi, Junzhe; Sheng, Yi; Zhu, Bingchuan; Tu, Jing; Ge, Qinyu; Chen, Ting; Lu, Zuhong

2017-05-01

Understanding of the bacterial community structure in drinking water resources helps to enhance the security of municipal water supplies. In this study, bacterial communities were surveyed in water and sediment during a heavy cyanobacterial bloom in a drinking water resource of Lake Taihu, China. A total of 325,317 high-quality sequences were obtained from different 16S ribosomal RNA (rRNA) regions (V3, V4, and V6) using the Miseq sequencing platform. A notable difference was shown between the water and sediment samples, as predominated by Cyanobacteria, Proteobacteria, and Actinobacteria in the water and Proteobacteria, Chloroflexi, and Verrucomicrobia in the sediment, respectively. The LD12 family dominated the water surface and was tightly associated with related indicators of cyanobacterial propagation, indicating involvement in the massive proliferation of cyanobacterial blooms. Alternatively, the genus Nitrospira dominated the sediment samples, which indicates that nitrite oxidation was very active in the sediment. Although pathogenic bacteria were not detected in a large amount, some genera such as Mycobacterium, Acinetobacter, and Legionella were still identified but in very low abundance. In addition, the effects of different V regions on bacterial diversity survey were evaluated. Overall, V4 and V3 were proven to be more promising V regions for bacterial diversity survey in water and sediment samples during heavy water blooms in Lake Taihu, respectively. As longer, cheaper, and faster DNA sequencing technologies become more accessible, we expect that bacterial community structures based on 16S rRNA amplicons as an indicator could be used alongside with physical and chemical indicators, to conduct comprehensive assessments for drinking water resource management.

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

NASA Technical Reports Server (NTRS)

Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

1987-01-01

A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

NASA Technical Reports Server (NTRS)

Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

1994-01-01

When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

PubMed Central

Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

1994-01-01

Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway.

PubMed

Grewal, Savraj S; Evans, Justin R; Edgar, Bruce A

2007-12-17

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA(-/-) mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth-regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components.

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway

PubMed Central

Grewal, Savraj S.; Evans, Justin R.; Edgar, Bruce A.

2007-01-01

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA −/− mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth–regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components. PMID:18086911

A critical role for noncoding 5S rRNA in regulating Mdmx stability.

PubMed

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

On the Rocks: Microbiological Quality and Microbial Diversity of Packaged Ice in Southern California.

PubMed

Lee, Kun Ho; Ab Samad, Liana S; Lwin, Phillip M; Riedel, Stefan F; Magin, Ashley; Bashir, Mina; Vaishampayan, Parag A; Lin, Wei-Jen

2017-06-01

Ice is defined as a food and is frequently used in direct contact with food and beverages. Packaged ice is commercially produced and can be easily found in grocery and convenience stores. However, the quality and safety of packaged ice products is not consistent. The Packaged Ice Quality Control Standards manual (PIQCS) published by the International Packaged Ice Association provides the quality and processing standards for packaged ice produced by its members. Packaged ice produced on the premise of stores (on-site packaged ice) is not required to be in compliance with these standards. In this study, packaged ice produced by manufacturing plants or by in-store bagger (ISB) machines and on-site packaged ice were compared for their microbiological quality and microbial diversity. Our results revealed that 19% of the 120 on-site packaged ice samples did not meet the PIQCS microbial limit of 500 CFU/mL (or g) and also the absence of coliforms and Escherichia coli . Staphylococci were found in 34% of the on-site packaged ice samples, most likely through contamination from the packaging workers. None of the ISB and manufactured packaged ice samples had unacceptable microbial levels, and all were devoid of staphylococci. Salmonella was absent in all samples analyzed in this study. Microbial community analysis of ice based on 16S/18S rRNA targeted sequencing revealed a much higher microbial diversity and abundance in the on-site packaged ice than in the ISB ice. Proteobacteria, especially Alphaproteobacteria and Betaproteobacteria, were the dominant bacterial groups in all samples tested. Most of these bacteria were oligotrophic; however, a few opportunistic or potential pathogens were found at low levels in the on-site packaged ice but not in the ISB packaged ice. The types of microbes identified may provide information needed to investigate potential sources of contamination. Our data also suggest a need for enforcement of processing standards during the on-site packaging of ice.

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

PubMed Central

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

PubMed

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.

PubMed

Lueders, Tillmann; Manefield, Mike; Friedrich, Michael W

2004-01-01

Stable isotope probing (SIP) of nucleic acids allows the detection and identification of active members of natural microbial populations that are involved in the assimilation of an isotopically labelled compound into nucleic acids. SIP is based on the separation of isotopically labelled DNA or rRNA by isopycnic density gradient centrifugation. We have developed a highly sensitive protocol for the detection of 'light' and 'heavy' nucleic acids in fractions of centrifugation gradients. It involves the fluorometric quantification of total DNA or rRNA, and the quantification of either 16S rRNA genes or 16S rRNA in gradient fractions by real-time PCR with domain-specific primers. Using this approach, we found that fully 13C-labelled DNA or rRNA of Methylobacterium extorquens was quantitatively resolved from unlabelled DNA or rRNA of Methanosarcina barkeri by cesium chloride or cesium trifluoroacetate density gradient centrifugation respectively. However, a constant low background of unspecific nucleic acids was detected in all DNA or rRNA gradient fractions, which is important for the interpretation of environmental SIP results. Consequently, quantitative analysis of gradient fractions provides a higher precision and finer resolution for retrieval of isotopically enriched nucleic acids than possible using ethidium bromide or gradient fractionation combined with fingerprinting analyses. This is a prerequisite for the fine-scale tracing of microbial populations metabolizing 13C-labelled compounds in natural ecosystems.

Drosophila mitochondrial DNA: a novel gene order.

PubMed Central

Clary, D O; Goddard, J M; Martin, S C; Fauron, C M; Wolstenholme, D R

1982-01-01

Part of the replication origin-containing A+T-rich region of the Drosophila yakuba mtDNA molecule and segments on either side of this region have been sequenced, and the genes within them identified. The data confirm that the small and large rRNA genes lie in tandem adjacent to that side of the A+T-rich region which is replicated first, and establish that a tRNAval gene lies between the two rRNA genes and that URF1 follows the large rRNA gene. The data further establish that the genes for tRNAile, tRNAgln, tRNAf-met and URF2 lie in the order given, on the opposite side of the A+T-rich region to the rRNA genes and, except for tRNAgln, are contained in the opposite strand to the rRNA, tRNAval and URF1 genes. This is in contrast to mammalian mtDNAs where all of these genes are located on the side of the replication origin which is replicated last, within the order tRNAphe, small (12S) rRNA, tRNAval, large (16S) rRNA, tRNAleu, URF1, tRNAile, tRNAgln, tRNAf-met and URF2, and, except tRNAgln, are all contained in the same (H) strand. In D. yakuba URF1 and URF2, the triplet AGA appears to specify an amino acid, which is again different from the situation found in mammalian mtDNAs, where AGA is used only as a rare termination codon. PMID:6294611

Single sample resolution of rare microbial dark matter in a marine invertebrate metagenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Ian J.; Weyna, Theodore R.; Fong, Stephen S.

Direct, untargeted sequencing of environmental samples (metagenomics) and de novo genome assembly enable the study of uncultured and phylogenetically divergent organisms. However, separating individual genomes from a mixed community has often relied on the differential-coverage analysis of multiple, deeply sequenced samples. In the metagenomic investigation of the marine bryozoan Bugula neritina, we uncovered seven bacterial genomes associated with a single B. neritina individual that appeared to be transient associates, two of which were unique to one individual and undetectable using certain “universal” 16S rRNA primers and probes. We recovered high quality genome assemblies for several rare instances of “microbial darkmore » matter,” or phylogenetically divergent bacteria lacking genomes in reference databases, from a single tissue sample that was not subjected to any physical or chemical pre-treatment. One of these rare, divergent organisms has a small (593 kbp), poorly annotated genome with low GC content (20.9%) and a 16S rRNA gene with just 65% sequence similarity to the closest reference sequence. Lastly, our findings illustrate the importance of sampling strategy and de novo assembly of metagenomic reads to understand the extent and function of bacterial biodiversity.« less

Single sample resolution of rare microbial dark matter in a marine invertebrate metagenome

DOE PAGES

Miller, Ian J.; Weyna, Theodore R.; Fong, Stephen S.; ...

2016-09-29

Direct, untargeted sequencing of environmental samples (metagenomics) and de novo genome assembly enable the study of uncultured and phylogenetically divergent organisms. However, separating individual genomes from a mixed community has often relied on the differential-coverage analysis of multiple, deeply sequenced samples. In the metagenomic investigation of the marine bryozoan Bugula neritina, we uncovered seven bacterial genomes associated with a single B. neritina individual that appeared to be transient associates, two of which were unique to one individual and undetectable using certain “universal” 16S rRNA primers and probes. We recovered high quality genome assemblies for several rare instances of “microbial darkmore » matter,” or phylogenetically divergent bacteria lacking genomes in reference databases, from a single tissue sample that was not subjected to any physical or chemical pre-treatment. One of these rare, divergent organisms has a small (593 kbp), poorly annotated genome with low GC content (20.9%) and a 16S rRNA gene with just 65% sequence similarity to the closest reference sequence. Lastly, our findings illustrate the importance of sampling strategy and de novo assembly of metagenomic reads to understand the extent and function of bacterial biodiversity.« less

CATCh, an Ensemble Classifier for Chimera Detection in 16S rRNA Sequencing Studies

PubMed Central

Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen

2014-01-01

In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins

DOE PAGES

Bagwell, Christopher E.; Noble, Peter A.; Milliken, Charles E.; ...

2018-03-09

Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and environmental DNA was extracted for 454 pyrosequencing of bacterial 16S rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy) hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levelsmore » of organic carbon were co-localized with the precipitant relative to bulk dissolved organic concentrations. Bacterial densities were highly variable between sampling locations and with depth within the water filled storage basin; cell numbers ranged from 4 × 10 3to 4 × 104 cells/mL. Bacterial diversity that was physically associated with the aluminum (oxy) hydroxide complexes exceeded an estimated 4,000 OTUs/amplicon library (3% cutoff) and the majority of sequences were aligned to the families Burkholderiaceae (23%), Nitrospiraceae (23%), Hyphomicrobiaceae (17%), and Comamonadaceae (6%). We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy) hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across a selection of natural and engineered aquatic ecosystems were performed and microbial community and taxonomic signatures unique to the spent nuclear fuel (SNF) storage basin environment were revealed. These insights could spur the development of tractable bio-indicators that are specific of and diagnostic for water quality at discrete locations and finer scales of resolution, marking an important contribution for improved water quality and management of SNF storage facilities.« less

Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bagwell, Christopher E.; Noble, Peter A.; Milliken, Charles E.

Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and environmental DNA was extracted for 454 pyrosequencing of bacterial 16S rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy) hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levelsmore » of organic carbon were co-localized with the precipitant relative to bulk dissolved organic concentrations. Bacterial densities were highly variable between sampling locations and with depth within the water filled storage basin; cell numbers ranged from 4 × 10 3to 4 × 104 cells/mL. Bacterial diversity that was physically associated with the aluminum (oxy) hydroxide complexes exceeded an estimated 4,000 OTUs/amplicon library (3% cutoff) and the majority of sequences were aligned to the families Burkholderiaceae (23%), Nitrospiraceae (23%), Hyphomicrobiaceae (17%), and Comamonadaceae (6%). We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy) hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across a selection of natural and engineered aquatic ecosystems were performed and microbial community and taxonomic signatures unique to the spent nuclear fuel (SNF) storage basin environment were revealed. These insights could spur the development of tractable bio-indicators that are specific of and diagnostic for water quality at discrete locations and finer scales of resolution, marking an important contribution for improved water quality and management of SNF storage facilities.« less

Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bagwell, Christopher E.; Noble, Peter A.; Milliken, Charles E.

Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and eDNA was extracted for pyrosequencing of bacterial rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy) hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levels of dissolved carbonmore » were co-localized with the precipitant relative to bulk water. Bacterial densities were highly variable between sampling locations and with depth; cell numbers (log scale) ranged from 5.6 to 4.89 cells / mL. Bacterial diversity that was physically associated with the aluminum (oxy) hydroxide complexes exceeded an estimated 4,000 OTUs / amplicon library (3% cutoff) and the greatest percent majority of sequences were aligned to the families Burkholderiales (23%), Nitrospiraceae (23%), Hyphomicrobiaceae (17%), and Comamonadaceae (6%). We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy) hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across diverse environmental landscapes were performed and microbiological signatures unique to the spent nuclear fuel storage basin environment were revealed. These insights could spur the development of tractable bioindicators that are specific of and diagnostic for water quality at discrete locations and finer scales of resolution, marking an important contribution for improved water quality and management of spent nuclear fuel storage facilities.« less

Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins.

PubMed

Bagwell, Christopher E; Noble, Peter A; Milliken, Charles E; Li, Dien; Kaplan, Daniel I

2018-01-01

Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and environmental DNA was extracted for 454 pyrosequencing of bacterial 16S rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy) hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levels of organic carbon were co-localized with the precipitant relative to bulk dissolved organic concentrations. Bacterial densities were highly variable between sampling locations and with depth within the water filled storage basin; cell numbers ranged from 4 × 10 3 to 4 × 10 4 cells/mL. Bacterial diversity that was physically associated with the aluminum (oxy) hydroxide complexes exceeded an estimated 4,000 OTUs/amplicon library (3% cutoff) and the majority of sequences were aligned to the families Burkholderiaceae (23%), Nitrospiraceae (23%), Hyphomicrobiaceae (17%), and Comamonadaceae (6%). We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy) hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across a selection of natural and engineered aquatic ecosystems were performed and microbial community and taxonomic signatures unique to the spent nuclear fuel (SNF) storage basin environment were revealed. These insights could spur the development of tractable bio-indicators that are specific of and diagnostic for water quality at discrete locations and finer scales of resolution, marking an important contribution for improved water quality and management of SNF storage facilities.

Amplicon Sequencing Reveals Microbiological Signatures in Spent Nuclear Fuel Storage Basins

PubMed Central

Bagwell, Christopher E.; Noble, Peter A.; Milliken, Charles E.; Li, Dien; Kaplan, Daniel I.

2018-01-01

Water quality is an important determinant for the structural integrity of alloy cladded fuels and assemblies during long-term wet storage. Detailed characterization of a water filled storage basin for spent nuclear reactor fuel was performed following the formation and proliferation of an amorphous white flocculent. White precipitant was sampled throughout the storage basin for chemical and spectroscopic characterization, and environmental DNA was extracted for 454 pyrosequencing of bacterial 16S rRNA gene diversity. Accordingly, spectroscopic analyses indicated the precipitant to be primarily amorphous to crystalline aluminum (oxy) hydroxides with minor associated elemental components including Fe, Si, Ti, and U. High levels of organic carbon were co-localized with the precipitant relative to bulk dissolved organic concentrations. Bacterial densities were highly variable between sampling locations and with depth within the water filled storage basin; cell numbers ranged from 4 × 103to 4 × 104 cells/mL. Bacterial diversity that was physically associated with the aluminum (oxy) hydroxide complexes exceeded an estimated 4,000 OTUs/amplicon library (3% cutoff) and the majority of sequences were aligned to the families Burkholderiaceae (23%), Nitrospiraceae (23%), Hyphomicrobiaceae (17%), and Comamonadaceae (6%). We surmise that episodic changes in the physical and chemical properties of the basin contribute to the polymerization of aluminum (oxy) hydroxides, which in turn can chemisorb nutrients, carbon ligands and bacterial cells from the surrounding bulk aqueous phase. As such, these precipitants should establish favorable microhabitats for bacterial colonization and growth. Comparative analyses of 16S rRNA gene amplicon libraries across a selection of natural and engineered aquatic ecosystems were performed and microbial community and taxonomic signatures unique to the spent nuclear fuel (SNF) storage basin environment were revealed. These insights could spur the development of tractable bio-indicators that are specific of and diagnostic for water quality at discrete locations and finer scales of resolution, marking an important contribution for improved water quality and management of SNF storage facilities. PMID:29593667

Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

PubMed

Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

2013-03-01

Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

ERIC Educational Resources Information Center

Guan, Min-Xin

2005-01-01

The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

PubMed Central

Xin, De-Dong; Wen, Jian-Fan

2012-01-01

Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID:22685540

Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

PubMed Central

Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

2017-01-01

Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

PubMed

Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

2017-11-01

Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In this work, we conclude that NTP and ppGpp concentrations can regulate synthesis of ribosomal proteins, but most of the effect of ppGpp is indirect as a consequence of translational feedback in response to changes in rRNA levels. Our results illustrate how effects of seemingly redundant regulatory mechanisms can be separated in time and that even when multiple mechanisms act concurrently their contributions are not necessarily equivalent. Copyright © 2017 American Society for Microbiology.

[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

Microbial Community Dynamics in Methane-Oxidizing Mesocosms from the Gulf of Mexico and U.S. Atlantic Margin

NASA Astrophysics Data System (ADS)

Redmond, M. C.; Sorgen, A. A.; Chan, E. W.; Kessler, J. D.

2016-12-01

Microbial methane oxidation at natural gas seeps plays an important role in reducing the amount of this greenhouse gas that reaches the atmosphere, but questions remain about the factors that control methane oxidation rates and organisms responsible. We collected water samples from methane seeps on the U.S. Atlantic Margin (Hudson Canyon) and the Gulf of Mexico and tracked aerobic methane oxidation with high resolution measurements of methane, carbon dioxide, and oxygen concentrations, stable isotopic changes in methane and carbon dioxide, trace metals and nutrients in ten replicate mesocosms from each site. At several time points, we collected DNA for 16S rRNA gene and metagenomic sequencing. Hudson Canyon seep mesocosm communities were dominated by methanotrophs from the family Methylococcaceae (>75% of 16S rRNA gene sequences in all samples). Methylococcaceae were also present in the Gulf of Mexico mesocosms, but were much less abundant (<50% of 16S rRNA gene sequences) and methane was consumed less rapidly than in the Hudson Canyon mesocosms. The Hudson Canyon seeps emit only methane, whereas the Gulf of Mexico seeps also emit ethane, propane, and other hydrocarbons. Consistent with this differing geochemistry, hydrocarbon degraders such as Colwellia and Cycloclasticus were also abundant in the Gulf of Mexico mesocosms, as were genes for the oxidation of longer chain alkanes and aromatic compounds.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

NASA Technical Reports Server (NTRS)

Winker, S.; Woese, C. R.

1991-01-01

The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

Theileria sp. Infections Associated with Bovine Fatalities in the United States Confirmed by Small-Subunit rRNA Gene Analyses of Blood and Tick Samples

PubMed Central

Chae, Joon-seok; Levy, Michael; Hunt, John; Schlater, Jack; Snider, Glen; Waghela, Suryakant D.; Holman, Patricia J.; Wagner, G. Gale

1999-01-01

Theileria sp.-specific small subunit (SSU) rRNA gene amplification confirmed the presence of the organism in cattle and in Amblyomma americanum and Dermacentor variabilis ticks collected from a cattle herd in Missouri. Blood from the index animal had type A and type D Theileria SSU rRNA genes. The type D gene was also found in blood from two cohort cattle and tick tissues. The type A SSU rRNA gene was previously reported from bovine Theileria isolates from Texas and North Carolina; the type D gene was reported from a Texas cow with theileriosis. PMID:10449501

Near full-length 16S rRNA gene next-generation sequencing revealed Asaia as a common midgut bacterium of wild and domesticated Queensland fruit fly larvae.

PubMed

Deutscher, Ania T; Burke, Catherine M; Darling, Aaron E; Riegler, Markus; Reynolds, Olivia L; Chapman, Toni A

2018-05-05

Gut microbiota affects tephritid (Diptera: Tephritidae) fruit fly development, physiology, behavior, and thus the quality of flies mass-reared for the sterile insect technique (SIT), a target-specific, sustainable, environmentally benign form of pest management. The Queensland fruit fly, Bactrocera tryoni (Tephritidae), is a significant horticultural pest in Australia and can be managed with SIT. Little is known about the impacts that laboratory-adaptation (domestication) and mass-rearing have on the tephritid larval gut microbiome. Read lengths of previous fruit fly next-generation sequencing (NGS) studies have limited the resolution of microbiome studies, and the diversity within populations is often overlooked. In this study, we used a new near full-length (> 1300 nt) 16S rRNA gene amplicon NGS approach to characterize gut bacterial communities of individual B. tryoni larvae from two field populations (developing in peaches) and three domesticated populations (mass- or laboratory-reared on artificial diets). Near full-length 16S rRNA gene sequences were obtained for 56 B. tryoni larvae. OTU clustering at 99% similarity revealed that gut bacterial diversity was low and significantly lower in domesticated larvae. Bacteria commonly associated with fruit (Acetobacteraceae, Enterobacteriaceae, and Leuconostocaceae) were detected in wild larvae, but were largely absent from domesticated larvae. However, Asaia, an acetic acid bacterium not frequently detected within adult tephritid species, was detected in larvae of both wild and domesticated populations (55 out of 56 larval gut samples). Larvae from the same single peach shared a similar gut bacterial profile, whereas larvae from different peaches collected from the same tree had different gut bacterial profiles. Clustering of the Asaia near full-length sequences at 100% similarity showed that the wild flies from different locations had different Asaia strains. Variation in the gut bacterial communities of B. tryoni larvae depends on diet, domestication, and horizontal acquisition. Bacterial variation in wild larvae suggests that more than one bacterial species can perform the same functional role; however, Asaia could be an important gut bacterium in larvae and warrants further study. A greater understanding of the functions of the bacteria detected in larvae could lead to increased fly quality and performance as part of the SIT.

The focus on sample quality: Influence of colon tissue collection on reliability of qPCR data

PubMed Central

Korenkova, Vlasta; Slyskova, Jana; Novosadova, Vendula; Pizzamiglio, Sara; Langerova, Lucie; Bjorkman, Jens; Vycital, Ondrej; Liska, Vaclav; Levy, Miroslav; Veskrna, Karel; Vodicka, Pavel; Vodickova, Ludmila; Kubista, Mikael; Verderio, Paolo

2016-01-01

Successful molecular analyses of human solid tissues require intact biological material with well-preserved nucleic acids, proteins, and other cell structures. Pre-analytical handling, comprising of the collection of material at the operating theatre, is among the first critical steps that influence sample quality. The aim of this study was to compare the experimental outcomes obtained from samples collected and stored by the conventional means of snap freezing and by PAXgene Tissue System (Qiagen). These approaches were evaluated by measuring rRNA and mRNA integrity of the samples (RNA Quality Indicator and Differential Amplification Method) and by gene expression profiling. The collection procedures of the biological material were implemented in two hospitals during colon cancer surgery in order to identify the impact of the collection method on the experimental outcome. Our study shows that the pre-analytical sample handling has a significant effect on the quality of RNA and on the variability of qPCR data. PAXgene collection mode proved to be more easily implemented in the operating room and moreover the quality of RNA obtained from human colon tissues by this method is superior to the one obtained by snap freezing. PMID:27383461

Metagenomic sequencing reveals the relationship between microbiota composition and quality of Chinese Rice Wine

PubMed Central

Hong, Xutao; Chen, Jing; Liu, Lin; Wu, Huan; Tan, Haiqin; Xie, Guangfa; Xu, Qian; Zou, Huijun; Yu, Wenjing; Wang, Lan; Qin, Nan

2016-01-01

Chinese Rice Wine (CRW) is a common alcoholic beverage in China. To investigate the influence of microbial composition on the quality of CRW, high throughput sequencing was performed for 110 wine samples on bacterial 16S rRNA gene and fungal Internal Transcribed Spacer II (ITS2). Bioinformatic analyses demonstrated that the quality of yeast starter and final wine correlated with microbial taxonomic composition, which was exemplified by our finding that wine spoilage resulted from a high proportion of genus Lactobacillus. Subsequently, based on Lactobacillus abundance of an early stage, a model was constructed to predict final wine quality. In addition, three batches of 20 representative wine samples selected from a pool of 110 samples were further analyzed in metagenomics. The results revealed that wine spoilage was due to rapid growth of Lactobacillus brevis at the early stage of fermentation. Gene functional analysis indicated the importance of some pathways such as synthesis of biotin, malolactic fermentation and production of short-chain fatty acid. These results led to a conclusion that metabolisms of microbes influence the wine quality. Thus, nurturing of beneficial microbes and inhibition of undesired ones are both important for the mechanized brewery. PMID:27241862

Metagenomic sequencing reveals the relationship between microbiota composition and quality of Chinese Rice Wine.

PubMed

Hong, Xutao; Chen, Jing; Liu, Lin; Wu, Huan; Tan, Haiqin; Xie, Guangfa; Xu, Qian; Zou, Huijun; Yu, Wenjing; Wang, Lan; Qin, Nan

2016-05-31

Chinese Rice Wine (CRW) is a common alcoholic beverage in China. To investigate the influence of microbial composition on the quality of CRW, high throughput sequencing was performed for 110 wine samples on bacterial 16S rRNA gene and fungal Internal Transcribed Spacer II (ITS2). Bioinformatic analyses demonstrated that the quality of yeast starter and final wine correlated with microbial taxonomic composition, which was exemplified by our finding that wine spoilage resulted from a high proportion of genus Lactobacillus. Subsequently, based on Lactobacillus abundance of an early stage, a model was constructed to predict final wine quality. In addition, three batches of 20 representative wine samples selected from a pool of 110 samples were further analyzed in metagenomics. The results revealed that wine spoilage was due to rapid growth of Lactobacillus brevis at the early stage of fermentation. Gene functional analysis indicated the importance of some pathways such as synthesis of biotin, malolactic fermentation and production of short-chain fatty acid. These results led to a conclusion that metabolisms of microbes influence the wine quality. Thus, nurturing of beneficial microbes and inhibition of undesired ones are both important for the mechanized brewery.

Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

PubMed Central

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

2013-01-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

PubMed

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

2013-10-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

A metagenomic approach to characterization of the vaginal microbiome signature in pregnancy.

PubMed

Aagaard, Kjersti; Riehle, Kevin; Ma, Jun; Segata, Nicola; Mistretta, Toni-Ann; Coarfa, Cristian; Raza, Sabeen; Rosenbaum, Sean; Van den Veyver, Ignatia; Milosavljevic, Aleksandar; Gevers, Dirk; Huttenhower, Curtis; Petrosino, Joseph; Versalovic, James

2012-01-01

While current major national research efforts (i.e., the NIH Human Microbiome Project) will enable comprehensive metagenomic characterization of the adult human microbiota, how and when these diverse microbial communities take up residence in the host and during reproductive life are unexplored at a population level. Because microbial abundance and diversity might differ in pregnancy, we sought to generate comparative metagenomic signatures across gestational age strata. DNA was isolated from the vagina (introitus, posterior fornix, midvagina) and the V5V3 region of bacterial 16S rRNA genes were sequenced (454FLX Titanium platform). Sixty-eight samples from 24 healthy gravidae (18 to 40 confirmed weeks) were compared with 301 non-pregnant controls (60 subjects). Generated sequence data were quality filtered, taxonomically binned, normalized, and organized by phylogeny and into operational taxonomic units (OTU); principal coordinates analysis (PCoA) of the resultant beta diversity measures were used for visualization and analysis in association with sample clinical metadata. Altogether, 1.4 gigabytes of data containing >2.5 million reads (averaging 6,837 sequences/sample of 493 nt in length) were generated for computational analyses. Although gravidae were not excluded by virtue of a posterior fornix pH >4.5 at the time of screening, unique vaginal microbiome signature encompassing several specific OTUs and higher-level clades was nevertheless observed and confirmed using a combination of phylogenetic, non-phylogenetic, supervised, and unsupervised approaches. Both overall diversity and richness were reduced in pregnancy, with dominance of Lactobacillus species (L. iners crispatus, jensenii and johnsonii, and the orders Lactobacillales (and Lactobacillaceae family), Clostridiales, Bacteroidales, and Actinomycetales. This intergroup comparison using rigorous standardized sampling protocols and analytical methodologies provides robust initial evidence that the vaginal microbial 16S rRNA gene catalogue uniquely differs in pregnancy, with variance of taxa across vaginal subsite and gestational age.

Community genomic analyses constrain the distribution of metabolic traits across the Chloroflexi phylum and indicate roles in sediment carbon cycling

PubMed Central

2013-01-01

Background Sediments are massive reservoirs of carbon compounds and host a large fraction of microbial life. Microorganisms within terrestrial aquifer sediments control buried organic carbon turnover, degrade organic contaminants, and impact drinking water quality. Recent 16S rRNA gene profiling indicates that members of the bacterial phylum Chloroflexi are common in sediment. Only the role of the class Dehalococcoidia, which degrade halogenated solvents, is well understood. Genomic sampling is available for only six of the approximate 30 Chloroflexi classes, so little is known about the phylogenetic distribution of reductive dehalogenation or about the broader metabolic characteristics of Chloroflexi in sediment. Results We used metagenomics to directly evaluate the metabolic potential and diversity of Chloroflexi in aquifer sediments. We sampled genomic sequence from 86 Chloroflexi representing 15 distinct lineages, including members of eight classes previously characterized only by 16S rRNA sequences. Unlike in the Dehalococcoidia, genes for organohalide respiration are rare within the Chloroflexi genomes sampled here. Near-complete genomes were reconstructed for three Chloroflexi. One, a member of an unsequenced lineage in the Anaerolinea, is an aerobe with the potential for respiring diverse carbon compounds. The others represent two genomically unsampled classes sibling to the Dehalococcoidia, and are anaerobes likely involved in sugar and plant-derived-compound degradation to acetate. Both fix CO2 via the Wood-Ljungdahl pathway, a pathway not previously documented in Chloroflexi. The genomes each encode unique traits apparently acquired from Archaea, including mechanisms of motility and ATP synthesis. Conclusions Chloroflexi in the aquifer sediments are abundant and highly diverse. Genomic analyses provide new evolutionary boundaries for obligate organohalide respiration. We expand the potential roles of Chloroflexi in sediment carbon cycling beyond organohalide respiration to include respiration of sugars, fermentation, CO2 fixation, and acetogenesis with ATP formation by substrate-level phosphorylation. PMID:24450983

Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

PubMed Central

Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

2009-01-01

Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

[Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

PubMed

Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

2013-07-04

Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

Nonenzymatic microorganism identification based on ribosomal RNA

NASA Astrophysics Data System (ADS)

Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

1999-11-01

Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

DNA extraction for streamlined metagenomics of diverse environmental samples.

PubMed

Marotz, Clarisse; Amir, Amnon; Humphrey, Greg; Gaffney, James; Gogul, Grant; Knight, Rob

2017-06-01

A major bottleneck for metagenomic sequencing is rapid and efficient DNA extraction. Here, we compare the extraction efficiencies of three magnetic bead-based platforms (KingFisher, epMotion, and Tecan) to a standardized column-based extraction platform across a variety of sample types, including feces, oral, skin, soil, and water. Replicate sample plates were extracted and prepared for 16S rRNA gene amplicon sequencing in parallel to assess extraction bias and DNA quality. The data demonstrate that any effect of extraction method on sequencing results was small compared with the variability across samples; however, the KingFisher platform produced the largest number of high-quality reads in the shortest amount of time. Based on these results, we have identified an extraction pipeline that dramatically reduces sample processing time without sacrificing bacterial taxonomic or abundance information.

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Location of rRNA transcription to the nucleolar components: disappearance of the fibrillar centers in nucleoli of regenerating rat hepatocytes.

PubMed

Montanaro, Lorenzo; Govoni, Marzia; Orrico, Catia; Treré, Davide; Derenzini, Massimo

2011-01-01

The precise location of rDNA transcription to the components of mammalian cell nucleolus is still debated. This was due to the fact that all the molecules necessary for rRNA synthesis are located in two of the three components, the fibrillar centers (FCs) and the dense fibrillar component (DFC), which together with the granular component (GC) are considered to be constantly present in mammalian cell nucleoli. In the present study we demonstrated that in nucleoli of many regenerating rat hepatocytes at 15 h after partial hepatectomy the FCs were no longer present, only the DFC and the GC being detected. At this time of regeneration the rRNA transcriptional activity was three fold that of resting hepatocytes, while the synthesis of DNA was not yet significantly increased, indicating that these nucleolar changes were due to the rRNA synthesis up-regulation. The DFC appeared to be organized in numerous, small, roundish tufts of fibrils. The silver staining procedure for AgNOR proteins, which are associated with the ribosomal genes, selectively and homogeneously stained these fibrillar tufts. Immuno-gold visualization of the Upstream Binding Factor (UBF), which is associated with the promoter region and the transcribed portion of the rRNA 45S gene, demonstrated that UBF was selectively located in the fibrillar tufts. We concluded that in proliferating rat hepatocytes the increased synthesis of rRNA induced an activation of the rRNA transcription machinery located in the fibrillar centers which, by becoming associated with the ribonucleoprotein transcripts, assumed the morphological pattern of the DFC.

Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation.

PubMed

Briggs, M W; Burkard, K T; Butler, J S

1998-05-22

The eukaryotic 25 S, 18 S, and 5.8 S rRNAs are synthesized as a single transcript with two internal transcribed spacers (ITS1 and ITS2), which are removed by endo- and exoribonucleolytic steps to produce mature rRNA. Genetic selection for suppressors of a polyadenylation defect yielded two cold-sensitive alleles of a gene that we named RRP6 (ribosomal RNA processing). Molecular cloning of RRP6 revealed its homology to a 100-kDa human, nucleolar PM-Scl autoantigen and to Escherichia coli RNase D, a 3'-5' exoribonuclease. Recessive mutations in rrp6 result in the accumulation of a novel 5. 8 S rRNA processing intermediate, called 5.8 S*, which has normal 5' ends, but retains approximately 30 nucleotides of ITS2. Pulse-chase analysis of 5.8 S rRNA processing in an rrp6- strain revealed a precursor-product relationship between 5.8 S* and 5.8 S rRNAs, suggesting that Rrp6p plays a role in the removal of the last 30 nucleotides of ITS2 from 5.8 S precursors. A portion of 5.8 S* rRNA assembles into 60 S ribosomes which form polyribosomes, suggesting that they function in protein synthesis. These findings indicate that Rrp6p plays a role in 5.8 S rRNA 3' end formation, and they identify a functional intermediate in the rRNA processing pathway.

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

The gut microbiome composition associates with bipolar disorder and illness severity.

PubMed

Evans, Simon J; Bassis, Christine M; Hein, Robert; Assari, Shervin; Flowers, Stephanie A; Kelly, Marisa B; Young, Vince B; Ellingrod, Vicky E; McInnis, Melvin G

2017-04-01

The gut microbiome is emerging as an important factor in regulating mental health yet it remains unclear what the target should be for psychiatric treatment. We aimed to elucidate the complement of the gut-microbiome community for individuals with bipolar disorder relative to controls; and test for relationships with burden of disease measures. We compared the stool microbiome from individuals with bipolar disorder (n = 115) and control subjects (n = 64) using 16S ribosomal RNA (rRNA) gene sequence analysis. Analysis of molecular variance (AMOVA) revealed global community case-control differences (AMOVA p = 0.047). Operational Taxonomical Unit (OTU) level analysis revealed significantly decreased fractional representation (p < 0.001) of Faecalibacterium after adjustment for age, sex, BMI and false discovery rate (FDR) correction at the p < 0.05 level. Within individuals with bipolar disorder, the fractional representation of Faecalibacterium associated with better self-reported health outcomes based on the Short Form Health Survey (SF12); the Patient Health Questionnaire (PHQ9); the Pittsburg Sleep Quality Index (PSQI); the Generalized Anxiety Disorder scale (GAD7); and the Altman Mania Rating Scale (ASRM), independent of covariates. This study provides the first detailed analysis of the gut microbiome relationships with multiple psychiatric domains from a bipolar population. The data support the hypothesis that targeting the microbiome may be an effective treatment paradigm for bipolar disorder. Copyright © 2016 Elsevier Ltd. All rights reserved.

hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

PubMed Central

Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

2015-01-01

Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

The E. coli 16S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein.

PubMed Central

Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C

1988-01-01

We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025

Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

PubMed Central

Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

2014-01-01

Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical modification (in the isolated rRNA), which suggests that considerable higher-order structure remains to be found (although all of it may not involve base-base interactions and so may not be detectable by comparative analysis). The agreement between the higher-order structure of the small-subunit rRNA and protection against chemical modification is not perfect, however; some bases shown to covary canonically are accessible to chemical modification (45).(ABSTRACT TRUNCATED AT 400 WORDS).

Recovery of microbial diversity and activity during bioremediation following chemical oxidation of diesel contaminated soils.

PubMed

Sutton, Nora B; Langenhoff, Alette A M; Lasso, Daniel Hidalgo; van der Zaan, Bas; van Gaans, Pauline; Maphosa, Farai; Smidt, Hauke; Grotenhuis, Tim; Rijnaarts, Huub H M

2014-03-01

To improve the coupling of in situ chemical oxidation and in situ bioremediation, a systematic analysis was performed of the effect of chemical oxidation with Fenton's reagent, modified Fenton's reagent, permanganate, or persulfate, on microbial diversity and activity during 8 weeks of incubation in two diesel-contaminated soils (peat and fill). Chemical oxidant and soil type affected the microbial community diversity and biodegradation activity; however, this was only observed following treatment with Fenton's reagent and modified Fenton's reagent, and in the biotic control without oxidation. Differences in the highest overall removal efficiencies of 69 % for peat (biotic control) and 59 % for fill (Fenton's reagent) were partially explained by changes in contaminant soil properties upon oxidation. Molecular analysis of 16S rRNA and alkane monooxygenase (alkB) gene abundances indicated that oxidation with Fenton's reagent and modified Fenton's reagent negatively affected microbial abundance. However, regeneration occurred, and final relative alkB abundances were 1-2 orders of magnitude higher in chemically treated microcosms than in the biotic control. 16S rRNA gene fragment fingerprinting with DGGE and prominent band sequencing illuminated microbial community composition and diversity differences between treatments and identified a variety of phylotypes within Alpha-, Beta-, and Gammaproteobacteria. Understanding microbial community dynamics during coupled chemical oxidation and bioremediation is integral to improved biphasic field application.

Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

USDA-ARS?s Scientific Manuscript database

This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

PubMed

Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

2010-06-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Vertical stratification of bacteria and archaea in sediments of a boreal stratified humic lake

NASA Astrophysics Data System (ADS)

Rissanen, Antti J.; Mpamah, Promise; Peura, Sari; Taipale, Sami; Biasi, Christina; Nykänen, Hannu

2015-04-01

Boreal stratified humic lakes, with steep redox gradients in the water column and in the sediment, are important sources of methane (CH4) to the atmosphere. CH4 flux from these lakes is largely controlled by the balance between CH4-production (methanogenesis), which takes place in the organic rich sediment and in the deepest water layers, and CH4-consumption (methanotrophy), which takes place mainly in the water column. While there is already some published information on the activity, diversity and community structure of bacteria in the water columns of these lakes, such information on sediment microbial communities is very scarce. This study aims to characterize the vertical variation patterns in the diversity and the structure of microbial communities in sediment of a boreal stratified lake. Particular focus is on microbes with the potential to contribute to methanogenesis (fermentative bacteria and methanogenic archaea) and to methanotrophy (methanotrophic bacteria and archaea). Two sediment cores (26 cm deep), collected from the deepest point (~6 m) of a small boreal stratified lake during winter-stratification, were divided into depth sections of 1 to 2 cm for analyses. Communities were studied from DNA extracted from sediment samples by next-generation sequencing (Ion Torrent) of polymerase chain reaction (PCR) - amplified bacterial and archaeal 16S rRNA gene amplicons. The abundance of methanogenic archaea was also specifically studied by quantitative-PCR of methyl coenzyme-M reductase gene (mcrA) amplicons. Furthermore, the community structure and the abundance of bacteria were studied by phospholipid fatty acid (PLFA) analysis. Dominant potential fermentative bacteria belonged to families Syntrophaceae, Clostridiaceae and Peptostreptococcaceae. There were considerable differences in the vertical distribution among these groups. The relative abundance of Syntrophaceae started to increase from the sediment surface, peaked at depth layer from 5 to 10 cm (up to 21 % of bacterial 16S rRNA gene amplicons) and decreased gradually towards deeper layers while the relative abundances of Clostridiaceae and Peptostreptococcaceae started to increase at deeper depths, at 5 cm and 10 cm, respectively, both peaking at depth layer from 20 to 26 cm (Clostridiaceae up to 13 % and Peptostreptococcaceae up to 11 % of bacterial 16S rRNA amplicons). Methanogenic community was dominated by acetoclastic methanogens (genus Methanosaeta), which were most abundant at depth layer from sediment surface to 10 cm (up to 87 % of archaeal 16S rRNA gene amplicons) and decreased drastically until the depth of 18 cm having quite stable relative abundance from 18 to 26 cm (5 to 11 % of archaeal 16S rRNA gene amplicons). Hydrogenotrophic methanogens (Methanoregula, Methanolinea, Methanospirillum, Methanocella) (3 to 11 % of archaeal 16S rRNA gene amplicons) did not show any specific depth patterns. The proportion of methanotrophic microbes was very low and they consisted almost completely of type II methanotrophic bacteria (family Methylocystaceae), which had highest relative abundance at depth layer from 5 to 10 cm (up to 3 % of bacterial 16S rRNA gene amplicons) and were almost absent below 15 cm. Anaerobic methanotrophic archaea were not detected. These findings will be discussed with results from PLFA and q-PCR analyses.

The Resilience of Microbial Community under Drying and Rewetting Cycles of Three Forest Soils.

PubMed

Zhou, Xue; Fornara, Dario; Ikenaga, Makoto; Akagi, Isao; Zhang, Ruifu; Jia, Zhongjun

2016-01-01

Forest soil ecosystems are associated with large pools and fluxes of carbon (C) and nitrogen (N), which could be strongly affected by variation in rainfall events under current climate change. Understanding how dry and wet cycle events might influence the metabolic state of indigenous soil microbes is crucial for predicting forest soil responses to environmental change. We used 454 pyrosequencing and quantitative PCR to address how present (DNA-based) and potentially active (RNA-based) soil bacterial communities might response to the changes in water availability across three different forest types located in two continents (Africa and Asia) under controlled drying and rewetting cycles. Sequencing of rRNA gene and transcript indicated that Proteobacteria, Actinobacteria, and Acidobacteria were the most responsive phyla to changes in water availability. We defined the ratio of rRNA transcript to rRNA gene abundance as a key indicator of potential microbial activity and we found that this ratio was increased following soil dry-down process whereas it decreased after soil rewetting. Following rewetting Crenarchaeota-like 16S rRNA gene transcript increased in some forest soils and this was linked to increases in soil nitrate levels suggesting greater nitrification rates under higher soil water availability. Changes in the relative abundance of (1) different microbial phyla and classes, and (2) 16S and amoA genes were found to be site- and taxa-specific and might have been driven by different life-strategies. Overall, we found that, after rewetting, the structure of the present and potentially active bacterial community structure as well as the abundance of bacterial (16S), archaeal (16S) and ammonia oxidizers (amoA), all returned to pre-dry-down levels. This suggests that microbial taxa have the ability to recover from desiccation, a critical response, which will contribute to maintaining microbial biodiversity in harsh ecosystems under environmental perturbations, such as significant changes in water availability.

The Resilience of Microbial Community under Drying and Rewetting Cycles of Three Forest Soils

PubMed Central

Zhou, Xue; Fornara, Dario; Ikenaga, Makoto; Akagi, Isao; Zhang, Ruifu; Jia, Zhongjun

2016-01-01

Forest soil ecosystems are associated with large pools and fluxes of carbon (C) and nitrogen (N), which could be strongly affected by variation in rainfall events under current climate change. Understanding how dry and wet cycle events might influence the metabolic state of indigenous soil microbes is crucial for predicting forest soil responses to environmental change. We used 454 pyrosequencing and quantitative PCR to address how present (DNA-based) and potentially active (RNA-based) soil bacterial communities might response to the changes in water availability across three different forest types located in two continents (Africa and Asia) under controlled drying and rewetting cycles. Sequencing of rRNA gene and transcript indicated that Proteobacteria, Actinobacteria, and Acidobacteria were the most responsive phyla to changes in water availability. We defined the ratio of rRNA transcript to rRNA gene abundance as a key indicator of potential microbial activity and we found that this ratio was increased following soil dry-down process whereas it decreased after soil rewetting. Following rewetting Crenarchaeota-like 16S rRNA gene transcript increased in some forest soils and this was linked to increases in soil nitrate levels suggesting greater nitrification rates under higher soil water availability. Changes in the relative abundance of (1) different microbial phyla and classes, and (2) 16S and amoA genes were found to be site- and taxa-specific and might have been driven by different life-strategies. Overall, we found that, after rewetting, the structure of the present and potentially active bacterial community structure as well as the abundance of bacterial (16S), archaeal (16S) and ammonia oxidizers (amoA), all returned to pre-dry-down levels. This suggests that microbial taxa have the ability to recover from desiccation, a critical response, which will contribute to maintaining microbial biodiversity in harsh ecosystems under environmental perturbations, such as significant changes in water availability. PMID:27486444

Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

PubMed

Mundus, D; Wollenzien, P

1998-11-01

Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.

Occurrence of Acquired 16S rRNA Methyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceae within a Tertiary Referral Hospital of Northeast India

PubMed Central

Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu

2017-01-01

ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725

Effects of Histone Deacetylase Inhibitor (HDACi); Trichostatin-A (TSA) on the expression of housekeeping genes.

PubMed

Mogal, Ashish; Abdulkadir, Sarki A

2006-04-01

In quantitative RT-PCR (qRT-PCR), analysis of gene expression is dependent on normalization using housekeeping genes such as 18S rRNA, GAPDH and beta actin. However, variability in their expression has been reported to be caused by factors like drug treatment, pathological states and cell-cycle phase. An emerging area of cancer research focuses on identifying the role of epigenetic alterations such as histone modifications and DNA methylation in the initiation and progression of cancer. Histone acetylation is the best studied modification so far and has been probed through the use of histone deacetylase inhibitors (HDACi). Further, modulation of histone acetylation is currently being explored as a therapeutic strategy in the treatment of cancer and HDACis have shown promise in inhibiting tumorigenesis and metastasis. Trichostatin-A (TSA) is the most widely used HDACi. Therefore, we were driven to identify a suitable internal control for RT-PCR following TSA treatment. We performed quantitative RT-PCR analysis using mouse prostate tissue explants, human prostate cancer (LNCaP) cells and human breast cancer (T-47D and ZR-75-1) cells following TSA treatment. Expression of housekeeping genes including 18S rRNA, beta actin, GAPDH and ribosomal highly-basic 23-kDa protein (rb 23-kDa, RPL13A) were compared in vehicle versus TSA treated samples. Our results showed marked variations in 18S rRNA, beta actin mRNA and GAPDH mRNA levels in mouse prostate explants and a human prostate cancer (LNCaP) cell line following TSA treatment. Furthermore, in two human breast cancer cell lines (T-47D and ZR-75-1) 18S rRNA, beta actin mRNA and GAPDH mRNA levels varied significantly. However, RPL13A mRNA levels remained constant in all the conditions tested. Therefore, we recommend use of RPL13A as a standard for normalization during TSA treatment.

The complete mitochondrial genome of the endangered spotback skate, Atlantoraja castelnaui.

PubMed

Duckett, Drew J L; Naylor, Gavin J P

2016-05-01

Chondrichthyes are a highly threatened class of organisms, largely due to overfishing and other human activities. The present study describes the complete mitochondrial genome (16,750 bp) of the endangered spotback skate, Atlantoraja castelnaui. The mitogenome is arranged in a typical vertebrate fashion, containing 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 1 control region.

Sample pooling for real-time PCR detection and virulence determination of the footrot pathogen Dichelobacter nodosus.

PubMed

Frosth, Sara; König, Ulrika; Nyman, Ann-Kristin; Aspán, Anna

2017-09-01

Dichelobacter nodosus is the principal cause of ovine footrot and strain virulence is an important factor in disease severity. Therefore, detection and virulence determination of D. nodosus is important for proper diagnosis of the disease. Today this is possible by real-time PCR analysis. Analysis of large numbers of samples is costly and laborious; therefore, pooling of individual samples is common in surveillance programs. However, pooling can reduce the sensitivity of the method. The aim of this study was to develop a pooling method for real-time PCR analysis that would allow sensitive detection and simultaneous virulence determination of D. nodosus. A total of 225 sheep from 17 flocks were sampled using ESwabs within the Swedish Footrot Control Program in 2014. Samples were first analysed individually and then in pools of five by real-time PCR assays targeting the 16S rRNA and aprV2/B2 genes of D. nodosus. Each pool consisted of four negative and one positive D. nodosus samples with varying amounts of the bacterium. In the individual analysis, 61 (27.1%) samples were positive in the 16S rRNA and the aprV2/B2 PCR assays and 164 (72.9%) samples were negative. All samples positive in the aprV2/B2 PCR-assay were of aprB2 variant. The pooled analysis showed that all 41 pools were also positive for D. nodosus 16S rRNA and the aprB2 variant. The diagnostic sensitivity for pooled and individual samples was therefore similar. Our method includes concentration of the bacteria before DNA-extraction. This may account for the maintenance of diagnostic sensitivity. Diagnostic sensitivity in the real-time PCR assays of the pooled samples were comparable to the sensitivity obtained for individually analysed samples. Even sub-clinical infections were able to be detected in the pooled PCR samples which is important for control of the disease. This method may therefore be implemented in footrot control programs where it can replace analysis of individual samples.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

PubMed

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

Association of nonribosomal nucleolar proteins in ribonucleoprotein complexes during interphase and mitosis.

PubMed

Piñol-Roma, S

1999-01-01

rRNA precursors are bound throughout their length by specific proteins, as the pre-rRNAs emerge from the transcription machinery. The association of pre-rRNA with proteins as ribonucleoprotein (RNP) complexes persists during maturation of 18S, 5.8S, and 28S rRNA, and through assembly of ribosomal subunits in the nucleolus. Preribosomal RNP complexes contain, in addition to ribosomal proteins, an unknown number of nonribosomal nucleolar proteins, as well as small nucleolar RNA-ribonucleoproteins (sno-RNPs). This report describes the use of a specific, rapid, and mild immunopurification approach to isolate and analyze human RNP complexes that contain nonribosomal nucleolar proteins, as well as ribosomal proteins and rRNA. Complexes immunopurified with antibodies to nucleolin-a major nucleolar RNA-binding protein-contain several distinct specific polypeptides that include, in addition to nucleolin, the previously identified nucleolar proteins B23 and fibrillarin, proteins with electrophoretic mobilities characteristic of ribosomal proteins including ribosomal protein S6, and a number of additional unidentified proteins. The physical association of these proteins with one another is mediated largely by RNA, in that the complexes dissociate upon digestion with RNase. Complexes isolated from M-phase cells are similar in protein composition to those isolated from interphase cell nuclear extracts. Therefore, the predominant proteins that associate with nucleolin in interphase remain in RNP complexes during mitosis, despite the cessation of rRNA synthesis and processing in M-phase. In addition, precursor rRNA, as well as processed 18S and 28S rRNA and candidate rRNA processing intermediates, is found associated with the immunopurified complexes. The characteristics of the rRNP complexes described here, therefore, indicate that they represent bona fide precursors of mature cytoplasmic ribosomal subunits.

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

PubMed Central

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

2010-01-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

Genetic relatedness of faecal coliforms and enterococci bacteria isolated from water and sediments of the Apies River, Gauteng, South Africa.

PubMed

Ekwanzala, Mutshiene Deogratias; Abia, Akebe Luther King; Ubomba-Jaswa, Eunice; Keshri, Jitendra; Momba, Ndombo Benteke Maggy

2017-12-01

To date, the microbiological quality of river sediments and its impact on water resources are not included in the water quality monitoring assessment. Therefore, the aim of this study was to establish genetic relatedness between faecal coliforms and enterococci isolated from the river water and riverbed sediments of Apies River to better understand the genetic similarity of microorganisms between the sediment and water phases. Indicator bacteria were subjected to a molecular study, which consisted of PCR amplification and sequence analysis of the 16S rRNA and 23S rRNA gene using specific primers for faecal coliforms and enterococci, respectively. Results revealed that the Apies River had high faecal pollution levels with enterococci showing low to moderate correlation coefficient (r 2 values ranged from 0.2605 to 0.7499) compared to the faecal coliforms which showed zero to low correlation (r 2 values ranged from 0.0027 to 0.1407) indicating that enterococci may be better indicator than faecal coliforms for detecting faecal contamination in riverbed sediments. The phylogenetic tree of faecal coliforms revealed a 98% homology among their nucleotide sequences confirming the close genetic relatedness between river water and riverbed sediment isolates. The phylogenetic tree of the enterococci showed that Enterococcus faecalis and Enterococcus faecium are the predominant species found in both river water and riverbed sediments with bootstrap values of ≥99%. A high degree of genetic relatedness between sediment and water isolates indicated a possible common ancestry and transmission pathway. We recommend the microbial monitoring of riverbed sediments as it harbours more diverse microbial community and once resuspended may cause health and environmental problems.

Temperature and Nutrient Effects on Periphyton Associated Bacterial Communities in Continuous Flow-Through Estuarine Mesocosms

NASA Astrophysics Data System (ADS)

Houghton, K.; James, J. B.; Devereux, R.; Friedman, S. D.

2016-02-01

Nutrient pollution is a leading cause of water quality impairments and degraded aquatic ecosystem condition. Reliable and reproducible indicators of ecosystem condition are needed to help manage nutrient pollution. The diatom component of periphyton has been used as a water quality indicator due to identifiable cell morphology and existence of relationships between nutrient concentration and diatom community composition. However, morphological identification of diatoms requires highly specialized personnel, is very time consuming, and can produce variable results, suggesting the need for alternative methods that are less expensive and more reproducible. DNA sequencing of the bacterial 16S rRNA gene is well documented and provides genus-level resolution of the community structure. The goal of this study was to evaluate the effects of nutrient loading and temperature on periphyton-associated bacterial communities using standard periphytometer techniques and next generation sequencing technologies. Continuous flow mesocosms were established in an eight tank system consisting of two temperature conditions (10°C and 20°C) and four nutrient conditions (1x to 6x ambient concentrations). Experimental conditions were replicated in July/August 2013 and September 2013. Replicate DNA samples were extracted and the 16S rRNA gene was sequenced using universal Bacterial primers. Initial analyses revealed strong differences in community structure based on temperature (p < 0.01, R = 0.997) and sampling month (p < 0.01, R = 0.993) while no significant differences were detected between nutrient treatments. These results suggest that the method can detect changes in periphyton associated bacterial communities based on temperature but a more refined approach, as might be based on functional genes instead of structural genes, may be needed to differentiate nutrient effects.

Isolation and identification of multidrug-resistant Staphylococcus haemolyticus from a laboratory-breeding mouse.

PubMed

Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu

2011-06-01

To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

PubMed Central

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-01-01

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription

PubMed Central

Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-01-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380

BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.

PubMed

Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

2012-03-01

Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.

Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

PubMed

Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

2014-01-01

The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

DMR1 (CCM1/YGR150C) of Saccharomyces cerevisiae encodes an RNA-binding protein from the pentatricopeptide repeat family required for the maintenance of the mitochondrial 15S ribosomal RNA.

PubMed

Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel

2010-04-01

Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

PubMed

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

NASA Technical Reports Server (NTRS)

Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.

1993-01-01

A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Occurrence and impact of the root-rot biocontrol agent Phlebiopsis gigantea on soil fungal communities in Picea abies forests of northern Europe.

PubMed

Menkis, Audrius; Burokienė, Daiva; Gaitnieks, Talis; Uotila, Antti; Johannesson, Hanna; Rosling, Anna; Finlay, Roger D; Stenlid, Jan; Vasaitis, Rimvydas

2012-08-01

The aim of this study was to assess belowground occurrence, persistence and possible impact of the biocontrol agent Phlebiopsis gigantea (Fr.) Jülich on soil fungi. Sampling of soil and roots of Picea abies (L.) H. Karst. was carried out at 12 P. gigantea-treated and five nontreated control sites representing 1- to 60-month-old clear-cuts and thinned forest sites in Finland and Latvia. The 454-sequencing of ITS rRNA from fine roots, humus and mineral soil resulted in 8626 high-quality fungal sequences. Phlebiopsis gigantea represented 1.3% of all fungal sequences and was found in 14 treated and nontreated sites and in all three substrates. In different substrates, the relative abundance of P. gigantea at stump treatment sites either did not differ significantly or was significantly lower than in nontreated controls. No significant correlation was found between the time elapsed since the tree harvesting and/or application of the biocontrol and abundance of P. gigantea in different substrates. In conclusion, the results demonstrate that P. gigantea occasionally occurs belowground in forest ecosystems but that stump treatment with the biocontrol agent has little or no impact on occurrence and persistence of P. gigantea belowground, and consequently no significant impact on soil fungi. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Arbuscular mycorrhizal fungi diversity influenced by different agricultural management practices in a semi-arid Mediterranean agro-ecosystem

NASA Astrophysics Data System (ADS)

de Mar Alguacil, Maria; Torrecillas, Emma; Garcia-Orenes, Fuensanta; Torres, Maria Pilar; Roldan, Antonio

2013-04-01

The arbuscular mycorrhizal fungi (AMF) are a key, integral component of the stability, sustainability and functioning of ecosystems. In this study a field experiment was performed at the El Teularet-Sierra de Enguera Experimental Station (eastern Spain) to assess the influence during a 6-yr period of different agricultural practices on the diversity of arbuscular mycorrhizal fungi (AMF). The management practices included residual herbicide use, ploughing, ploughing + oats, addition of oat straw mulch and a control (land abandonment). Adjacent soil under natural vegetation was used as a reference for local, high-quality soil and as a control for comparison with the agricultural soils under different management practices. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, sequencing and phylogenetic analyses. Thirty-six different phylotypes were identified, which were grouped in four families: Glomeraceae, Paraglomeraceae, Ambisporaceae and Claroideoglomeraceae. The first results showed significant differences in the distribution of the AMF phylotypes as consequence of the difference between agricultural management practices. Thus, the lowest diversity was observed for the plot that was treated with herbicide. The management practices including ploughing and ploughing + oats had similar AMF diversity. Oat straw mulching yielded the highest number of different AMF sequence types and showed the highest diversity index. Thus, this treatment could be more suitable in sustainable soil use and therefore protection of biodiversity.

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

PubMed

Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

2015-02-01

The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

[Design of primers to DNA of lactic acid bacteria].

PubMed

Lashchevskiĭ, V V; Kovalenko, N K

2003-01-01

Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

Drivers shaping the diversity and biogeography of total and active bacterial communities in the South China Sea

PubMed Central

Zhang, Yao; Zhao, Zihao; Dai, Minhan; Jiao, Nianzhi; Herndl, Gerhard J

2014-01-01

To test the hypothesis that different drivers shape the diversity and biogeography of the total and active bacterial community, we examined the bacterial community composition along two transects, one from the inner Pearl River estuary to the open waters of the South China Sea (SCS) and the other from the Luzon Strait to the SCS basin, using 454 pyrosequencing of the 16S rRNA and 16S rRNA gene (V1-3 regions) and thereby characterizing the active and total bacterial community, respectively. The diversity and biogeographic patterns differed substantially between the active and total bacterial communities. Although the composition of both the total and active bacterial community was strongly correlated with environmental factors and weakly correlated with geographic distance, the active bacterial community displayed higher environmental sensitivity than the total community and particularly a greater distance effect largely caused by the active assemblage from deep waters. The 16S rRNA vs. rDNA relationships indicated that the active bacteria were low in relative abundance in the SCS. This might be due to a high competition between active bacterial taxa as indicated by our community network models. Based on these analyses, we speculate that high competition could cause some dispersal limitation of the active bacterial community resulting in a distinct distance-decay relationship. Altogether, our results indicated that the biogeographic distribution of bacteria in the SCS is the result of both environmental control and distance decay. PMID:24684298

Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba hosts in two chloraminated drinking water distribution systems.

PubMed

Wang, Hong; Edwards, Marc; Falkinham, Joseph O; Pruden, Amy

2012-09-01

The spread of opportunistic pathogens via public water systems is of growing concern. The purpose of this study was to identify patterns of occurrence among three opportunistic pathogens (Legionella pneumophila, Mycobacterium avium, and Pseudomonas aeruginosa) relative to biotic and abiotic factors in two representative chloraminated drinking water distribution systems using culture-independent methods. Generally, a high occurrence of Legionella (≥69.0%) and mycobacteria (100%), lower occurrence of L. pneumophila (≤20%) and M. avium (≤33.3%), and rare detection of Pseudomonas aeruginosa (≤13.3%) were observed in both systems according to quantitative PCR. Also, Hartmanella vermiformis was more prevalent than Acanthamoeba, both of which are known hosts for opportunistic pathogen amplification, the latter itself containing pathogenic members. Three-minute flushing served to distinguish distribution system water from plumbing in buildings (i.e., premise plumbing water) and resulted in reduced numbers of copies of Legionella, mycobacteria, H. vermiformis, and 16S rRNA genes (P < 0.05) while yielding distinct terminal restriction fragment polymorphism (T-RFLP) profiles of 16S rRNA genes. Within certain subgroups of samples, some positive correlations, including correlations of numbers of mycobacteria and total bacteria (16S rRNA genes), H. vermiformis and total bacteria, mycobacteria and H. vermiformis, and Legionella and H. vermiformis, were noted, emphasizing potential microbial ecological relationships. Overall, the results provide insight into factors that may aid in controlling opportunistic pathogen proliferation in real-world water systems.

Molecular Survey of the Occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and Amoeba Hosts in Two Chloraminated Drinking Water Distribution Systems

PubMed Central

Wang, Hong; Edwards, Marc; Falkinham, Joseph O.

2012-01-01

The spread of opportunistic pathogens via public water systems is of growing concern. The purpose of this study was to identify patterns of occurrence among three opportunistic pathogens (Legionella pneumophila, Mycobacterium avium, and Pseudomonas aeruginosa) relative to biotic and abiotic factors in two representative chloraminated drinking water distribution systems using culture-independent methods. Generally, a high occurrence of Legionella (≥69.0%) and mycobacteria (100%), lower occurrence of L. pneumophila (≤20%) and M. avium (≤33.3%), and rare detection of Pseudomonas aeruginosa (≤13.3%) were observed in both systems according to quantitative PCR. Also, Hartmanella vermiformis was more prevalent than Acanthamoeba, both of which are known hosts for opportunistic pathogen amplification, the latter itself containing pathogenic members. Three-minute flushing served to distinguish distribution system water from plumbing in buildings (i.e., premise plumbing water) and resulted in reduced numbers of copies of Legionella, mycobacteria, H. vermiformis, and 16S rRNA genes (P < 0.05) while yielding distinct terminal restriction fragment polymorphism (T-RFLP) profiles of 16S rRNA genes. Within certain subgroups of samples, some positive correlations, including correlations of numbers of mycobacteria and total bacteria (16S rRNA genes), H. vermiformis and total bacteria, mycobacteria and H. vermiformis, and Legionella and H. vermiformis, were noted, emphasizing potential microbial ecological relationships. Overall, the results provide insight into factors that may aid in controlling opportunistic pathogen proliferation in real-world water systems. PMID:22752174

Conserved Regulators of Nucleolar Size Revealed by Global Phenotypic Analyses

PubMed Central

Neumüller, Ralph A.; Gross, Thomas; Samsonova, Anastasia A.; Vinayagam, Arunachalam; Buckner, Michael; Founk, Karen; Hu, Yanhui; Sharifpoor, Sara; Rosebrock, Adam P.; Andrews, Brenda; Winston, Fred; Perrimon, Norbert

2014-01-01

Regulation of cell growth is a fundamental process in development and disease that integrates a vast array of extra- and intracellular information. A central player in this process is RNA polymerase I (Pol I), which transcribes ribosomal RNA (rRNA) genes in the nucleolus. Rapidly growing cancer cells are characterized by increased Pol I–mediated transcription and, consequently, nucleolar hypertrophy. To map the genetic network underlying the regulation of nucleolar size and of Pol I–mediated transcription, we performed comparative, genome-wide loss-of-function analyses of nucleolar size in Saccharomyces cerevisiae and Drosophila melanogaster coupled with mass spectrometry–based analyses of the ribosomal DNA (rDNA) promoter. With this approach, we identified a set of conserved and nonconserved molecular complexes that control nucleolar size. Furthermore, we characterized a direct role of the histone information regulator (HIR) complex in repressing rRNA transcription in yeast. Our study provides a full-genome, cross-species analysis of a nuclear subcompartment and shows that this approach can identify conserved molecular modules. PMID:23962978

Diverse Thermus species inhabit a single hot spring microbial mat

NASA Technical Reports Server (NTRS)

Nold, S. C.; Ward, D. M.

1995-01-01

Through an effort to characterize aerobic chemoorganotrophic bacteria in the Octopus Spring cyano-bacterial mat community, we cultivated four Thermus isolates with unique 16S rRNA sequences. Isolates clustered within existing Thermus clades, including those containing Thermus ruber, Thermus aquaticus, and a subgroup closely related to T. aquaticus. One Octopus Spring isolate is nearly identical (99.9% similar) to isolates from Iceland, and two others are closely related to a T. ruber isolated from Russia. Octopus Spring isolates similar to T. aquaticus and T. ruber exhibited optimal growth rates at high (65-70 degrees C) and low (50 degrees C) temperatures, respectively, with the most abundant species best adapted to the temperature of the habitat (50-55 degrees C). Our results display a diversity of Thermus genotypes defined by 16S rRNA within one hot spring microbial community. We suggest that specialization to temperature and perhaps other local environmental features controls the abundance of Thermus populations.

Fungal community and cellulose-degrading genes in the composting process of Chinese medicinal herbal residues.

PubMed

Tian, Xueping; Yang, Tao; He, Jingzhong; Chu, Qian; Jia, Xiaojun; Huang, Jun

2017-10-01

The fungal community and the population of 16S rRNA, 18S rRNA and cellulose-degrading genes during the 30-day composting process of Chinese medicinal herbal residues were investigated using Illumina MiSeq and quantitative real-time PCR. An obvious succession of fungal communities occurred during the composting process. Unidentified fungi predominated in the raw materials. As composting progressed, Ascomycota became the most dominant phylum, with Aspergillus being the most dominant genus, and Aspergillus fumigatus making up 99.65% of that genus. Because of the inoculation of cellulolytic fungi in the mature stage, the cellulose degradation rate in inoculation groups was faster and the relative abundances of Aspergillus and the glycoside hydrolase family 7 genes were significantly higher than those in the control groups. These indicated that the fungal inoculants facilitated the degradation of cellulose, increased cellulolytic fungi and optimized the community structure. Copyright © 2017. Published by Elsevier Ltd.

Genetic diversity of Trichomonas vaginalis clinical isolates from Henan province in central China.

PubMed

Mao, Meng; Liu, Hui Li

2015-07-01

Trichomonas vaginalis is a flagellated protozoan parasite that infects the human urogenital tract, causing the most common non-viral, sexually transmitted disease worldwide. In this study, genetic variants of T. vaginalis were identified in Henan Province, China. Fragments of the small subunit of nuclear ribosomal RNA (18S rRNA) were amplified from 32 T. vaginalis isolates obtained from seven regions of Henan Province. Overall, 18 haplotypes were determined from the 18S rRNA sequences. Each sampled population and the total population displayed high haplotype diversity (Hd), accompanied by very low nucleotide diversity (Pi). In these molecular genetic variants, 91.58% genetic variation was derived from intra-regions. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. Demographic analysis supported population expansion of T. vaginalis isolates from central China. Our findings showing moderate-to-high genetic variations in the 32 isolates of T. vaginalis provide useful knowledge for monitoring changes in parasite populations for the development of future control strategies.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

PubMed

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Conditional Inactivation of Upstream Binding Factor Reveals Its Epigenetic Functions and the Existence of a Somatic Nucleolar Precursor Body

PubMed Central

Hamdane, Nourdine; Stefanovsky, Victor Y.; Tremblay, Michel G.; Németh, Attila; Paquet, Eric; Lessard, Frédéric; Sanij, Elaine; Hannan, Ross; Moss, Tom

2014-01-01

Upstream Binding Factor (UBF) is a unique multi-HMGB-box protein first identified as a co-factor in RNA polymerase I (RPI/PolI) transcription. However, its poor DNA sequence selectivity and its ability to generate nucleosome-like nucleoprotein complexes suggest a more generalized role in chromatin structure. We previously showed that extensive depletion of UBF reduced the number of actively transcribed ribosomal RNA (rRNA) genes, but had little effect on rRNA synthesis rates or cell proliferation, leaving open the question of its requirement for RPI transcription. Using gene deletion in mouse, we now show that UBF is essential for embryo development beyond morula. Conditional deletion in cell cultures reveals that UBF is also essential for transcription of the rRNA genes and that it defines the active chromatin conformation of both gene and enhancer sequences. Loss of UBF prevents formation of the SL1/TIF1B pre-initiation complex and recruitment of the RPI-Rrn3/TIF1A complex. It is also accompanied by recruitment of H3K9me3, canonical histone H1 and HP1α, but not by de novo DNA methylation. Further, genes retain penta-acetyl H4 and H2A.Z, suggesting that even in the absence of UBF the rRNA genes can maintain a potentially active state. In contrast to canonical histone H1, binding of H1.4 is dependent on UBF, strongly suggesting that it plays a positive role in gene activity. Unexpectedly, arrest of rRNA synthesis does not suppress transcription of the 5S, tRNA or snRNA genes, nor expression of the several hundred mRNA genes implicated in ribosome biogenesis. Thus, rRNA gene activity does not coordinate global gene expression for ribosome biogenesis. Loss of UBF also unexpectedly induced the formation in cells of a large sub-nuclear structure resembling the nucleolar precursor body (NPB) of oocytes and early embryos. These somatic NPBs contain rRNA synthesis and processing factors but do not associate with the rRNA gene loci (NORs). PMID:25121932

Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.

PubMed

Kim, Jeong-Soon; Wang, Nian

2009-03-06

Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

A Case-Control Study of Molecular Epidemiology in Relation to Azithromycin Resistance in Neisseria gonorrhoeae Isolates Collected in Amsterdam, the Netherlands, between 2008 and 2015

PubMed Central

Wind, Carolien M.; Bruisten, Sylvia M.; Schim van der Loeff, Maarten F.; Dierdorp, Mirjam; de Vries, Henry J. C.

2017-01-01

ABSTRACT Neisseria gonorrhoeae resistance to ceftriaxone and azithromycin is increasing, which threatens the recommended dual therapy. We used molecular epidemiology to identify N. gonorrhoeae clusters and associations with azithromycin resistance in Amsterdam, the Netherlands. N. gonorrhoeae isolates (n = 143) were selected from patients visiting the Amsterdam STI Outpatient Clinic from January 2008 through September 2015. We included all 69 azithromycin-resistant isolates (MIC ≥ 2.0 mg/liter) and 74 frequency-matched susceptible controls (MIC ≤ 0.25 mg/liter). The methods used were 23S rRNA and mtrR sequencing, N. gonorrhoeae multiantigen sequence typing (NG-MAST), N. gonorrhoeae multilocus variable-number tandem-repeat analysis (NG-MLVA), and a specific PCR to detect mosaic penA genes. A hierarchical cluster analysis of NG-MLVA related to resistance and epidemiological characteristics was performed. Azithromycin-resistant isolates had C2611T mutations in 23S rRNA (n = 62, 89.9%, P < 0.001) and were NG-MAST genogroup G2992 (P < 0.001), G5108 (P < 0.001), or G359 (P = 0.02) significantly more often than susceptible isolates and were more often part of NG-MLVA clusters (P < 0.001). Two resistant isolates (2.9%) had A2059G mutations, and five (7.3%) had wild-type 23S rRNA. No association between mtrR mutations and azithromycin resistance was found. Twenty-four isolates, including 10 azithromycin-resistant isolates, showed reduced susceptibility to extended-spectrum cephalosporins. Of these, five contained a penA mosaic gene. Four of the five NG-MLVA clusters contained resistant and susceptible isolates. Two clusters consisting mainly of resistant isolates included strains from men who have sex with men and from heterosexual males and females. The co-occurrence of resistant and susceptible strains in NG-MLVA clusters and the frequent occurrence of resistant strains outside of clusters suggest that azithromycin resistance develops independently from the background genome. PMID:28373191

The Functional Implications of Bottom Up and Top Down Controls on Marine Bacteria in Arthur Harbor, a Highly Productive Coastal Setting on the West Antarctic Peninsula

NASA Astrophysics Data System (ADS)

Bowman, J. S.; Amaral-Zettler, L. A.; Rich, J. J.; Luria, C.; Ducklow, H. W.

2016-02-01

Marine bacteria can be broadly classified into two groups based on their ecology; slow growing oligotrophic specialists and fast growing copiotrophs. These ecological strategies are associated with specific taxonomic and functional groups, making it possible to use 16S rRNA gene amplicon and shotgun metagenomic data to qualitatively, and possibly quantitatively, identify the contribution of each strategy to marine biogeochemical cycles. We leveraged a 5-year (2009 to 2014) time series of 16S rRNA gene amplicon data for Arthur Harbor, located near Palmer Station, Antarctica, to identify trends in the abundance of taxa associated with each ecological strategy. Using emergent self-organizing maps, we identified four recurring "modes" in bacterial community structure based on the relative abundance of the ubiquitous SAR11 clade. A different bacterial genus was dominant in each mode; Pelagibacter, Polaribacter, Roseobacter, and Colwellia. To explore the functional implications of these different modes we applied shotgun metagenomics and functional predictions using the newly available tool PAPRICA, in combination with flow cytometry and estimates of bacterial production. Our annotation and assembly of binned contigs corresponding to the dominant genera illuminate the succession of metabolic functions across the 2013-2014 austral summer and inform the timing of autotrophic and mixotrophic (putatively bacterivorous) phytoplankton blooms. Surprisingly, while the abundance of Pelagibacter 16S rRNA gene reads was negatively correlated with the concentration of chlorophyll a, the ratio of Pelagibacter to Polaribacter and Roseobacter was poorly correlated with the ratio of high nucleic acid (HNA) to low nucleic acid (LNA) bacteria as determined by flow cytometry, and the relative size of the HNA population at times contrasted sharply with chlorophyll a. These findings suggest that the physiological state of bacterial cells and top down controls play a strong role in HNA: LNA dynamics.

Short-term changes in the composition of active marine bacterial assemblages in response to diesel oil pollution.

PubMed

Lanfranconi, Mariana P; Bosch, Rafael; Nogales, Balbina

2010-09-01

The changes caused by diesel oil pollution in the metabolically active bacterioplankton from an oligotrophic coastal location were analysed in laboratory microcosms (44 l) using 16S ribosomal RNA (16S rRNA) as molecular marker. The aim was to simulate typical hydrocarbon pollution events in a coastal area exploited for seasonal touristic activities. The experiment consisted in addition of low amounts of diesel oil without nutrients to seawater collected at different times (winter and summer). Bacterial diversity was analysed by terminal-restriction fragment length polymorphism (T-RFLP) profiling of 16S rRNAs after reverse transcription polymerase chain reaction (RT-PCR), and by generation of 16S rRNA clone libraries in control and diesel-polluted microcosms. Diesel addition caused a twofold increase in prokaryotic numbers in comparison with controls at the end of the experiment, both in winter and summer microcosms. Bacterioplankton composition, determined by 16S rRNA T-RFLP data, changed rapidly (within 17 h) in response to treatment. The resulting communities were different in microcosms with water collected in summer and winter. A reduction in diversity (Shannon index, calculated on the basis of T-RFLP data) was observed only in summer microcosms. This was due to the rapid increase of phylotypes affiliated to the Oceanospirillaceae, not observed in winter microcosms. After diesel treatment there was a reduction in the number of phylotypes related to SAR11, SAR86 and picocyanobacteria, while phylotypes of the Roseobacter clade, and the OMG group seemed to be favoured. Our results show that diesel pollution alone caused profound effects on the bacterioplankton of oligotrophic seawater, and explained many of the differences in diversity reported previously in pristine and polluted sites in this coastal area. © 2010 The Authors; Journal compilation © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

A retrospective pilot study to determine whether the reproductive tract microbiota differs between women with a history of infertility and fertile women.

PubMed

Wee, Bryan A; Thomas, Mark; Sweeney, Emma Louise; Frentiu, Francesca D; Samios, Melanie; Ravel, Jacques; Gajer, Pawel; Myers, Garry; Timms, Peter; Allan, John A; Huston, Wilhelmina M

2018-06-01

We know very little about the microbiota inhabiting the upper female reproductive tract and how it impacts on fertility. This pilot study aimed to examine the vaginal, cervical and endometrial microbiota for women with a history of infertility compared to women with a history of fertility. Using a retrospective case-control study design, women were recruited for collection of vaginal, cervical and endometrial samples. The microbiota composition was analysed by 16S ribosomal RNA (rRNA) gene amplification and endometrial expression of selected human genes by quantitative reverse transcription polymerase chain reaction. Sixty-five specimens from the reproductive tract of 31 women were successfully analysed using 16S rRNA gene amplicon sequencing (16 controls and 15 cases). The dominant microbial community members were consistent in the vagina and cervix, and generally consistent with the endometrium although the relative proportions varied. We detected three major microbiota clusters that did not group by tissue location or case-control status. There was a trend that infertile women more often had Ureaplasma in the vagina and Gardnerella in the cervix. Testing for the expression of selected genes in the endometrium did not show evidence of correlation with case-control status, or with microbial community composition, although Tenascin-C expression correlated with a history of miscarriage. There is a need for further exploration of the endometrial microbiota, and how the microbiota members or profile interplays with fertility or assisted reproductive technologies. © 2017 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Impact of Substratum Surface on Microbial Community Structure and Treatment Performance in Biological Aerated Filters

PubMed Central

Kim, Lavane; Pagaling, Eulyn; Zuo, Yi Y.

2014-01-01

The impact of substratum surface property change on biofilm community structure was investigated using laboratory biological aerated filter (BAF) reactors and molecular microbial community analysis. Two substratum surfaces that differed in surface properties were created via surface coating and used to develop biofilms in test (modified surface) and control (original surface) BAF reactors. Microbial community analysis by 16S rRNA gene-based PCR-denaturing gradient gel electrophoresis (DGGE) showed that the surface property change consistently resulted in distinct profiles of microbial populations during replicate reactor start-ups. Pyrosequencing of the bar-coded 16S rRNA gene amplicons surveyed more than 90% of the microbial diversity in the microbial communities and identified 72 unique bacterial species within 19 bacterial orders. Among the 19 orders of bacteria detected, Burkholderiales and Rhodocyclales of the Betaproteobacteria class were numerically dominant and accounted for 90.5 to 97.4% of the sequence reads, and their relative abundances in the test and control BAF reactors were different in consistent patterns during the two reactor start-ups. Three of the five dominant bacterial species also showed consistent relative abundance changes between the test and control BAF reactors. The different biofilm microbial communities led to different treatment efficiencies, with consistently higher total organic carbon (TOC) removal in the test reactor than in the control reactor. Further understanding of how surface properties affect biofilm microbial communities and functional performance would enable the rational design of new generations of substrata for the improvement of biofilm-based biological treatment processes. PMID:24141134

Direct Biomarkers of Microbial Translocation Correlate with Immune Activation in Adult Zambians with Environmental Enteropathy and Hepatosplenic Schistosomiasis

PubMed Central

Kaonga, Patrick; Kaimoyo, Evans; Besa, Ellen; Zyambo, Kanekwa; Sinkala, Edford; Kelly, Paul

2017-01-01

Abstract. Microbial translocation is a poorly understood consequence of several disorders such as environmental enteropathy (EE) and hepatosplenic schistosomiasis (HSS). Herein, we compared biomarkers of microbial origin and immune activation in adults with these disorders and in healthy controls. A cross-sectional study was conducted in participants with EE recruited from Misisi compound, Lusaka, Zambia; HSS patients and healthy controls from the University Teaching Hospital, Lusaka. Plasma lipopolysaccharides (LPSs) was measured by limulus amoebocyte lysate assay, plasma 16S ribosomal RNA (16S rRNA) gene copy number was quantified by quantitative real-time polymerase chain reaction, Toll-like receptor ligand (TLRL) activity by QUANTI-Blue detection medium, and cytokines from cell culture supernatant by Cytometric Bead Array. In univariate analysis LPS, 16S rRNA gene copy number, and TLR activity were all high and correlated with each other and with cytokines tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), IL-10, and IL-4 secreted by the RAW-Blue cells. After controlling for baseline characteristic, biomarkers of microbial translocation in blood were predictors of TNF-α, IL-6, and IL-10 activation in cell culture supernatant from EE participants and HSS patients but not in healthy controls. TLR activity showed the strongest correlation with TNF-α. These data provide correlative evidence that microbial translocation contributes to systemic cytokine activation in two disorders common in the tropics, with total TLR ligand estimation showing the strongest correlation with TNF-α (r = 0.66, P < 0.001). PMID:29140241

Structure prediction and binding sites analysis of curcin protein of Jatropha curcas using computational approaches.

PubMed

Srivastava, Mugdha; Gupta, Shishir K; Abhilash, P C; Singh, Nandita

2012-07-01

Ribosome inactivating proteins (RIPs) are defense proteins in a number of higher-plant species that are directly targeted toward herbivores. Jatropha curcas is one of the biodiesel plants having RIPs. The Jatropha seed meal, after extraction of oil, is rich in curcin, a highly toxic RIP similar to ricin, which makes it unsuitable for animal feed. Although the toxicity of curcin is well documented in the literature, the detailed toxic properties and the 3D structure of curcin has not been determined by X-ray crystallography, NMR spectroscopy or any in silico techniques to date. In this pursuit, the structure of curcin was modeled by a composite approach of 3D structure prediction using threading and ab initio modeling. Assessment of model quality was assessed by methods which include Ramachandran plot analysis and Qmean score estimation. Further, we applied the protein-ligand docking approach to identify the r-RNA binding residue of curcin. The present work provides the first structural insight into the binding mode of r-RNA adenine to the curcin protein and forms the basis for designing future inhibitors of curcin. Cloning of a future peptide inhibitor within J. curcas can produce non-toxic varieties of J. curcas, which would make the seed-cake suitable as animal feed without curcin detoxification.

Bacterial Population Changes in a Membrane Bioreactor for Graywater Treatment Monitored by Denaturing Gradient Gel Electrophoretic Analysis of 16S rRNA Gene Fragments

PubMed Central

Stamper, David M.; Walch, Marianne; Jacobs, Rachel N.

2003-01-01

The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD5), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time. PMID:12571004

Effects of dietary supplementation of Ulva pertusa and non-starch polysaccharide enzymes on gut microbiota of Siganus canaliculatus

NASA Astrophysics Data System (ADS)

Zhang, Xinxu; Wu, Huijuan; Li, Zhongzhen; Li, Yuanyou; Wang, Shuqi; Zhu, Dashi; Wen, Xiaobo; Li, Shengkang

2018-03-01

Fishes represent the highest diversity of vertebrates; however, our understanding of the compositions and functions of their gut microbiota is limited. In this study, we provided the first insight into the gut microbiota of the herbivorous fish Siganus canaliculatus by using three molecular ecology techniques based on the 16S rRNA genes (denaturing gradient gel electrophoresis, clone library construction, and highthroughput Illumina sequencing), and the Illumina sequencing technique is suggested here due to its higher overall coverage of the total 16S rRNA genes. A core gut microbiota of 29 bacterial groups, covering >99.9% of the total bacterial community, was found to be dominated by Proteobacteria and Firmicutes in fish fed three different diets with/without the supplementation of Ulva pertusa and non-starch polysaccharide (NSP) enzymes (cellulase, xylanase, and β-glucanase). Diverse potential NSP-degrading bacteria and probiotics (e.g., Ruminococcus, Clostridium and Lachnospiraceae) were detected in the intestine of the fish fed U. pertusa, suggesting that these microorganisms likely participated in the degradation of NSPs derived from U. pertusa. This study supports our previous conclusion that U. pertusa-based diets are suitable for the production of S. canaliculatus with lower costs without compromising quality.

Application of MALDI-TOF MS Systems in the Rapid Identification of Campylobacter spp. of Public Health Importance.

PubMed

Hsieh, Ying-Hsin; Wang, Yun F; Moura, Hercules; Miranda, Nancy; Simpson, Steven; Gowrishankar, Ramnath; Barr, John; Kerdahi, Khalil; Sulaiman, Irshad M

2018-05-01

Campylobacteriosis is an infectious gastrointestinal disease caused by Campylobacter spp. In most cases, it is either underdiagnosed or underreported due to poor diagnostics and limited databases. Several DNA-based molecular diagnostic techniques, including 16S ribosomal RNA (rRNA) sequence typing, have been widely used in the species identification of Campylobacter. Nevertheless, these assays are time-consuming and require a high quality of bacterial DNA. Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) MS is an emerging diagnostic technology that can provide the rapid identification of microorganisms by using their intact cells without extraction or purification. In this study, we analyzed 24 American Type Culture Collection reference isolates of 16 Campylobacter spp. and five unknown clinical bacterial isolates for rapid identification utilizing two commercially available MADI-TOF MS platforms, namely the bioMérieux VITEK® MS and Bruker Biotyper systems. In addition, 16S rRNA sequencing was performed to confirm the species-level identification of the unknown clinical isolates. Both MALDI-TOF MS systems identified the isolates of C. jejuni, C. coli, C. lari, and C. fetus. The results of this study suggest that the MALDI-TOF MS technique can be used in the identification of Campylobacter spp. of public health importance.

Identification of Opportunistic Pathogenic Bacteria in Drinking Water Samples of Different Rural Health Centers and Their Clinical Impacts on Humans

PubMed Central

Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.

2013-01-01

International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144

Effects of dietary supplementation of Ulva pertusa and non-starch polysaccharide enzymes on gut microbiota of Siganus canaliculatus

NASA Astrophysics Data System (ADS)

Zhang, Xinxu; Wu, Huijuan; Li, Zhongzhen; Li, Yuanyou; Wang, Shuqi; Zhu, Dashi; Wen, Xiaobo; Li, Shengkang

2017-05-01

Fishes represent the highest diversity of vertebrates; however, our understanding of the compositions and functions of their gut microbiota is limited. In this study, we provided the first insight into the gut microbiota of the herbivorous fish Siganus canaliculatus (S. canaliculatus) by using three molecular ecology techniques based on the 16S rRNA genes (denaturing gradient gel electrophoresis, clone library construction, and high-throughput Illumina sequencing), and the Illumina sequencing technique is suggested here due to its higher overall coverage of the total 16S rRNA genes. A core gut microbiota of 29 bacterial groups, covering >99.9% of the total bacterial community, was found to be dominated by Proteobacteria and Firmicutes in fish fed three different diets with/without the supplementation of Ulva pertusa (U. pertusa) and non-starch polysaccharide (NSP) enzymes (cellulase, xylanase, and β-glucanase). Diverse potential NSP-degrading bacteria and probiotics (e.g., Ruminococcus, Clostridium and Lachnospiraceae) were detected in the intestine of the fish fed U. pertusa, suggesting that these microorganisms likely participated in the degradation of NSPs derived from U. pertusa. This study supports our previous conclusion that U. pertusa-based diets are suitable for the production of S. canaliculatus with lower costs without compromising quality.

Yeast communities associated with artisanal mezcal fermentations from Agave salmiana.

PubMed

Verdugo Valdez, A; Segura Garcia, L; Kirchmayr, M; Ramírez Rodríguez, P; González Esquinca, A; Coria, R; Gschaedler Mathis, A

2011-11-01

The aims of this work were to characterize the fermentation process of mezcal from San Luis Potosi, México and identify the yeasts present in the fermentation using molecular culture-dependent methods (RFLP of the 5.8S-ITS and sequencing of the D1/D2 domain) and also by using a culture-independent method (DGGE). The alcoholic fermentations of two separate musts obtained from Agave salmiana were analyzed. Sugar, ethanol and major volatile compounds concentrations were higher in the first fermentation, which shows the importance of having a quality standard for raw materials, particularly in the concentration of fructans, in order to produce fermented Agave salmiana must with similar characteristics. One hundred ninety-two (192) different yeast colonies were identified, from those present on WL agar plates, by RFLP analysis of the ITS1-5.8S- ITS2 from the rRNA gene, with restriction endonucleases, HhaI, HaeIII and HinfI. The identified yeasts were: Saccharomyces cerevisiae, Kluyveromyces marxianus, Pichia kluyveri, Zygosaccharomyces bailii, Clavispora lusitaniae, Torulaspora delbrueckii, Candida ethanolica and Saccharomyces exiguus. These identifications were confirmed by sequencing the D1-D2 region of the 26S rRNA gene. With the PCR-DGGE method, bands corresponding to S. cerevisiae, K. marxianus and T. delbrueckii were clearly detected, confirming the results obtained with classic techniques.

Bacterial population changes in a membrane bioreactor for graywater treatment monitored by denaturing gradient gel electrophoretic analysis of 16S rRNA gene fragments.

PubMed

Stamper, David M; Walch, Marianne; Jacobs, Rachel N

2003-02-01

The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD(5)), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time.

Microbial Community Structure in Relation to Water Quality in ...

EPA Pesticide Factsheets

Weeks Bay is a shallow, microtidal, eutrophic sub-estuary of Mobile Bay, AL. High watershed nutrient inputs to the estuary contribute to a eutrophic condition characterized by frequent summertime diel-cycling hypoxia and dissolved oxygen (DO) oversaturation. Spatial and seasonal variability of microbial communities that contribute to estuarine ecosystem metabolism were characterized using high-throughput DNA sequencing. Surface water samples were collected from spring to fall at three sites along a transect of Weeks Bay from the Fish River to Mobile Bay. Water samples were analyzed for physiochemical properties and were also filtered onto Sterivex filters for DNA extraction. Genes for 16S rRNA and 18S rRNA were amplified and sequenced according to Earth Microbiome Project protocols. Sequences were assembled into contigs and clustered into OTUs with mothur using the Silva database. The prokaryotes were dominated by Cyanobacteria, Actinobacteria, and Spartobacteria, whereas the eukaryotes were dominated by Bacillariophyta (diatoms). Multivariate statistical analysis of microbial community composition and environmental data showed that Bacteria, Archaea and Eukaryota were clustered by season. BEST analysis by station showed that prokaryotic community structure was associated with salinity and CDOM (Rho=0.924), whereas eukaryotic community structure was most associated with salinity (Rho=0.846). Prokaryotic community structure within seasons was associated with six

Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.

PubMed

Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong

2016-05-01

Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.

A Novel Approach to Managing Invasive Termite Species Using Genetically Engineered Bacteria

DTIC Science & Technology

2008-08-01

the United States and in many other countries. These wood-destroying insects are a major concern for the Department of Defense because it has...would provide a highly specific approach to control insects in urban and agricultural environments without the use of conventional pesticides. Bait...target surface receptors of the protozoa. Termite specific bacteria were previously identified using culture independent 16S rRNA gene sequencing of

Pronounced daily succession of phytoplankton, archaea and bacteria following a spring bloom.

PubMed

Needham, David M; Fuhrman, Jed A

2016-02-29

Marine phytoplankton perform approximately half of global carbon fixation, with their blooms contributing disproportionately to carbon sequestration(1), and most phytoplankton production is ultimately consumed by heterotrophic prokaryotes(2). Therefore, phytoplankton and heterotrophic community dynamics are important in modelling carbon cycling and the impacts of global change(3). In a typical bloom, diatoms dominate initially, transitioning over several weeks to smaller and motile phytoplankton(4). Here, we show unexpected, rapid community variation from daily rRNA analysis of phytoplankton and prokaryotic community members following a bloom off southern California. Analysis of phytoplankton chloroplast 16S rRNA demonstrated ten different dominant phytoplankton over 18 days alone, including four taxa with animal toxin-producing strains. The dominant diatoms, flagellates and picophytoplankton varied dramatically in carbon export potential. Dominant prokaryotes also varied rapidly. Euryarchaea briefly became the most abundant organism, peaking over a few days to account for about 40% of prokaryotes. Phytoplankton and prokaryotic communities correlated better with each other than with environmental parameters. Extending beyond the traditional view of blooms being controlled primarily by physics and inorganic nutrients, these dynamics imply highly heterogeneous, continually changing conditions over time and/or space and suggest that interactions among microorganisms are critical in controlling plankton diversity, dynamics and fates.

Addition of allochthonous fungi to a historically contaminated soil affects both remediation efficiency and bacterial diversity.

PubMed

Federici, Ermanno; Leonardi, Vanessa; Giubilei, Maria A; Quaratino, Daniele; Spaccapelo, Roberta; D'Annibale, Alessandro; Petruccioli, Maurizio

2007-11-01

Botryosphaeria rhodina DABAC P82 and Pleurotus pulmonarius CBS 664.97 were tested for their ability to grow and to degrade aromatic hydrocarbons in an aged contaminated soil. To evaluate the impact of indigenous microflora on the overall process, incubations were performed on both fumigated and nonfumigated soils. Fungal colonization by B. rhodina was unexpectedly lower in the fumigated than in the nonfumigated soil while the growth of P. pulmonarius showed an opposite response. Degradation performances and detoxification by both fungi in the nonfumigated soil were markedly higher than those observed in the fumigated one. Heterotrophic bacterial counts in nonfumigated soil augmented with either B. rhodina or P. pulmonarius were significantly higher than those of the corresponding incubation control (6.7 +/- 0.3 x 10(8) and 8.35 +/- 0.6 x 10(8), respectively, vs 9.2 +/- 0.3 x 10(7)). Bacterial communities of both incubation controls and fungal-augmented soil were compared by numerical analysis of denaturing gradient gel electrophoresis profiles of polymerase chain reaction (PCR)-amplified 16S ribosomal RNA (rRNA) genes and cloning and sequencing of PCR-amplified 16S rRNA genes. Besides increasing overall diversity, fungal augmentation led to considerable qualitative differences with respect to the pristine soil.

Symbiotic bacteria contribute to increasing the population size of a freshwater crustacean, Daphnia magna.

PubMed

Peerakietkhajorn, Saranya; Tsukada, Koji; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

2015-04-01

The filter-feeding crustacean Daphnia is a key organism in freshwater ecosystems. Here, we report the effect of symbiotic bacteria on ecologically important life history traits, such as population dynamics and longevity, in Daphnia magna. By disinfection of the daphniid embryos with glutaraldehyde, aposymbiotic daphniids were prepared and cultured under bacteria-free conditions. Removal of bacteria from the daphniids was monitored by quantitative polymerase chain reaction for bacterial 16S rRNA gene. The population of aposymbiotic daphniids was reduced 10-folds compared with that of the control daphniids. Importantly, re-infection with symbiotic bacteria caused daphniids to regain bacteria and increase their fecundity to the level of the control daphniids, suggesting that symbiotic bacteria regulate Daphnia fecundity. To identify the species of symbiotic bacteria, 16S rRNA genes of bacteria in daphniids were sequenced. This revealed that 50% of sequences belonged to the Limnohabitans sp. of the Betaproteobacteria class and that the diversity of bacterial taxa was relatively low. These results suggested that symbiotic bacteria have a beneficial effect on D. magna, and that aposymbiotic Daphnia are useful tools in understanding the role of symbiotic bacteria in the environmental responses and evolution of their hosts. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Plasmodium vivax molecular diagnostics in community surveys: pitfalls and solutions.

PubMed

Gruenberg, Maria; Moniz, Clara Antunes; Hofmann, Natalie Ellen; Wampfler, Rahel; Koepfli, Cristian; Mueller, Ivo; Monteiro, Wuelton Marcelo; Lacerda, Marcus; de Melo, Gisely Cardoso; Kuehn, Andrea; Siqueira, Andre M; Felger, Ingrid

2018-01-30

A distinctive feature of Plasmodium vivax infections is the overall low parasite density in peripheral blood. Thus, identifying asymptomatic infected individuals in endemic communities requires diagnostic tests with high sensitivity. The detection limits of molecular diagnostic tests are primarily defined by the volume of blood analysed and by the copy number of the amplified molecular marker serving as the template for amplification. By using mitochondrial DNA as the multi-copy template, the detection limit can be improved more than tenfold, compared to standard 18S rRNA targets, thereby allowing detection of lower parasite densities. In a very low transmission area in Brazil, application of a mitochondrial DNA-based assay increased prevalence from 4.9 to 6.5%. The usefulness of molecular tests in malaria epidemiological studies is widely recognized, especially when precise prevalence rates are desired. Of concern, however, is the challenge of demonstrating test accuracy and quality control for samples with very low parasite densities. In this case, chance effects in template distribution around the detection limit constrain reproducibility. Rigorous assessment of false positive and false negative test results is, therefore, required to prevent over- or under-estimation of parasite prevalence in epidemiological studies or when monitoring interventions.

Field assessment of bacterial communities and total trihalomethanes: Implications for drinking water networks.

PubMed

Montoya-Pachongo, Carolina; Douterelo, Isabel; Noakes, Catherine; Camargo-Valero, Miller Alonso; Sleigh, Andrew; Escobar-Rivera, Juan-Carlos; Torres-Lozada, Patricia

2018-03-01

Operation and maintenance (O&M) of drinking water distribution networks (DWDNs) in tropical countries simultaneously face the control of acute and chronic risks due to the presence of microorganisms and disinfection by-products, respectively. In this study, results from a detailed field characterization of microbiological, chemical and infrastructural parameters of a tropical-climate DWDN are presented. Water physicochemical parameters and the characteristics of the network were assessed to evaluate the relationship between abiotic and microbiological factors and their association with the presence of total trihalomethanes (TTHMs). Illumina sequencing of the bacterial 16s rRNA gene revealed significant differences in the composition of biofilm and planktonic communities. The highly diverse biofilm communities showed the presence of methylotrophic bacteria, which suggest the presence of methyl radicals such as THMs within this habitat. Microbiological parameters correlated with water age, pH, temperature and free residual chlorine. The results from this study are necessary to increase the awareness of O&M practices in DWDNs required to reduce biofilm formation and maintain appropriate microbiological and chemical water quality, in relation to biofilm detachment and DBP formation. Copyright © 2017 Elsevier B.V. All rights reserved.

A Guide to the Natural History of Freshwater Lake Bacteria†

PubMed Central

Newton, Ryan J.; Jones, Stuart E.; Eiler, Alexander; McMahon, Katherine D.; Bertilsson, Stefan

2011-01-01

Summary: Freshwater bacteria are at the hub of biogeochemical cycles and control water quality in lakes. Despite this, little is known about the identity and ecology of functionally significant lake bacteria. Molecular studies have identified many abundant lake bacteria, but there is a large variation in the taxonomic or phylogenetic breadths among the methods used for this exploration. Because of this, an inconsistent and overlapping naming structure has developed for freshwater bacteria, creating a significant obstacle to identifying coherent ecological traits among these groups. A discourse that unites the field is sorely needed. Here we present a new freshwater lake phylogeny constructed from all published 16S rRNA gene sequences from lake epilimnia and propose a unifying vocabulary to discuss freshwater taxa. With this new vocabulary in place, we review the current information on the ecology, ecophysiology, and distribution of lake bacteria and highlight newly identified phylotypes. In the second part of our review, we conduct meta-analyses on the compiled data, identifying distribution patterns for bacterial phylotypes among biomes and across environmental gradients in lakes. We conclude by emphasizing the role that this review can play in providing a coherent framework for future studies. PMID:21372319

Differences in planktonic microbial communities associated with three types of macrophyte stands in a shallow lake.

PubMed

Mentes, Anikó; Szabó, Attila; Somogyi, Boglárka; Vajna, Balázs; Tugyi, Nóra; Csitári, Bianka; Vörös, Lajos; Felföldi, Tamás

2018-02-01

Little is known about how various substances from living and decomposing aquatic macrophytes affect the horizontal patterns of planktonic bacterial communities. Study sites were located within Lake Kolon, which is a freshwater marsh and can be characterised by open-water sites and small ponds with different macrovegetation (Phragmites australis, Nymphea alba and Utricularia vulgaris). Our aim was to reveal the impact of these macrophytes on the composition of the planktonic microbial communities using comparative analysis of environmental parameters, microscopy and pyrosequencing data. Bacterial 16S rRNA gene sequences were dominated by members of phyla Proteobacteria (36%-72%), Bacteroidetes (12%-33%) and Actinobacteria (5%-26%), but in the anoxic sample the ratio of Chlorobi (54%) was also remarkable. In the phytoplankton community, Cryptomonas sp., Dinobryon divergens, Euglena acus and chrysoflagellates had the highest proportion. Despite the similarities in most of the measured environmental parameters, the inner ponds had different bacterial and algal communities, suggesting that the presence and quality of macrophytes directly and indirectly controlled the composition of microbial plankton. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of the bacterial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing.

PubMed

Lagacé, L; Pitre, M; Jacques, M; Roy, D

2004-04-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the gamma- and beta-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). gamma-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control.

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

PubMed

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-10-15

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples

PubMed Central

de Vries, Michel; Deijs, Martin; Canuti, Marta; van Schaik, Barbera D. C.; Faria, Nuno R.; van de Garde, Martijn D. B.; Jachimowski, Loes C. M.; Jebbink, Maarten F.; Jakobs, Marja; Luyf, Angela C. M.; Coenjaerts, Frank E. J.; Claas, Eric C. J.; Molenkamp, Richard; Koekkoek, Sylvie M.; Lammens, Christine; Leus, Frank; Goossens, Herman; Ieven, Margareta; Baas, Frank; van der Hoek, Lia

2011-01-01

In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material. PMID:21283679

Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

PubMed

Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

2015-03-01

Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

PubMed

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

relA-dependent RNA polymerase activity in Escherichia coli.

PubMed Central

Ryals, J; Bremer, H

1982-01-01

Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

PubMed

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Analysis of Bacterial and Fungal Nucleic Acid in Canine Sterile Granulomatous and Pyogranulomatous Dermatitis and Panniculitis.

PubMed

Rosa, Fabio B; Older, Caitlin E; Meason-Smith, Courtney; Suchodolski, Jan S; Lingsweiler, Sonia; Mansell, Joanne E; Hoffmann, Aline Rodrigues

2018-01-01

Next generation sequencing (NGS) studies are revealing a diverse microbiota on the skin of dogs. The skin microbiota of canine sterile granulomatous and pyogranulomatous dermatitis (SGPD) has yet to be investigated using NGS techniques. NGS targeting the 16S rRNA and ITS-1 region of bacterial and fungal DNA, respectively, were used to investigate if bacterial and fungal DNA were associated with skin lesions in cases of canine SGPD. The study included 20 formalin-fixed paraffin-embedded (FFPE) skin samples and 12 fresh samples from SGPD-affected dogs, and 10 FFPE and 10 fresh samples from healthy dogs. DNA was extracted from deep dermis and panniculus, and microbial DNA was amplified using primers targeting the bacterial 16S rRNA V1-V3 and fungal ITS-1 regions. The amplified DNA was utilized for NGS on an Illumina MiSeq instrument. The sequences were processed using QIIME. No differences in fungal or bacterial alpha diversity were observed between the SGPD and control samples. Beta diversity analysis demonstrated differences in the bacterial communities between SGPD and control, but not in the fungal communities. Compared to controls, the family Erysipelotrichaceae and genus Staphylococcus were significantly more abundant in the SGPD FFPE samples, and genus Corynebacterium were more abundant in fresh samples. The bacteria found to be more abundant in SGPD are common inhabitants of skin surfaces, and likely secondary contaminants in SGPD cases. This study provides additional evidence that SGPD lesions are likely sterile.

16S rRNA and Omp31 Gene Based Molecular Characterization of Field Strains of B. melitensis from Aborted Foetus of Goats in India

PubMed Central

Singh, Ajay; Gupta, Vivek Kumar; Kumar, Amit; Singh, Vikas Kumar; Nayakwadi, Shivasharanappa

2013-01-01

Brucellosis is a reemerging infectious zoonotic disease of worldwide importance. In human, it is mainly caused by Brucella melitensis, a natural pathogen for goats. In India, a large number of goats are reared in semi-intensive to intensive system within the close vicinity of human being. At present, there is no vaccination and control strategy for caprine brucellosis in the country. Thus, to formulate an effective control strategy, the status of etiological agent is essential. To cope up with these, the present study was conducted to isolate and identify the prevalent Brucella species in caprine brucellosis in India. The 30 samples (fetal membrane, fetal stomach content and vaginal swabs) collected throughout India from the aborted fetus of goats revealed the isolation of 05 isolates all belonging to Brucella melitensis biovars 3. All the isolates produced amplification products of 1412 and 720 bp in polymerase chain reaction with genus and species specific 16S rRNA and omp31 gene based primers, respectively. Moreover, the amplification of omp31 gene in all the isolates confirmed the presence of immuno dominant outer membrane protein (31 kDa omp) in all the field isolates of B. melitensis in aborted foetus of goats in India. These findings can support the development of omp31 based specific serodiagnostic test as well as vaccine for the control of caprine brucellosis in India. PMID:24453799

Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

PubMed Central

Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

2008-01-01

We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

Effect of storage time on gene expression data acquired from unfrozen archived newborn blood spots.

PubMed

Ho, Nhan T; Busik, Julia V; Resau, James H; Paneth, Nigel; Khoo, Sok Kean

2016-11-01

Unfrozen archived newborn blood spots (NBS) have been shown to retain sufficient messenger RNA (mRNA) for gene expression profiling. However, the effect of storage time at ambient temperature for NBS samples in relation to the quality of gene expression data is relatively unknown. Here, we evaluated mRNA expression from quantitative real-time PCR (qRT-PCR) and microarray data obtained from NBS samples stored at ambient temperature to determine the effect of storage time on the quality of gene expression. These data were generated in a previous case-control study examining NBS in 53 children with cerebral palsy (CP) and 53 matched controls. NBS sample storage period ranged from 3 to 16years at ambient temperature. We found persistently low RNA integrity numbers (RIN=2.3±0.71) and 28S/18S rRNA ratios (~0) across NBS samples for all storage periods. In both qRT-PCR and microarray data, the expression of three common housekeeping genes-beta cytoskeletal actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and peptidylprolyl isomerase A (PPIA)-decreased with increased storage time. Median values of each microarray probe intensity at log 2 scale also decreased over time. After eight years of storage, probe intensity values were largely reduced to background intensity levels. Of 21,500 genes tested, 89% significantly decreased in signal intensity, with 13,551, 10,730, and 9925 genes detected within 5years, > 5 to <10years, and >10years of storage, respectively. We also examined the expression of two gender-specific genes (X inactivation-specific transcript, XIST and lysine-specific demethylase 5D, KDM5D) and seven gene sets representing the inflammatory, hypoxic, coagulative, and thyroidal pathways hypothesized to be related to CP risk to determine the effect of storage time on the detection of these biologically relevant genes. We found the gender-specific genes and CP-related gene sets detectable in all storage periods, but exhibited differential expression (between male vs. female or CP vs. control) only within the first six years of storage. We concluded that gene expression data quality deteriorates in unfrozen archived NBS over time and that differential gene expression profiling and analysis is recommended for those NBS samples collected and stored within six years at ambient temperature. Copyright © 2016 Elsevier Inc. All rights reserved.

A comparison of sequencing platforms and bioinformatics pipelines for compositional analysis of the gut microbiome.

PubMed

Allali, Imane; Arnold, Jason W; Roach, Jeffrey; Cadenas, Maria Belen; Butz, Natasha; Hassan, Hosni M; Koci, Matthew; Ballou, Anne; Mendoza, Mary; Ali, Rizwana; Azcarate-Peril, M Andrea

2017-09-13

Advancements in Next Generation Sequencing (NGS) technologies regarding throughput, read length and accuracy had a major impact on microbiome research by significantly improving 16S rRNA amplicon sequencing. As rapid improvements in sequencing platforms and new data analysis pipelines are introduced, it is essential to evaluate their capabilities in specific applications. The aim of this study was to assess whether the same project-specific biological conclusions regarding microbiome composition could be reached using different sequencing platforms and bioinformatics pipelines. Chicken cecum microbiome was analyzed by 16S rRNA amplicon sequencing using Illumina MiSeq, Ion Torrent PGM, and Roche 454 GS FLX Titanium platforms, with standard and modified protocols for library preparation. We labeled the bioinformatics pipelines included in our analysis QIIME1 and QIIME2 (de novo OTU picking [not to be confused with QIIME version 2 commonly referred to as QIIME2]), QIIME3 and QIIME4 (open reference OTU picking), UPARSE1 and UPARSE2 (each pair differs only in the use of chimera depletion methods), and DADA2 (for Illumina data only). GS FLX+ yielded the longest reads and highest quality scores, while MiSeq generated the largest number of reads after quality filtering. Declines in quality scores were observed starting at bases 150-199 for GS FLX+ and bases 90-99 for MiSeq. Scores were stable for PGM-generated data. Overall microbiome compositional profiles were comparable between platforms; however, average relative abundance of specific taxa varied depending on sequencing platform, library preparation method, and bioinformatics analysis. Specifically, QIIME with de novo OTU picking yielded the highest number of unique species and alpha diversity was reduced with UPARSE and DADA2 compared to QIIME. The three platforms compared in this study were capable of discriminating samples by treatment, despite differences in diversity and abundance, leading to similar biological conclusions. Our results demonstrate that while there were differences in depth of coverage and phylogenetic diversity, all workflows revealed comparable treatment effects on microbial diversity. To increase reproducibility and reliability and to retain consistency between similar studies, it is important to consider the impact on data quality and relative abundance of taxa when selecting NGS platforms and analysis tools for microbiome studies.

Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

2010-01-01

Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

PubMed

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

Methane production and methanogen levels in steers that differ in residual gain.

PubMed

Freetly, H C; Lindholm-Perry, A K; Hales, K E; Brown-Brandl, T M; Kim, M; Myer, P R; Wells, J E

2015-05-01

Methane (CH4) gas released by cattle isa product of fermentation in the digestive tract. The 2 primary sites of CH4 production in ruminants are the reticulum-rumen complex and the cecum. Methane release from cattle represents a 2% to 12% loss of the energy intake. Reducing the proportion of feed energy lost as CH4 has the potential of improving feed efficiency as well as decreasing the contribution of cattle to greenhouse gas production. Feed intake and growth were measured on 132 fall-born steers for 70 d. Seven steers with extreme positive residual gain (RG) and 7 steers with extreme negative RG whose DMI was within 0.32 SD of the mean intake were selected for subsequent measurements. Enteric CH4 production was measured via indirect calorimetry. Rumen, cecum, and rectal contents were obtained from steers at slaughter for measurement of in vitro CH4 production and methanogen 16S rRNA levels. Enteric CH4 production did not differ (P = 0.11) between the positive RG (112 ± 13 L/d)and the negative RG (74 ± 13 L/d) steers. In vitro rumen methane production did not differ between positive RG(64.26 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (61.49 × 10(-5) ± 10.85 × 10(-5) mmol∙g(-1)DM∙min(-1); P = 0.86). In vitro cecum methane production did not differ between positive RG (4.24 ×10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1)) and negative RG (4.35 × 10(-5) ± 1.90 × 10(-5) mmol∙g(-1) DM∙min(-1); P = 0.97). Methanogen 16S rRNA as a percentage of the total bacteria16S rRNA did not differ between RG groups (P = 0.18). The methanogen 16S rRNA as a percentage of rumen fluid total bacteria 16S rRNA (5.3% ±3.1%) did not differ from the methanogen 16S rRNA asa percentage of cecum content total bacteria 16S rRNA(11.8% ± 3.1%; P = 0.14). The methanogen 16S rRNA as a percentage of the rectum content total bacteria 16SrRNA (0.7% ± 3.1%) was not different from the rumen content (P = 0.29) but was less than the cecum content(P = 0.01). Methanomicrobiales 16S rRNA as a percentage of total methanogen 16S rRNA did not differ across sample sites (P = 0.81); however, steers with positive RG (10.5% ± 1.6%) were more numerous than steers with negative RG (5.1% ± 1.6%; P = 0.02). Cattle that differ in RG at the same DMI do not differ in characteristics associated with CH4 production.

Pyrosequencing of Bacterial Symbionts within Axinella corrugata Sponges: Diversity and Seasonal Variability

PubMed Central

White, James R.; Patel, Jignasa; Ottesen, Andrea; Arce, Gabriela; Blackwelder, Patricia; Lopez, Jose V.

2012-01-01

Background Marine sponge species are of significant interest to many scientific fields including marine ecology, conservation biology, genetics, host-microbe symbiosis and pharmacology. One of the most intriguing aspects of the sponge “holobiont” system is the unique physiology, interaction with microbes from the marine environment and the development of a complex commensal microbial community. However, intraspecific variability and temporal stability of sponge-associated bacterial symbionts remain relatively unknown. Methodology/Principal Findings We have characterized the bacterial symbiont community biodiversity of seven different individuals of the Caribbean reef sponge Axinella corrugata, from two different Florida reef locations during variable seasons using multiplex 454 pyrosequencing of 16 S rRNA amplicons. Over 265,512 high-quality 16 S rRNA sequences were generated and analyzed. Utilizing versatile bioinformatics methods and analytical software such as the QIIME and CloVR packages, we have identified 9,444 distinct bacterial operational taxonomic units (OTUs). Approximately 65,550 rRNA sequences (24%) could not be matched to bacteria at the class level, and may therefore represent novel taxa. Differentially abundant classes between seasonal Axinella communities included Gammaproteobacteria, Flavobacteria, Alphaproteobacteria, Cyanobacteria, Acidobacter and Nitrospira. Comparisons with a proximal outgroup sponge species (Amphimedon compressa), and the growing sponge symbiont literature, indicate that this study has identified approximately 330 A. corrugata-specific symbiotic OTUs, many of which are related to the sulfur-oxidizing Ectothiorhodospiraceae. This family appeared exclusively within A. corrugata, comprising >34.5% of all sequenced amplicons. Other A. corrugata symbionts such as Deltaproteobacteria, Bdellovibrio, and Thiocystis among many others are described. Conclusions/Significance Slight shifts in several bacterial taxa were observed between communities sampled during spring and fall seasons. New 16 S rDNA sequences and concomitant identifications greatly expand the microbial community profile for this model reef sponge, and will likely be useful as a baseline for any future comparisons regarding sponge microbial community dynamics. PMID:22701613

Comparison of potential diatom 'barcode' genes (the 18S rRNA gene and ITS, COI, rbcL) and their effectiveness in discriminating and determining species taxonomy in the Bacillariophyta.

PubMed

Guo, Liliang; Sui, Zhenghong; Zhang, Shu; Ren, Yuanyuan; Liu, Yuan

2015-04-01

Diatoms form an enormous group of photoautotrophic micro-eukaryotes and play a crucial role in marine ecology. In this study, we evaluated typical genes to determine whether they were effective at different levels of diatom clustering analysis to assess the potential of these regions for barcoding taxa. Our test genes included nuclear rRNA genes (the nuclear small-subunit rRNA gene and the 5.8S rRNA gene+ITS-2), a mitochondrial gene (cytochrome c-oxidase subunit 1, COI), a chloroplast gene [ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL)] and the universal plastid amplicon (UPA). Calculated genetic divergence was highest for the internal transcribed spacer (ITS; 5.8S+ITS-2) (p-distance of 1.569, 85.84% parsimony-informative sites) and COI (6.084, 82.14%), followed by the 18S rRNA gene (0.139, 57.69%), rbcL (0.120, 42.01%) and UPA (0.050, 14.97%), which indicated that ITS and COI were highly divergent compared with the other tested genes, and that their nucleotide compositions were variable within the whole group of diatoms. Bayesian inference (BI) analysis showed that the phylogenetic trees generated from each gene clustered diatoms at different phylogenetic levels. The 18S rRNA gene was better than the other genes in clustering higher diatom taxa, and both the 18S rRNA gene and rbcL performed well in clustering some lower taxa. The COI region was able to barcode species of some genera within the Bacillariophyceae. ITS was a potential marker for DNA based-taxonomy and DNA barcoding of Thalassiosirales, while species of Cyclotella, Skeletonema and Stephanodiscus gathered in separate clades, and were paraphyletic with those of Thalassiosira. Finally, UPA was too conserved to serve as a diatom barcode. © 2015 IUMS.

Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

PubMed Central

Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

2012-01-01

Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

PubMed Central

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-01-01

AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

acdc – Automated Contamination Detection and Confidence estimation for single-cell genome data

DOE PAGES

Lux, Markus; Kruger, Jan; Rinke, Christian; ...

2016-12-20

A major obstacle in single-cell sequencing is sample contamination with foreign DNA. To guarantee clean genome assemblies and to prevent the introduction of contamination into public databases, considerable quality control efforts are put into post-sequencing analysis. Contamination screening generally relies on reference-based methods such as database alignment or marker gene search, which limits the set of detectable contaminants to organisms with closely related reference species. As genomic coverage in the tree of life is highly fragmented, there is an urgent need for a reference-free methodology for contaminant identification in sequence data. We present acdc, a tool specifically developed to aidmore » the quality control process of genomic sequence data. By combining supervised and unsupervised methods, it reliably detects both known and de novo contaminants. First, 16S rRNA gene prediction and the inclusion of ultrafast exact alignment techniques allow sequence classification using existing knowledge from databases. Second, reference-free inspection is enabled by the use of state-of-the-art machine learning techniques that include fast, non-linear dimensionality reduction of oligonucleotide signatures and subsequent clustering algorithms that automatically estimate the number of clusters. The latter also enables the removal of any contaminant, yielding a clean sample. Furthermore, given the data complexity and the ill-posedness of clustering, acdc employs bootstrapping techniques to provide statistically profound confidence values. Tested on a large number of samples from diverse sequencing projects, our software is able to quickly and accurately identify contamination. Results are displayed in an interactive user interface. Acdc can be run from the web as well as a dedicated command line application, which allows easy integration into large sequencing project analysis workflows. Acdc can reliably detect contamination in single-cell genome data. In addition to database-driven detection, it complements existing tools by its unsupervised techniques, which allow for the detection of de novo contaminants. Our contribution has the potential to drastically reduce the amount of resources put into these processes, particularly in the context of limited availability of reference species. As single-cell genome data continues to grow rapidly, acdc adds to the toolkit of crucial quality assurance tools.« less

acdc – Automated Contamination Detection and Confidence estimation for single-cell genome data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lux, Markus; Kruger, Jan; Rinke, Christian

A major obstacle in single-cell sequencing is sample contamination with foreign DNA. To guarantee clean genome assemblies and to prevent the introduction of contamination into public databases, considerable quality control efforts are put into post-sequencing analysis. Contamination screening generally relies on reference-based methods such as database alignment or marker gene search, which limits the set of detectable contaminants to organisms with closely related reference species. As genomic coverage in the tree of life is highly fragmented, there is an urgent need for a reference-free methodology for contaminant identification in sequence data. We present acdc, a tool specifically developed to aidmore » the quality control process of genomic sequence data. By combining supervised and unsupervised methods, it reliably detects both known and de novo contaminants. First, 16S rRNA gene prediction and the inclusion of ultrafast exact alignment techniques allow sequence classification using existing knowledge from databases. Second, reference-free inspection is enabled by the use of state-of-the-art machine learning techniques that include fast, non-linear dimensionality reduction of oligonucleotide signatures and subsequent clustering algorithms that automatically estimate the number of clusters. The latter also enables the removal of any contaminant, yielding a clean sample. Furthermore, given the data complexity and the ill-posedness of clustering, acdc employs bootstrapping techniques to provide statistically profound confidence values. Tested on a large number of samples from diverse sequencing projects, our software is able to quickly and accurately identify contamination. Results are displayed in an interactive user interface. Acdc can be run from the web as well as a dedicated command line application, which allows easy integration into large sequencing project analysis workflows. Acdc can reliably detect contamination in single-cell genome data. In addition to database-driven detection, it complements existing tools by its unsupervised techniques, which allow for the detection of de novo contaminants. Our contribution has the potential to drastically reduce the amount of resources put into these processes, particularly in the context of limited availability of reference species. As single-cell genome data continues to grow rapidly, acdc adds to the toolkit of crucial quality assurance tools.« less

The Potential Role of Lung Microbiota in Lung Cancer Attributed to Household Coal Burning Exposures

PubMed Central

Hosgood, H. Dean; Sapkota, Amy R.; Rothman, Nathaniel; Rohan, Thomas; Hu, Wei; Xu, Jun; Vermeulen, Roel; He, Xingzhou; White, James Robert; Wu, Guoping; Wei, Fusheng; Mongodin, Emmanuel F.; Lan, Qing

2014-01-01

Bacteria influence site-specific disease etiology and the host’s ability to metabolize xenobiotics, such as polycyclic aromatic hydrocarbons (PAHs). Lung cancer in Xuanwei, China has been attributed to PAH-rich household air pollution from burning coal. This study seeks to explore the role of lung microbiota in lung cancer among never smoking Xuanwei women and how coal burning may influence these associations. DNA from sputum and buccal samples of never smoking lung cancer cases (n = 8, in duplicate) and controls (n = 8, in duplicate) in two Xuanwei villages was extracted using a multi-step enzymatic and physical lysis, followed by a standardized clean-up. V1–V2 regions of 16S rRNA genes were PCR-amplified. Purified amplicons were sequenced by 454 FLX Titanium pyrosequencing and high-quality sequences were evaluated for diversity and taxonomic membership. Bacterial diversity among cases and controls was similar in buccal samples (P = 0.46), but significantly different in sputum samples (P = 0.038). In sputum, Granulicatella (6.1 vs. 2.0%; P = 0.0016), Abiotrophia (1.5 vs. 0.085%; P = 0.0036), and Streptococcus (40.1 vs. 19.8%; P = 0.0142) were enriched in cases compared with controls. Sputum samples had on average 488.25 species-level OTUs in the flora of cases who used smoky coal (PAHrich) compared with 352.5 OTUs among cases who used smokeless coal (PAH-poor; P = 0.047). These differences were explained by the Bacilli species (Streptococcus infantis and Streptococcus anginosus). Our small study suggests that never smoking lung cancer cases have differing sputum microbiota than controls. PMID:24895247

Identifying optimal reference genes for the normalization of microRNA expression in cucumber under viral stress

PubMed Central

Liang, Chaoqiong; Hao, Jianjun; Meng, Yan; Luo, Laixin; Li, Jianqiang

2018-01-01

Cucumber green mottle mosaic virus (CGMMV) is an economically important pathogen and causes significant reduction of both yield and quality of cucumber (Cucumis sativus). Currently, there were no satisfied strategies for controlling the disease. A better understanding of microRNA (miRNA) expression related to the regulation of plant-virus interactions and virus resistance would be of great assistance when developing control strategies for CGMMV. However, accurate expression analysis is highly dependent on robust and reliable reference gene used as an internal control for normalization of miRNA expression. Most commonly used reference genes involved in CGMMV-infected cucumber are not universally expressed depending on tissue types and stages of plant development. It is therefore crucial to identify suitable reference genes in investigating the role of miRNA expression. In this study, seven reference genes, including Actin, Tubulin, EF-1α, 18S rRNA, Ubiquitin, GAPDH and Cyclophilin, were evaluated for the most accurate results in analyses using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene expression was assayed on cucumber leaves, stems and roots that were collected at different days post inoculation with CGMMV. The expression data were analyzed using algorithms including delta-Ct, geNorm, NormFinder, and BestKeeper as well as the comparative tool RefFinder. The reference genes were subsequently validated using miR159. The results showed that EF-1α and GAPDH were the most reliable reference genes for normalizing miRNA expression in leaf, root and stem samples, while Ubiquitin and EF-1α were the most suitable combination overall. PMID:29543906

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Chromatin structure and methylation of rat rRNA genes studied by formaldehyde fixation and psoralen cross-linking.

PubMed Central

Stancheva, I; Lucchini, R; Koller, T; Sogo, J M

1997-01-01

By using formaldehyde cross-linking of histones to DNA and gel retardation assays we show that formaldehyde fixation, similar to previously established psoralen photocross-linking, discriminates between nucleosome- packed (inactive) and nucleosome-free (active) fractions of ribosomal RNA genes. By both cross-linking techniques we were able to purify fragments from agarose gels, corresponding to coding, enhancer and promoter sequences of rRNA genes, which were further investigated with respect to DNA methylation. This approach allows us to analyse independently and in detail methylation patterns of active and inactive rRNA gene copies by the combination of Hpa II and Msp I restriction enzymes. We found CpG methylation mainly present in enhancer and promoter regions of inactive rRNA gene copies. The methylation of one single Hpa II site, located in the promoter region, showed particularly strong correlation with the transcriptional activity. PMID:9108154

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

NASA Technical Reports Server (NTRS)

Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

1993-01-01

The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.

PubMed

Wolfe, C J; Haygood, M G

1993-08-01

Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

PubMed

Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

2015-12-21

5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

NASA Technical Reports Server (NTRS)

Baharaeen, S.; Vishniac, H. S.

1984-01-01

Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

Ballistosporomyces changbaiensis sp. nov. and Ballistosporomyces bomiensis sp. nov., two novel species isolated from shrub plant leaves.

PubMed

Han, Pei-Jie; Li, Ai-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2016-07-01

Four strains, CB 266(T), CB 272, XZ 44D1(T) and XZ 49D2, isolated from shrub plant leaves in China were identified as two novel species of the genus Ballistosporomyces by the sequence analysis of the small subunit of ribosomal RNA (SSU rRNA), the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and internal transcribed spacer (ITS) + 5.8S rRNA region, and physiological comparisons. Ballistosporomyces changbaiensis sp. nov. (type strain CB 266(T) = CGMCC 2.02298(T) = CBS 10124(T), Mycobank number MB 815700) and Ballistosporomyces bomiensis sp. nov. (type strain XZ 44D1(T) = CGMCC 2.02661(T) = CBS 12512(T), Mycobank number MB 815701) are proposed to accommodate these two new species.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

PubMed

Fu, Rao; Gong, Jun

2017-11-01

Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.

PubMed

Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R

2010-09-02

Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

PubMed Central

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

2013-01-01

SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

PubMed

Branciamore, Sergio; Di Giulio, Massimo

2012-04-01

The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

The Evolutionarily Conserved Protein LAS1 Is Required for Pre-rRNA Processing at Both Ends of ITS2

PubMed Central

Schillewaert, Stéphanie; Wacheul, Ludivine; Lhomme, Frédéric

2012-01-01

Ribosome synthesis entails the formation of mature rRNAs from long precursor molecules, following a complex pre-rRNA processing pathway. Why the generation of mature rRNA ends is so complicated is unclear. Nor is it understood how pre-rRNA processing is coordinated at distant sites on pre-rRNA molecules. Here we characterized, in budding yeast and human cells, the evolutionarily conserved protein Las1. We found that, in both species, Las1 is required to process ITS2, which separates the 5.8S and 25S/28S rRNAs. In yeast, Las1 is required for pre-rRNA processing at both ends of ITS2. It is required for Rrp6-dependent formation of the 5.8S rRNA 3′ end and for Rat1-dependent formation of the 25S rRNA 5′ end. We further show that the Rat1-Rai1 5′-3′ exoribonuclease (exoRNase) complex functionally connects processing at both ends of the 5.8S rRNA. We suggest that pre-rRNA processing is coordinated at both ends of 5.8S rRNA and both ends of ITS2, which are brought together by pre-rRNA folding, by an RNA processing complex. Consistently, we note the conspicuous presence of ∼7- or 8-nucleotide extensions on both ends of 5.8S rRNA precursors and at the 5′ end of pre-25S RNAs suggestive of a protected spacer fragment of similar length. PMID:22083961

Complete mitochondrial genome of Germain's Peacock-Pheasant Polyplectron germaini (Aves, Galliformes, Phasianidae).

PubMed

Omeire, Destiny; Abdin, Shaunte; Brooks, Daniel M; Miranda, Hector C

2015-04-01

The Germain's Peacock-Pheasant Polyplectron germaini (Aves, Galliformes, Phasianidae) is classified as Near Threatened on the IUCN Red List. The complete mitochondrial genome of P. germaini is 16,699 bp, consisting of 13 protein-coding genes, 2 rRNA, 22 tRNA genes and 1 control region. All of the 13 protein-coding genes have ATG as start codon. Eight of the 13 protein-coding genes have TAA as stop codon.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

dBBQs: dataBase of Bacterial Quality scores.

PubMed

Wanchai, Visanu; Patumcharoenpol, Preecha; Nookaew, Intawat; Ussery, David

2017-12-28

It is well-known that genome sequencing technologies are becoming significantly cheaper and faster. As a result of this, the exponential growth in sequencing data in public databases allows us to explore ever growing large collections of genome sequences. However, it is less known that the majority of available sequenced genome sequences in public databases are not complete, drafts of varying qualities. We have calculated quality scores for around 100,000 bacterial genomes from all major genome repositories and put them in a fast and easy-to-use database. Prokaryotic genomic data from all sources were collected and combined to make a non-redundant set of bacterial genomes. The genome quality score for each was calculated by four different measurements: assembly quality, number of rRNA and tRNA genes, and the occurrence of conserved functional domains. The dataBase of Bacterial Quality scores (dBBQs) was designed to store and retrieve quality scores. It offers fast searching and download features which the result can be used for further analysis. In addition, the search results are shown in interactive JavaScript chart framework using DC.js. The analysis of quality scores across major public genome databases find that around 68% of the genomes are of acceptable quality for many uses. dBBQs (available at http://arc-gem.uams.edu/dbbqs ) provides genome quality scores for all available prokaryotic genome sequences with a user-friendly Web-interface. These scores can be used as cut-offs to get a high-quality set of genomes for testing bioinformatics tools or improving the analysis. Moreover, all data of the four measurements that were combined to make the quality score for each genome, which can potentially be used for further analysis. dBBQs will be updated regularly and is freely use for non-commercial purpose.

Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

PubMed Central

Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

1999-01-01

The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

PubMed Central

Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

2013-01-01

The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

Molecular analysis of tick-borne protozoan and rickettsial pathogens in small ruminants from two South African provinces.

PubMed

Ringo, Aaron Edmond; Adjou Moumouni, Paul Franck; Taioe, Moeti; Jirapattharasate, Charoonluk; Liu, Mingming; Wang, Guanbo; Gao, Yang; Guo, Huanping; Lee, Seung-Hun; Zheng, Weiqing; Efstratiou, Artemis; Li, Jixu; Inoue, Noboru; Suzuki, Hiroshi; Thekisoe, Oriel; Xuan, Xuenan

2018-04-01

Tick-borne protozoan and rickettsial diseases are a major threat to livestock in tropical and sub-tropical regions of Africa. In this study we investigated the presence and distribution of Theileria spp., Babesia ovis, Anaplasma ovis, Anaplasma phagocytophilum, Ehrlichia ruminantium and SFG Rickettsia in sheep and goats from Free State and KwaZulu-Natal provinces. A total of 91 blood samples were screened in this study, 61 from goats and 30 from sheep. PCR assay was conducted using primers based on Theileria spp. 18S rRNA, Babesia ovis (BoSSU rRNA), Anaplasma ovis (AoMSP4), Anaplasma phagocytophilum epank1, Ehrlichia ruminantium pCS20 and SFG Rickettsia OmpA. Overall infection rates of Theileria spp., Anaplasma ovis and Ehrlichia ruminantium were 18 (19.8%), 33 (36.3%) and 13 (14.3%), respectively. The co-infection of two pathogens were detected in 17/91 (18.7%) of all samples, goats having higher rates of co-infection compared to sheep. Phylogenetic tree analysis sequence of pCS20 gene of E. ruminantium of this study was found to be in the same clade with Kumm2 and Riverside strains both from South Africa. The phylogram of SSU rRNA of Theileria ovis had longer branch length compared to all other sequences most of which were from Asia and Middle East. This study provides important data for understanding the tick-borne diseases occurrence in the study area and it is expected to improve the approach for the diagnosis and control of these diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

PubMed

Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

2016-10-25

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis

PubMed Central

Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier

2016-01-01

MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501

Permeable Reactive Barriers Designed To Mitigate Eutrophication Alter Bacterial Community Composition and Aquifer Redox Conditions

PubMed Central

Hiller, Kenly A.; Foreman, Kenneth H.; Weisman, David

2015-01-01

Permeable reactive barriers (PRBs) consist of a labile carbon source that is positioned to intercept nitrate-laden groundwater to prevent eutrophication. Decomposition of carbon in the PRB drives groundwater anoxic, fostering microbial denitrification. Such PRBs are an ideal habitat to examine microbial community structure under high-nitrate, carbon-replete conditions in coastal aquifers. We examined a PRB installed at the Waquoit Bay National Estuarine Research Reserve in Falmouth, MA. Groundwater within and below the PRB was depleted in oxygen compared to groundwater at sites upgradient and at adjacent reference sites. Nitrate concentrations declined from a high of 25 μM upgradient and adjacent to the barrier to <0.1 μM within the PRB. We analyzed the total and active bacterial communities filtered from groundwater flowing through the PRB using amplicons of 16S rRNA and of the 16S rRNA genes. Analysis of the 16S rRNA genes collected from the PRB showed that the total bacterial community had high relative abundances of bacteria thought to have alternative metabolisms, such as fermentation, including candidate phyla OD1, OP3, TM7, and GN02. In contrast, the active bacteria had lower abundances of many of these bacteria, suggesting that the bacterial taxa that differentiate the PRB groundwater community were not actively growing. Among the environmental variables analyzed, dissolved oxygen concentration explained the largest proportion of total community structure. There was, however, no significant correlation between measured environmental parameters and the active microbial community, suggesting that controls on the active portion may differ from the community as a whole. PMID:26231655

Nucleosome Translational Position, Not Histone Acetylation, Determines TFIIIA Binding to Nucleosomal Xenopus laevis 5S rRNA Genes

PubMed Central

Howe, LeAnn; Ausió, Juan

1998-01-01

We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

MetaMetaDB: a database and analytic system for investigating microbial habitability.

PubMed

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

Cadmium uptake capacity of an indigenous cyanobacterial strain, Nostoc entophytum ISC32: new insight into metal uptake in microgravity-simulating conditions.

PubMed

Alidoust, Leila; Soltani, Neda; Modiri, Sima; Haghighi, Omid; Azarivand, Aisan; Khajeh, Khosro; Shahbani Zahiri, Hossein; Vali, Hojatollah; Akbari Noghabi, Kambiz

2016-02-01

Among nine cyanobacterial strains isolated from oil-contaminated regions in southern Iran, an isolate with maximum cadmium uptake capacity was selected and identified on the basis of analysis of morphological criteria and 16S rRNA gene sequence similarity as Nostoc entophytum (with 99% similarity). The isolate was tentatively designated N. entophytum ISC32. The phylogenetic affiliation of the isolates was determined on the basis of their 16S rRNA gene sequence. The maximum amount of Cd(II) adsorbed by strain ISC32 was 302.91 mg g(-1) from an initial exposure to a solution with a Cd(II) concentration of 150 mg l(-1). The cadmium uptake by metabolically active cells of cyanobacterial strain N. entophytum ISC32, retained in a clinostat for 6 days to simulate microgravity conditions, was examined and compared with that of ground control samples. N. entophytum ISC32 under the influence of microgravity was able to take up cadmium at amounts up to 29% higher than those of controls. The activity of antioxidant enzymes including catalase and peroxidase was increased in strain ISC32 exposed to microgravity conditions in a clinostat for 6 days, as catalase activity of the cells was more than three times higher than that of controls. The activity of the peroxidase enzyme increased by 36% compared with that of the controls. Membrane lipid peroxidation was also increased in the cells retained under microgravity conditions, up to 2.89-fold higher than in non-treated cells. Images obtained using scanning electron microscopy showed that cyanobacterial cells form continuous filaments which are drawn at certain levels, while the cells placed in a clinostat appeared as round-shaped, accumulated together and distorted to some extent.

Lupin kernel fiber consumption modifies fecal microbiota in healthy men as determined by rRNA gene fluorescent in situ hybridization.

PubMed

Smith, Stuart C; Choy, Rachel; Johnson, Stuart K; Hall, Ramon S; Wildeboer-Veloo, Alida C M; Welling, Gjalt W

2006-09-01

Changes in the composition of gastrointestinal microbiota by dietary interventions using pro- and prebiotics provide opportunity for improving health and preventing disease. However, the capacity of lupin kernel fiber (LKFibre), a novel legume-derived food ingredient, to act as a prebiotic and modulate the colonic microbiota in humans needed investigation. The present study aimed to determine the effect of LKFibre on human intestinal microbiota by quantitative fluorescent in situ hybridization (FISH) analysis. A total of 18 free-living healthy males between the ages of 24 and 64 years consumed a control diet and a LKFibre diet (containing an additional 17-30 g/day fiber beyond that of the control-incorporated into daily food items) for 28 days with a 28-day washout period in a single-blind, randomized, crossover dietary intervention design. Fecal samples were collected for 3 days towards the end of each diet and microbial populations analyzed by FISH analysis using 16S rRNA gene-based oligonucleotide probes targeting total and predominant microbial populations. Significantly higher levels of Bifidobacterium spp. (P = 0.001) and significantly lower levels of the clostridia group of C. ramosum, C. spiroforme and C. cocleatum (P = 0.039) were observed on the LKFibre diet compared with the control. No significant differences between the LKFibre and the control diet were observed for total bacteria, Lactobacillus spp., the Eubacterium spp., the C. histolyticum/C. lituseburense group and the Bacteroides-Prevotella group. Ingestion of LKFibre stimulated colonic bifidobacteria growth, which suggests that this dietary fiber may be considered as a prebiotic and may beneficially contribute to colon health.

Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

PubMed

Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

2015-01-01

Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.

Alcohol and tobacco consumption affects bacterial richness in oral cavity mucosa biofilms.

PubMed

Thomas, Andrew Maltez; Gleber-Netto, Frederico Omar; Fernandes, Gustavo Ribeiro; Amorim, Maria; Barbosa, Luisa Fernanda; Francisco, Ana Lúcia Noronha; de Andrade, Arthur Guerra; Setubal, João Carlos; Kowalski, Luiz Paulo; Nunes, Diana Noronha; Dias-Neto, Emmanuel

2014-10-03

Today there are more than 2 billion alcohol users and about 1.3 billion tobacco users worldwide. The chronic and heavy use of these two substances is at the heart of numerous diseases and may wreak havoc on the human oral microbiome. This study delves into the changes that alcohol and tobacco may cause on biofilms of the human oral microbiome. To do so, we used swabs to sample the oral biofilm of 22 subjects; including 9 control-individuals with no or very low consumption of alcohol and no consumption of tobacco, 7 who were chronic and heavy users of both substances and 6 active smokers that reported no significant alcohol consumption. DNA was extracted from swabs and the V1 region of the 16S rRNA gene was PCR amplified and sequenced using the Ion Torrent PGM platform, generating 3.7 million high quality reads. DNA sequences were clustered and OTUs were assigned using the ARB SILVA database and Qiime. We found no differences in species diversity and evenness among the groups. However, we found a significant decrease in species richness in only smokers and in smokers/drinkers when compared to controls. We found that Neisseria abundance was significantly decreased in both groups when compared to controls. Smokers had significant increases in Prevotella and Capnocytophaga and reductions in Granulicatella, Staphylococcus, Peptostreptococcus and Gemella when compared to the two other groups. Controls showed higher abundance of Aggregibacter, whilst smokers/drinkers had lower abundances of Fusobacteria. Samples from only smokers clustered closer together than to controls and smokers/drinkers, and also had a significant reduction in inter-group dissimilarity distances, indicating a more homogenous group than controls. Our results indicate that the continued use of tobacco or alcohol plus tobacco significantly reduces bacterial richness, which apparently leads to a reduction in inter-group variability, turning the respective biofilms into a more homogenous microenvironment in terms of bacterial community composition, with possible consequences for human oral diseases.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Classification of thermophilic actinobacteria isolated from arid desert soils, including the description of Amycolatopsis deserti sp. nov.

PubMed

Busarakam, Kanungnid; Brown, Ros; Bull, Alan T; Tan, Geok Yuan Annie; Zucchi, Tiago D; da Silva, Leonardo José; de Souza, Wallace Rafael; Goodfellow, Michael

2016-02-01

The taxonomic position of 26 filamentous actinobacteria isolated from a hyper-arid Atacama Desert soil and 2 from an arid Australian composite soil was established using a polyphasic approach. All of the isolates gave the diagnostic amplification product using 16S rRNA oligonucleotide primers specific for the genus Amycolatopsis. Representative isolates had chemotaxonomic and morphological properties typical of members of the genus Amycolatopsis. 16S rRNA gene analyses showed that all of the isolates belong to the Amycolatopsis methanolica 16S rRNA gene clade. The Atacama Desert isolates were assigned to one or other of two recognised species, namely Amycolatopsis ruanii and Amycolatopsis thermalba, based on 16S rRNA gene sequence, DNA:DNA relatedness and phenotypic data; emended descriptions are given for these species. In contrast, the two strains from the arid Australian composite soil, isolates GY024(T) and GY142, formed a distinct branch at the periphery of the A. methanolica 16S rRNA phyletic line, a taxon that was supported by all of the tree-making algorithms and by a 100 % bootstrap value. These strains shared a high degree of DNA:DNA relatedness and have many phenotypic properties in common, some of which distinguished them from all of the constituent species classified in the A. methanolica 16S rRNA clade. Isolates GY024(T) and GY142 merit recognition as a new species within the A. methanolica group of thermophilic strains. The name proposed for the new species is Amycolatopsis deserti sp. nov.; the type strain is GY024(T) (=NCIMB 14972(T) = NRRL B-65266(T)).

Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

PubMed

Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

2007-04-01

International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

PubMed Central

Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

2014-01-01

Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

PubMed

Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

2017-11-01

Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

PubMed Central

Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

2010-01-01

The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

Prevalence of 16S rRNA methylase genes in Klebsiella pneumoniae isolates from a Chinese teaching hospital: coexistence of rmtB and armA genes in the same isolate.

PubMed

Yu, Fangyou; Wang, Liangxing; Pan, Jingye; Yao, Dan; Chen, Chan; Zhu, Tao; Lou, Qiang; Hu, Jian; Wu, Yang; Zhang, Xueqing; Chen, Zengqiang; Qu, Di

2009-05-01

16S rRNA methylase-mediated high-level resistance to aminoglycosides has been reported recently in clinical isolates of Gram-negative bacilli from several countries. Twenty-one (6.2%, 21/337) of 337 isolates of Klebsiella pneumoniae from a teaching hospital in Wenzhou, China, were positive for 16S rRNA methylase genes (3 for armA, 13 for rmtB, 5 for both armA and rmtB) and highly resistant to gentamicin, amikacin, and tobramycin (MICs, > or =256 microg/mL). Nineteen of 21 isolates harboring 16S rRNA methyalse genes were extended-spectrum beta-lactamase (ESBL) producers. The plasmids harboring 16S rRNA methylase genes from 14 of 21 donors were transferred into the recipients, Escherichia coli J53. The armA and the rmtB usually coexisted with ESBL genes in the same isolate in clinical isolates and cotransferred with ESBL genes on a self-transmissible conjugative plasmid to the recipients. Among 5 isolates harboring both armA and rmtB, the armA genes were located on the chromosomes, and the rmtB genes were located on the plasmids, as determined by Southern hybridization. The result of pulsed-field gel electrophoresis showed that horizontal gene transfer and clonal spread were responsible for the dissemination of the rmtB and the armA genes. 16S rRNA methylase-producing isolates of Klebsiella pneumoniae were commonly identified in the Chinese teaching hospital with coexistence of rmtB and armA genes in the same isolate.

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

PubMed

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

PubMed Central

Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

2016-01-01

Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

PubMed

Hotto, Amber M; Huston, Zoe E; Stern, David B

2010-09-29

The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

Microbial diversity and impact on carbonate geochemistry across a changing geochemical gradient in a karst aquifer

PubMed Central

Gray, Cassie J; Engel, Annette S

2013-01-01

Although microbes are known to influence karst (carbonate) aquifer ecosystem-level processes, comparatively little information is available regarding the diversity of microbial activities that could influence water quality and geological modification. To assess microbial diversity in the context of aquifer geochemistry, we coupled 16S rRNA Sanger sequencing and 454 tag pyrosequencing to in situ microcosm experiments from wells that cross the transition from fresh to saline and sulfidic water in the Edwards Aquifer of central Texas, one of the largest karst aquifers in the United States. The distribution of microbial groups across the transition zone correlated with dissolved oxygen and sulfide concentration, and significant variations in community composition were explained by local carbonate geochemistry, specifically calcium concentration and alkalinity. The waters were supersaturated with respect to prevalent aquifer minerals, calcite and dolomite, but in situ microcosm experiments containing these minerals revealed significant mass loss from dissolution when colonized by microbes. Despite differences in cell density on the experimental surfaces, carbonate loss was greater from freshwater wells than saline, sulfidic wells. However, as cell density increased, which was correlated to and controlled by local geochemistry, dissolution rates decreased. Surface colonization by metabolically active cells promotes dissolution by creating local disequilibria between bulk aquifer fluids and mineral surfaces, but this also controls rates of karst aquifer modification. These results expand our understanding of microbial diversity in karst aquifers and emphasize the importance of evaluating active microbial processes that could affect carbonate weathering in the subsurface. PMID:23151637

Microbial diversity and impact on carbonate geochemistry across a changing geochemical gradient in a karst aquifer.

PubMed

Gray, Cassie J; Engel, Annette S

2013-02-01

Although microbes are known to influence karst (carbonate) aquifer ecosystem-level processes, comparatively little information is available regarding the diversity of microbial activities that could influence water quality and geological modification. To assess microbial diversity in the context of aquifer geochemistry, we coupled 16S rRNA Sanger sequencing and 454 tag pyrosequencing to in situ microcosm experiments from wells that cross the transition from fresh to saline and sulfidic water in the Edwards Aquifer of central Texas, one of the largest karst aquifers in the United States. The distribution of microbial groups across the transition zone correlated with dissolved oxygen and sulfide concentration, and significant variations in community composition were explained by local carbonate geochemistry, specifically calcium concentration and alkalinity. The waters were supersaturated with respect to prevalent aquifer minerals, calcite and dolomite, but in situ microcosm experiments containing these minerals revealed significant mass loss from dissolution when colonized by microbes. Despite differences in cell density on the experimental surfaces, carbonate loss was greater from freshwater wells than saline, sulfidic wells. However, as cell density increased, which was correlated to and controlled by local geochemistry, dissolution rates decreased. Surface colonization by metabolically active cells promotes dissolution by creating local disequilibria between bulk aquifer fluids and mineral surfaces, but this also controls rates of karst aquifer modification. These results expand our understanding of microbial diversity in karst aquifers and emphasize the importance of evaluating active microbial processes that could affect carbonate weathering in the subsurface.

Impact of Soil Texture on Soil Ciliate Communities

NASA Astrophysics Data System (ADS)

Chau, J. F.; Brown, S.; Habtom, E.; Brinson, F.; Epps, M.; Scott, R.

2014-12-01

Soil water content and connectivity strongly influence microbial activities in soil, controlling access to nutrients and electron acceptors, and mediating interactions between microbes within and between trophic levels. These interactions occur at or below the pore scale, and are influenced by soil texture and structure, which determine the microscale architecture of soil pores. Soil protozoa are relatively understudied, especially given the strong control they exert on bacterial communities through predation. Here, ciliate communities in soils of contrasting textures were investigated. Two ciliate-specific primer sets targeting the 18S rRNA gene were used to amplify DNA extracted from eight soil samples collected from Sumter National Forest in western South Carolina. Primer sets 121F-384F-1147R (semi-nested) and 315F-959R were used to amplify soil ciliate DNA via polymerase chain reaction (PCR), and the resulting PCR products were analyzed by gel electrophoresis to obtain quantity and band size. Approximately two hundred ciliate 18S rRNA sequences were obtained were obtained from each of two contrasting soils. Sequences were aligned against the NCBI GenBank database for identification, and the taxonomic classification of best-matched sequences was determined. The ultimate goal of the work is to quantify changes in the ciliate community under short-timescale changes in hydrologic conditions for varying soil textures, elucidating dynamic responses to desiccation stress in major soil ciliate taxa.

Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

PubMed

Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

2013-08-01

Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

PubMed Central

Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

2016-01-01

Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore

PubMed Central

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-01-01

INTRODUCTION Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. METHODS Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. RESULTS Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. CONCLUSION The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. PMID:26805667

Insights into molecular plasticity in protein complexes from Trm9-Trm112 tRNA modifying enzyme crystal structure

PubMed Central

Létoquart, Juliette; van Tran, Nhan; Caroline, Vonny; Aleksandrov, Alexey; Lazar, Noureddine; van Tilbeurgh, Herman; Liger, Dominique; Graille, Marc

2015-01-01

Most of the factors involved in translation (tRNA, rRNA and proteins) are subject to post-transcriptional and post-translational modifications, which participate in the fine-tuning and tight control of ribosome and protein synthesis processes. In eukaryotes, Trm112 acts as an obligate activating platform for at least four methyltransferases (MTase) involved in the modification of 18S rRNA (Bud23), tRNA (Trm9 and Trm11) and translation termination factor eRF1 (Mtq2). Trm112 is then at a nexus between ribosome synthesis and function. Here, we present a structure-function analysis of the Trm9-Trm112 complex, which is involved in the 5-methoxycarbonylmethyluridine (mcm5U) modification of the tRNA anticodon wobble position and hence promotes translational fidelity. We also compare the known crystal structures of various Trm112-MTase complexes, highlighting the structural plasticity allowing Trm112 to interact through a very similar mode with its MTase partners, although those share less than 20% sequence identity. PMID:26438534

Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA

PubMed Central

Seligmann, Hervé; Raoult, Didier

2018-01-01

We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833

Assessment of microbial communities associated with fermentative-methanogenic biodegradation of aromatic hydrocarbons in groundwater contaminated with a biodiesel blend (B20).

PubMed

Ramos, Débora Toledo; da Silva, Márcio Luís Busi; Nossa, Carlos Wolfgang; Alvarez, Pedro J J; Corseuil, Henry Xavier

2014-09-01

A controlled field experiment was conducted to assess the potential for fermentative-methanogenic biostimulation (by ammonium-acetate injection) to enhance biodegradation of benzene, toluene, ethylbenzene and xylenes (BTEX) as well as polycyclic aromatic hydrocarbons (PAHs) in groundwater contaminated with biodiesel B20 (20:80 v/v soybean biodiesel and diesel). Changes in microbial community structure were assessed by pyrosequencing 16S rRNA analyses. BTEX and PAH removal began 0.7 year following the release, concomitantly with the increase in the relative abundance of Desulfitobacterium and Geobacter spp. (from 5 to 52.7 % and 15.8 to 37.3 % of total Bacteria 16S rRNA, respectively), which are known to anaerobically degrade hydrocarbons. The accumulation of anaerobic metabolites acetate and hydrogen that could hinder the thermodynamic feasibility of BTEX and PAH biotransformations under fermentative/methanogenic conditions was apparently alleviated by the growing predominance of Methanosarcina. This suggests the importance of microbial population shifts that enrich microorganisms capable of interacting syntrophically to enhance the feasibility of fermentative-methanogenic bioremediation of biodiesel blend releases.

Utility of COX1 phylogenetics to differentiate between locally acquired and imported Plasmodium knowlesi infections in Singapore.

PubMed

Loh, Jin Phang; Gao, Qiu Han Christine; Lee, Vernon J; Tetteh, Kevin; Drakeley, Chris

2016-12-01

Although there have been several phylogenetic studies on Plasmodium knowlesi (P. knowlesi), only cytochrome c oxidase subunit 1 (COX1) gene analysis has shown some geographical differentiation between the isolates of different countries. Phylogenetic analysis of locally acquired P. knowlesi infections, based on circumsporozoite, small subunit ribosomal ribonucleic acid (SSU rRNA), merozoite surface protein 1 and COX1 gene targets, was performed. The results were compared with the published sequences of regional isolates from Malaysia and Thailand. Phylogenetic analysis of the circumsporozoite, SSU rRNA and merozoite surface protein 1 gene sequences for regional P. knowlesi isolates showed no obvious differentiation that could be attributed to their geographical origin. However, COX1 gene analysis showed that it was possible to differentiate between Singapore-acquired P. knowlesi infections and P. knowlesi infections from Peninsular Malaysia and Sarawak, Borneo, Malaysia. The ability to differentiate between locally acquired P. knowlesi infections and imported P. knowlesi infections has important utility for the monitoring of P. knowlesi malaria control programmes in Singapore. Copyright: © Singapore Medical Association

Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

PubMed

Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

1993-11-01

In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing.

PubMed

Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

2015-06-01

Organophosphates like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, and this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon, or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted, and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with Accession Number: JN794045.

Identification and characterization of a pesticide degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing.

PubMed

Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

2014-08-09

Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045.

16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria.

PubMed

Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J; Thomas, David J

2017-09-01

The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12-14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa.

Comparison of synovial fluid culture and 16S rRNA PCR in dogs with suspected septic arthritis.

PubMed

Scharf, V F; Lewis, D D; Wellehan, J F; Wamsley, H L; Richardson, R

2015-06-01

To prospectively compare the sensitivity and specificity of 16S rRNA PCR with culture for identifying the causative organism in synovial fluid obtained from dogs with suspected septic arthritis. Synovial fluid cytology, PCR analysis and aerobic, anaerobic and Mycoplasma culture of samples from the affected joints of 18 dogs presenting with suspected septic arthritis were performed. Synovial fluid samples from the corresponding contralateral joints of 7 dogs were also analysed as negative controls. There was no significant difference between the sensitivity of bacterial detection via culture (63.2%) versus PCR (73.7%) of synovial fluid (P=0.728) or between culture and combined PCR and culture (89.5%) of synovial fluid (P=0.124). The specificity of PCR (42.9%) was significantly lower than culture specificity (100%) (P=0.07). Although 16S PCR may hold potential as an ancillary diagnostic test for identifying the causative organism in dogs with septic arthritis, our study failed to demonstrate improved accuracy compared with traditional synovial fluid culture. © 2015 Australian Veterinary Association.

The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

PubMed

Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

2015-01-01

In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

Direct regulation of RNA polymerase III transcription by RB, p53 and c-Myc.

PubMed

Felton-Edkins, Zoë A; Kenneth, Niall S; Brown, Timothy R P; Daly, Nicole L; Gomez-Roman, Natividad; Grandori, Carla; Eisenman, Robert N; White, Robert J

2003-01-01

The synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is cell cycle regulated in higher organisms. Overexpression of pol III products is a general feature of transformed cells. These observations may be explained by the fact that a pol III-specific transcription factor, TFIIIB, is strongly regulated by the tumor suppressors RB and p53, as well as the proto-oncogene product c-Myc. RB and p53 repress TFIIIB, but this restraint can be lost in tumors through a variety of mechanisms. In contrast, c-Myc binds and activates TFIIIB, causing potent induction of pol III transcription. Using chromatin immunoprecipitation and RNA interference, we show that c-Myc interacts with tRNA and 5S rRNA genes in transformed cervical cells, stimulating their expression. Availability of pol III products may be an important determinant of a cell's capacity to grow. The ability to regulate pol III output may therefore be integral to the growth control functions of RB, p53 and c-Myc.

Antimicrobial susceptibility and molecular characterization of macrolide resistance of Mycoplasma bovis isolates from multiple provinces in China

PubMed Central

KONG, Ling-Cong; GAO, Duo; JIA, Bo-Yan; WANG, Zi; GAO, Yun-Hang; PEI, Zhi-Hua; LIU, Shu-Ming; XIN, Jiu-Qing; MA, Hong-Xia

2015-01-01

Mycoplasma bovis has spread widely throughout the world via animal movement and has become an important pathogen of bovine respiratory disease. However, the minimum inhibitory concentrations of antimicrobials for Mycoplasma bovis have not been studied in China. The objective of this study was to determine the prevalence and antibiotic resistance of Mycoplasma bovis isolated from young cattle with respiratory infection in China. Mycoplasma bovis was detected in 32/45 bovine respiratory infection outbreaks at beef farms in 8 provinces in China. The isolates were susceptible or had medium sensitivity to ciprofloxacin, enrofloxacin and doxycycline, but were frequently resistant to macrolides (13/32, 41%). An A2058G (Escherichia coli Numbering) mutation located in the rrnA operon in domain V of 23S rRNA was observed in strains that were resistant to macrolides. This single mutations at the rrnA operon in domain V of 23S rRNA may play an important role in the resistance of Mycoplasma bovis strains to macrolides. PMID:26346744

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

PubMed

Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

2010-11-01

MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

PubMed Central

Patarca, R; Dorta, B; Ramirez, J L

1982-01-01

As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.

PubMed

Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V

2010-10-01

The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.

16S rRNA gene-based association study identified microbial taxa associated with pork intramuscular fat content in feces and cecum lumen.

PubMed

Fang, Shaoming; Xiong, Xingwei; Su, Ying; Huang, Lusheng; Chen, Congying

2017-07-19

Intramuscular fat (IMF) that deposits among muscle fibers or within muscle cells is an important meat quality trait in pigs. Previous studies observed the effects of dietary nutrients and additives on improving the pork IMF. Gut microbiome plays an important role in host metabolism and energy harvest. Whether gut microbiota exerts effect on IMF remains unknown. In this study, we investigated the microbial community structure of 500 samples from porcine cecum and feces using high-throughput 16S rRNA gene sequencing. We found that phylogenetic composition and potential function capacity of microbiome varied between two types of samples. Bacteria wide association study identified 119 OTUs significantly associated with IMF in the two types of samples (FDR < 0.1). Most of the IMF-associated OTUs belong to the bacteria related to polysaccharide degradation and amino acid metabolism (such as Prevotella, Treponema, Bacteroides and Clostridium). Potential function capacities related to metabolisms of carbohydrate, energy and amino acids, cell motility, and membrane transport were significantly associated with IMF content. FishTaco analysis suggested that the shifts of potential function capacities of microbiome associated with IMF might be caused by the IMF-associated microbial taxa. This study firstly evaluated the contribution of gut microbiome to porcine IMF content. The results presented a potential capacity for improving IMF through modulating gut microbiota.