NASA Technical Reports Server (NTRS)
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis
USDA-ARS?s Scientific Manuscript database
In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
[Methods, challenges and opportunities for big data analyses of microbiome].
Sheng, Hua-Fang; Zhou, Hong-Wei
2015-07-01
Microbiome is a novel research field related with a variety of chronic inflamatory diseases. Technically, there are two major approaches to analysis of microbiome: metataxonome by sequencing the 16S rRNA variable tags, and metagenome by shot-gun sequencing of the total microbial (mainly bacterial) genome mixture. The 16S rRNA sequencing analyses pipeline includes sequence quality control, diversity analyses, taxonomy and statistics; metagenome analyses further includes gene annotation and functional analyses. With the development of the sequencing techniques, the cost of sequencing will decrease, and big data analyses will become the central task. Data standardization, accumulation, modeling and disease prediction are crucial for future exploit of these data. Meanwhile, the information property in these data, and the functional verification with culture-dependent and culture-independent experiments remain the focus in future research. Studies of human microbiome will bring a better understanding of the relations between the human body and the microbiome, especially in the context of disease diagnosis and therapy, which promise rich research opportunities.
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences
NASA Technical Reports Server (NTRS)
Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.
1995-01-01
Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.
Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan
2013-09-01
Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.
USDA-ARS?s Scientific Manuscript database
In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...
Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John
2014-01-01
Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.
Molecular confirmation of Hepatozoon canis in Mauritius.
Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel
2018-01-01
In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.
2011-10-01
Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.
1992-01-01
Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.
Gaby, John Christian; Buckley, Daniel H
2014-01-01
We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm.
Gaby, John Christian; Buckley, Daniel H.
2014-01-01
We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm PMID:24501396
Root-knot nematodes in golf course greens of the western United States
USDA-ARS?s Scientific Manuscript database
A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.
Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne
2011-06-01
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Phylogeny of Kinorhyncha Based on Morphology and Two Molecular Loci
Sørensen, Martin V.; Dal Zotto, Matteo; Rho, Hyun Soo; Herranz, Maria; Sánchez, Nuria; Pardos, Fernando; Yamasaki, Hiroshi
2015-01-01
The phylogeny of Kinorhyncha was analyzed using morphology and the molecular loci 18S rRNA and 28S rRNA. The different datasets were analyzed separately and in combination, using maximum likelihood and Bayesian Inference. Bayesian inference of molecular sequence data in combination with morphology supported the division of Kinorhyncha into two major clades: Cyclorhagida comb. nov. and Allomalorhagida nom. nov. The latter clade represents a new kinorhynch class, and accommodates Dracoderes, Franciscideres, a yet undescribed genus which is closely related with Franciscideres, and the traditional homalorhagid genera. Homalorhagid monophyly was not supported by any analyses with molecular sequence data included. Analysis of the combined molecular and morphological data furthermore supported a cyclorhagid clade which included all traditional cyclorhagid taxa, except Dracoderes that no longer should be considered a cyclorhagid genus. Accordingly, Cyclorhagida is divided into three main lineages: Echinoderidae, Campyloderidae, and a large clade, ‘Kentrorhagata’, which except for species of Campyloderes, includes all species with a midterminal spine present in adult individuals. Maximum likelihood analysis of the combined datasets produced a rather unresolved tree that was not regarded in the following discussion. Results of the analyses with only molecular sequence data included were incongruent at different points. However, common for all analyses was the support of several major clades, i.e., Campyloderidae, Kentrorhagata, Echinoderidae, Dracoderidae, Pycnophyidae, and a clade with Paracentrophyes + New Genus and Franciscideres (in those analyses where the latter was included). All molecular analyses including 18S rRNA sequence data furthermore supported monophyly of Allomalorhagida. Cyclorhagid monophyly was only supported in analyses of combined 18S rRNA and 28S rRNA (both ML and BI), and only in a restricted dataset where taxa with incomplete information from 28S rRNA had been omitted. Analysis of the morphological data produced results that were similar with those from the combined molecular and morphological analysis. E.g., the morphological data also supported exclusion of Dracoderes from Cyclorhagida. The main differences between the morphological analysis and analyses based on the combined datasets include: 1) Homalorhagida appears as monophyletic in the morphological tree only, 2) the morphological analyses position Franciscideres and the new genus within Cyclorhagida near Zelinkaderidae and Cateriidae, whereas analyses including molecular data place the two genera inside Allomalorhagida, and 3) species of Campyloderes appear in a basal trichotomy within Kentrorhagata in the morphological tree, whereas analysis of the combined datasets places species of Campyloderes as a sister clade to Echinoderidae and Kentrorhagata. PMID:26200115
Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.
2011-01-01
Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan
2014-02-01
Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.
Toxicity phenotype does not correlate with phylogeny of Cylindrospermopsis raciborskii strains.
Stucken, Karina; Murillo, Alejandro A; Soto-Liebe, Katia; Fuentes-Valdés, Juan J; Méndez, Marco A; Vásquez, Mónica
2009-02-01
Cylindrospermopsis raciborskii is a species of freshwater, bloom-forming cyanobacterium. C. raciborskii produces toxins, including cylindrospermopsin (hepatotoxin) and saxitoxin (neurotoxin), although non toxin-producing strains are also observed. In spite of differences in toxicity, C. raciborskii strains comprise a monophyletic group, based upon 16S rRNA gene sequence identities (greater than 99%). We performed phylogenetic analyses; 16S rRNA gene and 16S-23S rRNA gene internally transcribed spacer (ITS-1) sequence comparisons, and genomic DNA restriction fragment length polymorphism (RFLP), resolved by pulsed-field gel electrophoresis (PFGE), of strains of C. raciborskii, obtained mainly from the Australian phylogeographic cluster. Our results showed no correlation between toxic phenotype and phylogenetic association in the Australian strains. Analyses of the 16S rRNA gene and the respective ITS-1 sequences (long L, and short S) showed an independent evolution of each ribosomal operon. The genes putatively involved in the cylindrospermopsin biosynthetic pathway were present in one locus and only in the hepatotoxic strains, demonstrating a common genomic organization for these genes and the absence of mutated or inactivated biosynthetic genes in the non toxic strains. In summary, our results support the hypothesis that the genes involved in toxicity may have been transferred as an island by processes of gene lateral transfer, rather than convergent evolution.
USDA-ARS?s Scientific Manuscript database
The 10 species of Streptomyces implicated as the etiological agents in scab disease of potatoes or soft rot disease of sweet potatoes are distributed among 7 different phylogenetic clades in analyses based on 16S rRNA gene sequences, but high sequence similarity of this gene among Streptomyces speci...
Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson
2017-06-01
Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.
Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi
2016-07-01
In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.
Liu, Huawei; Zhang, Lei; Meng, Aihua; Zhang, Junbiao; Xie, Miaomiao; Qin, Yaohong; Faulk, Dylan Chase; Zhang, Baohong; Yang, Shushen; Qiu, Li
2017-01-01
Ten strains of endophytic diazotroph were isolated and identified from the plants collected from three different agricultural crop species, wheat, rice and maize, using the nitrogen-free selective isolation conditions. The nitrogen-fixing ability of endophytic diazotroph was verified by the nifH-PCR assay that showed positive nitrogen fixation ability. These identified strains were classified by 879F-RAPD and 16S rRNA sequence analysis. RAPD analyses revealed that the 10 strains were clustered into seven 879F-RAPD groups, suggesting a clonal origin. 16S rRNA sequencing analyses allowed the assignment of the 10 strains to known groups of nitrogen-fixing bacteria, including organisms from the genera Paenibacillus, Enterobacter, Klebsiella and Pantoea. These representative genus are not endophytic diazotrophs in the conventional sense. They may have obtained nitrogen fixation ability through lateral gene transfer, however, the evolutionary forces of lateral gene transfer are not well known. Molecular identification results from 16S rRNA analyses were also confirmed by morphological and biochemical data. The test strains SH6A and MZB showed positive effect on the growth of plants.
Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A
2016-07-01
Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.
Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.
Mishima, Y; Mitsuma, T; Ogata, K
1985-01-01
An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977
Novel application of the MSSCP method in biodiversity studies.
Tomczyk-Żak, Karolina; Kaczanowski, Szymon; Górecka, Magdalena; Zielenkiewicz, Urszula
2012-02-01
Analysis of 16S rRNA sequence diversity is widely performed for characterizing the biodiversity of microbial samples. The number of determined sequences has a considerable impact on complete results. Although the cost of mass sequencing is decreasing, it is often still too high for individual projects. We applied the multi-temperature single-strand conformational polymorphism (MSSCP) method to decrease the number of analysed sequences. This was a novel application of this method. As a control, the same sample was analysed using random sequencing. In this paper, we adapted the MSSCP technique for screening of unique sequences of the 16S rRNA gene library and bacterial strains isolated from biofilms growing on the walls of an ancient gold mine in Poland and determined whether the results obtained by both methods differed and whether random sequencing could be replaced by MSSCP. Although it was biased towards the detection of rare sequences in the samples, the qualitative results of MSSCP were not different than those of random sequencing. Unambiguous discrimination of unique clones and strains creates an opportunity to effectively estimate the biodiversity of natural communities, especially in populations which are numerous but species poor. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Winnepenninckx, B; Backeljau, T; Mackey, L Y; Brooks, J M; De Wachter, R; Kumar, S; Garey, J R
1995-11-01
The Aschelminthes is a collection of at least eight animal phyla, historically grouped together because the absence of a true body cavity was perceived as a pseudocoelom. Analyses of 18S rRNA sequences from six Aschelminth phyla (including four previously unpublished sequences) support polyphyly for the Aschelminthes. At least three distinct groups of Aschelminthes were detected: the Priapulida among the protostomes, the Rotifera-Acanthocephala as a sister group to the protostomes, and the Nematoda as a basal group to the triploblastic Eumetazoa.
Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman
2018-01-01
The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.
Vd’ačný, Peter; Bourland, William A.; Orsi, William; Epstein, Slava S.; Foissner, Wilhelm
2012-01-01
The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria + Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763
Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm
2012-11-01
The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria+Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. Copyright © 2012 Elsevier Inc. All rights reserved.
Cavalier-Smith, Thomas
2015-04-01
Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.
Bacterial community composition characterization of a lead-contaminated Microcoleus sp. consortium.
Giloteaux, Ludovic; Solé, Antoni; Esteve, Isabel; Duran, Robert
2011-08-01
A Microcoleus sp. consortium, obtained from the Ebro delta microbial mat, was maintained under different conditions including uncontaminated, lead-contaminated, and acidic conditions. Terminal restriction fragment length polymorphism and 16S rRNA gene library analyses were performed in order to determine the effect of lead and culture conditions on the Microcoleus sp. consortium. The bacterial composition inside the consortium revealed low diversity and the presence of specific terminal-restriction fragments under lead conditions. 16S rRNA gene library analyses showed that members of the consortium were affiliated to the Alpha, Beta, and Gammaproteobacteria and Cyanobacteria. Sequences closely related to Achromobacter spp., Alcaligenes faecalis, and Thiobacillus species were exclusively found under lead conditions while sequences related to Geitlerinema sp., a cyanobacterium belonging to the Oscillatoriales, were not found in presence of lead. This result showed a strong lead selection of the bacterial members present in the Microcoleus sp. consortium. Several of the 16S rRNA sequences were affiliated to nitrogen-fixing microorganisms including members of the Rhizobiaceae and the Sphingomonadaceae. Additionally, confocal laser scanning microscopy and scanning and transmission electron microscopy showed that under lead-contaminated condition Microcoleus sp. cells were grouped and the number of electrodense intracytoplasmic inclusions was increased.
USDA-ARS?s Scientific Manuscript database
Phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species having very similar gross morphology. These species, including Streptomyces bambergiensis, Streptomyces chlorus, Streptomyces...
Uhlik, Ondrej; Strejcek, Michal; Junkova, Petra; Sanda, Miloslav; Hroudova, Miluse; Vlcek, Cestmir; Mackova, Martina; Macek, Tomas
2011-01-01
Bacteria that are able to utilize biphenyl as a sole source of carbon were extracted and isolated from polychlorinated biphenyl (PCB)-contaminated soil vegetated by horseradish. Isolates were identified using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The usage of MALDI Biotyper for the classification of isolates was evaluated and compared to 16S rRNA gene sequence analysis. A wide spectrum of bacteria was isolated, with Arthrobacter, Serratia, Rhodococcus, and Rhizobium being predominant. Arthrobacter isolates also represented the most diverse group. The use of MALDI Biotyper in many cases permitted the identification at the level of species, which was not achieved by 16S rRNA gene sequence analyses. However, some isolates had to be identified by 16S rRNA gene analyses if MALDI Biotyper-based identification was at the level of probable or not reliable identification, usually due to a lack of reference spectra included in the database. Overall, this study shows the possibility of using MALDI-TOF MS and MALDI Biotyper for the fast and relatively nonlaborious identification/classification of soil isolates. At the same time, it demonstrates the dominant role of employing 16S rRNA gene analyses for the identification of recently isolated strains that can later fill the gaps in the protein-based identification databases. PMID:21821747
Wolff, G; Kück, U
1990-04-01
The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.
Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio
2008-01-01
In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order—this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia. PMID:18310338
Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko
2005-01-01
PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.
Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.
2011-01-01
High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204
TaxI: a software tool for DNA barcoding using distance methods
Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel
2005-01-01
DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755
How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys
Berney, Cédric; Fahrni, José; Pawlowski, Jan
2004-01-01
Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975
Branciamore, Sergio; Di Giulio, Massimo
2012-04-01
The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Chan, Clara; Itoh, Takashi; Ohkuma, Moriya
2013-01-01
Iron-rich flocs often occur where anoxic water containing ferrous iron encounters oxygenated environments. Culture-independent molecular analyses have revealed the presence of 16S rRNA gene sequences related to diverse bacteria, including autotrophic iron oxidizers and methanotrophs in iron-rich flocs; however, the metabolic functions of the microbial communities remain poorly characterized, particularly regarding carbon cycling. In the present study, we cultivated iron-oxidizing bacteria (FeOB) and performed clone library analyses of functional genes related to carbon fixation and methane oxidization (cbbM and pmoA, respectively), in addition to bacterial and archaeal 16S rRNA genes, in freshwater iron-rich flocs at groundwater discharge points. The analyses of 16S rRNA, cbbM, and pmoA genes strongly suggested the coexistence of autotrophic iron oxidizers and methanotrophs in the flocs. Furthermore, a novel stalk-forming microaerophilic FeOB, strain OYT1, was isolated and characterized phylogenetically and physiologically. The 16S rRNA and cbbM gene sequences of OYT1 are related to those of other microaerophilic FeOB in the family Gallionellaceae, of the Betaproteobacteria, isolated from freshwater environments at circumneutral pH. The physiological characteristics of OYT1 will help elucidate the ecophysiology of microaerophilic FeOB. Overall, this study demonstrates functional roles of microorganisms in iron flocs, suggesting several possible linkages between Fe and C cycling. PMID:23811518
PanFP: Pangenome-based functional profiles for microbial communities
Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren; ...
2015-09-26
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less
PanFP: pangenome-based functional profiles for microbial communities.
Jun, Se-Ran; Robeson, Michael S; Hauser, Loren J; Schadt, Christopher W; Gorin, Andrey A
2015-09-26
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost-effective way to screen samples of interest for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. We present a computational method called pangenome-based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU's taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome's functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8-0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed-reference OTU picking strategies against specific reference sequence databases. We developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub ( https://github.com/srjun/PanFP ).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less
Assessing the diversity of AM fungi in arid gypsophilous plant communities.
Alguacil, M M; Roldán, A; Torres, M P
2009-10-01
In the present study, we used PCR-Single-Stranded Conformation Polymorphism (SSCP) techniques to analyse arbuscular mycorrhizal fungi (AMF) communities in four sites within a 10 km(2) gypsum area in Southern Spain. Four common plant species from these ecosystems were selected. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, SSCP analysis, sequencing and phylogenetic analyses. A total of 1443 SSU rRNA sequences were analysed, for 21 AM fungal types: 19 belonged to the genus Glomus, 1 to the genus Diversispora and 1 to the Scutellospora. Four sequence groups were identified, which showed high similarity to sequences of known glomalean species or isolates: Glo G18 to Glomus constrictum, Glo G1 to Glomus intraradices, Glo G16 to Glomus clarum, Scut to Scutellospora dipurpurescens and Div to one new genus in the family Diversisporaceae identified recently as Otospora bareai. There were three sequence groups that received strong support in the phylogenetic analysis, and did not seem to be related to any sequences of AM fungi in culture or previously found in the database; thus, they could be novel taxa within the genus Glomus: Glo G4, Glo G2 and Glo G14. We have detected the presence of both generalist and potential specialist AMF in gypsum ecosystems. The AMF communities were different in the plant studied suggesting some degree of preference in the interactions between these symbionts.
Jiang, Xuexia; Jiao, Nianzhi
2016-09-01
Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.
Hubert, Jan; Erban, Tomas; Kopecky, Jan; Sopko, Bruno; Nesvorna, Marta; Lichovnikova, Martina; Schicht, Sabine; Strube, Christina; Sparagano, Olivier
2017-11-01
Blood feeding red poultry mites (RPM) serve as vectors of pathogenic bacteria and viruses among vertebrate hosts including wild birds, poultry hens, mammals, and humans. The microbiome of RPM has not yet been studied by high-throughput sequencing. RPM eggs, larvae, and engorged adult/nymph samples obtained in four poultry houses in Czechia were used for microbiome analyses by Illumina amplicon sequencing of the 16S ribosomal RNA (rRNA) gene V4 region. A laboratory RPM population was used as positive control for transcriptome analysis by pyrosequencing with identification of sequences originating from bacteria. The samples of engorged adult/nymph stages had 100-fold more copies of 16S rRNA gene copies than the samples of eggs and larvae. The microbiome composition showed differences among the four poultry houses and among observed developmental stadia. In the adults' microbiome 10 OTUs comprised 90 to 99% of all sequences. Bartonella-like bacteria covered between 30 and 70% of sequences in RPM microbiome and 25% bacterial sequences in transcriptome. The phylogenetic analyses of 16S rRNA gene sequences revealed two distinct groups of Bartonella-like bacteria forming sister groups: (i) symbionts of ants; (ii) Bartonella genus. Cardinium, Wolbachia, and Rickettsiella sp. were found in the microbiomes of all tested stadia, while Spiroplasma eriocheiris and Wolbachia were identified in the laboratory RPM transcriptome. The microbiomes from eggs, larvae, and engorged adults/nymphs differed. Bartonella-like symbionts were found in all stadia and sampling sites. Bartonella-like bacteria was the most diversified group within the RPM microbiome. The presence of identified putative pathogenic bacteria is relevant with respect to human and animal health issues while the identification of symbiontic bacteria can lead to new control methods targeting them to destabilize the arthropod host.
Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C
2005-03-01
The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.
Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.
Habibi, Gh
2012-01-01
Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.
Silaghi, C; Scheuerle, M C; Friche Passos, L M; Thiel, C; Pfister, K
2011-02-01
Central Switzerland is a highly endemic region for tick-borne fever (TBF) in cattle, however, little is known about A. phagocytophilum in goats. In the present study, 72 animals from six goat flocks (373 EDTA blood-samples) in Central Switzerland were analysed for A. phagocytophilum DNA. A real-time PCR targeting the msp2 gene of A. phagocytophilum was performed and in positive samples the partial 165 rRNA, groEL and msp4 gene were amplified for sequence analysis. Four DNA extracts were positive. Different sequence types on basis of the amplified genes were found. For comparison, sequences of A. phagocytophilum from 12 cattle (originating from Switzerland and Southern Germany) were analysed. The 165 rRNA gene sequences from cattle were all identical amongst each other, but the groEL and msp4 gene differed depending on the origin of the cattle samples and differed from the variants from goats. This study clearly provides molecular evidence for the presence of different types of A. phagocytophilum in goat flocks in Switzerland, a fact which deserves more thorough attention in clinical studies.
Ngugi, David Kamanda; Stingl, Ulrich
2012-01-01
Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592
Lynch, T; Gregson, D; Church, D L
2016-03-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Gregson, D.; Church, D. L.
2016-01-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153
Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C
2013-01-16
The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.
2012-06-01
During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.
NASA Astrophysics Data System (ADS)
Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.
2012-11-01
During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.
USDA-ARS?s Scientific Manuscript database
Previous phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species that exhibited very similar gross morphology in producing open looped (Retinaculum-Apertum) to spiral (Spira) chains...
Lopes-Santos, Lucilene; Castro, Daniel Bedo Assumpção; Ferreira-Tonin, Mariana; Corrêa, Daniele Bussioli Alves; Weir, Bevan Simon; Park, Duckchul; Ottoboni, Laura Maria Mariscal; Neto, Júlio Rodrigues; Destéfano, Suzete Aparecida Lanza
2017-06-01
The phylogenetic classification of the species Burkholderia andropogonis within the Burkholderia genus was reassessed using 16S rRNA gene phylogenetic analysis and multilocus sequence analysis (MLSA). Both phylogenetic trees revealed two main groups, named A and B, strongly supported by high bootstrap values (100%). Group A encompassed all of the Burkholderia species complex, whi.le Group B only comprised B. andropogonis species, with low percentage similarities with other species of the genus, from 92 to 95% for 16S rRNA gene sequences and 83% for conserved gene sequences. Average nucleotide identity (ANI), tetranucleotide signature frequency, and percentage of conserved proteins POCP analyses were also carried out, and in the three analyses B. andropogonis showed lower values when compared to the other Burkholderia species complex, near 71% for ANI, from 0.484 to 0.724 for tetranucleotide signature frequency, and around 50% for POCP, reinforcing the distance observed in the phylogenetic analyses. Our findings provide an important insight into the taxonomy of B. andropogonis. It is clear from the results that this bacterial species exhibits genotypic differences and represents a new genus described herein as Robbsia andropogonis gen. nov., comb. nov.
TAGAWA, Michihito; MATSUMOTO, Kotaro; YOKOYAMA, Naoaki; INOKUMA, Hisashi
2013-01-01
ABSTRACT Hemotropic mycoplasmas (hemoplasmas) are cell-wall deficient, epierythrocytic bacteria that cause infectious anemia in several mammalian species. The prevalence of hemoplasma species was examined by screening and species-specific PCR using blood samples collected from 51 sika deer in Hokkaido, Japan. Molecular analyses were performed for the 16S rRNA, 23S rRNA and RNase P RNA (rnpB) gene sequences. A total of 23/51 (45%) deer DNA samples were positive for hemoplasmas in the screening PCR. Using species-specific PCR, 12 and 17 samples were positive for ‘Candidatus Mycoplasma haemocervae’ and ‘Candidatus M. erythrocervae’, respectively. Sequencing and phylogenetic trees of those three genes indicate that the ‘Candidatus M. haemocervae’ and ‘Candidatus M. erythrocervae’ detected in Japanese deer are potentially different species from the cervine hemoplasma found in deer from America and Brazil. PMID:24270803
Evolutionary relationships among pathogenic Candida species and relatives.
Barns, S M; Lane, D J; Sogin, M L; Bibeau, C; Weisburg, W G
1991-01-01
Small subunit rRNA sequences have been determined for 10 of the most clinically important pathogenic species of the yeast genus Candida (including Torulopsis [Candida] glabrata and Yarrowia [Candida] lipolytica) and for Hansenula polymorpha. Phylogenetic analyses of these sequences and those of Saccharomyces cerevisiae, Kluyveromyces marxianus var. lactis, and Aspergillus fumigatus indicate that Candida albicans, C. tropicalis, C. parapsilosis, and C. viswanathii form a subgroup within the genus. The remaining significant pathogen, T. glabrata, falls into a second, distinct subgroup and is specifically related to S. cerevisiae and more distantly related to C. kefyr (psuedotropicalis) and K. marxianus var. lactis. The 18S rRNA sequence of Y. lipolytica has evolved rapidly in relation to the other Candida sequences examined and appears to be only distantly related to them. As anticipated, species of several other genera appear to bear specific relationships to members of the genus Candida. PMID:2007550
Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.
2017-01-01
RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661
Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C
2014-08-29
Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.
Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia
Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen
2016-01-01
Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821
Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S
2005-11-01
Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.
Lalev, A I; Abeyrathne, P D; Nazar, R N
2000-09-08
The interdependency of steps in the processing of pre-rRNA in Schizosaccharomyces pombe suggests that RNA processing, at least in part, acts as a quality control mechanism which helps assure that only functional RNA is incorporated into mature ribosomes. To determine further the role of the transcribed spacer regions in rRNA processing and to detect interactions which underlie the interdependencies, the ITS1 sequence was examined for its ability to form ribonucleoprotein complexes with cellular proteins. When incubated with protein extract, the spacer formed a specific large RNP. This complex was stable to fractionation by agarose or polyacrylamide gel electrophoresis. Modification exclusion analyses indicated that the proteins interact with a helical domain which is conserved in the internal transcribed spacers. Mutagenic analyses confirmed an interaction with this sequence and indicated that this domain is critical to the efficient maturation of the precursor RNA. The protein constituents, purified by affinity chromatography using the ITS1 sequence, retained an ability to form stable RNP. Protein analyses of gel purified complex, prepared with affinity-purified proteins, indicated at least 20 protein components ranging in size from 20-200 kDa. Peptide mapping by Maldi-Toff mass spectroscopy identified eight hypothetical RNA binding proteins which included four different RNA-binding motifs. Another protein was putatively identified as a pseudouridylate synthase. Additional RNA constituents were not detected. The significance of this complex with respect to rRNA maturation and interdependence in rRNA processing is discussed. Copyright 2000 Academic Press.
Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy
Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin
2016-01-01
ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115
Lenehan, Claire E; Tobe, Shanan S; Smith, Renee J; Popelka-Filcoff, Rachel S
2017-01-01
Many archaeological science studies use the concept of "provenance", where the origins of cultural material can be determined through physical or chemical properties that relate back to the origins of the material. Recent studies using DNA profiling of bacteria have been used for the forensic determination of soils, towards determination of geographic origin. This manuscript presents a novel approach to the provenance of archaeological minerals and related materials through the use of 16S rRNA sequencing analysis of microbial DNA. Through the microbial DNA characterization from ochre and multivariate statistics, we have demonstrated the clear discrimination between four distinct Australian cultural ochre sites.
Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward
2013-08-01
Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.
Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines.
Mapalo, Marc A; Stec, Daniel; Mirano-Bascos, Denise; Michalczyk, Łukasz
2016-06-20
The limnoterrestrial tardigrade fauna of the Philippines is completely unknown. In this paper, we describe the first ever limnoterrestrial water bear species from this southeast Asian country, Mesobiotus philippinicus sp. nov., found in a moss sample collected in Quezon City. Apart from morphometrics and imaging in light microscopy, we also analysed the new species under scanning electron microscope and sequenced four DNA markers differing in mutation rates, three nuclear (18S rRNA, 28S rRNA, and ITS-2) and one mitochondrial (COI). This allowed not only a detailed description but also provided barcodes to aid future species identification. The new species belongs to the harmsworthi group and is most similar to M. diffusus (Binda & Pilato, 1987), M. pseudocoronatus (Pilato et al., 2006), M. montanus (Murray, 1910) and M. mottai (Binda & Pilato, 1994), but differs from these species by whorled egg processes and dimensions of some morphometric traits. The 28S rRNA, ITS-2 and COI sequences presented in this paper are the first published DNA sequences for the genus Mesobiotus.
Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.
Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža
2017-05-01
Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T = NRRL Y-63865 T = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.
Hubert, Casey R J; Oldenburg, Thomas B P; Fustic, Milovan; Gray, Neil D; Larter, Stephen R; Penn, Kevin; Rowan, Arlene K; Seshadri, Rekha; Sherry, Angela; Swainsbury, Richard; Voordouw, Gerrit; Voordouw, Johanna K; Head, Ian M
2012-01-01
Summary The subsurface microbiology of an Athabasca oil sands reservoir in western Canada containing severely biodegraded oil was investigated by combining 16S rRNA gene- and polar lipid-based analyses of reservoir formation water with geochemical analyses of the crude oil and formation water. Biomass was filtered from formation water, DNA was extracted using two different methods, and 16S rRNA gene fragments were amplified with several different primer pairs prior to cloning and sequencing or community fingerprinting by denaturing gradient gel electrophoresis (DGGE). Similar results were obtained irrespective of the DNA extraction method or primers used. Archaeal libraries were dominated by Methanomicrobiales (410 of 414 total sequences formed a dominant phylotype affiliated with a Methanoregula sp.), consistent with the proposed dominant role of CO2-reducing methanogens in crude oil biodegradation. In two bacterial 16S rRNA clone libraries generated with different primer pairs, > 99% and 100% of the sequences were affiliated with Epsilonproteobacteria (n = 382 and 72 total clones respectively). This massive dominance of Epsilonproteobacteria sequences was again obtained in a third library (99% of sequences; n = 96 clones) using a third universal bacterial primer pair (inosine-341f and 1492r). Sequencing of bands from DGGE profiles and intact polar lipid analyses were in accordance with the bacterial clone library results. Epsilonproteobacterial OTUs were affiliated with Sulfuricurvum, Arcobacter and Sulfurospirillum spp. detected in other oil field habitats. The dominant organism revealed by the bacterial libraries (87% of all sequences) is a close relative of Sulfuricurvum kujiense – an organism capable of oxidizing reduced sulfur compounds in crude oil. Geochemical analysis of organic extracts from bitumen at different reservoir depths down to the oil water transition zone of these oil sands indicated active biodegradation of dibenzothiophenes, and stable sulfur isotope ratios for elemental sulfur and sulfate in formation waters were indicative of anaerobic oxidation of sulfur compounds. Microbial desulfurization of crude oil may be an important metabolism for Epsilonproteobacteria indigenous to oil reservoirs with elevated sulfur content and may explain their prevalence in formation waters from highly biodegraded petroleum systems. PMID:21824242
Dalmay, Tamas
2018-01-01
RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379
Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L
2007-04-10
To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.
Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H
2005-01-01
To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.
Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek
2014-01-01
The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.
Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
Molecular characterization of sulfate-reducing bacteria in the Guaymas Basin
NASA Technical Reports Server (NTRS)
Dhillon, Ashita; Teske, Andreas; Dillon, Jesse; Stahl, David A.; Sogin, Mitchell L.
2003-01-01
The Guaymas Basin (Gulf of California) is a hydrothermal vent site where thermal alteration of deposited planktonic and terrestrial organic matter forms petroliferous material which supports diverse sulfate-reducing bacteria. We explored the phylogenetic and functional diversity of the sulfate-reducing bacteria by characterizing PCR-amplified dissimilatory sulfite reductase (dsrAB) and 16S rRNA genes from the upper 4 cm of the Guaymas sediment. The dsrAB sequences revealed that there was a major clade closely related to the acetate-oxidizing delta-proteobacterial genus Desulfobacter and a clade of novel, deeply branching dsr sequences related to environmental dsr sequences from marine sediments in Aarhus Bay and Kysing Fjord (Denmark). Other dsr clones were affiliated with gram-positive thermophilic sulfate reducers (genus Desulfotomaculum) and the delta-proteobacterial species Desulforhabdus amnigena and Thermodesulforhabdus norvegica. Phylogenetic analysis of 16S rRNAs from the same environmental samples resulted in identification of four clones affiliated with Desulfobacterium niacini, a member of the acetate-oxidizing, nutritionally versatile genus Desulfobacterium, and one clone related to Desulfobacula toluolica and Desulfotignum balticum. Other bacterial 16S rRNA bacterial phylotypes were represented by non-sulfate reducers and uncultured lineages with unknown physiology, like OP9, OP8, as well as a group with no clear affiliation. In summary, analyses of both 16S rRNA and dsrAB clone libraries resulted in identification of members of the Desulfobacteriales in the Guaymas sediments. In addition, the dsrAB sequencing approach revealed a novel group of sulfate-reducing prokaryotes that could not be identified by 16S rRNA sequencing.
Lee, I-M; Bottner-Parker, K D; Zhao, Y; Bertaccini, A; Davis, R E
2012-09-01
The pigeon pea witches'-broom phytoplasma group (16SrIX) comprises diverse strains that cause numerous diseases in leguminous trees and herbaceous crops, vegetables, a fruit, a nut tree and a forest tree. At least 14 strains have been reported worldwide. Comparative phylogenetic analyses of the highly conserved 16S rRNA gene and the moderately conserved rplV (rpl22)-rpsC (rps3) and secY genes indicated that the 16SrIX group consists of at least six distinct genetic lineages. Some of these lineages cannot be readily differentiated based on analysis of 16S rRNA gene sequences alone. The relative genetic distances among these closely related lineages were better assessed by including more variable genes [e.g. ribosomal protein (rp) and secY genes]. The present study demonstrated that virtual RFLP analyses using rp and secY gene sequences allowed unambiguous identification of such lineages. A coding system is proposed to designate each distinct rp and secY subgroup in the 16SrIX group.
Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut
2018-06-01
Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.
NASA Technical Reports Server (NTRS)
Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr
1992-01-01
A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.
Phylogeny of culturable cyanobacteria from Brazilian mangroves.
Silva, Caroline Souza Pamplona; Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Fiore, Marli Fátima
2014-03-01
The cyanobacterial community from Brazilian mangrove ecosystems was examined using a culture-dependent method. Fifty cyanobacterial strains were isolated from soil, water and periphytic samples collected from Cardoso Island and Bertioga mangroves using specific cyanobacterial culture media. Unicellular, homocytous and heterocytous morphotypes were recovered, representing five orders, seven families and eight genera (Synechococcus, Cyanobium, Cyanobacterium, Chlorogloea, Leptolyngbya, Phormidium, Nostoc and Microchaete). All of these novel mangrove strains had their 16S rRNA gene sequenced and BLAST analysis revealed sequence identities ranging from 92.5 to 99.7% when they were compared with other strains available in GenBank. The results showed a high variability of the 16S rRNA gene sequences among the genotypes that was not associated with the morphologies observed. Phylogenetic analyses showed several branches formed exclusively by some of these novel 16S rRNA gene sequences. BLAST and phylogeny analyses allowed for the identification of Nodosilinea and Oxynema strains, genera already known to exhibit poor morphological diacritic traits. In addition, several Nostoc and Leptolyngbya morphotypes of the mangrove strains may represent new generic entities, as they were distantly affiliated with true genera clades. The presence of non-ribosomal peptide synthetase, polyketide synthase, microcystin and saxitoxin genes were detected in 20.5%, 100%, 37.5% and 33.3%, respectively, of the 44 tested isolates. A total of 134 organic extracts obtained from 44 strains were tested against microorganisms, and 26% of the extracts showed some antimicrobial activity. This is the first polyphasic study of cultured cyanobacteria from Brazilian mangrove ecosystems using morphological, genetic and biological approaches. Copyright © 2014 Elsevier GmbH. All rights reserved.
Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.
Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L
1996-01-01
Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200
Streptococcus bovimastitidis sp. nov., isolated from a dairy cow with mastitis.
de Vries, Stefan P W; Hadjirin, Nazreen F; Lay, Elizabeth M; Zadoks, Ruth N; Peacock, Sharon J; Parkhill, Julian; Grant, Andrew J; McDougall, Scott; Holmes, Mark A
2018-01-01
Here we describe a new species of the genus Streptococcus that was isolated from a dairy cow with mastitis in New Zealand. Strain NZ1587 T was Gram-positive, coccus-shaped and arranged as chains, catalase and coagulase negative, γ-haemolytic and negative for Lancefield carbohydrates (A-D, F and G). The 16S rRNA sequence did not match sequences in the NCBI 16S rRNA or GreenGenes databases. Taxonomic classification of strain NZ1587 T was investigated using 16S rRNA and core genome phylogeny, genome-wide average nucleotide identity (ANI) and predicted DNA-DNA hybridisation (DDH) analyses. Phylogeny based on 16S rRNA was unable to resolve the taxonomic position of strain NZ1587 T , however NZ1587 T shared 99.4 % identity at the 16S rRNA level with a distinct branch of S. pseudoporcinus. Importantly, core genome phylogeny demonstrated that NZ1587 T grouped amongst the 'pyogenic' streptococcal species and formed a distinct branch supported by a 100 % bootstrap value. In addition, average nucleotide identity and inferred DNA-DNA hybridisation analyses showed that NZ1587 T represents a novel species. Biochemical profiling using the rapid ID 32 strep identification test enabled differentiation of strain NZ1587 T from closely related streptococcal species. In conclusion, strain NZ1587 T can be classified as a novel species, and we propose a novel taxon named Streptococcus bovimastitidis sp. nov.; the type strain is NZ1587 T . NZ1587 T has been deposited in the Culture Collection University of Gothenburg (CCUG 69277 T ) and the Belgian Co-ordinated Collections of Micro-organisms/LMG (LMG 29747).
Arfken, Ann M; Song, Bongkeun; Mallin, Michael A
2015-09-01
Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.
Description of Drinking Water Bacterial Communities Using 16S rRNA Gene Sequence Analyses
Descriptions of bacterial communities inhabiting water distribution systems (WDS) have mainly been accomplished using culture-based approaches. Due to the inherent selective nature of culture-based approaches, the majority of bacteria inhabiting WDS remain uncharacterized. The go...
Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal
2005-04-11
We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.
Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R
2010-05-01
To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.
Koren, Omry; Knights, Dan; Gonzalez, Antonio; Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E
2013-01-01
Recent analyses of human-associated bacterial diversity have categorized individuals into 'enterotypes' or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes.
Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E.
2013-01-01
Recent analyses of human-associated bacterial diversity have categorized individuals into ‘enterotypes’ or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes. PMID:23326225
Masuda, R; Lopez, J V; Slattery, J P; Yuhki, N; O'Brien, S J
1996-12-01
Molecular phylogeny of the cat family Felidae is derived using two mitochondrial genes, cytochrome b and 12S rRNA. Phylogenetic methods of weighted maximum parsimony and minimum evolution estimated by neighbor-joining are employed to reconstruct topologies among 20 extant felid species. Sequence analyses of 363 bp of cytochrome b and 376 bp of the 12S rRNA genes yielded average pair-wise similarity values between felids ranging from 94 to 99% and from 85 to 99%, respectively. Phylogenetic reconstruction supports more recent, intralineage associations but fails to completely resolve interlineage relationships. Both genes produce a monophyletic group of Felis species but vary in the placement of the pallas cat. The ocelot lineage represents an early divergence within the Felidae, with strong associations between ocelot and margay, Geoffroy's cat and kodkod, and pampas cat and tigrina. Implications of the relative recency of felid evolution, presence of ancestral polymorphisms, and influence of outgroups in placement of the topological root are discussed.
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258
The sponge microbiome project.
Moitinho-Silva, Lucas; Nielsen, Shaun; Amir, Amnon; Gonzalez, Antonio; Ackermann, Gail L; Cerrano, Carlo; Astudillo-Garcia, Carmen; Easson, Cole; Sipkema, Detmer; Liu, Fang; Steinert, Georg; Kotoulas, Giorgos; McCormack, Grace P; Feng, Guofang; Bell, James J; Vicente, Jan; Björk, Johannes R; Montoya, Jose M; Olson, Julie B; Reveillaud, Julie; Steindler, Laura; Pineda, Mari-Carmen; Marra, Maria V; Ilan, Micha; Taylor, Michael W; Polymenakou, Paraskevi; Erwin, Patrick M; Schupp, Peter J; Simister, Rachel L; Knight, Rob; Thacker, Robert W; Costa, Rodrigo; Hill, Russell T; Lopez-Legentil, Susanna; Dailianis, Thanos; Ravasi, Timothy; Hentschel, Ute; Li, Zhiyong; Webster, Nicole S; Thomas, Torsten
2017-10-01
Marine sponges (phylum Porifera) are a diverse, phylogenetically deep-branching clade known for forming intimate partnerships with complex communities of microorganisms. To date, 16S rRNA gene sequencing studies have largely utilised different extraction and amplification methodologies to target the microbial communities of a limited number of sponge species, severely limiting comparative analyses of sponge microbial diversity and structure. Here, we provide an extensive and standardised dataset that will facilitate sponge microbiome comparisons across large spatial, temporal, and environmental scales. Samples from marine sponges (n = 3569 specimens), seawater (n = 370), marine sediments (n = 65) and other environments (n = 29) were collected from different locations across the globe. This dataset incorporates at least 268 different sponge species, including several yet unidentified taxa. The V4 region of the 16S rRNA gene was amplified and sequenced from extracted DNA using standardised procedures. Raw sequences (total of 1.1 billion sequences) were processed and clustered with (i) a standard protocol using QIIME closed-reference picking resulting in 39 543 operational taxonomic units (OTU) at 97% sequence identity, (ii) a de novo clustering using Mothur resulting in 518 246 OTUs, and (iii) a new high-resolution Deblur protocol resulting in 83 908 unique bacterial sequences. Abundance tables, representative sequences, taxonomic classifications, and metadata are provided. This dataset represents a comprehensive resource of sponge-associated microbial communities based on 16S rRNA gene sequences that can be used to address overarching hypotheses regarding host-associated prokaryotes, including host specificity, convergent evolution, environmental drivers of microbiome structure, and the sponge-associated rare biosphere. © The Authors 2017. Published by Oxford University Press.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Single cell genomics of uncultured marine alveolates shows paraphyly of basal dinoflagellates.
Strassert, Jürgen F H; Karnkowska, Anna; Hehenberger, Elisabeth; Del Campo, Javier; Kolisko, Martin; Okamoto, Noriko; Burki, Fabien; Janouškovec, Jan; Poirier, Camille; Leonard, Guy; Hallam, Steven J; Richards, Thomas A; Worden, Alexandra Z; Santoro, Alyson E; Keeling, Patrick J
2018-01-01
Marine alveolates (MALVs) are diverse and widespread early-branching dinoflagellates, but most knowledge of the group comes from a few cultured species that are generally not abundant in natural samples, or from diversity analyses of PCR-based environmental SSU rRNA gene sequences. To more broadly examine MALV genomes, we generated single cell genome sequences from seven individually isolated cells. Genes expected of heterotrophic eukaryotes were found, with interesting exceptions like presence of proteorhodopsin and vacuolar H + -pyrophosphatase. Phylogenetic analysis of concatenated SSU and LSU rRNA gene sequences provided strong support for the paraphyly of MALV lineages. Dinoflagellate viral nucleoproteins were found only in MALV groups that branched as sister to dinokaryotes. Our findings indicate that multiple independent origins of several characteristics early in dinoflagellate evolution, such as a parasitic life style, underlie the environmental diversity of MALVs, and suggest they have more varied trophic modes than previously thought.
Adenovirus and mycoplasma infection in an ornate box turtle (Terrapene ornata ornata) in Hungary.
Farkas, Szilvia L; Gál, János
2009-07-02
A female, adult ornate box turtle (Terrapene ornata ornata) with fatty liver was submitted for virologic examination in Hungary. Signs of an adenovirus infection including degeneration of the liver cells, enlarged nuclei and intranuclear inclusion bodies were detected by light microscopic examination. The presence of an adenovirus was later confirmed by obtaining partial sequence data from the adenoviral DNA-dependent DNA-polymerase. Phylogenetic analyses revealed that this novel chelonian adenovirus was distinct from previously described reptilian adenoviruses, not belonging to any of the recognized genera of the family Adenoviridae. As a part of the routine diagnostic procedure for chelonians the detection of herpes-, rana- and iridoviruses together with Mycoplasma spp. was attempted. Amplicons were generated by a general mycoplasma polymerase chain reaction (PCR) targeting the 16S/23S ribosomal RNA (rRNA) intergenic spacer region, as well as, a specific Mycoplasma agassizii PCR targeting the 16S rRNA gene. Based on the analyses of partial sequences of the 16S rRNA gene, the Mycoplasma sp. of the ornate box turtle seemed to be identical with the recently described eastern box turtle (Terrapene carolina carolina) Mycoplasma sp. This is the first report of a novel chelonian adenovirus and a mycoplasma infection in an ornate box turtle (T. ornata ornata) in Europe.
Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.
Mehnaz, Samina; Weselowski, Brian; Lazarovits, George
2007-03-01
A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).
A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples
de Vries, Michel; Deijs, Martin; Canuti, Marta; van Schaik, Barbera D. C.; Faria, Nuno R.; van de Garde, Martijn D. B.; Jachimowski, Loes C. M.; Jebbink, Maarten F.; Jakobs, Marja; Luyf, Angela C. M.; Coenjaerts, Frank E. J.; Claas, Eric C. J.; Molenkamp, Richard; Koekkoek, Sylvie M.; Lammens, Christine; Leus, Frank; Goossens, Herman; Ieven, Margareta; Baas, Frank; van der Hoek, Lia
2011-01-01
In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material. PMID:21283679
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Low-abundant bacteria drive compositional changes in the gut microbiota after dietary alteration.
Benjamino, Jacquelynn; Lincoln, Stephen; Srivastava, Ranjan; Graf, Joerg
2018-05-10
As the importance of beneficial bacteria is better recognized, understanding the dynamics of symbioses becomes increasingly crucial. In many gut symbioses, it is essential to understand whether changes in host diet play a role in the persistence of the bacterial gut community. In this study, termites were fed six dietary sources and the microbial community was monitored over a 49-day period using 16S rRNA gene sequencing. A deep backpropagation artificial neural network (ANN) was used to learn how the six different lignocellulose food sources affected the temporal composition of the hindgut microbiota of the termite as well as taxon-taxon and taxon-substrate interactions. Shifts in the termite gut microbiota after diet change in each colony were observed using 16S rRNA gene sequencing and beta diversity analyses. The artificial neural network accurately predicted the relative abundances of taxa at random points in the temporal study and showed that low-abundant taxa maintain community driving correlations in the hindgut. This combinatorial approach utilizing 16S rRNA gene sequencing and deep learning revealed that low-abundant bacteria that often do not belong to the core community are drivers of the termite hindgut bacterial community composition.
Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes
NASA Technical Reports Server (NTRS)
Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.
1987-01-01
A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.
Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia
2014-08-01
We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.
Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang
2006-01-01
Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074
Molecular diversity of drinking water bacterial communities using 16S rRNA gene sequence analyses
Our understanding of the microbial community structure of drinking water distribution system has relied on culture-based methods. However, recent studies have suggested that the majority of bacteria inhabiting distribution systems are unable to grow on artificial media. The goal ...
NASA Technical Reports Server (NTRS)
Zhao, H.; Yang, D.; Woese, C. R.; Bryant, M. P.
1993-01-01
After enrichment from Chinese rural anaerobic digestor sludge, anaerobic, sporing and nonsporing, saturated fatty acid-beta-oxidizing syntrophic bacteria were isolated as cocultures with H2- and formate-utilizing Methanospirillum hungatei or Desulfovibrio sp. strain G-11. The syntrophs degraded C4 to C8 saturated fatty acids, including isobutyrate and 2-methylbutyrate. They were adapted to grow on crotonate and were isolated as pure cultures. The crotonate-grown pure cultures alone did not grow on butyrate in either the presence or the absence of some common electron acceptors. However, when they were reconstituted with M. hungatei, growth on butyrate again occurred. In contrast, crotonate-grown Clostridium kluyveri and Clostridium sticklandii, as well as Clostridium sporogenes, failed to grow on butyrate when these organisms were cocultured with M. hungatei. The crotonate-grown pure subcultures of the syntrophs described above were subjected to 16S rRNA sequence analysis. Several previously documented fatty acid-beta-oxidizing syntrophs grown in pure cultures with crotonate were also subjected to comparative sequence analyses. The sequence analyses revealed that the new sporing and nonsporing isolates and other syntrophs that we sequenced, which had either gram-negative or gram-positive cell wall ultrastructure, all belonged to the phylogenetically gram-positive phylum. They were not closely related to any of the previously known subdivisions in the gram-positive phylum with which they were compared, but were closely related to each other, forming a new subdivision in the phylum. We recommend that this group be designated Syntrophomonadaceae fam. nov.; a description is given.
Genotypic and phenotypic diversity of Alicyclobacillus acidocaldarius isolates.
Félix-Valenzuela, L; Guardiola-Avila, I; Burgara-Estrella, A; Ibarra-Zavala, M; Mata-Haro, V
2015-10-01
The fruit juice industry recognizes Alicyclobacillus as a major quality control target micro-organism. In this study, we analysed 19 bacterial isolates to identify Alicyclobacillus species by polymerase chain reaction (PCR) and sequencing analyses. Phenotypic and genomic diversity among isolates were investigated by API 50CHB system and ERIC-PCR (enterobacterial repetitive intergenic consensus-PCR) respectively. All bacterial isolates were identified as Alicyclobacillus acidocaldarius, and almost all showed identical DNA sequences according to their 16S rRNA (rDNA) gene partial sequences. Only few carbohydrates were fermented by A. acidocaldarius isolates, and there was little variability in the biochemical profile. Genotypic fingerprinting of the A. acidocaldarius isolates showed high diversity, and clusters by ERIC-PCR were distinct to those obtained from the 16S rRNA gene phylogenetic tree. There was no correlation between phenotypic and genotypic variability in the A. acidocaldarius isolates analysed in this study. Detection of Alicyclobacillus strains is imperative in fruit concentrates and juices due to the production of guaiacol. Identification of the genera originates rejection of the product by processing industry. However, not all the Alicyclobacillus species are deteriorative and hence the importance to differentiate among them. In this study, partial 16S ribosomal RNA sequence alignment allowed the differentiation of species. In addition, ERIC-PCR was introduced for the genotypic characterization of Alicyclobacillus, as an alternative for differentiation among isolates from the same species. © 2015 The Society for Applied Microbiology.
Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E
1997-07-01
A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera.
Stancheva, I; Lucchini, R; Koller, T; Sogo, J M
1997-01-01
By using formaldehyde cross-linking of histones to DNA and gel retardation assays we show that formaldehyde fixation, similar to previously established psoralen photocross-linking, discriminates between nucleosome- packed (inactive) and nucleosome-free (active) fractions of ribosomal RNA genes. By both cross-linking techniques we were able to purify fragments from agarose gels, corresponding to coding, enhancer and promoter sequences of rRNA genes, which were further investigated with respect to DNA methylation. This approach allows us to analyse independently and in detail methylation patterns of active and inactive rRNA gene copies by the combination of Hpa II and Msp I restriction enzymes. We found CpG methylation mainly present in enhancer and promoter regions of inactive rRNA gene copies. The methylation of one single Hpa II site, located in the promoter region, showed particularly strong correlation with the transcriptional activity. PMID:9108154
Kurtzman, Cletus P
2016-07-01
DNA sequence analyses have demonstrated that species of the polyphyletic anamorphic ascomycete genus Candida may be members of described teleomorphic genera, members of the Candida tropicalis clade upon which the genus Candida is circumscribed, or members of isolated clades that represent undescribed genera. From phylogenetic analysis of gene sequences from nuclear large subunit rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II, Candida auringiensis (NRRL Y-17674(T), CBS 6913(T)), Candida salmanticensis (NRRL Y-17090(T), CBS 5121(T)), and Candida tartarivorans (NRRL Y-27291(T), CBS 7955(T)) were shown to be members of an isolated clade and are proposed for reclassification in the genus Groenewaldozyma gen. nov. (MycoBank MB 815817). Neighbouring taxa include species of the Wickerhamiella clade and Candida blankii.
Two alternative ways of start site selection in human norovirus reinitiation of translation.
Luttermann, Christine; Meyers, Gregor
2014-04-25
The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.
Potenza, L; Cafiero, M A; Camarda, A; La Salandra, G; Cucchiarini, L; Dachà, M
2009-10-01
In the present work mites previously identified as Dermanyssus gallinae De Geer (Acari, Mesostigmata) using morphological keys were investigated by molecular tools. The complete internal transcribed spacer 1 (ITS1), 5.8S ribosomal DNA, and ITS2 region of the ribosomal DNA from mites were amplified and sequenced to examine the level of sequence variations and to explore the feasibility of using this region in the identification of this mite. Conserved primers located at the 3'end of 18S and at the 5'start of 28S rRNA genes were used first, and amplified fragments were sequenced. Sequence analyses showed no variation in 5.8S and ITS2 region while slight intraspecific variations involving substitutions as well as deletions concentrated in the ITS1 region. Based on the sequence analyses a nested PCR of the ITS2 region followed by RFLP analyses has been set up in the attempt to provide a rapid molecular diagnostic tool of D. gallinae.
Garcia, S; Kovařík, A
2013-01-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008
Garcia, S; Kovařík, A
2013-07-01
In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.
NASA Technical Reports Server (NTRS)
Fox, G. E.
1985-01-01
Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.
Wickersheim, Michelle L; Blumenstiel, Justin P
2013-11-01
A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.
Microbial community structure in three deep-sea carbonate crusts.
Heijs, S K; Aloisi, G; Bouloubassi, I; Pancost, R D; Pierre, C; Sinninghe Damsté, J S; Gottschal, J C; van Elsas, J D; Forney, L J
2006-10-01
Carbonate crusts in marine environments can act as sinks for carbon dioxide. Therefore, understanding carbonate crust formation could be important for understanding global warming. In the present study, the microbial communities of three carbonate crust samples from deep-sea mud volcanoes in the eastern Mediterranean were characterized by sequencing 16S ribosomal RNA (rRNA) genes amplified from DNA directly retrieved from the samples. In combination with the mineralogical composition of the crusts and lipid analyses, sequence data were used to assess the possible role of prokaryotes in crust formation. Collectively, the obtained data showed the presence of highly diverse communities, which were distinct in each of the carbonate crusts studied. Bacterial 16S rRNA gene sequences were found in all crusts and the majority was classified as alpha-, gamma-, and delta- Proteobacteria. Interestingly, sequences of Proteobacteria related to Halomonas and Halovibrio sp., which can play an active role in carbonate mineral formation, were present in all crusts. Archaeal 16S rRNA gene sequences were retrieved from two of the crusts studied. Several of those were closely related to archaeal sequences of organisms that have previously been linked to the anaerobic oxidation of methane (AOM). However, the majority of archaeal sequences were not related to sequences of organisms known to be involved in AOM. In combination with the strongly negative delta 13C values of archaeal lipids, these results open the possibility that organisms with a role in AOM may be more diverse within the Archaea than previously suggested. Different communities found in the crusts could carry out similar processes that might play a role in carbonate crust formation.
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
No need to replace an "anomalous" primate (Primates) with an "anomalous" bear (Carnivora, Ursidae).
Gutiérrez, Eliécer E; Pine, Ronald H
2015-01-01
By means of mitochondrial 12S rRNA sequencing of putative "yeti", "bigfoot", and other "anomalous primate" hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an "anomalous primate", but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursusmaritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursusarctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropodamelanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics.
Bacillus horneckiae sp. nov., isolated from a spacecraft-assembly clean room.
Vaishampayan, Parag; Probst, Alexander; Krishnamurthi, Srinivasan; Ghosh, Sudeshna; Osman, Shariff; McDowall, Alasdair; Ruckmani, Arunachalam; Mayilraj, Shanmugam; Venkateswaran, Kasthuri
2010-05-01
Five Gram-stain-positive, motile, aerobic strains were isolated from a clean room of the Kennedy Space Center where the Phoenix spacecraft was assembled. All strains are rod-shaped, spore-forming bacteria, whose spores were resistant to UV radiation up to 1000 J m(-2). The spores were subterminally positioned and produced an external layer. A polyphasic taxonomic study including traditional biochemical tests, fatty acid analysis, cell-wall typing, lipid analyses, 16S rRNA gene sequencing and DNA-DNA hybridization studies was performed to characterize these novel strains. 16S rRNA gene sequencing and lipid analyses convincingly grouped these novel strains within the genus Bacillus as a cluster separate from already described species. The similarity of 16S rRNA gene sequences among the novel strains was >99 %, but the similarity was only about 97 % with their nearest neighbours Bacillus pocheonensis, Bacillus firmus and Bacillus bataviensis. DNA-DNA hybridization dissociation values were <24 % to the closest related type strains. The novel strains had a G+C content 35.6+/-0.5 mol% and could liquefy gelatin but did not utilize or produce acids from any of the carbon substrates tested. The major fatty acids were iso-C(15 : 0) and anteiso-C(15 : 0) and the cell-wall diamino acid was meso-diaminopimelic acid. Based on phylogenetic and phenotypic results, it is concluded that these strains represent a novel species of the genus Bacillus, for which the name Bacillus horneckiae sp. nov. is proposed. The type strain is 1P01SC(T) (=NRRL B-59162(T) =MTCC 9535(T)).
How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity
NASA Technical Reports Server (NTRS)
Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr
1992-01-01
16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.
Lewis, William H; Sendra, Kacper M; Embley, T Martin; Esteban, Genoveva F
2018-01-01
Many anaerobic ciliated protozoa contain organelles of mitochondrial ancestry called hydrogenosomes. These organelles generate molecular hydrogen that is consumed by methanogenic Archaea, living in endosymbiosis within many of these ciliates. Here we describe a new species of anaerobic ciliate, Trimyema finlayi n. sp., by using silver impregnation and microscopy to conduct a detailed morphometric analysis. Comparisons with previously published morphological data for this species, as well as the closely related species, Trimyema compressum , demonstrated that despite them being similar, both the mean cell size and the mean number of somatic kineties are lower for T. finlayi than for T. compressum , which suggests that they are distinct species. This was also supported by analysis of the 18S rRNA genes from these ciliates, the sequences of which are 97.5% identical (6 substitutions, 1479 compared bases), and in phylogenetic analyses these sequences grouped with other 18S rRNA genes sequenced from previous isolates of the same respective species. Together these data provide strong evidence that T. finlayi is a novel species of Trimyema , within the class Plagiopylea. Various microscopic techniques demonstrated that T. finlayi n. sp. contains polymorphic endosymbiotic methanogens, and analysis of the endosymbionts' 16S rRNA gene showed that they belong to the genus Methanocorpusculum , which was confirmed using fluorescence in situ hybridization with specific probes. Despite the degree of similarity and close relationship between these ciliates, T. compressum contains endosymbiotic methanogens from a different genus, Methanobrevibacter . In phylogenetic analyses of 16S rRNA genes, the Methanocorpusculum endosymbiont of T. finlayi n. sp. grouped with sequences from Methanomicrobia, including the endosymbiont of an earlier isolate of the same species, ' Trimyema sp.,' which was sampled approximately 22 years earlier, at a distant (∼400 km) geographical location. Identification of the same endosymbiont species in the two separate isolates of T. finlayi n. sp. provides evidence for spatial and temporal stability of the Methanocorpusculum-T. finlayi n. sp. endosymbiosis. T. finlayi n. sp. and T. compressum provide an example of two closely related anaerobic ciliates that have endosymbionts from different methanogen genera, suggesting that the endosymbionts have not co-speciated with their hosts.
Halpern, Malka; Fridman, Svetlana; Aizenberg-Gershtein, Yana; Izhaki, Ido
2013-01-01
Pseudomonas flectens Johnson 1956, a plant-pathogenic bacterium on the pods of the French bean, is no longer considered to be a member of the genus Pseudomonas sensu stricto. A polyphasic approach that included examination of phenotypic properties and phylogenetic analyses based on 16S rRNA, rpoB and atpD gene sequences supported the transfer of Pseudomonas flectens Johnson 1956 to a new genus in the family Enterobacteriaceae as Phaseolibacter flectens gen. nov., comb. nov. Two strains of Phaseolibacter flectens were studied (ATCC 12775(T) and LMG 2186); the strains shared 99.8 % sequence similarity in their 16S rRNA genes and the housekeeping gene sequences were identical. Strains of Phaseolibacter flectens shared 96.6 % or less 16S rRNA gene sequence similarity with members of different genera in the family Enterobacteriaceae and only 84.7 % sequence similarity with Pseudomonas aeruginosa LMG 1242(T), demonstrating that they are not related to the genus Pseudomonas. As Phaseolibacter flectens formed an independent phyletic lineage in all of the phylogenetic analyses, it could not be affiliated to any of the recognized genera within the family Enterobacteriaceae and therefore was assigned to a new genus. Cells were Gram-negative, straight rods, motile by means of one or two polar flagella, fermentative, facultative anaerobes, oxidase-negative and catalase-positive. Growth occurred in the presence of 0-60 % sucrose. The DNA G+C content of the type strain was 44.3 mol%. On the basis of phenotypic properties and phylogenetic distinctiveness, Pseudomonas flectens Johnson 1956 is transferred to the novel genus Phaseolibacter gen. nov. as Phaseolibacter flectens gen. nov., comb. nov. The type strain of Phaseolibacter flectens is ATCC 12775(T) = CFBP 3281(T) = ICMP 745(T) = LMG 2187(T) = NCPPB 539(T).
USDA-ARS?s Scientific Manuscript database
This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
Molecular Evidence of Chlamydia-Like Organisms in the Feces of Myotis daubentonii Bats.
Hokynar, K; Vesterinen, E J; Lilley, T M; Pulliainen, A T; Korhonen, S J; Paavonen, J; Puolakkainen, M
2017-01-15
Chlamydia-like organisms (CLOs) are recently identified members of the Chlamydiales order. CLOs share intracellular lifestyles and biphasic developmental cycles, and they have been detected in environmental samples as well as in various hosts such as amoebae and arthropods. In this study, we screened bat feces for the presence of CLOs by molecular analysis. Using pan-Chlamydiales PCR targeting the 16S rRNA gene, Chlamydiales DNA was detected in 54% of the specimens. PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA and 23S rRNA genes were used to classify positive specimens and infer their phylogenetic relationships. Most sequences matched best with Rhabdochlamydia species or uncultured Chlamydia sequences identified in ticks. Another set of sequences matched best with sequences of the Chlamydia genus or uncultured Chlamydiales from snakes. To gain evidence of whether CLOs in bat feces are merely diet borne, we analyzed insects trapped from the same location where the bats foraged. Interestingly, the CLO sequences resembling Rhabdochlamydia spp. were detected in insect material as well, but the other set of CLO sequences was not, suggesting that this set might not originate from prey. Thus, bats represent another potential host for Chlamydiales and could harbor novel, previously unidentified members of this order. Several pathogenic viruses are known to colonize bats, and recent analyses indicate that bats are also reservoir hosts for bacterial genera. Chlamydia-like organisms (CLOs) have been detected in several animal species. CLOs have high 16S rRNA sequence similarity to Chlamydiaceae and exhibit similar intracellular lifestyles and biphasic developmental cycles. Our study describes the frequent occurrence of CLO DNA in bat feces, suggesting an expanding host species spectrum for the Chlamydiales As bats can acquire various infectious agents through their diet, prey insects were also studied. We identified CLO sequences in bats that matched best with sequences in prey insects but also CLO sequences not detected in prey insects. This suggests that a portion of CLO DNA present in bat feces is not prey borne. Furthermore, some sequences from bat droppings not originating from their diet might well represent novel, previously unidentified members of the Chlamydiales order. Copyright © 2016 American Society for Microbiology.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
de Sousa, Keyla Carstens Marques; Herrera, Heitor Miraglia; Secato, Caroline Tostes; Oliveira, André do Vale; Santos, Filipe Martins; Rocha, Fabiana Lopes; Barreto, Wanessa Teixeira Gomes; Macedo, Gabriel Carvalho; de Andrade Pinto, Pedro Cordeiro Estrela; Machado, Rosangela Zacarias; Costa, Mirela Tinucci; André, Marcos Rogério
2017-07-01
Hemotropic mycoplasmas are known to cause anemia in several mammalian species. The present work aimed to investigate the occurrence of Mycoplasma spp. in wild mammals, domestic dogs and their respective ectoparasites, in southern Pantanal region, central-western Brazil. Between August 2013 and March 2015, 31 Nasua nasua, 78 Cerdocyon thous, seven Leopardus pardalis, 42 dogs, 110 wild rodents, and 30 marsupials were trapped and ectoparasites (ticks and fleas) found parasitizing the animals were collected. Mammals and ectoparasites DNA samples were submitted to conventional PCR assays for Mycoplasma spp. targeting 16S rRNA and RnaseP genes. Twenty-four N. nasua, three C. thous, two domestic dogs, one L. pardalis and one wild rodent were positive for 16S rRNA PCR protocols. Fourteen N. nasua samples were also positive in RnaseP PCR. No marsupial or arthropod showed positivity for Mycoplasma spp. The phylogenetic analyses based on 16S rRNA gene showed that all sequences obtained from dogs, two sequences obtained from C. thous and ten sequences obtained from N. nasua showed to be closely related to Mycoplasma haemocanis/Mycoplasma haemofelis species. Genotypes closely related to 'Candidatus Mycoplasma haemominutum' and Mycoplasma haemomuris were detected in the L. pardalis and in the wild rodent, respectively. Probably a novel Mycoplasma genotype, closely related to a sequence obtained from a Brazilian capybara was detected in 14 N. nasua, based on a concatenated phylogenetic analysis of 16S rRNA and RnaseP genes. The present study revealed that wild animals in southern Pantanal region, Brazil, are exposed to different species of hemoplasmas. Copyright © 2017 Elsevier B.V. All rights reserved.
Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.
2007-01-01
We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.
Pan, W J; Blackburn, E H
1995-01-01
The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211
Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha
2004-11-01
A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.
Anda, Mizue; Ikeda, Seishi; Eda, Shima; Okubo, Takashi; Sato, Shusei; Tabata, Satoshi; Mitsui, Hisayuki; Minamisawa, Kiwamu
2011-01-01
The aims of this study were to isolate Aurantimonas and Methylobacterium strains that responded to soybean nodulation phenotypes and nitrogen fertilization rates in a previous culture-independent analysis (Ikeda et al. ISME J. 4:315-326, 2010). Two strategies were adopted for isolation from enriched bacterial cells prepared from stems of field-grown, hypernodulated soybeans: PCR-assisted isolation for Aurantimonas and selective cultivation for Methylobacterium. Thirteen of 768 isolates cultivated on Nutrient Agar medium were identified as Aurantimonas by colony PCR specific for Aurantimonas and 16S rRNA gene sequencing. Meanwhile, among 187 isolates on methanol-containing agar media, 126 were identified by 16S rRNA gene sequences as Methylobacterium. A clustering analysis (>99% identity) of the 16S rRNA gene sequences for the combined datasets of the present and previous studies revealed 4 and 8 operational taxonomic units (OTUs) for Aurantimonas and Methylobacterium, respectively, and showed the successful isolation of target bacteria for these two groups. ERIC- and BOX-PCR showed the genomic uniformity of the target isolates. In addition, phylogenetic analyses of Aurantimonas revealed a phyllosphere-specific cluster in the genus. The isolates obtained in the present study will be useful for revealing unknown legume-microbe interactions in relation to the autoregulation of nodulation.
Chao, Shiou-Huei; Kudo, Yuko; Tsai, Ying-Chieh; Watanabe, Koichi
2012-03-01
Three Gram-stain-positive strains were isolated from fermented mustard and were rod-shaped, non-motile, asporogenous, facultatively anaerobic, homofermentative and did not exhibit catalase activity. Comparative analyses of 16S rRNA, pheS and rpoA gene sequences demonstrated that the novel strains were members of the genus Lactobacillus. On the basis of 16S rRNA gene sequence analysis, the type strains of Lactobacillus crustorum (98.7% similarity), Lactobacillus farciminis (98.9%) and Lactobacillus mindensis (97.9%) were the closest neighbours. However, DNA-DNA reassociation values with these strains were less than 50%. Phenotypic and genotypic features demonstrated that these isolates represent a novel species of the genus Lactobacillus, for which the name Lactobacillus futsaii sp. nov. is proposed; the type strain is YM 0097(T) (=JCM 17355(T)=BCRC 80278(T)).
Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).
Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar
2016-12-01
In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.
Yabsley, Michael J.; Work, Thierry M.; Rameyer, Robert A.
2006-01-01
The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial ß-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial ß-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the ß-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.
Yabsley, Michael J; Work, Thierry M; Rameyer, Robert A
2006-04-01
The phylogenetic relationship of avian Babesia with other piroplasms remains unclear, mainly because of a lack of objective criteria such as molecular phylogenetics. In this study, our objective was to sequence the entire 18S, ITS-1, 5.8S, and ITS-2 regions of the rRNA gene and partial beta-tubulin gene of B. poelea, first described from brown boobies (Sula leucogaster) from the central Pacific, and compare them to those of other piroplasms. Phylogenetic analyses of the entire 18S rRNA gene sequence revealed that B. poelea belonged to the clade of piroplasms previously detected in humans, domestic dogs, and wild ungulates in the western United States. The entire ITS-1, 5.8S, ITS-2, and partial beta-tubulin gene sequence shared conserved regions with previously described Babesia and Theileria species. The intron of the beta-tubulin gene was 45 bp. This is the first molecular characterization of an avian piroplasm.
Rekadwad, Bhagwan N; Gonzalez, Juan M
2017-08-01
A report on 16S rRNA gene sequence re-analysis and digitalization is presented using Lysinibacillus species (one example) deposited in National Microbial Repositories in India. Lysinibacillus species 16S rRNA gene sequences were digitalized to provide quick response (QR) codes, Chaose Game Representation (CGR) and Frequency of Chaose Game Representation (FCGR). GC percentage, phylogenetic analysis, and principal component analysis (PCA) are tools used for the differentiation and reclassification of the strains under investigation. The seven reasons supporting the statements made by us as misclassified Lysinibacillus species deposited in National Microbial Depositories are given in this paper. Based on seven reasons, bacteria deposited in National Microbial Repositories such as Lysinibacillus and many other needs reanalyses for their exact identity. Leaves of identity with type strains of related species shows difference 2 to 8 % suggesting that reclassification is needed to correctly assign species names to the analyzed Lysinibacillus strains available in National Microbial Repositories.
Origin, evolution, and biogeography of Juglans: a phylogenetic perspective
USDA-ARS?s Scientific Manuscript database
Phylogenetic analyses of extant Juglans (Juglandaceae) using five cpDNA intergenic spacer (IGS) sequences (trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM) were performed to elucidate the origin, diversification, historical biogeography, and evolutionary relationships within the genus...
Native valve endocarditis due to a novel strain of Legionella.
Pearce, Meghan M; Theodoropoulos, Nicole; Noskin, Gary A; Flaherty, John P; Stemper, Mary E; Aspeslet, Teresa; Cianciotto, Nicholas P; Reed, Kurt D
2011-09-01
Legionellae are Gram-negative bacteria which are capable of causing disease, most commonly in the form of pneumonia. We describe a case of native valve endocarditis caused by a Legionella strain which by genotypic (16S rRNA and mip gene sequencing) and phenotypic analyses is unlike previously described strains of Legionella.
Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA
Seligmann, Hervé; Raoult, Didier
2018-01-01
We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833
Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M
1994-01-01
Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917
2011-01-01
Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Lee, Seung-Hun; Kim, Kyoo-Tae; Kwon, Oh-Deog; Ock, Younsung; Kim, Taeil; Choi, Donghag; Kwak, Dongmi
2016-01-01
We describe for the first time the detection of Coxiella-like bacteria (CLB), Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae) by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.
Micromonospora halotolerans sp. nov., isolated from the rhizosphere of a Pisum sativum plant.
Carro, Lorena; Pukall, Rüdiger; Spröer, Cathrin; Kroppenstedt, Reiner M; Trujillo, Martha E
2013-06-01
A filamentous actinomycete strain designated CR18(T) was isolated on humic acid agar from the rhizosphere of a Pisum sativum plant collected in Spain. This isolate was observed to grow optimally at 28 °C, pH 7.0 and in the presence of 5 % NaCl. Phylogenetic analyses based on the 16S rRNA gene sequence indicated a close relationship with the type strains of Micromonospora chersina and Micromonospora endolithica. A further analysis based on a concatenated DNA sequence stretch of 4,523 bp that included partial sequences of the atpD, gyrB, recA, rpoB and 16S rRNA genes clearly differentiated the new strain from recognized Micromonospora species compared. DNA-DNA hybridization studies further supported the taxonomic position of strain CR18(T) as a novel genomic species. Chemotaxonomic analyses which included whole cell sugars, polar lipids, fatty acid profiles and menaquinone composition confirmed the affiliation of the new strain to the genus Micromonospora and also highlighted differences at the species level. These studies were finally complemented with an array of physiological tests to help differentiate between the new strain and its phylogenetic neighbours. Consequently, strain CR18(T) (= CECT 7890(T) = DSM 45598(T)) is proposed as the type strain of a novel species, Micromonospora halotolerans sp. nov.
Howard, Meredith D. A.; Smith, G. Jason; Kudela, Raphael M.
2009-01-01
Yessotoxin (YTX) is a globally distributed marine toxin produced by some isolates of the dinoflagellate species Protoceratium reticulatum, Lingulodinium polyedrum, and Gonyaulax spinifera within the order Gonyaulacales. The process of isolating cells and testing each isolate individually for YTX production during toxic blooms are labor intensive, and this impedes our ability to respond quickly to toxic blooms. In this study, we used molecular sequences from the large subunit and internal transcribed spacer genomic regions in the ribosomal operon of known YTX-producing dinoflagellates to determine if genetic differences exist among geographically distinct populations or between toxic and nontoxic isolates within species. In all analyses, all three YTX-producing species fell within the Gonyaulacales order in agreement with morphological taxonomy. Phylogenetic analyses of available rRNA gene sequences indicate that the capacity for YTX production appears to be confined to the order Gonyaulacales. These findings indicate that Gonyaulacoloid dinoflagellate species are the most likely to produce YTX and thus should be prioritized for YTX screening during events. Dinoflagellate species that fall outside of the Gonyaulacales order are unlikely to produce YTX. Although the rRNA operon offers multiple sequence domains to resolve species level diversification within this dinoflagellate order, these domains are not sufficiently variable to provide robust markers for YTX toxicity. PMID:19011074
Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong
2013-07-04
Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.
Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R
2006-01-01
As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639
Common 5S rRNA variants are likely to be accepted in many sequence contexts
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.
Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics
Wittekindt, Nicola E.; Padhi, Abinash; Schuster, Stephan C.; Qi, Ji; Zhao, Fangqing; Tomsho, Lynn P.; Kasson, Lindsay R.; Packard, Michael; Cross, Paul C.; Poss, Mary
2010-01-01
The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.
No need to replace an “anomalous” primate (Primates) with an “anomalous” bear (Carnivora, Ursidae)
Gutiérrez, Eliécer E.; Pine, Ronald H.
2015-01-01
Abstract By means of mitochondrial 12S rRNA sequencing of putative “yeti”, “bigfoot”, and other “anomalous primate” hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an “anomalous primate”, but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursus maritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursus arctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropoda melanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics. PMID:25829853
Characterization of shed medicinal leech mucus reveals a diverse microbiota
Ott, Brittany M.; Rickards, Allen; Gehrke, Lauren; Rio, Rita V. M.
2015-01-01
Microbial transmission through mucosal-mediated mechanisms is widespread throughout the animal kingdom. One example of this occurs with Hirudo verbana, the medicinal leech, where host attraction to shed conspecific mucus facilitates horizontal transmission of a predominant gut symbiont, the Gammaproteobacterium Aeromonas veronii. However, whether this mucus may harbor other bacteria has not been examined. Here, we characterize the microbiota of shed leech mucus through Illumina deep sequencing of the V3-V4 hypervariable region of the 16S rRNA gene. Additionally, Restriction Fragment Length Polymorphism (RFLP) typing with subsequent Sanger Sequencing of a 16S rRNA gene clone library provided qualitative confirmation of the microbial composition. Phylogenetic analyses of full-length 16S rRNA sequences were performed to examine microbial taxonomic distribution. Analyses using both technologies indicate the dominance of the Bacteroidetes and Proteobacteria phyla within the mucus microbiota. We determined the presence of other previously described leech symbionts, in addition to a number of putative novel leech-associated bacteria. A second predominant gut symbiont, the Rikenella-like bacteria, was also identified within mucus and exhibited similar population dynamics to A. veronii, suggesting persistence in syntrophy beyond the gut. Interestingly, the most abundant bacterial genus belonged to Pedobacter, which includes members capable of producing heparinase, an enzyme that degrades the anticoagulant, heparin. Additionally, bacteria associated with denitrification and sulfate cycling were observed, indicating an abundance of these anions within mucus, likely originating from the leech excretory system. A diverse microbiota harbored within shed mucus has significant potential implications for the evolution of microbiomes, including opportunities for gene transfer and utility in host capture of a diverse group of symbionts. PMID:25620963
Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.
2003-01-01
The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285
Bourland, William; Rotterova, Johana; Čepička, Ivan
2017-06-01
Metopid ciliates occupy terrestrial, freshwater, and marine habitats worldwide, playing important roles as predominant consumers of bacteria, flagellates, algae, and diatoms in hypoxic environments. Metopus and Brachonella are the most species-rich metopid genera, however most of their species have not been studied by modern methods Here, we report the morphologic, morphometric and molecular characterization, and phylogeny of Metopus es and Brachonella contorta, both types of their respective genera, collected in a broad global sampling effort. Five strains of M. es and three strains of B. contorta were studied in detail, providing the first correlation of morphology, morphometrics, and 18S rRNA gene sequencing for both. We submitted 29 new 18S rRNA gene sequences to GenBank. Phylogenetic analyses yielded trees of similar topology. A strongly supported Metopus es clade is sister to the Brachonella contorta clade. Our analysis shows genus Metopus is not monophyletic. The monophyly of Brachonella cannot yet be determined due to lack of sequences for other species of this genus in molecular databases. Both species appear to have a global distribution. Metopus es was not found in Africa, probably reflecting low sampling effort. Strains of both species showed low 18S rRNA gene sequence divergence despite wide geographic separation. Copyright © 2016 Elsevier GmbH. All rights reserved.
Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O
2017-03-01
Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
NASA Technical Reports Server (NTRS)
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li
2013-10-01
According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.
Native Valve Endocarditis Due to a Novel Strain of Legionella ▿
Pearce, Meghan M.; Theodoropoulos, Nicole; Noskin, Gary A.; Flaherty, John P.; Stemper, Mary E.; Aspeslet, Teresa; Cianciotto, Nicholas P.; Reed, Kurt D.
2011-01-01
Legionellae are Gram-negative bacteria which are capable of causing disease, most commonly in the form of pneumonia. We describe a case of native valve endocarditis caused by a Legionella strain which by genotypic (16S rRNA and mip gene sequencing) and phenotypic analyses is unlike previously described strains of Legionella. PMID:21795511
Hui, Feng-Li; Chen, Liang; Chu, Xue-Ying; Niu, Qiu-Hong; Ke, Tao
2013-03-01
A novel anamorphic yeast species is described to accommodate three isolates recovered from the guts of three different wood-boring insect larvae collected in Henan, central China. On the basis of sequence analyses of the D1/D2 domains of the large-subunit rRNA gene and the internal transcribed spacer regions, the three strains are assigned to a novel species of the genus Wickerhamomyces, although the formation of ascospores was not observed. These strains also exhibited a number of distinct morphological and physiological characteristics that clearly differentiated them from Wickerhamomyces mucosus, Candida odintsovae and Wickerhamomyces rabaulensis, the most closely related species. In view of the phenotypic differences and unique rRNA gene sequences, we consider that these three isolates represent a novel species of the genus Wickerhamomyces, Wickerhamomyces mori sp. nov. The type strain is NYNU 1216(T) ( = CICC 1983(T) = CBS 12678(T)).
McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M
2013-06-01
To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.
FunGene: the functional gene pipeline and repository.
Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R
2013-01-01
Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.
Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie
2009-11-01
Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.
Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu
2011-06-01
To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
Phylogenetic relationships among superfamilies of Neritimorpha (Mollusca: Gastropoda).
Uribe, Juan E; Colgan, Don; Castro, Lyda R; Kano, Yasunori; Zardoya, Rafael
2016-11-01
Despite the extraordinary morphological and ecological diversity of Neritimorpha, few studies have focused on the phylogenetic relationships of this lineage of gastropods, which includes four extant superfamilies: Neritopsoidea, Hydrocenoidea, Helicinoidea, and Neritoidea. Here, the nucleotide sequences of the complete mitochondrial genomes of Georissa bangueyensis (Hydrocenoidea), Neritina usnea (Neritoidea), and Pleuropoma jana (Helicinoidea) and the nearly complete mt genomes of Titiscania sp. (Neritopsoidea) and Theodoxus fluviatilis (Neritoidea) were determined. Phylogenetic reconstructions using probabilistic methods were based on mitochondrial (13 protein coding genes and two ribosomal rRNA genes), nuclear (partial 28S rRNA, 18S rRNA, actin, and histone H3 genes) and combined sequence data sets. All phylogenetic analyses except one converged on a single, highly supported tree in which Neritopsoidea was recovered as the sister group of a clade including Helicinoidea as the sister group of Hydrocenoidea and Neritoidea. This topology agrees with the fossil record and supports at least three independent invasions of land by neritimorph snails. The mitochondrial genomes of Titiscania sp., G. bangueyensis, N. usnea, and T. fluviatilis share the same gene organization previously described for Nerita mt genomes whereas that of P. jana has undergone major rearrangements. We sequenced about half of the mitochondrial genome of another species of Helicinoidea, Viana regina, and confirmed that this species shares the highly derived gene order of P. jana. Copyright © 2016 Elsevier Inc. All rights reserved.
Tartar, Aurélien; Boucias, Drion G; Becnel, James J; Adams, Byron J
2003-11-01
The Helicosporidia are invertebrate pathogens that have recently been identified as non-photosynthetic green algae (Chlorophyta). In order to confirm the algal nature of the genus Helicosporidium, the presence of a retained chloroplast genome in Helicosporidia cells was investigated. Fragments homologous to plastid 16S rRNA (rrn16) genes were amplified successfully from cellular DNA extracted from two different Helicosporidium isolates. The fragment sequences are 1269 and 1266 bp long, are very AT-rich (60.7 %) and are similar to homologous genes sequenced from non-photosynthetic green algae. Maximum-parsimony, maximum-likelihood and neighbour-joining methods were used to infer phylogenetic trees from an rrn16 sequence alignment. All trees depicted the Helicosporidia as sister taxa to the non-photosynthetic, pathogenic alga Prototheca zopfii. Moreover, the trees identified Helicosporidium spp. as members of a clade that included the heterotrophic species Prototheca spp. and the mesotrophic species Chlorella protothecoides. The clade is always strongly supported by bootstrap values, suggesting that all these organisms share a most recent common ancestor. Phylogenetic analyses inferred from plastid 16S rRNA genes confirmed that the Helicosporidia are non-photosynthetic green algae, close relatives of the genus Prototheca (Chlorophyta, Trebouxiophyceae). Such phylogenetic affinities suggest that Helicosporidium spp. are likely to possess Prototheca-like organelles and organelle genomes.
Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.
Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F
2009-04-01
Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Yabsley, Michael J.; Clay, Sarah E.; Gibbs, Samantha E. J.; Cunningham, Mark W.; Austel, Michaela G.
2013-01-01
Demodex mites, although usually nonpathogenic, can cause a wide range of dermatological lesions ranging from mild skin irritation and alopecia to severe furunculosis. Recently, a case of demodicosis from a white-tailed deer (Odocoileus virginianus) revealed a Demodex species morphologically distinct from Demodex odocoilei. All life cycle stages were considerably larger than D. odocoilei and although similar in size to D. kutzeri and D. acutipes from European cervids, numerous morphometrics distinguished the four species. Adult males and females were 209.1 ± 13.1 and 225.5 ± 13.4 μm in length, respectively. Ova, larva, and nymphs measured 65.1 ± 4.1, 124.9 ± 11.6, and 205.1 ± 19.4 μm in length, respectively. For phylogenetic analyses, a portion of the 18S rRNA gene was amplified and sequenced from samples of the WTD Demodex sp., two Demodex samples from domestic dogs, and Demodex ursi from a black bear. Phylogenetic analyses indicated that the WTD Demodex was most similar to D. musculi from laboratory mice. A partial sequence from D. ursi was identical to the WTD Demodex sequence; however, these two species can be differentiated morphologically. This paper describes a second Demodex species from white-tailed deer and indicates that 18S rRNA is useful for phylogenetic analysis of most Demodex species, but two morphologically distinct species had identical partial sequences. Additional gene targets should be investigated for phylogenetic and parasite-host association studies. PMID:27335854
Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga
2007-01-01
Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.
2001-01-01
The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085
Liu, Mingjian; Fan, Xinpeng; Gao, Feng; Gao, Shan; Yu, Yuhe; Warren, Alan; Huang, Jie
2016-11-01
A cryptic species of the Tetrahymena pyriformis complex, Tetrahymena australis, has been known for a long time but never properly diagnosed based on taxonomic methods. The species name is thus invalid according to the International Code of Zoological Nomenclature. Recently, a population isolated from a freshwater lake in Wuhan, China was investigated using live observations, silver staining methods and gene sequence data. This organism can be separated from other described species of the T. pyriformis complex by its relatively small body size, the number of somatic kineties and differences in sequences of two genes, namely the small subunit ribosomal RNA (SSU rRNA) and the mitochondrial cytochrome c oxidase subunit I (cox1). We compared the SSU rRNA gene sequences of all available Tetrahymena species to reveal the nucleotide differences within this genus. The sequence of the Wuhan population is identical to two sequences of a previously isolated strain of T. australis (ATCC #30831). Phylogenetic analyses indicate that these three sequences (X56167, M98015, KT334373) cluster with Tetrahymena shanghaiensis (EF070256) in a polytomy. However, sequence divergence of the cox1 gene between the Wuhan population and another strain of T. australis (ATCC #30271) is 1.4%, suggesting that these may represent different subspecies. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.
Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H
2016-03-01
A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.
Jensen, Anders; Scholz, Christian F P; Kilian, Mogens
2016-11-01
The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.
A phylogenetic analysis of Aquifex pyrophilus
NASA Technical Reports Server (NTRS)
Burggraf, S.; Olsen, G. J.; Stetter, K. O.; Woese, C. R.
1992-01-01
The 16S rRNA of the bacterion Aquifex pyrophilus, a microaerophilic, oxygen-reducing hyperthermophile, has been sequenced directly from the the PCR amplified gene. Phylogenetic analyses show the Aq. pyrophilus lineage to be probably the deepest (earliest) in the (eu)bacterial tree. The addition of this deep branching to the bacterial tree further supports the argument that the Bacteria are of thermophilic ancestry.
A thermophilic, fermentative microaerophile (ET-5b) and a thermophilic acetogen (ET-5a) were coisolated from oxic soil obtained from Egypt. The 16S rRNA gene sequence of ET-5a was 99.8% identical to that of the classic acetogen Moorella thermoacetica. Further analyses confirmed t...
Community analysis of a full-scale anaerobic bioreactor treating paper mill wastewater.
Roest, Kees; Heilig, Hans G H J; Smidt, Hauke; de Vos, Willem M; Stams, Alfons J M; Akkermans, Antoon D L
2005-03-01
To get insight into the microbial community of an Upflow Anaerobic Sludge Blanket reactor treating paper mill wastewater, conventional microbiological methods were combined with 16S rRNA gene analyses. Particular attention was paid to microorganisms able to degrade propionate or butyrate in the presence or absence of sulphate. Serial enrichment dilutions allowed estimating the number of microorganisms per ml sludge that could use butyrate with or without sulphate (10(5)), propionate without sulphate (10(6)), or propionate and sulphate (10(8)). Quantitative RNA dot-blot hybridisation indicated that Archaea were two-times more abundant in the microbial community of anaerobic sludge than Bacteria. The microbial community composition was further characterised by 16S rRNA-gene-targeted Denaturing Gradient Gel Electrophoresis (DGGE) fingerprinting, and via cloning and sequencing of dominant amplicons from the bacterial and archaeal patterns. Most of the nearly full length (approximately 1.45 kb) bacterial 16S rRNA gene sequences showed less than 97% similarity to sequences present in public databases, in contrast to the archaeal clones (approximately. 1.3 kb) that were highly similar to known sequences. While Methanosaeta was found as the most abundant genus, also Crenarchaeote-relatives were identified. The microbial community was relatively stable over a period of 3 years (samples taken in July 1999, May 2001, March 2002 and June 2002) as indicated by the high similarity index calculated from DGGE profiles (81.9+/-2.7% for Bacteria and 75.1+/-3.1% for Archaea). 16S rRNA gene sequence analysis indicated the presence of unknown and yet uncultured microorganisms, but also showed that known sulphate-reducing bacteria and syntrophic fatty acid-oxidising microorganisms dominated the enrichments.
Triadó-Margarit, Xavier; Casamayor, Emilio O
2015-12-01
Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.
Molecular phylogeny of the armored catfish family Callichthyidae (Ostariophysi, Siluriformes).
Shimabukuro-Dias, Cristiane Kioko; Oliveira, Claudio; Reis, Roberto E; Foresti, Fausto
2004-07-01
The family Callichthyidae comprises eight genera of fishes widely distributed across the Neotropical region. In the present study, sequences of the mitochondrial genes 12S rRNA, 16S rRNA, ND4, tRNAHis, and tRNASer were obtained from 28 callichthyid specimens. The sample included 12 species of Corydoras, three species of Aspidoras, two species of Brochis, Dianema, Lepthoplosternum, and Megalechis, and two local populations of Callichthys and Hoplosternum. Sequences of Nematogenys inermis (Nematogenyidae), Trichomycterus areolatus, and Henonemus punctatus (Trichomycteridae), Astroblepus sp. (Astroblepidae), and Neoplecostomus paranensis, Delturus parahybae, and Hemipsilichthys nimius (Loricariidae) were included as the outgroup. Phylogenetic analyses were performed by using the methods of maximum parsimony and maximum likelihood. The results of almost all analyses were very similar. The family Callichthyidae is monophyletic and comprises two natural groups: the subfamilies Corydoradinae (Aspidoras, Brochis, and Corydoras) and Callichthyinae (Callichthys, Dianema, Hoplosternum, Lepthoplosternum, and Megalechis), as previously demonstrated by morphological studies. The relationships observed within these subfamilies are in several ways different from those previously proposed on the basis of morphological data. Molecular results were compared with the morphologic and cytogenetic data available on the family. Copyright 2003 Elsevier Inc.
Bradyrhizobium sacchari sp. nov., a legume nodulating bacterium isolated from sugarcane roots.
de Matos, Gustavo Feitosa; Zilli, Jerri Edson; de Araújo, Jean Luiz Simões; Parma, Marcia Maria; Melo, Itamar Soares; Radl, Viviane; Baldani, José Ivo; Rouws, Luc Felicianus Marie
2017-11-01
Members of the genus Bradyrhizobium are well-known as nitrogen-fixing microsymbionts of a wide variety of leguminous species, but they have also been found in different environments, notably as endophytes in non-legumes such as sugarcane. This study presents a detailed polyphasic characterization of four Bradyrhizobium strains (type strain BR 10280 T ), previously isolated from roots of sugarcane in Brazil. 16S rRNA sequence analysis, multilocus sequence analysis (MLSA) and analysis of the 16S-23S rRNA internal transcribed spacer showed that these strains form a novel clade close to, but different from B. huanghuaihaiense strain CCBAU 23303 T . Average nucleotide identity (ANI) analyses confirmed that BR 10280 T represents a novel species. Phylogenetic analysis based on nodC gene sequences also placed the strains close to CCBAU 23303 T , but different from this latter strain, the sugarcane strains did not nodulate soybean, although they effectively nodulated Vigna unguiculata, Cajanus cajan and Macroptilium atropurpureum. Physiological traits are in agreement with the placement of the strains in the genus Bradyrhizobium as a novel species for which the name Bradyrhizobium sacchari sp. nov. is proposed.
Antarctic ice core samples: culturable bacterial diversity.
Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R
2013-01-01
Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Characterization of a novel variant of Mycobacterium chimaera.
van Ingen, J; Hoefsloot, W; Buijtels, P C A M; Tortoli, E; Supply, P; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D
2012-09-01
In this study, nonchromogenic mycobacteria were isolated from pulmonary samples of three patients in the Netherlands. All isolates had identical, unique 16S rRNA gene and 16S-23S ITS sequences, which were closely related to those of Mycobacterium chimaera and Mycobacterium marseillense. The biochemical features of the isolates differed slightly from those of M. chimaera, suggesting that the isolates may represent a possible separate species within the Mycobacterium avium complex (MAC). However, the cell-wall mycolic acid pattern, analysed by HPLC, and the partial sequences of the hsp65 and rpoB genes were identical to those of M. chimaera. We concluded that the isolates represent a novel variant of M. chimaera. The results of this analysis have led us to question the currently used methods of species definition for members of the genus Mycobacterium, which are based largely on 16S rRNA or rpoB gene sequencing. Definitions based on a single genetic target are likely to be insufficient. Genetic divergence, especially in the MAC, yields strains that cannot be confidently assigned to a specific species based on the analysis of a single genetic target.
Ancient DNA analysis reveals woolly rhino evolutionary relationships.
Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine
2003-09-01
With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.
NASA Technical Reports Server (NTRS)
Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.
1994-01-01
When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.
Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung
2011-01-01
Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154
Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H
1996-01-01
Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607
Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.
2011-01-01
Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774
Powell, J. Elijah; Ratnayeke, Nalin; Moran, Nancy A.
2017-01-01
High throughput rRNA amplicon surveys of bacterial communities provide a rapid snapshot of taxonomic composition. But strains with nearly identical rRNA sequences often differ in gene repertoires and metabolic capabilities. To assess strain-level variation within Snodgrassella alvi, a gut symbiont of corbiculate bees, we performed deep sequencing on amplicons of a single copy coding gene (minD) as well as the 16S rDNA V4 region. We surveyed honey bees (Apis mellifera) sampled globally and 12 bumble bee species (Bombus) sampled from two regions of the USA. The minD analyses reveal that S. alvi contains far more strain diversity than is evident from 16S rDNA analysis. Many taxa inferred on the basis of 16S rDNA are shared between A. mellifera and Bombus species, but taxa inferred on the basis of minD are never shared and often are restricted to particular Bombus species. Clustering based on minD revealed that gut communities often reflect host species and geographic location. Both minD and 16S rDNA analyses indicate that strain diversity is higher in A. mellifera than in Bombus species. The minD locus flanks a 16S gene, enabling development of strain-specific 16S fluorescent probes to illuminate the spatial relationship of strains within the bee gut. PMID:27482856
Bowers, Holly A.; Tomas, Carmelo; Tengs, Torstein; Kempton, Jason W.; Lewitus, Alan J.; Oldach, David W.
2010-01-01
Species within the class Raphidophyceae were associated with fish kill events in Japanese, European, Canadian, and U.S. coastal waters. Fish mortality was attributable to gill damage with exposure to reactive oxygen species (peroxide, superoxide, and hydroxide radicals), neurotoxins, physical clogging, and hemolytic substances. Morphological identification of these organisms in environmental water samples is difficult, particularly when fixatives are used. Because of this difficulty and the continued global emergence of these species in coastal estuarine waters, we initiated the development and validation of a suite of real-time polymerase chain reaction (PCR) assays. Sequencing was used to generate complete data sets for nuclear encoded small-subunit ribosomal RNA (SSU rRNA; 18S); internal transcribed spacers 1 and 2, 5.8S; and plastid encoded SSU rRNA (16S) for confirmed raphidophyte cultures from various geographic locations. Sequences for several Chattonella species (C. antiqua, C. marina, C. ovata, C. subsalsa, and C. verruculosa), Heterosigma akashiwo, and Fibrocapsa japonica were generated and used to design rapid and specific PCR assays for several species including C. verruculosa Hara et Chihara, C. subsalsa Biecheler, the complex comprised of C. marina Hara et Chihara, C. antiqua Ono and C. ovata, H. akashiwo Ono, and F. japonica Toriumi et Takano using appropriate loci. With this comprehensive data set, we were also able to perform phylogenetic analyses to determine the relationship between these species. PMID:20411032
Remarkable archaeal diversity detected in a Yellowstone National Park hot spring environment.
Barns, S M; Fundyga, R E; Jeffries, M W; Pace, N R
1994-01-01
Of the three primary phylogenetic domains--Archaea (archaebacteria), Bacteria (eubacteria), and Eucarya (eukaryotes)--Archaea is the least understood in terms of its diversity, physiologies, and ecological panorama. Although many species of Crenarchaeota (one of the two recognized archaeal kingdoms sensu Woese [Woese, C. R., Kandler, O. & Wheelis, M. L. (1990) Proc. Natl. Acad. Sci. USA 87, 4576-4579]) have been isolated, they constitute a relatively tight-knit cluster of lineages in phylogenetic analyses of rRNA sequences. It seemed possible that this limited diversity is merely apparent and reflects only a failure to culture organisms, not their absence. We report here phylogenetic characterization of many archaeal small subunit rRNA gene sequences obtained by polymerase chain reaction amplification of mixed population DNA extracted directly from sediment of a hot spring in Yellowstone National Park. This approach obviates the need for cultivation to identify organisms. The analyses document the existence not only of species belonging to well-characterized crenarchaeal genera or families but also of crenarchaeal species for which no close relatives have so far been found. The large number of distinct archaeal sequence types retrieved from this single hot spring was unexpected and demonstrates that Crenarchaeota is a much more diverse group than was previously suspected. The results have impact on our concepts of the phylogenetic organization of Archaea. PMID:7510403
Mobberley, Jennifer M; Ortega, Maya C; Foster, Jamie S
2012-01-01
Thrombolites are unlaminated carbonate structures that form as a result of the metabolic interactions of complex microbial mat communities. Thrombolites have a long geological history; however, little is known regarding the microbes associated with modern structures. In this study, we use a barcoded 16S rRNA gene-pyrosequencing approach coupled with morphological analysis to assess the bacterial, cyanobacterial and archaeal diversity associated with actively forming thrombolites found in Highborne Cay, Bahamas. Analyses revealed four distinct microbial mat communities referred to as black, beige, pink and button mats on the surfaces of the thrombolites. At a coarse phylogenetic resolution, the domain bacterial sequence libraries from the four mats were similar, with Proteobacteria and Cyanobacteria being the most abundant. At the finer resolution of the rRNA gene sequences, significant differences in community structure were observed, with dramatically different cyanobacterial communities. Of the four mat types, the button mats contained the highest diversity of Cyanobacteria, and were dominated by two sequence clusters with high similarity to the genus Dichothrix, an organism associated with the deposition of carbonate. Archaeal diversity was low, but varied in all mat types, and the archaeal community was predominately composed of members of the Thaumarchaeota and Euryarchaeota. The morphological and genetic data support the hypothesis that the four mat types are distinctive thrombolitic mat communities. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group
NASA Astrophysics Data System (ADS)
Lloyd, K. G.; Biddle, J.; Teske, A.
2011-12-01
Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.
A new version of the RDP (Ribosomal Database Project)
NASA Technical Reports Server (NTRS)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Petti, C. A.; Polage, C. R.; Schreckenberger, P.
2005-01-01
Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109
Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.
Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A
2016-05-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Skin microbiome surveys are strongly influenced by experimental design
Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.
2016-01-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039
Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.
2010-01-01
Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113
Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš
2016-09-01
Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Patarca, R; Dorta, B; Ramirez, J L
1982-01-01
As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402
High-resolution phylogenetic microbial community profiling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singer, Esther; Coleman-Derr, Devin; Bowman, Brett
2014-03-17
The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less
Brazelton, William J; Schrenk, Matthew O; Kelley, Deborah S; Baross, John A
2006-09-01
Hydrothermal venting and the formation of carbonate chimneys in the Lost City hydrothermal field (LCHF) are driven predominantly by serpentinization reactions and cooling of mantle rocks, resulting in a highly reducing, high-pH environment with abundant dissolved hydrogen and methane. Phylogenetic and terminal restriction fragment length polymorphism analyses of 16S rRNA genes in fluids and carbonate material from this site indicate the presence of organisms similar to sulfur-oxidizing, sulfate-reducing, and methane-oxidizing Bacteria as well as methanogenic and anaerobic methane-oxidizing Archaea. The presence of these metabolic groups indicates that microbial cycling of sulfur and methane may be the dominant biogeochemical processes active within this ultramafic rock-hosted environment. 16S rRNA gene sequences grouping within the Methylobacter and Thiomicrospira clades were recovered from a chemically diverse suite of carbonate chimney and fluid samples. In contrast, 16S rRNA genes corresponding to the Lost City Methanosarcinales phylotype were found exclusively in high-temperature chimneys, while a phylotype of anaerobic methanotrophic Archaea (ANME-1) was restricted to lower-temperature, less vigorously venting sites. A hyperthermophilic habitat beneath the LCHF may be reflected by 16S rRNA gene sequences belonging to Thermococcales and uncultured Crenarchaeota identified in vent fluids. The finding of a diverse microbial ecosystem supported by the interaction of high-temperature, high-pH fluids resulting from serpentinization reactions in the subsurface provides insight into the biogeochemistry of what may be a pervasive process in ultramafic subseafloor environments.
Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish
USDA-ARS?s Scientific Manuscript database
RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
Xing, Mengxin; Hou, Zhanhui; Yuan, Jianbo; Liu, Yuan; Qu, Yanmei; Liu, Bin
2013-12-01
Metagenomics combined with 16S rRNA gene sequence analyses was applied to unveil the taxonomic composition and functional diversity of the farmed adult turbot gastrointestinal (GI) microbiome. Proteobacteria and Firmicutes which existed in both GI content and mucus were dominated in the turbot GI microbiome. 16S rRNA gene sequence analyses also indicated that the turbot GI tract may harbor some bacteria which originated from associated seawater. Functional analyses indicated that the clustering-based subsystem and many metabolic subsystems were dominant in the turbot GI metagenome. Compared with other gut metagenomes, quorum sensing and biofilm formation was overabundant in the turbot GI metagenome. Genes associated with quorum sensing and biofilm formation were found in species within Vibrio, including Vibrio vulnificus, Vibrio cholerae and Vibrio parahaemolyticus. In farmed fish gut metagenomes, the stress response and protein folding subsystems were over-represented and several genes concerning antibiotic and heavy metal resistance were also detected. These data suggested that the turbot GI microbiome may be affected by human factors in aquaculture. Additionally, iron acquisition and the metabolism subsystem were more abundant in the turbot GI metagenome when compared with freshwater fish gut metagenome, suggesting that unique metabolic potential may be observed in marine animal GI microbiomes. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D
2016-12-15
Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.
Subbotin, Sergei A; Ragsdale, Erik J; Mullens, Teresa; Roberts, Philip A; Mundo-Ocampo, Manuel; Baldwin, James G
2008-08-01
The root lesion nematodes of the genus Pratylenchus Filipjev, 1936 are migratory endoparasites of plant roots, considered among the most widespread and important nematode parasites in a variety of crops. We obtained gene sequences from the D2 and D3 expansion segments of 28S rRNA partial and 18S rRNA from 31 populations belonging to 11 valid and two unidentified species of root lesion nematodes and five outgroup taxa. These datasets were analyzed using maximum parsimony and Bayesian inference. The alignments were generated using the secondary structure models for these molecules and analyzed with Bayesian inference under the standard models and the complex model, considering helices under the doublet model and loops and bulges under the general time reversible model. The phylogenetic informativeness of morphological characters is tested by reconstruction of their histories on rRNA based trees using parallel parsimony and Bayesian approaches. Phylogenetic and sequence analyses of the 28S D2-D3 dataset with 145 accessions for 28 species and 18S dataset with 68 accessions for 15 species confirmed among large numbers of geographical diverse isolates that most classical morphospecies are monophyletic. Phylogenetic analyses revealed at least six distinct major clades of examined Pratylenchus species and these clades are generally congruent with those defined by characters derived from lip patterns, numbers of lip annules, and spermatheca shape. Morphological results suggest the need for sophisticated character discovery and analysis for morphology based phylogenetics in nematodes.
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L
1991-06-01
In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.
Springer, M S; Amrine, H M; Burk, A; Stanhope, M J
1999-03-01
We concatenated sequences for four mitochondrial genes (12S rRNA, tRNA valine, 16S rRNA, cytochrome b) and four nuclear genes [aquaporin, alpha 2B adrenergic receptor (A2AB), interphotoreceptor retinoid-binding protein (IRBP), von Willebrand factor (vWF)] into a multigene data set representing 11 eutherian orders (Artiodactyla, Hyracoidea, Insectivora, Lagomorpha, Macroscelidea, Perissodactyla, Primates, Proboscidea, Rodentia, Sirenia, Tubulidentata). Within this data set, we recognized nine mitochondrial partitions (both stems and loops, for each of 12S rRNA, tRNA valine, and 16S rRNA; and first, second, and third codon positions of cytochrome b) and 12 nuclear partitions (first, second, and third codon positions, respectively, of each of the four nuclear genes). Four of the 21 partitions (third positions of cytochrome b, A2AB, IRBP, and vWF) showed significant heterogeneity in base composition across taxa. Phylogenetic analyses (parsimony, minimum evolution, maximum likelihood) based on sequences for all 21 partitions provide 99-100% bootstrap support for Afrotheria and Paenungulata. With the elimination of the four partitions exhibiting heterogeneity in base composition, there is also high bootstrap support (89-100%) for cow + horse. Statistical tests reject Altungulata, Anagalida, and Ungulata. Data set heterogeneity between mitochondrial and nuclear genes is most evident when all partitions are included in the phylogenetic analyses. Mitochondrial-gene trees associate cow with horse, whereas nuclear-gene trees associate cow with hedgehog and these two with horse. However, after eliminating third positions of A2AB, IRBP, and vWF, nuclear data agree with mitochondrial data in supporting cow + horse. Nuclear genes provide stronger support for both Afrotheria and Paenungulata. Removal of third positions of cytochrome b results in improved performance for the mitochondrial genes in recovering these clades.
Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang
2008-09-01
A Gram-negative, non-motile, pleomorphic bacterial strain, designated SMK-142(T), was isolated from a tidal flat of the Yellow Sea, Korea, and was subjected to a polyphasic taxonomic study. Strain SMK-142(T) grew optimally at pH 7.0-8.0, 25 degrees C and in the presence of 2% (w/v) NaCl. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain SMK-142(T) clustered with Lutibacter litoralis with which it exhibited a 16S rRNA gene sequence similarity value of 91.2%. This cluster joined the clade comprising the genera Tenacibaculum and Polaribacter at a high bootstrap resampling value. Strain SMK-142(T) contained MK-6 as the predominant menaquinone and iso-C(15:0), iso-C(15:1) and iso-C(17:0) 3-OH as the major fatty acids. The DNA G+C content was 37.2 mol%. Strain SMK-142(T) was differentiated from three phylogenetically related genera, Lutibacter, Tenacibaculum and Polaribacter, on the basis of low 16S rRNA gene sequence similarity values and differences in fatty acid profiles and in some phenotypic properties. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-142(T) represents a novel genus and species for which the name Aestuariicola saemankumensis gen. nov., sp. nov. is proposed (phylum Bacteroidetes, family Flavobacteriaceae). The type strain of the type species, Aestuariicola saemankumensis sp. nov., is SMK-142(T) (=KCTC 22171(T)=CCUG 55329(T)).
Bacterial diversity of Taxus rhizosphere: culture-independent and culture-dependent approaches.
Hao, Da Cheng; Ge, Guang Bo; Yang, Ling
2008-07-01
The regional variability of Taxus rhizosphere bacterial community composition and diversity was studied by comparative analysis of three large 16S rRNA gene clone libraries from the Taxus rhizosphere in different regions of China (subtropical and temperate regions). One hundred and forty-six clones were screened for three libraries. Phylogenetic analysis of 16S rRNA gene sequences demonstrated that the abundance of sequences affiliated with Gammaproteobacteria, Betaproteobacteria, and Actinobacteria was higher in the library from the T. xmedia rhizosphere of the temperate region compared with the subtropical Taxus mairei rhizosphere. On the other hand, Acidobacteria was more abundant in libraries from the subtropical Taxus mairei rhizosphere. Richness estimates and diversity indices of three libraries revealed major differences, indicating a higher richness in the Taxus rhizosphere bacterial communities of the subtropical region and considerable variability in the bacterial community composition within this region. By enrichment culture, a novel Actinobacteria strain DICP16 was isolated from the T. xmedia rhizosphere of the temperate region and was identified as Leifsonia shinshuensis sp. via 16S rRNA gene and gyrase B sequence analyses. DICP16 was able to remove the xylosyl group from 7-xylosyl-10-deacetylbaccatin III and 7-xylosyl-10-deacetylpaclitaxel, thereby making the xylosyltaxanes available as sources of 10-deacetylbaccatin III and the anticancer drug paclitaxel. Taken together, the present studies provide, for the first time, the knowledge of the biodiversity of microorganisms populating Taxus rhizospheres.
Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander
2010-04-01
Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
Watanabe, Koichi; Makino, Hiroshi; Sasamoto, Masae; Kudo, Yuko; Fujimoto, Junji; Demberel, Shirchin
2009-06-01
Two novel micro-organisms, designated strains YIT 10443(T) and YIT 10738, were isolated from airag, a traditional fermented mare's milk from Mongolia. The two strains were Gram-positive-staining, non-motile, asporogenous, catalase-negative, facultatively anaerobic rods of various shapes. Comparative analyses of 16S rRNA and ClpC ATPase (clpC) gene sequences and the presence of fructose-6-phosphate phosphoketolase (F6PPK) demonstrated that the novel strains were members of the genus Bifidobacterium. On the basis of 16S rRNA gene sequence similarity, the type strains of Bifidobacterium minimum (96.6 %) and Bifidobacterium psychraerophilum (95.7 %) were the closest neighbours of the novel strains, and DNA-DNA reassociation values with these strains were found to be lower than 15 %. The phenotypic and genotypic features demonstrated that the two strains represent a single, novel Bifidobacterium species, for which the name Bifidobacterium mongoliense sp. nov. is proposed. The type strain is YIT 10443(T) (=JCM 15461(T) =DSM 21395(T)).
Bosman, Anna-Mari; Oosthuizen, Marinda C; Peirce, Michael A; Venter, Estelle H; Penzhorn, Barend L
2010-08-01
In a previous paper, we reported on a large number of cheetah blood specimens that gave positive signals only for Babesia and/or Theileria genus-specific probes on the reverse line blot (RLB) assay, indicating the presence of a novel species or variant of an existing species. Some of these specimens were investigated further by microscopic, serological, sequencing, and phylogenetic analyses. The near-full-length 18S rRNA genes of 13 samples, as well as the second internal transcribed spacer (ITS2) region, were amplified, cloned, and sequenced. A species-specific RLB probe, designed to target the hypervariable V4 region of the 18S rRNA gene for detection of the novel Babesia sp., was used to screen an additional 137 cheetah blood specimens for the presence of the species. The prevalence of infection was 28.5%. Here we describe the morphology and phylogenetic relationships of the novel species, which we have named Babesia lengau sp. nov.
Bosman, Anna-Mari; Oosthuizen, Marinda C.; Peirce, Michael A.; Venter, Estelle H.; Penzhorn, Barend L.
2010-01-01
In a previous paper, we reported on a large number of cheetah blood specimens that gave positive signals only for Babesia and/or Theileria genus-specific probes on the reverse line blot (RLB) assay, indicating the presence of a novel species or variant of an existing species. Some of these specimens were investigated further by microscopic, serological, sequencing, and phylogenetic analyses. The near-full-length 18S rRNA genes of 13 samples, as well as the second internal transcribed spacer (ITS2) region, were amplified, cloned, and sequenced. A species-specific RLB probe, designed to target the hypervariable V4 region of the 18S rRNA gene for detection of the novel Babesia sp., was used to screen an additional 137 cheetah blood specimens for the presence of the species. The prevalence of infection was 28.5%. Here we describe the morphology and phylogenetic relationships of the novel species, which we have named Babesia lengau sp. nov. PMID:20519464
McFrederick, Quinn S; Vuong, Hoang Q; Rothman, Jason A
2018-06-01
Gram-stain-positive, rod-shaped, non-spore forming bacteria have been isolated from flowers and the guts of adult wild bees in the families Megachilidae and Halictidae. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Lactobacillus, and are most closely related to the honey-bee associated bacteria Lactobacillus kunkeei (97.0 % sequence similarity) and Lactobacillus apinorum (97.0 % sequence similarity). Phylogenetic analyses of 16S rRNA genes and six single-copy protein coding genes, in situ and in silico DNA-DNA hybridization, and fatty-acid profiling differentiates the newly isolated bacteria as three novel Lactobacillus species: Lactobacillus micheneri sp. nov. with the type strain Hlig3 T (=DSM 104126 T ,=NRRL B-65473 T ), Lactobacillus timberlakei with the type strain HV_12 T (=DSM 104128 T ,=NRRL B-65472 T ), and Lactobacillus quenuiae sp. nov. with the type strain HV_6 T (=DSM 104127 T ,=NRRL B-65474 T ).
Rapid identification of acetic acid bacteria using MALDI-TOF mass spectrometry fingerprinting.
Andrés-Barrao, Cristina; Benagli, Cinzia; Chappuis, Malou; Ortega Pérez, Ruben; Tonolla, Mauro; Barja, François
2013-03-01
Acetic acid bacteria (AAB) are widespread microorganisms characterized by their ability to transform alcohols and sugar-alcohols into their corresponding organic acids. The suitability of matrix-assisted laser desorption-time of flight mass spectrometry (MALDI-TOF MS) for the identification of cultured AAB involved in the industrial production of vinegar was evaluated on 64 reference strains from the genera Acetobacter, Gluconacetobacter and Gluconobacter. Analysis of MS spectra obtained from single colonies of these strains confirmed their basic classification based on comparative 16S rRNA gene sequence analysis. MALDI-TOF analyses of isolates from vinegar cross-checked by comparative sequence analysis of 16S rRNA gene fragments allowed AAB to be identified, and it was possible to differentiate them from mixed cultures and non-AAB. The results showed that MALDI-TOF MS analysis was a rapid and reliable method for the clustering and identification of AAB species. Copyright © 2012 Elsevier GmbH. All rights reserved.
Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus
Sánchez, Maximo; Ramírez-Bahena, Martha-Helena; Peix, Alvaro; Lorite, María J.; Sanjuán, Juan; Monza, Jorge
2014-01-01
Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium. The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium, for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T). PMID:24271211
Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia
2016-12-01
Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.
Staley, C.; Sadowsky, M. J.; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.
2015-01-01
In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650
Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality
Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea
2017-01-01
Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368
Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung
2007-01-01
This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845
MetaMetaDB: a database and analytic system for investigating microbial habitability.
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.
NASA Technical Reports Server (NTRS)
Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.
1995-01-01
Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.
Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J
2010-04-01
This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.
Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo
2015-04-01
The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential for fine scale differentiation of local fermented foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Angiuoli, Samuel V; White, James R; Matalka, Malcolm; White, Owen; Fricke, W Florian
2011-01-01
The widespread popularity of genomic applications is threatened by the "bioinformatics bottleneck" resulting from uncertainty about the cost and infrastructure needed to meet increasing demands for next-generation sequence analysis. Cloud computing services have been discussed as potential new bioinformatics support systems but have not been evaluated thoroughly. We present benchmark costs and runtimes for common microbial genomics applications, including 16S rRNA analysis, microbial whole-genome shotgun (WGS) sequence assembly and annotation, WGS metagenomics and large-scale BLAST. Sequence dataset types and sizes were selected to correspond to outputs typically generated by small- to midsize facilities equipped with 454 and Illumina platforms, except for WGS metagenomics where sampling of Illumina data was used. Automated analysis pipelines, as implemented in the CloVR virtual machine, were used in order to guarantee transparency, reproducibility and portability across different operating systems, including the commercial Amazon Elastic Compute Cloud (EC2), which was used to attach real dollar costs to each analysis type. We found considerable differences in computational requirements, runtimes and costs associated with different microbial genomics applications. While all 16S analyses completed on a single-CPU desktop in under three hours, microbial genome and metagenome analyses utilized multi-CPU support of up to 120 CPUs on Amazon EC2, where each analysis completed in under 24 hours for less than $60. Representative datasets were used to estimate maximum data throughput on different cluster sizes and to compare costs between EC2 and comparable local grid servers. Although bioinformatics requirements for microbial genomics depend on dataset characteristics and the analysis protocols applied, our results suggests that smaller sequencing facilities (up to three Roche/454 or one Illumina GAIIx sequencer) invested in 16S rRNA amplicon sequencing, microbial single-genome and metagenomics WGS projects can achieve cost-efficient bioinformatics support using CloVR in combination with Amazon EC2 as an alternative to local computing centers.
Angiuoli, Samuel V.; White, James R.; Matalka, Malcolm; White, Owen; Fricke, W. Florian
2011-01-01
Background The widespread popularity of genomic applications is threatened by the “bioinformatics bottleneck” resulting from uncertainty about the cost and infrastructure needed to meet increasing demands for next-generation sequence analysis. Cloud computing services have been discussed as potential new bioinformatics support systems but have not been evaluated thoroughly. Results We present benchmark costs and runtimes for common microbial genomics applications, including 16S rRNA analysis, microbial whole-genome shotgun (WGS) sequence assembly and annotation, WGS metagenomics and large-scale BLAST. Sequence dataset types and sizes were selected to correspond to outputs typically generated by small- to midsize facilities equipped with 454 and Illumina platforms, except for WGS metagenomics where sampling of Illumina data was used. Automated analysis pipelines, as implemented in the CloVR virtual machine, were used in order to guarantee transparency, reproducibility and portability across different operating systems, including the commercial Amazon Elastic Compute Cloud (EC2), which was used to attach real dollar costs to each analysis type. We found considerable differences in computational requirements, runtimes and costs associated with different microbial genomics applications. While all 16S analyses completed on a single-CPU desktop in under three hours, microbial genome and metagenome analyses utilized multi-CPU support of up to 120 CPUs on Amazon EC2, where each analysis completed in under 24 hours for less than $60. Representative datasets were used to estimate maximum data throughput on different cluster sizes and to compare costs between EC2 and comparable local grid servers. Conclusions Although bioinformatics requirements for microbial genomics depend on dataset characteristics and the analysis protocols applied, our results suggests that smaller sequencing facilities (up to three Roche/454 or one Illumina GAIIx sequencer) invested in 16S rRNA amplicon sequencing, microbial single-genome and metagenomics WGS projects can achieve cost-efficient bioinformatics support using CloVR in combination with Amazon EC2 as an alternative to local computing centers. PMID:22028928
Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson
2014-03-01
16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).
Evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus
NASA Technical Reports Server (NTRS)
Miller, S. R.; Castenholz, R. W.
2000-01-01
The extension of ecological tolerance limits may be an important mechanism by which microorganisms adapt to novel environments, but it may come at the evolutionary cost of reduced performance under ancestral conditions. We combined a comparative physiological approach with phylogenetic analyses to study the evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus. Among the 20 laboratory clones of Synechococcus isolated from collections made along an Oregon hot spring thermal gradient, four different 16S rRNA gene sequences were identified. Phylogenies constructed by using the sequence data indicated that the clones were polyphyletic but that three of the four sequence groups formed a clade. Differences in thermotolerance were observed for clones with different 16S rRNA gene sequences, and comparison of these physiological differences within a phylogenetic framework provided evidence that more thermotolerant lineages of Synechococcus evolved from less thermotolerant ancestors. The extension of the thermal limit in these bacteria was correlated with a reduction in the breadth of the temperature range for growth, which provides evidence that enhanced thermotolerance has come at the evolutionary cost of increased thermal specialization. This study illustrates the utility of using phylogenetic comparative methods to investigate how evolutionary processes have shaped historical patterns of ecological diversification in microorganisms.
Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.
Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E
1999-09-01
Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.
Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.
2010-01-01
The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719
Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho
2016-01-01
DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256
How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?
Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T
2018-03-15
The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.
Taxonomic and predicted metabolic profiles of the human gut microbiome in pre-Columbian mummies.
Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Dowd, Scot E; Toranzos, Gary A; Marota, Isolina; Cano, Raul J
2016-11-01
Characterization of naturally mummified human gut remains could potentially provide insights into the preservation and evolution of commensal and pathogenic microorganisms, and metabolic profiles. We characterized the gut microbiome of two pre-Columbian Andean mummies dating to the 10-15th centuries using 16S rRNA gene high-throughput sequencing and metagenomics, and compared them to a previously characterized gut microbiome of an 11th century AD pre-Columbian Andean mummy. Our previous study showed that the Clostridiales represented the majority of the bacterial communities in the mummified gut remains, but that other microbial communities were also preserved during the process of natural mummification, as shown with the metagenomics analyses. The gut microbiome of the other two mummies were mainly comprised by Clostridiales or Bacillales, as demonstrated with 16S rRNA gene amplicon sequencing, many of which are facultative anaerobes, possibly consistent with the process of natural mummification requiring low oxygen levels. Metagenome analyses showed the presence of other microbial groups that were positively or negatively correlated with specific metabolic profiles. The presence of sequences similar to both Trypanosoma cruzi and Leishmania donovani could suggest that these pathogens were prevalent in pre-Columbian individuals. Taxonomic and functional profiling of mummified human gut remains will aid in the understanding of the microbial ecology of the process of natural mummification. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Pigmentiphaga aceris sp. nov., isolated from tree sap.
Lee, Soon Dong
2017-09-01
Two Gram-stain-negative bacterial strains, SAP-32T and SAP-36, were isolated from sap drawn from the Acer pictum from Mount Halla in Jeju, Republic of Korea. The organisms were strictly aerobic, non-sporulating, motile rods and showed growth at 10-30 °C, pH 7-8 and with 0-2 % NaCl. The major isoprenoid quinone was Q-8. The predominant fatty acids were C16 : 0, cyclo-C17 : 0, summed feature 3 and C18 : 0. The polar lipids contained phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, an unknown aminophosphoglycolipid, an unknown glycolipid, an unknown phospholipid and two unknown lipids. The DNA G+C content was 64.4 mol%. The results of phylogenetic analyses based on 16S rRNA gene sequences indicated that SAP-32T and SAP-36 formed a distinct cluster with members of the genus Pigmentiphaga within the family Alcaligenaceae. Both strains showed 16S rRNA gene sequence similarity of 100 % to each other. The closest relatives of the isolates were Pigmentiphaga daeguensis (97.08 % sequence similarity), Pigmentiphaga kullae (97.01 %) and Pigmentiphaga litoralis (96.73 %). On the basis of data from phenotypic, chemotaxonomic and phylogenetic analyses, SAP-32T (=KCTC 52619T=DSM 104039T) and SAP-36 (=KCTC 52620=DSM 104072) represent members of a novel species of the genus Pigmentiphaga, for which the name Pigmentiphaga aceris sp. nov. is proposed.
Ian, Elena; Malko, Dmitry B.; Sekurova, Olga N.; Bredholt, Harald; Rückert, Christian; Borisova, Marina E.; Albersmeier, Andreas; Kalinowski, Jörn; Gelfand, Mikhail S.; Zotchev, Sergey B.
2014-01-01
A total of 74 actinomycete isolates were cultivated from two marine sponges, Geodia barretti and Phakellia ventilabrum collected at the same spot at the bottom of the Trondheim fjord (Norway). Phylogenetic analyses of sponge-associated actinomycetes based on the 16S rRNA gene sequences demonstrated the presence of species belonging to the genera Streptomyces, Nocardiopsis, Rhodococcus, Pseudonocardia and Micromonospora. Most isolates required sea water for growth, suggesting them being adapted to the marine environment. Phylogenetic analysis of Streptomyces spp. revealed two isolates that originated from different sponges and had 99.7% identity in their 16S rRNA gene sequences, indicating that they represent very closely related strains. Sequencing, annotation, and analyses of the genomes of these Streptomyces isolates demonstrated that they are sister organisms closely related to terrestrial Streptomyces albus J1074. Unlike S. albus J1074, the two sponge streptomycetes grew and differentiated faster on the medium containing sea water. Comparative genomics revealed several genes presumably responsible for partial marine adaptation of these isolates. Genome mining targeted to secondary metabolite biosynthesis gene clusters identified several of those, which were not present in S. albus J1074, and likely to have been retained from a common ancestor, or acquired from other actinomycetes. Certain genes and gene clusters were shown to be differentially acquired or lost, supporting the hypothesis of divergent evolution of the two Streptomyces species in different sponge hosts. PMID:24819608
Ian, Elena; Malko, Dmitry B; Sekurova, Olga N; Bredholt, Harald; Rückert, Christian; Borisova, Marina E; Albersmeier, Andreas; Kalinowski, Jörn; Gelfand, Mikhail S; Zotchev, Sergey B
2014-01-01
A total of 74 actinomycete isolates were cultivated from two marine sponges, Geodia barretti and Phakellia ventilabrum collected at the same spot at the bottom of the Trondheim fjord (Norway). Phylogenetic analyses of sponge-associated actinomycetes based on the 16S rRNA gene sequences demonstrated the presence of species belonging to the genera Streptomyces, Nocardiopsis, Rhodococcus, Pseudonocardia and Micromonospora. Most isolates required sea water for growth, suggesting them being adapted to the marine environment. Phylogenetic analysis of Streptomyces spp. revealed two isolates that originated from different sponges and had 99.7% identity in their 16S rRNA gene sequences, indicating that they represent very closely related strains. Sequencing, annotation, and analyses of the genomes of these Streptomyces isolates demonstrated that they are sister organisms closely related to terrestrial Streptomyces albus J1074. Unlike S. albus J1074, the two sponge streptomycetes grew and differentiated faster on the medium containing sea water. Comparative genomics revealed several genes presumably responsible for partial marine adaptation of these isolates. Genome mining targeted to secondary metabolite biosynthesis gene clusters identified several of those, which were not present in S. albus J1074, and likely to have been retained from a common ancestor, or acquired from other actinomycetes. Certain genes and gene clusters were shown to be differentially acquired or lost, supporting the hypothesis of divergent evolution of the two Streptomyces species in different sponge hosts.
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.
Allegrucci, Giuliana; Rampini, Mauro; Di Russo, Claudio; Lana, Enrico; Cocchi, Sara; Sbordoni, Valerio
2014-01-01
Abstract The genus Dolichopoda (Orthoptera; Rhaphidopohoridae) is present in Italy with 9 species distributed from northwestern Italy (Piedmont and Liguria) to the southernmost Apennines (Calabria), occurring also in the Tyrrhenian coastal areas and in Sardinia. Three morphologically very close taxa have been described in Piedmont and Liguria, i.e., D. ligustica ligustica, D. ligustica septentrionalis and D. azami azami. To investigate the delimitation of the northwestern species of Dolichopoda, we performed both morphological and molecular analyses. Morphological analysis was carried out by considering diagnostic characters generally used to distinguish different taxa, as the shape of epiphallus in males and the subgenital fig in females. Molecular analysis was performed by sequencing three mitochondrial genes, 12S rRNA, 16S rRNA, partially sequenced and the entire gene of COI. Results from both morphological and molecular analyses highlighted a very homogeneous group of populations, although genetically structured. Three haplogroups geographically distributed could be distinguished and based on these results we suggest a new taxonomic arrangement. All populations, due to the priority of description, should be assigned to D. azami azami Saulcy, 1893 and to preserve the names ligustica and septentrionalis, corresponding to different genetic haplogroups, we assign them to D. azami ligustica stat. n. Baccetti & Capra, 1959 and to D. azami septentrionalis stat. n. Baccetti & Capra, 1959. PMID:25197209
Doležalová, Jana; Vallo, Peter; Petrželková, Klára J; Foitová, Ivona; Nurcahyo, Wisnu; Mudakikwa, Antoine; Hashimoto, Chie; Jirků, Milan; Lukeš, Julius; Scholz, Tomáš; Modrý, David
2015-09-01
Anoplocephalid tapeworms of the genus Bertiella Stiles and Hassall, 1902 and Anoplocephala Blanchard, 1848, found in the Asian, African and American non-human primates are presumed to sporadic ape-to-man transmissions. Variable nuclear (5.8S-ITS2; 28S rRNA) and mitochondrial genes (cox1; nad1) of isolates of anoplocephalids originating from different primates (Callicebus oenanthe, Gorilla beringei, Gorilla gorilla, Pan troglodytes and Pongo abelii) and humans from various regions (South America, Africa, South-East Asia) were sequenced. In most analyses, Bertiella formed a monophyletic group within the subfamily Anoplocephalinae, however, the 28S rRNA sequence-based analysis indicated paraphyletic relationship between Bertiella from primates and Australian marsupials and rodents, which should thus be regarded as different taxa. Moreover, isolate determined as Anoplocephala cf. gorillae from mountain gorilla clustered within the Bertiella clade from primates. This either indicates that A. gorillae deserves to be included into the genus Bertiella, or, that an unknown Bertiella species infects also mountain gorillas. The analyses allowed the genetic differentiation of the isolates, albeit with no obvious geographical or host-related patterns. The unexpected genetic diversity of the isolates studied suggests the existence of several Bertiella species in primates and human and calls for revision of the whole group, based both on molecular and morphological data.
2012-01-01
Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR) are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas. PMID:23256920
Lamendella, Regina; Li, Kent C.; Oerther, Daniel
2013-01-01
Several swine-specific microbial source tracking methods are based on PCR assays targeting Bacteroidales 16S rRNA gene sequences. The limited application of these assays can be explained by the poor understanding of their molecular diversity in fecal sources and environmental waters. In order to address this, we studied the diversity of 9,340 partial (>600 bp in length) Bacteroidales 16S rRNA gene sequences from 13 fecal sources and nine feces-contaminated watersheds. The compositions of major Bacteroidales populations were analyzed to determine which host and environmental sequences were contributing to each group. This information allowed us to identify populations which were both exclusive to swine fecal sources and detected in swine-contaminated waters. Phylogenetic and diversity analyses revealed that some markers previously believed to be highly specific to swine populations are shared by multiple hosts, potentially explaining the cross-amplification signals obtained with nontargeted hosts. These data suggest that while many Bacteroidales populations are cosmopolitan, others exhibit a preferential host distribution and may be able to survive different environmental conditions. This study further demonstrates the importance of elucidating the diversity patterns of targeted bacterial groups to develop more inclusive fecal source tracking applications. PMID:23160126
Prevotella massiliensis sp. nov. isolated from human blood.
Berger, Pierre; Adékambi, Toïdi; Mallet, Marie-Noelle; Drancourt, Michel
2005-12-01
We report a bacterial isolate (Marseille isolate) recovered from the blood of a patient hospitalized in an intensive care unit, presenting with severe trauma, fever and mechanical ventilation. Colonies appeared at 37 degrees C on blood agar after 72 h incubation. This isolate was a strictly anaerobic, Gram-negative rod phenotypically related to other Prevotella species described to date: non-motile, catalase-negative, oxidase-positive, non-glucose fermenting, resistant to vancomycin and susceptible to kanamycin. Cells exhibited a trilamellar membrane under electron microscopy. The fatty acid methyl ester profile was marginally related to that of Clostridium botulinum group A (distance: 26.27%) and Bifidobacterium bifidum GC subgroup B (distance: 26.38%). 16S rRNA gene sequence similarity was 90.0% with that of Prevotella oris and 89.1% with that of Prevotella melaninogenica. Partial rpoB gene sequence similarity was 84.5 and 86.4% with P. oris and P. melaninogenica, respectively. According to current standards, phenotypic traits, 16S rRNA and rpoB gene sequence analyses indicated that the Marseille isolate belonged to a previously unrecognized species of the genus Prevotella, and we propose classifying it in the new taxon "Prevotella massiliensis" sp. nov.
Equally parsimonious pathways through an RNA sequence space are not equally likely
NASA Technical Reports Server (NTRS)
Lee, Y. H.; DSouza, L. M.; Fox, G. E.
1997-01-01
An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.
Ko, Kwan Soo; Peck, Kyong Ran; Oh, Won Sup; Lee, Nam Yong; Lee, Jang Ho; Song, Jae-Hoon
2005-05-01
A gram-negative bacillus, SMC-8986(T), which was isolated from the purulent exudate of an epidermal cyst but could not be identified by a conventional microbiologic method, was characterized by a variety of phenotypic and genotypic analyses. Sequences of the 16S rRNA gene revealed that this bacterium belongs to the genus Bordetella but diverged distinctly from previously described Bordetella species. Analyses of cellular fatty acid composition and performance of biochemical tests confirmed that this bacterium is distinct from other Bordetella species. Furthermore, the results of comparative sequence analyses of two protein-coding genes (risA and ompA) also showed that this strain represents a new species within the genus Bordetella. Based on the evaluated phenotypic and genotypic characteristics, it is proposed that SMC-8986(T) should be classified as a new species, namely Bordetella ansorpii sp. nov.
NASA Astrophysics Data System (ADS)
De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio
2012-06-01
Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons
Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.
2017-01-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516
Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy
2007-01-01
It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones analysed. In all, 28 phylotypes were identified: Lysobacter enzymogenes was the most abundant phylotype (31.4%), followed by Lysobacter sp. C3 (28.3%), gamma proteobacterium N4-7 (6.6%), Methylobacterium SM4 (4.7%) and Staphylococcus epidermidis (4.7%); 36 clones (7.0%) represented uncultivable phylotypes. We conclude that a diverse range of bacterial species are found within biofilms on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties. PMID:17501992
Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas
2012-08-01
The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.
Thomas, Matthew C.; Selinger, L. Brent
2012-01-01
The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure. PMID:22685143
Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C
2013-01-01
The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.
Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.
2013-01-01
The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343
Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike
2013-12-01
Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.
MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
NASA Technical Reports Server (NTRS)
Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.
1995-01-01
Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.
Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin
2015-03-01
The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Comparative Study: Taxonomic Grouping of Alkaline Protease Producing Bacilli.
Tekin, Nilgun; Cihan, Arzu Coleri; Karaca, Basar; Cokmus, Cumhur
2017-03-30
Alkaline proteases have biotechnological importance due to their activity and stability at alkaline pH. 56 bacteria, capable of growing under alkaline conditions were isolated and their alkaline protease activities were carried out at different parameters to determine their optimum alkaline protease production conditions. Seven isolates were showed higher alkaline protease production capacity than the reference strains. The highest alkaline protease producing isolates (103125 U/g), E114 and C265, were identified as Bacillus licheniformis with 99.4% and Bacillus mojavensis 99.8% based on 16S rRNA gene sequence similarities, respectively. Interestingly, the isolates identified as Bacillus safensis were also found to be high alkaline protease producing strains. Genotypic characterizations of the isolates were also determined by using a wide range of molecular techniques (ARDRA, ITS-PCR, (GTG)5-PCR, BOX-PCR). These different techniques allowed us to differentiate the alkaliphilic isolates and the results were in concurrence with phylogenetic analyses of the 16S rRNA genes. While ITS-PCR provided the highest correlation with 16S rRNA groups, (GTG)5-PCR showed the highest differentiation at species and intra-species level. In this study, each of the biotechnologically valuable alkaline protease producing isolates was grouped into their taxonomic positions with multi-genotypic analyses.
Diversity of anaerobic microbes in spacecraft assembly clean rooms.
Probst, Alexander; Vaishampayan, Parag; Osman, Shariff; Moissl-Eichinger, Christine; Andersen, Gary L; Venkateswaran, Kasthuri
2010-05-01
Although the cultivable and noncultivable microbial diversity of spacecraft assembly clean rooms has been previously documented using conventional and state-of-the-art molecular techniques, the occurrence of obligate anaerobes within these clean rooms is still uncertain. Therefore, anaerobic bacterial communities of three clean-room facilities were analyzed during assembly of the Mars Science Laboratory rover. Anaerobic bacteria were cultured on several media, and DNA was extracted from suitable anaerobic enrichments and examined with conventional 16S rRNA gene clone library, as well as high-density phylogenetic 16S rRNA gene microarray (PhyloChip) technologies. The culture-dependent analyses predominantly showed the presence of clostridial and propionibacterial strains. The 16S rRNA gene sequences retrieved from clone libraries revealed distinct microbial populations associated with each clean-room facility, clustered exclusively within gram-positive organisms. PhyloChip analysis detected a greater microbial diversity, spanning many phyla of bacteria, and provided a deeper insight into the microbial community structure of the clean-room facilities. This study presents an integrated approach for assessing the anaerobic microbial population within clean-room facilities, using both molecular and cultivation-based analyses. The results reveal that highly diverse anaerobic bacterial populations persist in the clean rooms even after the imposition of rigorous maintenance programs and will pose a challenge to planetary protection implementation activities.
Brito, Elcia M S; Piñón-Castillo, Hilda A; Guyoneaud, Rémy; Caretta, César A; Gutiérrez-Corona, J Félix; Duran, Robert; Reyna-López, Georgina E; Nevárez-Moorillón, G Virginia; Fahy, Anne; Goñi-Urriza, Marisol
2013-01-01
Anthropogenic extreme environments are among the most interesting sites for the bioprospection of extremophiles since the selection pressures may favor the presence of microorganisms of great interest for taxonomical and astrobiological research as well as for bioremediation technologies and industrial applications. In this work, T-RFLP and 16S rRNA gene library analyses were carried out to describe the autochthonous bacterial populations from an industrial waste characterized as hyper-alkaline (pH between 9 and 14), hyper-saline (around 100 PSU) and highly contaminated with metals, mainly chromium (from 5 to 18 g kg(-1)) and iron (from 2 to 108 g kg(-1)). Due to matrix interference with DNA extraction, a protocol optimization step was required in order to carry out molecular analyses. The most abundant populations, as evaluated by both T-RFLP and 16S rRNA gene library analyses, were affiliated to Bacillus and Lysobacter genera. Lysobacter related sequences were present in the three samples: solid residue and lixiviate sediments from both dry and wet seasons. Sequences related to Thiobacillus were also found; although strains affiliated to this genus are known to have tolerance to metals, they have not previously been detected in alkaline environments. Together with Bacillus (already described as a metal reducer), such organisms could be of use in bioremediation technologies for reducing chromium, as well as for the prospection of enzymes of biotechnological interest.
Begum, Rabeya; Alam, Sheikh Shamimul; Menzel, Gerhard; Schmidt, Thomas
2009-01-01
Background and Aims Dendrobium species show tremendous morphological diversity and have broad geographical distribution. As repetitive sequence analysis is a useful tool to investigate the evolution of chromosomes and genomes, the aim of the present study was the characterization of repetitive sequences from Dendrobium moschatum for comparative molecular and cytogenetic studies in the related species Dendrobium aphyllum, Dendrobium aggregatum and representatives from other orchid genera. Methods In order to isolate highly repetitive sequences, a c0t-1 DNA plasmid library was established. Repeats were sequenced and used as probes for Southern hybridization. Sequence divergence was analysed using bioinformatic tools. Repetitive sequences were localized along orchid chromosomes by fluorescence in situ hybridization (FISH). Key Results Characterization of the c0t-1 library resulted in the detection of repetitive sequences including the (GA)n dinucleotide DmoO11, numerous Arabidopsis-like telomeric repeats and the highly amplified dispersed repeat DmoF14. The DmoF14 repeat is conserved in six Dendrobium species but diversified in representative species of three other orchid genera. FISH analyses showed the genome-wide distribution of DmoF14 in D. moschatum, D. aphyllum and D. aggregatum. Hybridization with the telomeric repeats demonstrated Arabidopsis-like telomeres at the chromosome ends of Dendrobium species. However, FISH using the telomeric probe revealed two pairs of chromosomes with strong intercalary signals in D. aphyllum. FISH showed the terminal position of 5S and 18S–5·8S–25S rRNA genes and a characteristic number of rDNA sites in the three Dendrobium species. Conclusions The repeated sequences isolated from D. moschatum c0t-1 DNA constitute major DNA families of the D. moschatum, D. aphyllum and D. aggregatum genomes with DmoF14 representing an ancient component of orchid genomes. Large intercalary telomere-like arrays suggest chromosomal rearrangements in D. aphyllum while the number and localization of rRNA genes as well as the species-specific distribution pattern of an abundant microsatellite reflect the genomic diversity of the three Dendrobium species. PMID:19635741
Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng
2017-05-10
Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .
Taniguchi, Takako; Sekiya, Ayumi; Higa, Mariko; Saeki, Yuji; Umeki, Kazumi; Okayama, Akihiko; Hayashi, Tetsuya
2014-01-01
Helicobacter cinaedi infection is recognized as an increasingly important emerging disease in humans. Although H. cinaedi-like strains have been isolated from a variety of animals, it is difficult to identify particular isolates due to their unusual phenotypic profiles and the limited number of biochemical tests for detecting helicobacters. Moreover, analyses of the 16S rRNA gene sequences are also limited due to the high levels of similarity among closely related helicobacters. This study was conducted to evaluate intact-cell mass spectrometry (ICMS) profiling using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) as a tool for the identification of H. cinaedi. A total of 68 strains of H. cinaedi isolated from humans, dogs, a cat, and hamsters were examined in addition to other Helicobacter species. The major ICMS profiles of H. cinaedi were identical and differed from those of Helicobacter bilis, which show >98% sequence similarity at the 16S rRNA sequence level. A phyloproteomic analysis of the H. cinaedi strains examined in this work revealed that human isolates formed a single cluster that was distinct from that of the animal isolates, with the exception of two strains from dogs. These phyloproteomic results agreed with those of the phylogenetic analysis based on the nucleotide sequences of the hsp60 gene. Because they formed a distinct cluster in both analyses, our data suggest that animal strains may not be a major source of infection in humans. In conclusion, the ICMS profiles obtained using a MALDI-TOF MS approach may be useful for the identification and subtyping of H. cinaedi. PMID:24153128
Quaglino, Fabio; Kube, Michael; Jawhari, Maan; Abou-Jawdah, Yusuf; Siewert, Christin; Choueiri, Elia; Sobh, Hana; Casati, Paola; Tedeschi, Rosemarie; Lova, Marina Molino; Alma, Alberto; Bianco, Piero Attilio
2015-07-30
Almond witches'-broom (AlmWB), a devastating disease of almond, peach and nectarine in Lebanon, is associated with 'Candidatus Phytoplasma phoenicium'. In the present study, we generated a draft genome sequence of 'Ca. P. phoenicium' strain SA213, representative of phytoplasma strain populations from different host plants, and determined the genetic diversity among phytoplasma strain populations by phylogenetic analyses of 16S rRNA, groEL, tufB and inmp gene sequences. Sequence-based typing and phylogenetic analysis of the gene inmp, coding an integral membrane protein, distinguished AlmWB-associated phytoplasma strains originating from diverse host plants, whereas their 16S rRNA, tufB and groEL genes shared 100 % sequence identity. Moreover, dN/dS analysis indicated positive selection acting on inmp gene. Additionally, the analysis of 'Ca. P. phoenicium' draft genome revealed the presence of integral membrane proteins and effector-like proteins and potential candidates for interaction with hosts. One of the integral membrane proteins was predicted as BI-1, an inhibitor of apoptosis-promoting Bax factor. Bioinformatics analyses revealed the presence of putative BI-1 in draft and complete genomes of other 'Ca. Phytoplasma' species. The genetic diversity within 'Ca. P. phoenicium' strain populations in Lebanon suggested that AlmWB disease could be associated with phytoplasma strains derived from the adaptation of an original strain to diverse hosts. Moreover, the identification of a putative inhibitor of apoptosis-promoting Bax factor (BI-1) in 'Ca. P. phoenicium' draft genome and within genomes of other 'Ca. Phytoplasma' species suggested its potential role as a phytoplasma fitness-increasing factor by modification of the host-defense response.
Claesson, Rolf; Sjögren, Ulf; Esberg, Anders; Brundin, Malin; Granlund, Margareta
2017-12-01
There are few reports on the bacterial species Actinomyces radicidentis in the literature. In this study, putative A. radicidentis isolates were collected from 16 root canal samples from 601 examined patients. The isolates were examined by biochemical tests, 16S rRNA gene sequencing, Arbitrarily-primed (AP-) PCR, antibiotic susceptibility testing, and MALDI-TOF analyses. In parallel, two A. radicidentis reference strains and two putative A. radicidentis isolates from United Kingdom were tested. Sixteen of the 18 isolates were confirmed as A. radicidentis. The remaining two isolates, both of which were isolated from root canals (one from Sweden and the other from the UK), but were identified as Actinomyces haliotis by sequencing ∼ 1300 base pairs of the 16S rRNA-gene. This isolates had a divergent, but between them similar, AP-PCR pattern, and a common distribution of sequence signatures in the 16S rRNA gene, but were not identified by MALDI-TOF. A. haliotis is a close relative to A. radicidentis, hitherto only been described from a sea-snail. The identity of A. haliotis was confirmed by a phylogenetic tree based on 16S rRNA gene sequences with species specific sequences included, and by additional biochemical tests. The examined bacteria exhibited similar antibiotic susceptibility patterns when tested for 10 separate antibiotic classes with E-tests (bioMérieux). The MIC 90 for β-lactams (benzylpenicillin and cefuroxime) and vancomycin was 0.5 mg/L, for colistin and ciprofloxacin 8 mg/mL and for the other antibiotic classes ≤ 25 mg/mL The isolation of A. haliotis from infected dental root canals cast doubt on the accepted opinion that all Actinomyces infections have an endogenous source. Copyright © 2017 Elsevier Ltd. All rights reserved.
Serological detection and molecular characterization of piroplasmids in equids in Brazil.
Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias
2018-03-01
Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.
Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris
2017-01-01
Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.
2007-12-04
The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Jones, Susan C.; Jenkins, Tracie M.
2016-01-01
The goal of this study was to infer Heterotermes (Froggatt) (Dictyoptera: Rhinotermitidae) species diversity on the island of Puerto Rico from phylogenetic analyses of DNA sequence data from two mitochondrial genes, 16S rRNA and cytochrome oxidase II (COII). This termite genus is a structural pest known to be well adapted to arid environments in subtropical and tropical regions worldwide including Puerto Rico and many other Caribbean islands. Extensive sampling was accomplished across Puerto Rico, and phylogenetic analyses of individual gene sequences from these samples indicated robust datasets of congruent gene tree topologies showing three monophyletic groups: H. cardini (Snyder), H. convexinotatus (Snyder), and H. tenuis (Hagen). We found that H. cardini and H. convexinotatus were widespread in the arid coastal regions of Puerto Rico, whereas H. tenuis was uncommon and may represent a relatively new introduction. We found only H. convexinotatus on Culebra Island. We provide strong evidence that Puerto Rico may be linked to the Heterotermes in southern Florida, USA, since its GenBank 16S sequence was identical to that of seven Puerto Rican H. cardini sequences. Our study represents the first records of H. cardini from Puerto Rico and Grand Bahama.
rpoB Gene Sequencing for Identification of Corynebacterium Species
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2004-01-01
The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970
Röder, Christoph; König, Helmut; Fröhlich, Jürgen
2007-09-01
Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.
Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.
Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier
2014-01-01
Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.
Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun
2017-10-06
Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.
Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R
As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.
Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas
2016-09-23
The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.
2013-01-01
Background Analyses of mitochondrial (mt) genome sequences in recent years challenge the current working hypothesis of Nematoda phylogeny proposed from morphology, ecology and nuclear small subunit rRNA gene sequences, and raise the need to sequence additional mt genomes for a broad range of nematode lineages. Results We sequenced the complete mt genomes of three Ascaridia species (family Ascaridiidae) that infest chickens, pigeons and parrots, respectively. These three Ascaridia species have an identical arrangement of mt genes to each other but differ substantially from other nematodes. Phylogenetic analyses of the mt genome sequences of the Ascaridia species, together with 62 other nematode species, support the monophylies of seven high-level taxa of the phylum Nematoda: 1) the subclass Dorylaimia; 2) the orders Rhabditida, Trichinellida and Mermithida; 3) the suborder Rhabditina; and 4) the infraorders Spiruromorpha and Oxyuridomorpha. Analyses of mt genome sequences, however, reject the monophylies of the suborders Spirurina and Tylenchina, and the infraorders Rhabditomorpha, Panagrolaimomorpha and Tylenchomorpha. Monophyly of the infraorder Ascaridomorpha varies depending on the methods of phylogenetic analysis. The Ascaridomorpha was more closely related to the infraorders Rhabditomorpha and Diplogasteromorpha (suborder Rhabditina) than they were to the other two infraorders of the Spirurina: Oxyuridorpha and Spiruromorpha. The closer relationship among Ascaridomorpha, Rhabditomorpha and Diplogasteromorpha was also supported by a shared common pattern of mitochondrial gene arrangement. Conclusions Analyses of mitochondrial genome sequences and gene arrangement has provided novel insights into the phylogenetic relationships among several major lineages of nematodes. Many lineages of nematodes, however, are underrepresented or not represented in these analyses. Expanding taxon sampling is necessary for future phylogenetic studies of nematodes with mt genome sequences. PMID:23800363
NASA Technical Reports Server (NTRS)
Winker, S.; Woese, C. R.
1991-01-01
The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.
Sato, Mitsuharu; Miyazaki, Kentaro
2017-01-01
Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992
Multicolor microRNA FISH effectively differentiates tumor types
Renwick, Neil; Cekan, Pavol; Masry, Paul A.; McGeary, Sean E.; Miller, Jason B.; Hafner, Markus; Li, Zhen; Mihailovic, Aleksandra; Morozov, Pavel; Brown, Miguel; Gogakos, Tasos; Mobin, Mehrpouya B.; Snorrason, Einar L.; Feilotter, Harriet E.; Zhang, Xiao; Perlis, Clifford S.; Wu, Hong; Suárez-Fariñas, Mayte; Feng, Huichen; Shuda, Masahiro; Moore, Patrick S.; Tron, Victor A.; Chang, Yuan; Tuschl, Thomas
2013-01-01
MicroRNAs (miRNAs) are excellent tumor biomarkers because of their cell-type specificity and abundance. However, many miRNA detection methods, such as real-time PCR, obliterate valuable visuospatial information in tissue samples. To enable miRNA visualization in formalin-fixed paraffin-embedded (FFPE) tissues, we developed multicolor miRNA FISH. As a proof of concept, we used this method to differentiate two skin tumors, basal cell carcinoma (BCC) and Merkel cell carcinoma (MCC), with overlapping histologic features but distinct cellular origins. Using sequencing-based miRNA profiling and discriminant analysis, we identified the tumor-specific miRNAs miR-205 and miR-375 in BCC and MCC, respectively. We addressed three major shortcomings in miRNA FISH, identifying optimal conditions for miRNA fixation and ribosomal RNA (rRNA) retention using model compounds and high-pressure liquid chromatography (HPLC) analyses, enhancing signal amplification and detection by increasing probe-hapten linker lengths, and improving probe specificity using shortened probes with minimal rRNA sequence complementarity. We validated our method on 4 BCC and 12 MCC tumors. Amplified miR-205 and miR-375 signals were normalized against directly detectable reference rRNA signals. Tumors were classified using predefined cutoff values, and all were correctly identified in blinded analysis. Our study establishes a reliable miRNA FISH technique for parallel visualization of differentially expressed miRNAs in FFPE tumor tissues. PMID:23728175
Fortin, Nathalie; Munoz-Ramos, Valentina; Bird, David; Lévesque, Benoît; Whyte, Lyle G.; Greer, Charles W.
2015-01-01
Missisquoi Bay (MB) is a temperate eutrophic freshwater lake that frequently experiences toxic Microcystis-dominated cyanobacterial blooms. Non-point sources are responsible for the high concentrations of phosphorus and nitrogen in the bay. This study combined data from environmental parameters, E. coli counts, high-throughput sequencing of 16S rRNA gene amplicons, quantitative PCR (16S rRNA and mcyD genes) and toxin analyses to identify the main bloom-promoting factors. In 2009, nutrient concentrations correlated with E. coli counts, abundance of total cyanobacterial cells, Microcystis 16S rRNA and mcyD genes and intracellular microcystin. Total and dissolved phosphorus also correlated significantly with rainfall. The major cyanobacterial taxa were members of the orders Chroococcales and Nostocales. The genus Microcystis was the main mcyD-carrier and main microcystin producer. Our results suggested that increasing nutrient concentrations and total nitrogen:total phosphorus (TN:TP) ratios approaching 11:1, coupled with an increase in temperature, promoted Microcystis-dominated toxic blooms. Although the importance of nutrient ratios and absolute concentrations on cyanobacterial and Microcystis dynamics have been documented in other laboratories, an optimum TN:TP ratio for Microcystis dominance has not been previously observed in situ. This observation provides further support that nutrient ratios are an important determinant of species composition in natural phytoplankton assemblages. PMID:25984732
Hu, Xiaozhong; Fan, Yangbo; Warren, Alan
2015-08-01
The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko
1998-01-01
By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600
Liu, Shuaishuai; Zhang, Yanhong; Wang, Changming; Lin, Qiang
2016-07-01
The complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus was first determined in this article. The total length of H. spinosissimus mitogenome is 16 527 bp and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. The gene order and composition of H. spinosissimus were similar to those of most other vertebrates. The overall base composition of H. spinosissimus is 32.1% A, 30.3% T, 14.9% G and 22.7% C, with a slight A + T-rich feature (62.4%). Phylogenetic analyses based on complete mitochondrial genome sequence showed that H. spinosissimus has a close genetic relationship to H. ingens and H. kuda.
van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L
1992-10-01
The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.
Robinett, C C; O'Connor, A; Dunaway, M
1997-01-01
We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359
Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min
2009-01-01
A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).
Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H
1996-01-01
Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850
Kaur, Sukhpreet; Yawar, Mir; Kumar, P Anil; Suresh, K
2014-03-01
A Gram-stain-positive, rod-shaped, spore-forming and strictly anaerobic bacterium, designated UB-B.2(T), was isolated from an industrial effluent anaerobic digester sample. It grew optimally at 30 °C and pH 7.0. Comparative analysis of the 16S rRNA gene sequence confirmed that strain UB-B.2(T) was closely related to Clostridium hathewayi DSM 13479(T) (97.84% similarity), a member of rRNA gene cluster XIVa of the genus Clostridium, and formed a coherent cluster with other related members of the Blautia (Clostridium) coccoides rRNA group in phylogenetic analyses. The end products of glucose fermentation by strain UB-B.2(T) were acetate and propionate. The G+C content of the DNA was 51.4 mol%. Although strain UB-B.2(T) showed 97.8% 16S rRNA gene sequence identity to the type strain of C. hathewayi, it exhibited only 38.4% relatedness at the whole-genome level. It also showed differences from its closest phylogenetic relative, C. hathewayi DSM 13479(T), in phenotypic characteristics such as hydrolysis of aesculin, starch and urea and fermentation end products. Both strains showed phenotypic differences from the members of rRNA gene cluster XIVa of the genus Clostridium. Based on these differences, C. hathewayi DSM 13479(T) and strain UB-B.2(T) were identified as representatives of a new genus of the family Clostridiaceae. Thus, we propose the reclassification of Clostridium hathewayi as Hungatella hathewayi gen. nov., comb. nov., the type species of the new genus (type strain DSM 13479(T) = CCUG 43506(T) = MTCC 10951(T)). Strain UB-B.2(T) ( = MTCC 11101(T) = DSM 24995(T)) is assigned to the novel species Hungatella effluvii gen. nov., sp. nov as the type strain.
Stoeck, Thorsten; Breiner, Hans-Werner; Filker, Sabine; Ostermaier, Veronika; Kammerlander, Barbara; Sonntag, Bettina
2014-02-01
Analyses of high-throughput environmental sequencing data have become the 'gold-standard' to address fundamental questions of microbial diversity, ecology and biogeography. Findings that emerged from sequencing are, e.g. the discovery of the extensive 'rare microbial biosphere' and its potential function as a seed-bank. Even though applied since several years, results from high-throughput environmental sequencing have hardly been validated. We assessed how well pyrosequenced amplicons [the hypervariable eukaryotic V4 region of the small subunit ribosomal RNA (SSU rRNA) gene] reflected morphotype ciliate plankton. Moreover, we assessed if amplicon sequencing had the potential to detect the annual ciliate plankton stock. In both cases, we identified significant quantitative and qualitative differences. Our study makes evident that taxon abundance distributions inferred from amplicon data are highly biased and do not mirror actual morphotype abundances at all. Potential reasons included cell losses after fixation, cryptic morphotypes, resting stages, insufficient sequence data availability of morphologically described species and the unsatisfying resolution of the V4 SSU rRNA fragment for accurate taxonomic assignments. The latter two underline the necessity of barcoding initiatives for eukaryotic microbes to better and fully exploit environmental amplicon data sets, which then will also allow studying the potential of seed-bank taxa as a buffer for environmental changes. © 2013 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
Suwannapoom, Chatmongkon; Yuan, Zhi-Yong; Chen, Jin-Min; Hou, Mian; Zhao, Hai-Peng; Wang, Li-Jun; Nguyen, Truong Son; Nguyen, Truong Q; Murphy, Robert W; Sullivan, Jaqueline; Mcleod, David S; Che, Jing
2016-03-21
Phylogenetic reconstructions derived from DNA sequence data play a central role in documenting the number of species in a complex. Such analyses are pointing to the existence of many cryptic species, especially in poorly understood groups such as the genus Limnonectes, and the L. kuhlii species complex in particular. To understand the Limnonectes frogs of China, we reconstruct the major matrilineal genealogy of Limnonectes from China and Southeast Asia based on 12S rRNA, tRNAVal and 16S rRNA gene sequences. Based on new data we recognize five species of Limnonectes in China including L. bannaensis, L. fujianensis, L. fragilis, L. taylori (new record), and a new species from southern China and Myanmar. Phylogenetically, the new species is more closely related to the clade comprising L. taylori, L. megastomias, L. isanensis, L. nguyenorum, and L. jarujini from Thailand than to other Chinese species. This study supports previous findings of sympatric members of a species complex that are not each other's closest relatives.
Phylogenetic perspective and the search for life on earth and elsewhere
NASA Technical Reports Server (NTRS)
Pace, Norman R.
1989-01-01
Any search for microbial life on Mars cannot rely upon cultivation of indigenous organisms. Only a minority of even terrestrial organisms that are observed in mixed, naturally-occurring microbial populations can be cultivated in the laboratory. Consequently, methods are being developed for analyzing the phylogenetic affiliations of the constituents of natural microbial populations without the need for their cultivation. This is more than an exercise in taxonomy, for the extent of phylogenetic relatedness between unknown and known organisms is some measure of the extent of their biochemical commonalities. In one approach, total DNA is isolated from natural microbial populations and 16S rRNA genes are shotgun cloned for rapid sequence determinations and phylogenetic analyses. A second approach employs oligodeoxynucleotide hybridization probes that bind to phylogenetic group-specific sequences in 16S rRNA. Since each actively growing cell contains about 104 ribosomes, the binding of the diagnostic probes to single cells can be visualized by radioactivity or fluorescence. The application of these methods and the use of in situ cultivation techniques is illustrated using submarine hydrothermal vent communities. Recommendations are made regarding planning toward future Mars missions.
Mycobacterium intermedium sp. nov.
Meier, A; Kirschner, P; Schröder, K H; Wolters, J; Kroppenstedt, R M; Böttger, E C
1993-04-01
Strains of a new type of slowly growing mycobacterium were repeatedly isolated from sputum from a patient with pulmonary disease. This photochromogenic organism grew at 22, 31, 37, and 41 degrees C, possessed catalase, acid phosphatase, esterase, beta-galactosidase, and arylsulfatase activities, and hydrolyzed Tween. It did not produce nicotinic acid or have nitrate reductase, acetamidase, benzamidase, isonicotinamidase, nicotinamidase, pyrazinamidase, succinidamidase, and acid phosphatase activities. Urease activity was variable. The organism is susceptible to ethambutol and resistant to isoniazid and streptomycin. A mycolic acid analysis revealed the presence of alpha-mycolates, alpha'-mycolates, and keto-mycolates. The results of comparative 16S rRNA sequencing placed this organism at an intermediate position between the rapidly and slowly growing mycobacteria. On the basis of the pattern of enzymatic activities and metabolic properties, the results of fatty acid analyses, and the unique 16S rRNA sequence, we propose that this organism represents a new species, for which we propose the name Mycobacterium intermedium. The type strain is strain 1669/91; a culture of this strain has been deposited in the Deutsche Sammlung von Mikroorganismen und Zellkulturen as strain DSM 44049.
NASA Technical Reports Server (NTRS)
Gosink, J. J.; Woese, C. R.; Staley, J. T.
1998-01-01
Several psychrophilic, gas vacuolate strains of the Cytophage-Flavobacterium-Bacteroides (CFB) phylogenetic group were isolated from sea ice and water from the Arctic and the Antarctic. The closest taxonomically defined species by 16S rRNA sequence analysis is 'Flectobacillus glomeratus'. However, 'Flc. glomeratus' is phylogenetically distant from the Flectobacillus type species, Flc. major. On the basis of phenotypic, genotypic and 16S rRNA sequence analyses we propose a new genus, Polaribacter, with three new species, Polaribacter irgensii strain 23-P (ATCC 700398), Polaribacter franzmannii strain 301 (ATCC 700399) and Polaribacter filamentus strain 215 (ATCC 700397). P. filamentus is the type species of the genus. None of these species exhibits a cosmopolitan or bipolar distribution. This is the first taxonomic description of gas vacuolate bacteria in the CFB group. Additionally, we propose that 'Flc. glomeratus' be reclassified to the genus Polaribacter as P. glomeratus, comb. nov.
The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.
Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C
1994-12-01
Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.
Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora
Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.
1999-01-01
The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008
NASA Astrophysics Data System (ADS)
Dong, Y.; Cann, I.; Mackie, R.; Price, N.; Flynn, T. M.; Sanford, R.; Miller, P.; Chia, N.; Kumar, C. G.; Kim, P.; Sivaguru, M.; Fouke, B. W.
2010-12-01
Knowledge of the composition, structure and activity of microbial communities that live in deeply buried sedimentary rocks is fundamental to the future of subsurface biosphere stewardship as it relates to hydrocarbon exploration and extraction, carbon sequestration, gas storage and groundwater management. However, the study of indigenous subsurface microorganisms has been limited by the technical challenges of collecting deep formation water samples that have not been heavily contaminated by the mud used to drill the wells. To address this issue, a “clean-sampling method” deploying the newly developed Schlumberger Quicksilver MDT probe was used to collect a subsurface sample at a depth of 1.79 km (5872 ft) from an exploratory well within Cambrian-age sandstones in the Illinois Basin. This yielded a formation water sample that was determined to have less than 4% drilling mud contamination based on tracking changes in the aqueous geochemistry of the formation water during ~3 hours of pumping at depth prior to sample collection. A suite of microscopy and culture-independent molecular analyses were completed using the DNA extracted from microbial cells in the formation water, which included 454 amplicon pyrosequencing that targeted the V1-V3 hypervariable region of bacterial 16S rRNA gene sequences. Results demonstrated an extremely low diversity microbial community living in formation water at 1.79 km-depth. More than 95 % of the total V1-V3 pyrosequencing reads (n=11574) obtained from the formation water were affiliated with a halophilic γ-proteobacterium and most closely related to the genus Halomonas. In contrast, about 3 % of the V1-V3 sequences in the drilling mud library (n=13044) were classified as genus Halomonas but were distinctly different and distantly related to the formation water Halomonas detected at 1.79 km-depth. These results were consistent with those obtained using a suite of other molecular screens (e.g., Terminal-Restriction Fragment Length Polymorphism (T-RFLP) and the initial full length 16S rRNA amplicon libraries) and bioinformatic analyses (e.g., 16S rRNA and Open Reading Frame (ORF) calls established from the 454 metagenomic community analyses). Functional pathway modeling is underway to evaluate the adaptation of this indigenous microbial community to the hydrologic and geologic history of the deep subsurface environment of the Illinois Basin.
Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification.
Gundersen, D E; Lee, I M; Rehner, S A; Davis, R E; Kingsbury, D T
1994-01-01
A global phylogenetic analysis using parsimony of 16S rRNA gene sequences from 46 mollicutes, 19 mycoplasmalike organisms (MLOs) (new trivial name, phytoplasmas), and several related bacteria placed the MLOs definitively among the members of the class Mollicutes and revealed that MLOs form a large discrete monophyletic clade, paraphyletic to the Acholeplasma species, within the Anaeroplasma clade. Within the MLO clade resolved in the global mollicutes phylogeny and a comprehensive MLO phylogeny derived by parsimony analyses of 16S rRNA gene sequences from 30 diverse MLOs representative of nearly all known distinct MLO groups, five major phylogenetic groups with a total of 11 distinct subclades (monophyletic groups or taxa) could be recognized. These MLO subclades (roman numerals) and designated type strains were as follows: i, Maryland aster yellows AY1; ii, apple proliferation AP-A; iii, peanut witches'-broom PnWB; iv, Canada peach X CX; v, rice yellow dwarf RYD; vi, pigeon pea witches'-broom PPWB; vii, palm lethal yellowing LY; viii, ash yellows AshY; ix, clover proliferation CP; x, elm yellows EY; and xi, loofah witches'-broom LfWB. The designations of subclades and their phylogenetic positions within the MLO clade were supported by a congruent phylogeny derived by parsimony analyses of ribosomal protein L22 gene sequences from most representative MLOs. On the basis of the phylogenies inferred in the present study, we propose that MLOs should be represented taxonomically at the minimal level of genus and that each phylogenetically distinct MLO subclade identified should represent at least a distinct species under this new genus. Images PMID:8071198
He, Yan; Caporaso, J Gregory; Jiang, Xiao-Tao; Sheng, Hua-Fang; Huse, Susan M; Rideout, Jai Ram; Edgar, Robert C; Kopylova, Evguenia; Walters, William A; Knight, Rob; Zhou, Hong-Wei
2015-01-01
The operational taxonomic unit (OTU) is widely used in microbial ecology. Reproducibility in microbial ecology research depends on the reliability of OTU-based 16S ribosomal subunit RNA (rRNA) analyses. Here, we report that many hierarchical and greedy clustering methods produce unstable OTUs, with membership that depends on the number of sequences clustered. If OTUs are regenerated with additional sequences or samples, sequences originally assigned to a given OTU can be split into different OTUs. Alternatively, sequences assigned to different OTUs can be merged into a single OTU. This OTU instability affects alpha-diversity analyses such as rarefaction curves, beta-diversity analyses such as distance-based ordination (for example, Principal Coordinate Analysis (PCoA)), and the identification of differentially represented OTUs. Our results show that the proportion of unstable OTUs varies for different clustering methods. We found that the closed-reference method is the only one that produces completely stable OTUs, with the caveat that sequences that do not match a pre-existing reference sequence collection are discarded. As a compromise to the factors listed above, we propose using an open-reference method to enhance OTU stability. This type of method clusters sequences against a database and includes unmatched sequences by clustering them via a relatively stable de novo clustering method. OTU stability is an important consideration when analyzing microbial diversity and is a feature that should be taken into account during the development of novel OTU clustering methods.
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.
1998-01-01
We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678
Root-Bernstein, Robert; Root-Bernstein, Meredith
2016-05-21
We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Delport, Tiffany C.; Asher, Amy J.; Beaumont, Linda J.; Webster, Koa N.; Harcourt, Robert G.; Power, Michelle L.
2014-01-01
Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations. PMID:25426423
Delport, Tiffany C; Asher, Amy J; Beaumont, Linda J; Webster, Koa N; Harcourt, Robert G; Power, Michelle L
2014-12-01
Giardia and Cryptosporidium are amongst the most common protozoan parasites identified as causing enteric disease in pinnipeds. A number of Giardia assemblages and Cryptosporidium species and genotypes are common in humans and terrestrial mammals and have also been identified in marine mammals. To investigate the occurrence of these parasites in an endangered marine mammal, the Australian sea lion (Neophoca cinerea), genomic DNA was extracted from faecal samples collected from wild populations (n = 271) in Southern and Western Australia and three Australian captive populations (n = 19). These were screened using PCR targeting the 18S rRNA of Giardia and Cryptosporidium. Giardia duodenalis was detected in 28 wild sea lions and in seven captive individuals. Successful sequencing of the 18S rRNA gene assigned 27 Giardia isolates to assemblage B and one to assemblage A, both assemblages commonly found in humans. Subsequent screening at the gdh and β-giardin loci resulted in amplification of only one of the 35 18S rRNA positive samples at the β-giardin locus. Sequencing at the β-giardin locus assigned the assemblage B 18S rRNA confirmed isolate to assemblage AI. The geographic distribution of sea lion populations sampled in relation to human settlements indicated that Giardia presence in sea lions was highest in populations less than 25 km from humans. Cryptosporidium was not detected by PCR screening in either wild colonies or captive sea lion populations. These data suggest that the presence of G. duodenalis in the endangered Australian sea lion is likely the result of dispersal from human sources. Multilocus molecular analyses are essential for the determination of G. duodenalis assemblages and subsequent inferences on transmission routes to endangered marine mammal populations.
Thollesson, M.
1999-01-01
The phylogeny of Euthyneura is analysed by using DNA sequences of the mitochondrial 16S rRNA gene. Despite the common notion that this gene is too variable to provide useful information at high taxonomic levels, such as in the present study, bootstrap proportions are high for several clades in the study. This indicates that there is a useful amount of variation despite the noise due to multiple substitutions. The analyses furthermore indicate that (i) Gymnosomata (represented by Clione) is not a part of Euthyneura, but Clione forms a clade with the caenogastropods; (ii) Acteon is the sister group to the remaining euthyneuran taxa in the study; (iii) the nudibranch taxa form two clades, one comprising Dendronotoidea, Arminoidea and Aeolidoidea (together Cladobranchia) with Notaspidea (represented by Berthella) as sister group, while the fourth nudibranch taxon, Doridoidea, forms a separate clade; (iv) Cephalaspidea s.s. and Anaspidea form clades that are each other's sister groups (together Pleurocoela). Finally, there is no clade present in the analyses corresponding to the taxon Opisthobranchia in the traditional sense, and the use of this name is probably better abandoned altogether.
Characterization of cyanobacterial communities from high-elevation lakes in the Bolivian Andes
NASA Astrophysics Data System (ADS)
Fleming, Erich D.; Prufert-Bebout, Leslie
2010-06-01
The Bolivian Altiplano is a harsh environment for life with high solar irradiation (visible and UVR), below freezing temperatures, and some of the lowest precipitation rates on the planet. However, microbial life is visibly abundant in small isolated refugia of spring or snowmelt-fed lakes. In this study, we characterized the cyanobacterial composition of a variety of microbial mats present in three lake systems: Laguna Blanca, Laguna Verde (elevation 4300 m), and a summit lake in the Licancabur Volcano cone (elevation 5970 m). These lakes and their adjacent geothermal springs present an interesting diversity of environments within a geographically small region (5 km2). From these sites, 78 cyanobacterial cultures were isolated in addition to ˜400 cyanobacterial 16S rRNA gene sequences from environmental genomic DNA. Based on microscopy, cultivation, and molecular analyses, these communities contained many heterocytous, nitrogen-fixing cyanobacteria (e.g., Calothrix, Nostoc, Nodularia) as well as a large number of cyanobacteria belonging to the form-genus Leptolyngbya. More than a third (37%) of all taxa in this study were new species (≤96% 16S rRNA gene sequence identity), and 11% represented new and novel taxa distantly related (≤93% identity) to any known cyanobacteria. This is one of the few studies to characterize cyanobacterial communities based on both cultivation-dependent and cultivation-independent analyses.
Actinomyces gaoshouyii sp. nov., isolated from plateau pika (Ochotona curzoniae).
Meng, Xiangli; Wang, Yiting; Lu, Shan; Lai, Xin-He; Jin, Dong; Yang, Jing; Xu, Jianguo
2017-09-01
Two strains (pika_113T and pika_114) of a previously undescribed Actinomyces-like bacterium were recovered from the intestinal contents of plateau pika (Ochotona curzoniae) on the Tibet-Qinghai Plateau, China. Results from biochemical characterization indicated that the two strains were phenotypically homogeneous and distinct from other previously described species of the genus Actinomyces. Based on the comparison of 16S rRNA gene sequences and genome analysis, the bacteria were determined to be a hitherto unknown subline within the genus Actinomyces, being most closely related to type strains of Actinomyces denticolens and Actinomyces timonensis with a respective 97.2 and 97.1 % similarity in their 16S rRNA gene sequences. Phylogenetic analyses confirmed that pika_113T was well separated from any other recognized species of the genus Actinomyces and within the cluster with A. denticolens and A. timonensis. The genome of strain pika_113T displayed less than 42 % relatedness in DNA-DNA hybridization with all the available genomes of existing species of the genus Actinomyces in the NCBI database. Collectively, based on the phenotypic characteristics and phylogenetic analyses results, we propose the novel isolates as representatives of Actinomyces gaoshouyii sp. nov. The type strain of Actinomyces gaoshouyii is pika_113T (=CGMCC 4.7372T=DSM 104049T), with a genomic DNA G+C content of 71 mol%.
Zhuo, Kan; Wang, Honghong; Zhang, Hongling; Liao, Jinling
2014-11-07
Heterodera guangdongensis n. sp. is described from bamboo (Phyllostachys pubescens Mazel) based on morphology and molecular analyses of rRNA D2D3 expansion domains of large subunit (LSU D2D3) and internal transcribed spacer (ITS) sequences. This new species can be classified in the Cyperi group. Cysts are characterized by a prominent, ambifenestrate vulval cone with weak underbridge, a vulva-anus distance of 28.9-35.9 μm and a vulval slit of 31.1-41.0 μm, but without bullae. Females are characterized by a 25.1-27.6 μm stylet with rounded knobs sloping slightly posteriorly. Males are characterized by a 21.5-23.0 μm stylet with knobs slightly projecting or flat anteriorly, lateral field with four lines, and a 22.0-26.0 μm spicule with bifurcate tip. Second-stage juveniles are characterized by a 19.3-21.3 stylet with slightly projecting or anteriorly flattened knobs, lateral field with three lines, a 41.7-61.3 μm tail with finely rounded terminus and hyaline portion forming 43.0-57.1% of the tail length. Molecular analyses show that the species has unique D2D3 and ITS rRNA sequences and RFLP-ITS-rRNA profiles.
Miao, Miao; Wang, Yangang; Song, Weibo; Clamp, John C; Al-Rasheid, Khaled A S
2010-02-01
Recently, an undescribed marine ciliate was isolated from China. Investigation of its morphology and infraciliature revealed it as an undescribed species representing a new genus, Eurystomatella n. gen., the type of the new family Eurystomatellidae n. fam. The new family is defined by close-set, apically positioned oral membranelles and a dominant buccal field that is surrounded by an almost completely circular paroral membrane. The new genus is defined by having a small oral membranelle 1 (M1), bipartite M2 and well-developed M3, a body surface faintly sculptured with a silverline system in a quadrangular, reticulate pattern and a cytostome located at the anterior third of a large buccal field. The type species of the new genus, Eurystomatella sinica n. sp., is a morphologically unique form that is defined mainly by the combination of a conspicuously flattened body, several caudal cilia, extremely long cilia associated with the buccal apparatus and a contractile vacuole located subcaudally. According to phylogenetic analyses of small-subunit (SSU) rRNA gene sequences, Eurystomatella clusters with the genus Cyclidium, as a sister group to the family Pleuronematidae. The great divergence in both buccal and somatic ciliature between Eurystomatella and all other known scuticociliates supports the establishment of a new family for Eurystomatella.
Hernández, Marcela; Villalobos, Patricio; Morgante, Verónica; González, Myriam; Reiff, Caroline; Moore, Edward; Seeger, Michael
2008-09-01
s-Triazine herbicides are used extensively in South America in agriculture and forestry. In this study, a bacterium designated as strain MHP41, capable of degrading simazine and atrazine, was isolated from agricultural soil in the Quillota valley, central Chile. Strain MHP41 is able to grow in minimal medium, using simazine as the sole nitrogen source. In this medium, the bacterium exhibited a growth rate of mu=0.10 h(-1), yielding a high biomass of 4.2 x 10(8) CFU mL(-1). Resting cells of strain MHP41 degrade more than 80% of simazine within 60 min. The atzA, atzB, atzC, atzD, atzE and atzF genes encoding the enzymes of the simazine upper and lower pathways were detected in strain MHP41. The motile Gram-negative bacterium was identified as a Pseudomonas sp., based on the Biolog microplate system and comparative sequence analyses of the 16S rRNA gene. Amplified ribosomal DNA restriction analysis allowed the differentiation of strain MHP41 from Pseudomonas sp. ADP. The comparative 16S rRNA gene sequence analyses suggested that strain MHP41 is closely related to Pseudomonas nitroreducens and Pseudomonas multiresinovorans. This is the first s-triazine-degrading bacterium isolated in South America. Strain MHP41 is a potential biocatalyst for the remediation of s-triazine-contaminated environments.
From Sequences to Insights in Microbial Ecology
Knight, R.
2010-01-01
s4-3 Rapid declines in the cost of sequencing have made large volumes of DNA sequence data available to individual investigators. Now, data analysis is the rate-limiting step: providing a user with sequences alone typically leads to bewilderment, frustration, and skepticism about the technology. In this talk, I focus on how to extract insights from 16S rRNA data, including key lab steps (barcoding and normalization) and on which tools are available to perform routine but essential processing steps such as denoising, chimera detection, taxonomy assignment, and diversity analyses (including detection of biological clusters and gradients in the samples). Providing users with advice on these points and with a standard pipeline they can exploit (but modify if circumstances require) can greatly accelerate the rate of understanding, publication, and acquisition of funding for further studies.
Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun
2014-07-01
Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.
Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S
2015-10-01
In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Branton, William G.; Ellestad, Kristofor K.; Maingat, Ferdinand; Wheatley, B. Matt; Rud, Erling; Warren, René L.; Holt, Robert A.; Surette, Michael G.; Power, Christopher
2013-01-01
The brain is assumed to be a sterile organ in the absence of disease although the impact of immune disruption is uncertain in terms of brain microbial diversity or quantity. To investigate microbial diversity and quantity in the brain, the profile of infectious agents was examined in pathologically normal and abnormal brains from persons with HIV/AIDS [HIV] (n = 12), other disease controls [ODC] (n = 14) and in cerebral surgical resections for epilepsy [SURG] (n = 6). Deep sequencing of cerebral white matter-derived RNA from the HIV (n = 4) and ODC (n = 4) patients and SURG (n = 2) groups revealed bacterially-encoded 16 s RNA sequences in all brain specimens with α-proteobacteria representing over 70% of bacterial sequences while the other 30% of bacterial classes varied widely. Bacterial rRNA was detected in white matter glial cells by in situ hybridization and peptidoglycan immunoreactivity was also localized principally in glia in human brains. Analyses of amplified bacterial 16 s rRNA sequences disclosed that Proteobacteria was the principal bacterial phylum in all human brain samples with similar bacterial rRNA quantities in HIV and ODC groups despite increased host neuroimmune responses in the HIV group. Exogenous viruses including bacteriophage and human herpes viruses-4, -5 and -6 were detected variably in autopsied brains from both clinical groups. Brains from SIV- and SHIV-infected macaques displayed a profile of bacterial phyla also dominated by Proteobacteria but bacterial sequences were not detected in experimentally FIV-infected cat or RAG1−/− mouse brains. Intracerebral implantation of human brain homogenates into RAG1−/− mice revealed a preponderance of α-proteobacteria 16 s RNA sequences in the brains of recipient mice at 7 weeks post-implantation, which was abrogated by prior heat-treatment of the brain homogenate. Thus, α-proteobacteria represented the major bacterial component of the primate brain’s microbiome regardless of underlying immune status, which could be transferred into naïve hosts leading to microbial persistence in the brain. PMID:23355888
Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke
2017-09-18
Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B.V. All rights reserved.
Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.
Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507
Miranda, Priscilla J.; McLain, Nathan K.; Hatzenpichler, Roland; Orphan, Victoria J.; Dillon, Jesse G.
2016-01-01
The shallow-sea hydrothermal vents at White Point (WP) in Palos Verdes on the southern California coast support microbial mats and provide easily accessed settings in which to study chemolithoautotrophic sulfur cycling. Previous studies have cultured sulfur-oxidizing bacteria from the WP mats; however, almost nothing is known about the in situ diversity and activity of the microorganisms in these habitats. We studied the diversity, micron-scale spatial associations and metabolic activity of the mat community via sequence analysis of 16S rRNA and aprA genes, fluorescence in situ hybridization (FISH) microscopy and sulfate reduction rate (SRR) measurements. Sequence analysis revealed a diverse group of bacteria, dominated by sulfur cycling gamma-, epsilon-, and deltaproteobacterial lineages such as Marithrix, Sulfurovum, and Desulfuromusa. FISH microscopy suggests a close physical association between sulfur-oxidizing and sulfur-reducing genotypes, while radiotracer studies showed low, but detectable, SRR. Comparative 16S rRNA gene sequence analyses indicate the WP sulfur vent microbial mat community is similar, but distinct from other hydrothermal vent communities representing a range of biotopes and lithologic settings. These findings suggest a complete biological sulfur cycle is operating in the WP mat ecosystem mediated by diverse bacterial lineages, with some similarity with deep-sea hydrothermal vent communities. PMID:27512390
Flores, B S; Siddall, M E; Burreson, E M
1996-08-01
The phylogenetic position of the phylum Haplosporidia was investigated with the complete small subunit rRNA gene sequences from 5 species in the phylum: Haplosporidium nelsoni and Haplosporidium costale, parasites of the eastern oyster Crassostrea virginica; Haplosporidium louisiana, a parasite of the mudcrab Panopeus herbstii; Minchinia teredinis, a parasite of shipworms (Teredo spp.) and Urosporidium crescens, a hyperparasite found in metacercariae of the trematode Megalophallus sp. in the blue crab, Callinectes sapidus. Multiple alignments of small subunit rRNA gene sequences included the 5 haplosporidian taxa and 14 taxa in the alveolate phyla Ciliophora, Dinoflagellida, and Apicomplexa. Maximum parsimony analysis placed the phylum Haplosporidia as a monophyletic group within the alveolate clade, as a taxon of equal rank with the other 3 alveolate phyla, and as a sister taxon to the clade composed of the phyla Dinoflagellida and Apicomplexa. Transversionally weighted parsimony placed the haplosporidians as a sister taxon to the ciliates. A separate analysis focused on the relationships of species in the genus Haplosporidium. Analyses were conducted with the haplosporidians as a functional ingroup, using each of the alveolate phyla individually as functional outgroups. The results indicated that species in the genus Haplosporidium do not form a monophyletic assemblage. As such, the present morphological criteria for distinguishing the genera Haplosporidium and Minchinia are insufficient.
Temperature and nutrient effects on periphyton associated ...
Nutrient pollution is a leading cause of water quality impairments and degraded aquatic ecosystem condition. Reliable and reproducible indicators of ecosystem condition are needed to help manage nutrient pollution. The diatom component of periphyton has been used as a water quality indicator due to identifiable cell morphology and existence of relationships between nutrient concentration and diatom community composition. However, morphological identification of diatoms requires highly specialized personnel, is very time consuming, and can produce variable results, suggesting the need for alternative methods that are less expensive and more reproducible. DNA sequencing of the bacterial 16S rRNA gene is well documented and provides genus-level resolution of the community structure. The goal of this study was to evaluate the effects of nutrient loading and temperature on periphyton-associated bacterial communities using standard periphytometer techniques and next generation sequencing technologies. Continuous flow mesocosms were established in an eight tank system consisting of two temperature conditions (10°C and 20°C) and four nutrient conditions (1x to 6x ambient concentrations). Experimental conditions were replicated in July/August 2013 and September 2013. Replicate DNA samples were extracted and the 16S rRNA gene was sequenced using universal Bacterial primers. Initial analyses revealed strong differences in community structure based on temperature (p <
Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.
Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J
2017-11-02
Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had altered diversity profiles. Both bioinformatics 16S rRNA pipelines used in this study (OTU and paired end) presented similar taxonomic profiles at genus level. We determined that DNA extraction from ELBW faecal samples, particularly those infants receiving probiotic supplementation, should include a prolonged beat-beating step. Furthermore, use of the 16S rRNA (V1 + V2 + V3) and (V6 + V7 + V8) regions provides reliable representation of ELBW microbiota profiles, while inclusion of the (V4 + V5) region may not be appropriate for studies where Bifidobacterium constitutes a resident microbiota member.
High-resolution phylogenetic microbial community profiling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin
Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less
High-resolution phylogenetic microbial community profiling
Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...
2016-02-09
Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less
Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.
Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O
2008-04-01
Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.
Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.
2011-01-01
Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895
Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R
2011-09-01
Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.
Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P
1999-12-01
The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.
NASA Technical Reports Server (NTRS)
Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)
1999-01-01
The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science
Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.
2017-01-01
Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing
Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro
2017-01-01
Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100
Fast, accurate and easy-to-pipeline methods for amplicon sequence processing
NASA Astrophysics Data System (ADS)
Antonielli, Livio; Sessitsch, Angela
2016-04-01
Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.
Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A
2017-01-01
We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Hassa, Julia; Maus, Irena; Off, Sandra; Pühler, Alfred; Scherer, Paul; Klocke, Michael; Schlüter, Andreas
2018-06-01
The production of biogas by anaerobic digestion (AD) of agricultural residues, organic wastes, animal excrements, municipal sludge, and energy crops has a firm place in sustainable energy production and bio-economy strategies. Focusing on the microbial community involved in biomass conversion offers the opportunity to control and engineer the biogas process with the objective to optimize its efficiency. Taxonomic profiling of biogas producing communities by means of high-throughput 16S rRNA gene amplicon sequencing provided high-resolution insights into bacterial and archaeal structures of AD assemblages and their linkages to fed substrates and process parameters. Commonly, the bacterial phyla Firmicutes and Bacteroidetes appeared to dominate biogas communities in varying abundances depending on the apparent process conditions. Regarding the community of methanogenic Archaea, their diversity was mainly affected by the nature and composition of the substrates, availability of nutrients and ammonium/ammonia contents, but not by the temperature. It also appeared that a high proportion of 16S rRNA sequences can only be classified on higher taxonomic ranks indicating that many community members and their participation in AD within functional networks are still unknown. Although cultivation-based approaches to isolate microorganisms from biogas fermentation samples yielded hundreds of novel species and strains, this approach intrinsically is limited to the cultivable fraction of the community. To obtain genome sequence information of non-cultivable biogas community members, metagenome sequencing including assembly and binning strategies was highly valuable. Corresponding research has led to the compilation of hundreds of metagenome-assembled genomes (MAGs) frequently representing novel taxa whose metabolism and lifestyle could be reconstructed based on nucleotide sequence information. In contrast to metagenome analyses revealing the genetic potential of microbial communities, metatranscriptome sequencing provided insights into the metabolically active community. Taking advantage of genome sequence information, transcriptional activities were evaluated considering the microorganism's genetic background. Metaproteome studies uncovered enzyme profiles expressed by biogas community members. Enzymes involved in cellulose and hemicellulose decomposition and utilization of other complex biopolymers were identified. Future studies on biogas functional microbial networks will increasingly involve integrated multi-omics analyses evaluating metagenome, transcriptome, proteome, and metabolome datasets.
2012-01-01
Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411
Schumann, Peter; Zhang, De-Chao; França, Luís; Albuquerque, Luciana; da Costa, Milton S; Margesin, Rosa
2017-03-01
Two Gram-stain-variable, non-motile, catalase-positive and cytochrome c oxidase-negative bacteria, designated AK20-18 T and AM20-54, were isolated from forest soil samples collected in the Italian Alps. Growth occurred at a temperature range of 5-30 °C, at pH 6-9 and in the presence of 0-5 % (w/v) NaCl. The 16S rRNA gene sequence similarity between strains AK20-18 T and AM20-54 was 100 %. Phylogenetic analysis based on 16S rRNA gene sequence showed that strain AK20-18 T had highest 16S rRNA gene sequence similarity with the type strain of Arthrobacter psychrochitiniphilus (96.9 %). The cell-wall peptidoglycan structure of strain AK20-18 T was of the type A3alpha l-Lys-l-Thr-l-Ala2 (A11.27). The whole-cell sugars were galactose, ribose and lesser amounts of mannose. The major respiratory quinone of the two strains was menaquinone 9(H2) [MK-9(H2)], whereas MK-10(H2) was a minor component. The polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and unknown glycolipids. The major cellular fatty acids were anteiso-C15 : 0, iso-C15 : 0, iso-C16 : 0 and anteiso-C17 : 0. The genomic DNA G+C content was 59.9 mol%. Combined data of phylogenetic, phenotypic and chemotaxonomic analyses demonstrated that strains AK20-18 T and AM20-54 represent a novel genus and species, for which the name Psychromicrobium silvestre gen. nov., sp. nov. is proposed. The type strain of Psychromicrobium silvestregen. nov., sp. nov. is AK20-18 T (=DSM 102047 T =LMG 29369 T ).
Leucobacter salsicius sp. nov., from a salt-fermented food.
Yun, Ji-Hyun; Roh, Seong Woon; Kim, Min-Soo; Jung, Mi-Ja; Park, Eun-Jin; Shin, Kee-Sun; Nam, Young-Do; Bae, Jin-Woo
2011-03-01
Strain M1-8(T) was isolated from jeotgal, a Korean salt-fermented food. Cells were aerobic, non-motile, Gram-reaction-positive and rod-shaped. Colonies were cream-coloured and circular with entire margins. Strain M1-8(T) exhibited optimal growth at 25-30 °C and pH 7.0-8.0 and in 0-4 % (w/v) NaCl. The strain tolerated up to 10.0 mM Cr(VI). Phylogenetic analyses of 16S rRNA gene sequences indicated that strain M1-8(T) represents a novel species in the genus Leucobacter. The 16S rRNA gene sequence of M1-8(T) exhibited 98.1 % similarity to that of Leucobacter chromiireducens subsp. chromiireducens L-1(T). The new isolate was clustered with Leucobacter species on a 16S rRNA gene sequence-based phylogenetic tree. The chromosomal DNA G+C content of strain M1-8(T) was 62.8 %. Its cell-wall peptidoglycan contained 2,4-diaminobutyric acid, glutamic acid, alanine, glycine and γ-aminobutyric acid. The major menaquinone was MK-11 and the predominant fatty acids were anteiso-C₁₅:₀ (63.6 %), anteiso-C₁₇:₀ (16.7 %) and iso-C₁₆:₀ (14.2 %). The polar lipid profile of strain M1-8(T) contained diphosphatidylglycerol and one unknown glycolipid. Significant genotypic and phenotypic differences were found between strain M1-8(T) and other Leucobacter species. These differentiating characteristics indicate that strain M1-8(T) represents a novel species of the genus Leucobacter, for which the name Leucobacter salsicius sp. nov. is proposed. The type strain is M1-8(T) (=KACC 21127(T) =JCM 16362(T)).
Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing
Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa
2014-01-01
While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880
Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.
Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa
2014-01-01
While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.
Identification of a novel subgroup 16SrII-U phytoplasma associated with papaya little leaf disease.
Yang, Yi; Jiang, Lei; Che, Haiyan; Cao, Xueren; Luo, Daquan
2016-09-01
Papaya is an important fruit crop cultivated in tropical and subtropical regions. Papaya little leaf (PLL) disease was observed in China. The phytoplasma 16S rRNA gene was detected from symptomatic papaya trees via PCR using phytoplasma universal primers P1/P7 followed by R16F2n/R16R2. No amplification products were obtained from templates of asymptomatic papaya trees. These results indicated a direct association between phytoplasma infection and PLL disease. Comparative and phylogenetic analyses of 16S rRNA gene sequences indicated that the papaya-infecting phytoplasmas under study belonged to the peanut witches' broom phytoplasma group (16SrII). Genotyping through use of computer-simulated RFLP analysis of 16S rRNA genes and coefficients of RFLP pattern similarities (0.97) reveal that the PLL phytoplasma was placed in a new subgroup. In this article, we describe the molecular characterization of a new phytoplasma associated with PLL disease and propose that the PLL phytoplasma be considered as a novel subgroup, 16SrII-U.
Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.
Schmidt, Mariane; Priemé, Anders; Stougaard, Peter
2006-12-01
Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.
Tsunematsu, Noriko; Goto, Mieko; Saiki, Yumiko; Baba, Michiko; Udagawa, Tadashi; Kazumi, Yuko
2008-09-01
The bacilli which were isolated from a patient suspected of the mixed infections with Mycobacterium avium and Mycobacterium intracellulare, were analyzed. The genotypes of M. avium in the sedimented fractions of treated sputum and in some colonies isolated from Ogawa medium were compared by the Variable Numbers of Tandem Repeats (VNTR). A woman, aged 57. Mycobacterial species isolated from some colonies by culture in 2004 and 2006 and from the treated sputum in 2006, were determined by DNA sequencing analysis of the 16S rRNA gene. Also, by using VNTR, the genotype of mycobacteria was analyzed. [Results] (1) The colony isolated from Ogawa medium in 2004 was monoclonal M. avium. (2) By VNTR analyses of specimens in 2006, multiple acid-fast bacteria were found in the sputum sediment and in isolated bacteria from Ogawa medium. (3) By analyses of 16S rRNA DNA sequence, M. avium and M. intracellulare were found in the colonies isolated from the sputum sediment and the Ogawa medium in 2006. (4) The same VNTR patterns were obtained in M. avium in 2004 and 2006 when single colony was analyzed. (5) From the showerhead and culvert of the bathroom in the patient's house, M. avium was not detected. By VNTR analyses, it was considered that the mixed infections of M. avium and M. intracellulare had been generated during treatment in this case. Therefore, in the case of suspected complex infection, VNTR analysis would be a useful genotyping method in M. avium complex infection.
Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung
2015-02-01
Initiation of transcription for ribosomal RNA (rRNA) by RNA polymerase I requires TATA-binding protein (TBP) and TBP-associated factors (TAF1A, TAF1B and TAF1C). p53 tumour suppressor inhibits rRNA transcription by blocking TAF1C-UBF interaction, but alterations of TAF1C itself in tumorigenesis remain unknown. The aim of this study was to explore whether TAF1C gene was mutated in gastric (GC) and colorectal cancers (CRC).In a public database, we found that TAF1C gene had a mononucleotide repeat (C8) in the coding sequences that might be a mutation target in the cancers with microsatellite instability (MSI). We analysed 79 GC and 124 CRC by single-strand conformation polymorphism and DNA sequencing analyses. In this study, we found TAF1C frameshift mutations (8.8% of GC and 10.1% of CRC with MSI-H), which were not found in stable MSI/low MSI (MSS/MSI-L) (0/90). In addition, we analysed intratumoural heterogeneity (ITH) of TAF1C frameshift mutations in 16 CRC and found that three CRC (18.8%) harboured regional ITH of the TAF1C frameshift mutations. Our results indicate that TAF1C gene harboured not only somatic frameshift mutations but also the mutational ITH, which together might play a role in tumourigenesis of GC and CRC. Our data also suggest that multi-regional mutation analysis is needed for a better evaluation of the mutation status in CRC.
Diversity of Anaerobic Microbes in Spacecraft Assembly Clean Rooms ▿ †
Probst, Alexander; Vaishampayan, Parag; Osman, Shariff; Moissl-Eichinger, Christine; Andersen, Gary L.; Venkateswaran, Kasthuri
2010-01-01
Although the cultivable and noncultivable microbial diversity of spacecraft assembly clean rooms has been previously documented using conventional and state-of-the-art molecular techniques, the occurrence of obligate anaerobes within these clean rooms is still uncertain. Therefore, anaerobic bacterial communities of three clean-room facilities were analyzed during assembly of the Mars Science Laboratory rover. Anaerobic bacteria were cultured on several media, and DNA was extracted from suitable anaerobic enrichments and examined with conventional 16S rRNA gene clone library, as well as high-density phylogenetic 16S rRNA gene microarray (PhyloChip) technologies. The culture-dependent analyses predominantly showed the presence of clostridial and propionibacterial strains. The 16S rRNA gene sequences retrieved from clone libraries revealed distinct microbial populations associated with each clean-room facility, clustered exclusively within gram-positive organisms. PhyloChip analysis detected a greater microbial diversity, spanning many phyla of bacteria, and provided a deeper insight into the microbial community structure of the clean-room facilities. This study presents an integrated approach for assessing the anaerobic microbial population within clean-room facilities, using both molecular and cultivation-based analyses. The results reveal that highly diverse anaerobic bacterial populations persist in the clean rooms even after the imposition of rigorous maintenance programs and will pose a challenge to planetary protection implementation activities. PMID:20228115
Analysis of Chromobacterium sp. natural isolates from different Brazilian ecosystems
Lima-Bittencourt, Cláudia I; Astolfi-Filho, Spartaco; Chartone-Souza, Edmar; Santos, Fabrício R; Nascimento, Andréa MA
2007-01-01
Background Chromobacterium violaceum is a free-living bacterium able to survive under diverse environmental conditions. In this study we evaluate the genetic and physiological diversity of Chromobacterium sp. isolates from three Brazilian ecosystems: Brazilian Savannah (Cerrado), Atlantic Rain Forest and Amazon Rain Forest. We have analyzed the diversity with molecular approaches (16S rRNA gene sequences and amplified ribosomal DNA restriction analysis) and phenotypic surveys of antibiotic resistance and biochemistry profiles. Results In general, the clusters based on physiological profiles included isolates from two or more geographical locations indicating that they are not restricted to a single ecosystem. The isolates from Brazilian Savannah presented greater physiologic diversity and their biochemical profile was the most variable of all groupings. The isolates recovered from Amazon and Atlantic Rain Forests presented the most similar biochemical characteristics to the Chromobacterium violaceum ATCC 12472 strain. Clusters based on biochemical profiles were congruent with clusters obtained by the 16S rRNA gene tree. According to the phylogenetic analyses, isolates from the Amazon Rain Forest and Savannah displayed a closer relationship to the Chromobacterium violaceum ATCC 12472. Furthermore, 16S rRNA gene tree revealed a good correlation between phylogenetic clustering and geographic origin. Conclusion The physiological analyses clearly demonstrate the high biochemical versatility found in the C. violaceum genome and molecular methods allowed to detect the intra and inter-population diversity of isolates from three Brazilian ecosystems. PMID:17584942
Spieck, Eva; Keuter, Sabine; Wenzel, Thilo; Bock, Eberhard; Ludwig, Wolfgang
2014-05-01
Nitrite oxidizing bacteria are an integral part of the nitrogen cycle in marine waters, but the knowledge about their diversity is limited. Recently, a high abundance of Nitrospina-like 16S rRNA gene sequences has been detected in oceanic habitats with low oxygen content by molecular methods. Here, we describe a new strain of Nitrospina, which was sampled in 100m depth from the Black Sea. It coexisted with a not-yet cultivated chemoorganotrophic gammaproteobacterium and could be purified by classical isolation methods including Percoll density gradient centrifugation. The new Nitrospina-like bacterium grew lithoautotrophically at 28°C in diluted seawater supplemented with inorganic salts and nitrite. Gram-negative rods were characterized morphologically, physiologically and partly biochemically. The 16S rRNA gene of the new strain of Nitrospina is 97.9% similar to the described species N. gracilis and DNA/DNA hybridization experiments revealed a relatedness of 30.0%. The data from both Nitrospina species and environmental clones were used for an extensive 16S rRNA based phylogenetic study applying high quality filtering. Treeing analyses confirm the newly defined phylum status for "Nitrospinae" [18]. The results of phylogenetic and genotypic analyses support the proposal of a novel species Nitrospina watsonii sp. nov. (type strain 347(T), LMG 27401(T), NCIMB 14887(T)). Copyright © 2014 Elsevier GmbH. All rights reserved.
Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.
Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R
2013-01-01
The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.
Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.
2000-01-01
Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993
Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.
2009-01-01
The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351
Tremblay, Julien
2018-01-22
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien
2012-06-01
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
Bioconductor Workflow for Microbiome Data Analysis: from raw reads to community analyses
Callahan, Ben J.; Sankaran, Kris; Fukuyama, Julia A.; McMurdie, Paul J.; Holmes, Susan P.
2016-01-01
High-throughput sequencing of PCR-amplified taxonomic markers (like the 16S rRNA gene) has enabled a new level of analysis of complex bacterial communities known as microbiomes. Many tools exist to quantify and compare abundance levels or OTU composition of communities in different conditions. The sequencing reads have to be denoised and assigned to the closest taxa from a reference database. Common approaches use a notion of 97% similarity and normalize the data by subsampling to equalize library sizes. In this paper, we show that statistical models allow more accurate abundance estimates. By providing a complete workflow in R, we enable the user to do sophisticated downstream statistical analyses, whether parametric or nonparametric. We provide examples of using the R packages dada2, phyloseq, DESeq2, ggplot2 and vegan to filter, visualize and test microbiome data. We also provide examples of supervised analyses using random forests and nonparametric testing using community networks and the ggnetwork package. PMID:27508062
The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).
Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai
2016-01-01
In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.
Campylobacter canadensis sp. nov., from captive whooping cranes in Canada.
Inglis, G Douglas; Hoar, Bryanne M; Whiteside, Douglas P; Morck, Douglas W
2007-11-01
Ten isolates of an unknown Campylobacter species were isolated from cloacal swabs obtained from captive adult whooping cranes (Grus americana). All isolates were identified as Campylobacter based on generic PCR and grouped with other Campylobacter species based on 23S rRNA gene sequence. None of the isolates could be identified by species-specific PCR for known taxa, and all ten isolates formed a robust clade that was very distinct from known Campylobacter species based on 16S rRNA, rpoB and cpn60 gene sequences. The results of 16S rRNA gene nucleotide sequence (
NASA Astrophysics Data System (ADS)
Foster, I. S.; Demirel, C.; Hyde, A.; Motamedi, S.; Frantz, C. M.; Stamps, B. W.; Nunn, H. S.; Oremland, R. S.; Rosen, M.; Miller, L. G.; Corsetti, F. A.; Spear, J. R.
2016-12-01
Paoha Island formed 450 years ago within Mono Lake, California, as a result of magmatic activity in the underlying Long Valley Caldera. Previous studies of Paoha Island hot springs focused on the presence of novel organisms adapted to high levels of arsenic (114-138 µM). However, the microbial community structure, relationship with Mono Lake, and preservation potential of these communities remains largely unexplored. Here, we present water chemistry, 16S and 18S rRNA gene sequences, and metagenomic data for spring water and biofilms sampled on a recently exposed mudflat along the shoreline of Paoha Island. Spring waters were hypoxic, alkaline, and saline, had variable temperature (39-70 °C near spring sources) and high concentrations of arsenic, sulfide and reduced organic compounds. Thermodynamic modeling based on spring water chemistry indicated that sulfide and methane oxidation were the most energetically favorable respiratory metabolisms. 16S rRNA gene sequencing revealed distinct communities in different biofilms: red biofilms were dominated by arsenite-oxidizing phototrophs within the Ectothiorhodospiraceae, while OTUs most closely related to the cyanobacterial genus Arthrospira were present in green biofilms, as well as a large proportion of sequences assigned to sulfur-oxidizing bacteria. Metagenomic analysis identified genes related to arsenic resistance, arsenic oxidation/reduction, sulfur oxidation and photosynthesis. Eukaryotic rRNA gene sequencing analyses revealed few detectable taxa in spring biofilms and waters compared to Mono Lake; springs receiving splash from the lake were dominated by the alga Picocystis. The co-occurrence of hypoxia, high pH, and close proximity of anoxygenic and oxygenic phototrophic mats makes this site a potential Archean/Proterozoic analogue environment, but suggests that similar environments if preserved in the rock record, may not preserve evidence for community dynamics or the existence of photosynthetic metabolisms.
Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.
2000-01-01
Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239
Uncommonly isolated clinical Pseudomonas: identification and phylogenetic assignation.
Mulet, M; Gomila, M; Ramírez, A; Cardew, S; Moore, E R B; Lalucat, J; García-Valdés, E
2017-02-01
Fifty-two Pseudomonas strains that were difficult to identify at the species level in the phenotypic routine characterizations employed by clinical microbiology laboratories were selected for genotypic-based analysis. Species level identifications were done initially by partial sequencing of the DNA dependent RNA polymerase sub-unit D gene (rpoD). Two other gene sequences, for the small sub-unit ribosonal RNA (16S rRNA) and for DNA gyrase sub-unit B (gyrB) were added in a multilocus sequence analysis (MLSA) study to confirm the species identifications. These sequences were analyzed with a collection of reference sequences from the type strains of 161 Pseudomonas species within an in-house multi-locus sequence analysis database. Whole-cell matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analyses of these strains complemented the DNA sequenced-based phylogenetic analyses and were observed to be in accordance with the results of the sequence data. Twenty-three out of 52 strains were assigned to 12 recognized species not commonly detected in clinical specimens and 29 (56 %) were considered representatives of at least ten putative new species. Most strains were distributed within the P. fluorescens and P. aeruginosa lineages. The value of rpoD sequences in species-level identifications for Pseudomonas is emphasized. The correct species identifications of clinical strains is essential for establishing the intrinsic antibiotic resistance patterns and improved treatment plans.
Vacek, A T; Bourque, D P
1980-09-01
Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.
Witek, Marta A; Conn, Graeme L
2014-09-01
The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
Kamina, Anyango D.; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains’ interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP. PMID:28542332
Rudi, Knut; Zimonja, Monika; Kvenshagen, Bente; Rugtveit, Jarle; Midtvedt, Tore; Eggesbø, Merete
2007-01-01
We present a novel approach for comparing 16S rRNA gene clone libraries that is independent of both DNA sequence alignment and definition of bacterial phylogroups. These steps are the major bottlenecks in current microbial comparative analyses. We used direct comparisons of taxon density distributions in an absolute evolutionary coordinate space. The coordinate space was generated by using alignment-independent bilinear multivariate modeling. Statistical analyses for clone library comparisons were based on multivariate analysis of variance, partial least-squares regression, and permutations. Clone libraries from both adult and infant gastrointestinal tract microbial communities were used as biological models. We reanalyzed a library consisting of 11,831 clones covering complete colons from three healthy adults in addition to a smaller 390-clone library from infant feces. We show that it is possible to extract detailed information about microbial community structures using our alignment-independent method. Our density distribution analysis is also very efficient with respect to computer operation time, meeting the future requirements of large-scale screenings to understand the diversity and dynamics of microbial communities. PMID:17337554
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
2016-05-03
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Multigenetic characterization of 'Candidatus Xenohaliotis californiensis'.
Cicala, Francesco; Moore, James D; Cáceres-Martínez, Jorge; Del Río-Portilla, Miguel A; Hernández-Rodríguez, Mónica; Vásquez-Yeomans, Rebeca; Rocha-Olivares, Axayácatl
2017-01-01
'Candidatus Xenohaliotis californiensis' (or Ca.Xc) is the aetiological agent of withering syndrome, a chronic wasting disease affecting most if not all North American species of abalone, and has been described as a Rickettsiales-like prokaryote. Genetic data regarding this species are limited to the 16S rRNA gene. The inability to grow it axenically has hindered its genetic and genomic characterization and, in consequence, a thorough analysis of its systematics. Here, we amplified and sequenced five genes (16S rRNA, 23S rRNA, ftsZ, virD4 and virB11) of Ca.Xc from infected abalone to analyse its phylogenetic position. Phylogenies from concatenated DNA and amino acid sequences with representative genera of most Rickettsiales unequivocally place Ca.Xc in the family Anaplasmataceae. Furthermore, the family has two reciprocally monophyletic lineages: one leading to (Neorickettsia, Ca.Xc) and the other to ((Ehrlichia, Anaplasma), Wolbachia)). A molecular-clock Bayesian reconstruction places Ca.Xc as the most basal lineage in Anaplasmataceae. These phylogenetic hypotheses shed light on patterns of host evolution and of ecological transitions. Specifically, Neorickettsia and Ca.Xc inhabit aquatic hosts whereas the remaining Anaplasmataceae are found in terrestrial hosts. Additionally, our evolutionary timeline places the directly transmitted marine Ca.Xc as the basal Anaplasmataceae, ancestral to both freshwater and terrestrial species with adaptations leading to more complex life cycles involving intermediate vectors or reservoir species; this supports the hypothesis of a marine origin for this bacterial family.
probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016
Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas
2016-01-01
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809
Integrative analysis of environmental sequences using MEGAN4.
Huson, Daniel H; Mitra, Suparna; Ruscheweyh, Hans-Joachim; Weber, Nico; Schuster, Stephan C
2011-09-01
A major challenge in the analysis of environmental sequences is data integration. The question is how to analyze different types of data in a unified approach, addressing both the taxonomic and functional aspects. To facilitate such analyses, we have substantially extended MEGAN, a widely used taxonomic analysis program. The new program, MEGAN4, provides an integrated approach to the taxonomic and functional analysis of metagenomic, metatranscriptomic, metaproteomic, and rRNA data. While taxonomic analysis is performed based on the NCBI taxonomy, functional analysis is performed using the SEED classification of subsystems and functional roles or the KEGG classification of pathways and enzymes. A number of examples illustrate how such analyses can be performed, and show that one can also import and compare classification results obtained using others' tools. MEGAN4 is freely available for academic purposes, and installers for all three major operating systems can be downloaded from www-ab.informatik.uni-tuebingen.de/software/megan.
Characterization of isolates of meloidogyne from rice-wheat production fields in Nepal.
Pokharel, Ramesh R; Abawi, George S; Zhang, Ning; Duxbury, John M; Smart, Christine D
2007-09-01
Thirty-three isolates of root-knot nematode were recovered from soil samples from rice-wheat fields in Nepal and maintained on rice cv. BR 11. The isolates were characterized using morphology, host range and DNA sequence analyses in order to ascertain their identity. Results indicated phenotypic similarity (juvenile measurements, perennial pattern, host range and gall shape) of the Nepalese isolates with Meloidogyne graminicola, with minor variations. The rice varieties LA 110 and Labelle were susceptible to all of the Nepalese isolates, but differences in the aggressiveness of the isolates were observed. Phylogenetic analyses based on the sequences of partial internal transcribed spacer (ITS) of the rRNA genes indicated that all Nepalese isolates formed a distinct clade with known isolates of M. graminicola with high bootstrap support. Furthermore, two groups were identified within the M. graminicola clade. No correlation between ITS haplotype and aggressiveness or host range was found among the tested isolates.
Byrne, Maria; Rowe, Frank; Uthicke, Sven
2010-09-01
The Stichopodidae comprise a diverse assemblage of holothuroids most of which occur in the Indo-Pacific. Phylogenetic analyses of mitochondrial gene (COI, 16S rRNA) sequence for 111 individuals (7 genera, 17 species) clarified taxonomic uncertainties, species relationships, biogeography and evolution of the family. A monophyly of the genus Stichopus was supported with the exception of Stichopus ellipes. Molecular analyses confirmed genus level taxonomy based on morphology. Most specimens harvested as S. horrens fell in the S. monotuberculatus clade, a morphologically variable assemblage with others from the S. naso clade. Taxonomic clarification of species fished as S. horrens will assist conservation measures. Evolutionary rates based on comparison of sequence from trans-ithmian Isostichopus species estimated that Stichopus and Isostichopus diverged ca. 5.5-10.7Ma (Miocene). More recent splits were estimated to be younger than 1Ma. Copyright 2010 Elsevier Inc. All rights reserved.
Lewis, Dawn E; Chauhan, Ashvini; White, John R; Overholt, Will; Green, Stefan J; Jasrotia, Puja; Wafula, Denis; Jagoe, Charles
2012-10-01
Microorganisms are very sensitive to environmental change and can be used to gauge anthropogenic impacts and even predict restoration success of degraded environments. Here, we report assessment of bauxite mining activities on soil biogeochemistry and microbial community structure using un-mined and three post-mined sites in Jamaica. The post-mined soils represent a chronosequence, undergoing restoration since 1987, 1997, and 2007. Soils were collected during dry and wet seasons and analyzed for pH, organic matter (OM), total carbon (TC), nitrogen (TN), and phosphorus. The microbial community structure was assessed through quantitative PCR and massively parallel bacterial ribosomal RNA (rRNA) gene sequencing. Edaphic factors and microbial community composition were analyzed using multivariate statistical approaches and revealed a significant, negative impact of mining on soil that persisted even after greater than 20 years of restoration. Seasonal fluctuations contributed to variation in measured soil properties and community composition, but they were minor in comparison to long-term effects of mining. In both seasons, post-mined soils were higher in pH but OM, TC, and TN decreased. Bacterial rRNA gene analyses demonstrated a general decrease in diversity in post-mined soils and up to a 3-log decrease in rRNA gene abundance. Community composition analyses demonstrated that bacteria from the Proteobacteria (α, β, γ, δ), Acidobacteria, and Firmicutes were abundant in all soils. The abundance of Firmicutes was elevated in newer post-mined soils relative to the un-mined soil, and this contrasted a decrease, relative to un-mined soils, in proteobacterial and acidobacterial rRNA gene abundances. Our study indicates long-lasting impacts of mining activities to soil biogeochemical and microbial properties with impending loss in soil productivity.
Goggin, C L; Barker, S C
1993-07-01
Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.
Loh, Siew-May; Gillett, Amber; Ryan, Una; Irwin, Peter; Oskam, Charlotte
2017-04-01
Recently, a novel species of the genus Borreliawas identified in Bothriocroton concolor and Ixodes holocyclus ticks from echidnas. Analyses of 16S rRNA and flaB genes identified three closely related genotypes of this bacterium (Borrelia sp. Aus A-C) that were unique and distinct from previously described borreliae. Phylogenetic analyses of flaB (763 bp), groEL (1537 bp), gyrB (1702 bp) and glpQ (874 bp) gene sequences and concatenated sequences (3585 bp) of three gene loci (16S rRNA, flaB and gyrB) were consistent with previous findings and confirm that this novel species of the genus Borrelia is more closely related to, yet distinct from, the Reptile-associated (REP) and Relapsing Fever (RF) groups. At the flaB locus, genotypes A, B and C shared the highest percentage sequence similarities (87.9, 88 and 87.9 %, respectively) with B.orrelia turcica (REP), whereas at the groEL and gyrB loci, these genotypes were most similar (88.2-89.4 %) to B.orrelia hermsii (RF). At the glpQ locus, genotypes A and B were most similar (85.7 and 85.4 % respectively) to Borrelia sp. Tortoise14H1 (REP). The presence of the glpQ gene, which is absent in the Lyme Borreliosis group spirochaetes, further emphasises that the novel species of the genus Borrelia characterized in the present study does not belong to this group. Phylogenetic analyses at multiple loci produced consistent topographies revealing the monophyletic grouping of this bacterium, therefore providing strong support for its species status. We propose the name 'CandidatusBorrelia tachyglossi', and hypothesize that this species of the genus Borrelia may be endemic to Australia. The pathogenic potential of this bacterium is not yet known.
Loh, Siew-May; Gillett, Amber; Ryan, Una; Irwin, Peter
2017-01-01
Recently, a novel species of the genus Borreliawas identified in Bothriocroton concolor and Ixodes holocyclus ticks from echidnas. Analyses of 16S rRNA and flaB genes identified three closely related genotypes of this bacterium (Borrelia sp. Aus A-C) that were unique and distinct from previously described borreliae. Phylogenetic analyses of flaB (763 bp), groEL (1537 bp), gyrB (1702 bp) and glpQ (874 bp) gene sequences and concatenated sequences (3585 bp) of three gene loci (16S rRNA, flaB and gyrB) were consistent with previous findings and confirm that this novel species of the genus Borrelia is more closely related to, yet distinct from, the Reptile-associated (REP) and Relapsing Fever (RF) groups. At the flaB locus, genotypes A, B and C shared the highest percentage sequence similarities (87.9, 88 and 87.9 %, respectively) with B.orrelia turcica (REP), whereas at the groEL and gyrB loci, these genotypes were most similar (88.2–89.4 %) to B.orrelia hermsii (RF). At the glpQ locus, genotypes A and B were most similar (85.7 and 85.4 % respectively) to Borrelia sp. Tortoise14H1 (REP). The presence of the glpQ gene, which is absent in the Lyme Borreliosis group spirochaetes, further emphasises that the novel species of the genus Borrelia characterized in the present study does not belong to this group. Phylogenetic analyses at multiple loci produced consistent topographies revealing the monophyletic grouping of this bacterium, therefore providing strong support for its species status. We propose the name ‘Candidatus Borrelia tachyglossi’, and hypothesize that this species of the genus Borrelia may be endemic to Australia. The pathogenic potential of this bacterium is not yet known. PMID:28475032
Jin, Wanchun; Wachino, Jun-Ichi; Kimura, Kouji; Yamada, Keiko; Arakawa, Yoshichika
2015-05-01
Enterobacteriaceae clinical isolates showing amikacin resistance (MIC 64 to >256 mg/L) in the absence of 16S rRNA methyltransferase (MTase) genes were found. The aim of this study was to clarify the molecular mechanisms underlying amikacin resistance in Enterobacteriaceae clinical isolates that do not produce 16S rRNA MTases. PCR was performed to detect already-known amikacin resistance determinants. Cloning experiments and sequence analyses were performed to characterize unknown amikacin resistance determinants. Transfer of amikacin resistance determinants was performed by conjugation and transformation. The complete nucleotide sequence of the plasmids was determined by next-generation sequencing technology. Amikacin resistance enzymes were purified with a column chromatography system. The enzymatic function of the purified protein was investigated by thin-layer chromatography (TLC) and HPLC. Among the 14 isolates, 9 were found to carry already-known amikacin resistance determinants such as aac(6')-Ia and aac(6')-Ib. Genetic analyses revealed the presence of a new amikacin acetyltransferase gene, named aac(6')-Ian, located on a 169 829 bp transferable plasmid (p11663) of the Serratia marcescens strain NUBL-11663, one of the five strains negative for known aac(6') genes by PCR. Plasmid p11663 also carried a novel ESBL gene, named blaTLA-3. HPLC and TLC analyses demonstrated that AAC(6')-Ian catalysed the transfer of an acetyl group from acetyl coenzyme A onto an amine at the 6'-position of various aminoglycosides. We identified aac(6')-Ian as a novel amikacin resistance determinant together with a new ESBL gene, blaTLA-3, on a transferable plasmid of a S. marcescens clinical isolate. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hoshino, Tatsuhiko; Inagaki, Fumio
2017-01-01
Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-12-31
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-01-01
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215
Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.
He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong
2012-06-01
The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.
2011-01-01
Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978
The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...
Flynn, A N; Lyndon, C A; Church, D L
2013-08-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.
Kim, Minseok; Morrison, Mark; Yu, Zhongtang
2011-09-01
Phylogenetic analysis was conducted to examine ruminal bacteria in two ruminal fractions (adherent fraction vs. liquid fraction) collected from cattle fed with two different diets: forage alone vs. forage plus concentrate. One hundred forty-four 16S rRNA gene (rrs) sequences were obtained from clone libraries constructed from the four samples. These rrs sequences were assigned to 116 different operational taxonomic units (OTUs) defined at 0.03 phylogenetic distance. Most of these OTUs could not be assigned to any known genus. The phylum Firmicutes was represented by approximately 70% of all the sequences. By comparing to the OTUs already documented in the rumen, 52 new OTUs were identified. UniFrac, SONS, and denaturing gradient gel electrophoresis analyses revealed difference in diversity between the two fractions and between the two diets. This study showed that rrs sequences recovered from small clone libraries can still help identify novel species-level OTUs.
Bifidobacterium aquikefiri sp. nov., isolated from water kefir.
Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter
2016-03-01
A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.
Genetic Diversity Among Botulinum Neurotoxin Producing Clostridial Strains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hill, K K; Smith, T J; Helma, C H
2006-07-06
Clostridium botulinum is a taxonomic designation for many diverse anaerobic spore forming rod-shaped bacteria which have the common property of producing botulinum neurotoxins (BoNTs). The BoNTs are exoneurotoxins that can cause severe paralysis and even death in humans and various other animal species. A collection of 174 C. botulinum strains were examined by amplified fragment length polymorphism (AFLP) analysis and by sequencing of the 16S rRNA gene and BoNT genes to examine genetic diversity within this species. This collection contained representatives of each of the seven different serotypes of botulinum neurotoxins (BoNT A-G). Analysis of the16S rRNA sequences confirmed earliermore » reports of at least four distinct genomic backgrounds (Groups I-IV) each of which has independently acquired one or more BoNT serotypes through horizontal gene transfer. AFLP analysis provided higher resolution, and can be used to further subdivide the four groups into sub-groups. Sequencing of the BoNT genes from serotypes A, B and E in multiple strains confirmed significant sequence variation within each serotype. Four distinct lineages within each of the BoNT A and B serotypes, and five distinct lineages of serotype E strains were identified. The nucleotide sequences of the seven serotypes of BoNT were compared and show varying degrees of interrelatedness and recombination as has been previously noted for the NTNH gene which is linked to BoNT. These analyses contribute to the understanding of the evolution and phylogeny within this species and assist in the development of improved diagnostics and therapeutics for treatment of botulism.« less
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.
Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji
2017-02-28
High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Rideout, Jai Ram; He, Yan; Navas-Molina, Jose A; Walters, William A; Ursell, Luke K; Gibbons, Sean M; Chase, John; McDonald, Daniel; Gonzalez, Antonio; Robbins-Pianka, Adam; Clemente, Jose C; Gilbert, Jack A; Huse, Susan M; Zhou, Hong-Wei; Knight, Rob; Caporaso, J Gregory
2014-01-01
We present a performance-optimized algorithm, subsampled open-reference OTU picking, for assigning marker gene (e.g., 16S rRNA) sequences generated on next-generation sequencing platforms to operational taxonomic units (OTUs) for microbial community analysis. This algorithm provides benefits over de novo OTU picking (clustering can be performed largely in parallel, reducing runtime) and closed-reference OTU picking (all reads are clustered, not only those that match a reference database sequence with high similarity). Because more of our algorithm can be run in parallel relative to "classic" open-reference OTU picking, it makes open-reference OTU picking tractable on massive amplicon sequence data sets (though on smaller data sets, "classic" open-reference OTU clustering is often faster). We illustrate that here by applying it to the first 15,000 samples sequenced for the Earth Microbiome Project (1.3 billion V4 16S rRNA amplicons). To the best of our knowledge, this is the largest OTU picking run ever performed, and we estimate that our new algorithm runs in less than 1/5 the time than would be required of "classic" open reference OTU picking. We show that subsampled open-reference OTU picking yields results that are highly correlated with those generated by "classic" open-reference OTU picking through comparisons on three well-studied datasets. An implementation of this algorithm is provided in the popular QIIME software package, which uses uclust for read clustering. All analyses were performed using QIIME's uclust wrappers, though we provide details (aided by the open-source code in our GitHub repository) that will allow implementation of subsampled open-reference OTU picking independently of QIIME (e.g., in a compiled programming language, where runtimes should be further reduced). Our analyses should generalize to other implementations of these OTU picking algorithms. Finally, we present a comparison of parameter settings in QIIME's OTU picking workflows and make recommendations on settings for these free parameters to optimize runtime without reducing the quality of the results. These optimized parameters can vastly decrease the runtime of uclust-based OTU picking in QIIME.
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions
Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake
2015-01-01
Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756
[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].
Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu
2002-12-01
Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.
Harrison, Nigel A; Davis, Robert E; Oropeza, Carlos; Helmick, Ericka E; Narváez, María; Eden-Green, Simon; Dollet, Michel; Dickinson, Matthew
2014-06-01
In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100% identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0-99.6% identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d'Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5% sequence identity with all previously described members of 'Candidatus Phytoplasma'. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of 'Candidatus Phytoplasma', justifying its recognition as the reference strain of a novel taxon, 'Candidatus Phytoplasma palmicola'. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d'Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael
2013-01-01
Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968
Pitt, Alexandra; Schmidt, Johanna; Lang, Elke; Whitman, William B; Woyke, Tanja; Hahn, Martin W
2018-06-01
Strain AP-Melu-1000-B4 was isolated from a lake located in the mountains of the Mediterranean island of Corsica (France). Phenotypic, chemotaxonomic and genomic traits were investigated. Phylogenetic analyses based on 16S rRNA gene sequencing referred the strain to the cryptic species complex PnecC within the genus Polynucleobacter. The strain encoded genes for biosynthesis of proteorhodopsin and retinal. When pelleted by centrifugation the strain showed an intense rose colouring. Major fatty acids were C16 : 1ω7c, C16 : 0, C18 : 1ω7c and summed feature 2 (C16 : 1 isoI and C14 : 0-3OH). The sequence of the 16S rRNA gene contained an indel which was not present in any previously described Polynucleobacter species. Genome sequencing revealed a genome size of 1.89 Mbp and a G+C content of 46.6 mol%. In order to resolve the phylogenetic position of the new strain within subcluster PnecC, its phylogeny was reconstructed from sequences of 319 shared genes. To represent all currently described Polynucleobacter species by whole genome sequences, three type strains were additionally sequenced. Our phylogenetic analysis revealed that strain AP-Melu-100-B4 occupied a basal position compared with previously described PnecC strains. Pairwise determined whole genome average nucleotide identity (gANI) values suggested that strain AP-Melu-1000-B4 represents a new species, for which we propose the name Polynucleobacter meluiroseus sp. nov. with the type strain AP-Melu-1000-B4 T (=DSM 103591 T =CIP 111329 T ).
Wei, Yulong; Silke, Jordan R; Xia, Xuhua
2017-12-15
Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.
Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F
2015-03-01
Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.
Busarakam, Kanungnid; Brown, Ros; Bull, Alan T; Tan, Geok Yuan Annie; Zucchi, Tiago D; da Silva, Leonardo José; de Souza, Wallace Rafael; Goodfellow, Michael
2016-02-01
The taxonomic position of 26 filamentous actinobacteria isolated from a hyper-arid Atacama Desert soil and 2 from an arid Australian composite soil was established using a polyphasic approach. All of the isolates gave the diagnostic amplification product using 16S rRNA oligonucleotide primers specific for the genus Amycolatopsis. Representative isolates had chemotaxonomic and morphological properties typical of members of the genus Amycolatopsis. 16S rRNA gene analyses showed that all of the isolates belong to the Amycolatopsis methanolica 16S rRNA gene clade. The Atacama Desert isolates were assigned to one or other of two recognised species, namely Amycolatopsis ruanii and Amycolatopsis thermalba, based on 16S rRNA gene sequence, DNA:DNA relatedness and phenotypic data; emended descriptions are given for these species. In contrast, the two strains from the arid Australian composite soil, isolates GY024(T) and GY142, formed a distinct branch at the periphery of the A. methanolica 16S rRNA phyletic line, a taxon that was supported by all of the tree-making algorithms and by a 100 % bootstrap value. These strains shared a high degree of DNA:DNA relatedness and have many phenotypic properties in common, some of which distinguished them from all of the constituent species classified in the A. methanolica 16S rRNA clade. Isolates GY024(T) and GY142 merit recognition as a new species within the A. methanolica group of thermophilic strains. The name proposed for the new species is Amycolatopsis deserti sp. nov.; the type strain is GY024(T) (=NCIMB 14972(T) = NRRL B-65266(T)).
PCR detection of uncultured rumen bacteria.
Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan
2012-07-01
16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.
Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing
NASA Astrophysics Data System (ADS)
Chen, K.
2017-01-01
With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).
Anaplasma phagocytophilum in sheep and goats in central and southeastern China.
Yang, Jifei; Liu, Zhijie; Niu, Qingli; Liu, Junlong; Han, Rong; Guan, Guiquan; Li, Youquan; Liu, Guangyuan; Luo, Jianxun; Yin, Hong
2016-11-21
Anaplasma phagocytophilum is wide spread throughout the world and impacts both human and animal health. Several distinct ecological clusters and ecotypes of the agent have been established on the basis of various genetic loci. However, information on the genetic variability of A. phagocytophilum isolates in China represents a gap in knowledge. The objective of this study was to determine the prevalence and genetic characterization of A. phagocytophilum in small ruminants in central and southeastern China. The presence of A. phagocytophilum was determined in 421 blood samples collected from small ruminants by PCR. Positive samples were genetically characterized based on 16S rRNA and groEL genes. Statistical analyses were conducted to identify ecotypes of A. phagocytophilum strains, to assess their host range and zoonotic potential. Out of 421 sampled small ruminants, 106 (25.2%) were positive for A. phagocytophilum. The positive rate was higher in sheep (35.1%, 40/114) than in goats (26.4%, 66/307) (P < 0.05). Sequence analyses revealed that the isolates identified in this study were placed on two separate clades, indicating that two 16S rRNA variants of A. phagocytophilum were circulating in small ruminants in China. However, analysis using obtained groEL sequences in this study formed one cluster, which was separate from other known ecotypes reported in Europe. In addition, a novel Anaplasma sp. was identified and closely related to an isolate previously reported in Hyalomma asiaticum, which clustered independently from all recognized Anaplasma species. A molecular survey of A. phagocytophilum was conducted in sheep and goats from ten provinces in central and southeastern China. Two 16S rRNA variants and a new ecotype of A. phagocytophilum were identified in small ruminants in China. Moreover, a potential novel Anaplasma species was reported in goats. Our findings provide additional information on the complexity of A. phagocytophilum in terms of genetic diversity in China.
Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J
2008-06-01
We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.
Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J
2018-05-29
Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.
Gu, Quan; Li, Xunde; Qu, Pinghua; Hou, Shuiping; Li, Juntao; Atwill, Edward R; Chen, Shouyi
2015-01-01
Strains of Francisella spp. were isolated from cooling water from an air conditioning system in Guangzhou, China. These strains are Gram negative, coccobacilli, non-motile, oxidase negative, catalase negative, esterase and lipid esterase positive. In addition, these bacteria grow on cysteine-supplemented media at 20 °C to 40 °C with an optimal growth temperature of 30 °C. Analysis of 16S rRNA gene sequences revealed that these strains belong to the genus Francisella. Biochemical tests and phylogenetic and BLAST analyses of 16S rRNA, rpoB and sdhA genes indicated that one strain was very similar to Francisella philomiragia and that the other strains were identical or highly similar to the Francisella guangzhouensis sp. nov. strain 08HL01032 we previously described. Biochemical and molecular characteristics of these strains demonstrated that multiple Francisella species exist in air conditioning systems.
Ko, Kwan Soo; Lee, Nam Yong; Oh, Won Sup; Lee, Jang Ho; Ki, Hyun Kyun; Peck, Kyong Ran; Song, Jae-Hoon
2005-01-01
A Gram-negative bacillus, SMC-6271(T), which was isolated from the bone marrow of a patient with leukemia but could not be identified by a conventional microbiologic method, was characterized by a genotypic analysis of 16S rRNA gene. Sequences of the 16S rRNA gene revealed that this bacterium was closely related to Tepidimonas ignava and other slightly thermophilic isolates but diverged distinctly from them. Analyses of cellular fatty acid composition and performance of biochemical tests confirmed that this bacterium is a distinct species from the other Tepidimonas species. Based on the evaluated phenotypic and genotypic characteristics, it is proposed that SMC-6271T (=ABB 0301T =KCTC 12412T =JCM 13232T) should be classified as a new species, namely Tepidimonas arfidensis sp. nov.
Catheter-associated bacteremia by Mycobacterium senegalense in Korea
Oh, Won Sup; Ko, Kwan Soo; Song, Jae-Hoon; Lee, Mi Young; Ryu, Seong Yeol; Heo, Sangtaek; Kwon, Ki Tae; Lee, Jang-Ho; Peck, Kyong Ran; Lee, Nam Yong
2005-01-01
Background Rapidly growing mycobacteria is recognized as one of the causative agents of catheter-related infections, especially in immunocompromised hosts. To date, however, Mycobacterium senegalense, which was known as the principal pathogen of bovine farcy, has not been reported in human infection. Case presentation We describe the first case of human infection by M. senegalense, which has caused catheter-related bloodstream infection in a cancer patient in Korea. The microorganism was identified by the 16S rRNA gene, rpoB, and 16S-23S rRNA gene internal transcribed spacer (ITS) sequence analyses. Conclusion Our first report of catheter-associated bacteremia caused by M. senegalense suggests the zoonotic nature of this species and indicates the expansion of mycobacterial species relating to human infection. M. senegalense should be considered as one of the causes of human infections in the clinical practice. PMID:16307688
Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.
Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi
2015-01-01
Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.
Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R
2010-06-01
The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.
NASA Astrophysics Data System (ADS)
Ferreira, M.; Creveling, J.; Hilburn, I.; Karlsson, E.; Pepe-Ranney, C.; Spear, J.; Dawson, S.; Geobio2008, I.
2008-12-01
Silicified structures that exhibit a putative biologic component in their formation permeate the rock record as stromatolites. We have studied a silicified microbial structure from a hot spring in Yellowstone National Park using phenotypic, phylogenetic, and metagenomic analyses to determine microbial carbon metabolic pathways and the phylogenetic affiliations of microbes present in this unique structure. In this multi-faceted approach, dominant physiologies, specifically with regards to anaerobic and aerobic metabolisms, were inferred from 16S rRNA gene sequences and 454 sequencing data from bulk DNA samples of the structure. Carbon utilization as indicated by ECO Biolog plates showed abundant heterotrophy and heterotrophic diversity throughout the microbial structure. Microbes within the structure are able to utilize all tested sources of carbohydrates, lipids/fatty acids, and protein/amino acids as carbon sources. ECO plate testing of the hot spring water yielded considerable less carbohydrate consumption (only 4 out of 13 tested carbohydrates) and similar lipids/fatty acids and protein/amino acids consumption (2 out of 3 and 5 out of 5 tested sources respectively). Full length 16S rRNA gene sequences and metagenomic 454 pyrosequencing of community DNA showed limited diversity among primary producers. From the 16S data, the majority of the autotrophs are inferred to utilize the Calvin cycle for CO2 fixation, followed by 3-hydroxypropionate/4- hydroxybutyrate CO2 fixation. However, an analysis of the metagenomic data compared to the KEGG database does not show genes directly involved with Calvin cycle carbon fixation. Further BLAST searches of our data failed to find significant matches within our 6514 metagenomic sequences to known RuBisCo sequences taken from the NCBI database. This is likely due to a far under-sampled dataset of metagenomic sequences, and the low number (958) that had matches to the KEGG pathways database. Anaerobic versus aerobic physiology also can be estimated from the 16S clone libraries. Phylogenetic analysis of recovered 16S sequences suggests that 15% of the 16S sequences can be attributed to anaerobic microbes while 42% likely come from aerobes. The remaining 43% of 16S rRNA gene sequences belong to metabolically unassigned phyla both known and novel. This preliminary study demonstrates that the small spatially stratified silicified microbial structure present on the margins of a hot spring contains a rich and complex microbial community with different trophic levels and enzymatic pathways.
[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].
Petrov, N B; Vladychenskaia, N S
2005-01-01
Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.
The rRNA evolution and procaryotic phylogeny
NASA Technical Reports Server (NTRS)
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
Flynn, A. N.; Lyndon, C. A.
2013-01-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2005-01-01
Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586
Panosyan, Hovik; Birkeland, Nils-Kåre
2014-11-01
The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F
2015-07-23
The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.
Giorgini, M; Bernardo, U; Monti, M M; Nappo, A G; Gebiola, M
2010-04-01
Bacteria in the genus Rickettsia are intracellular symbionts of disparate groups of organisms. Some Rickettsia strains infect vertebrate animals and plants, where they cause diseases, but most strains are vertically inherited symbionts of invertebrates. In insects Rickettsia symbionts are known to have diverse effects on hosts ranging from influencing host fitness to manipulating reproduction. Here we provide evidence that a Rickettsia symbiont causes thelytokous parthenogenesis (in which mothers produce only daughters from unfertilized eggs) in a parasitoid wasp, Pnigalio soemius (Hymenoptera: Eulophidae). Feeding antibiotics to thelytokous female wasps resulted in production of progeny that were almost all males. Cloning and sequencing of a fragment of the 16S rRNA gene amplified with universal primers, diagnostic PCR screening of symbiont lineages associated with manipulation of reproduction, and fluorescence in situ hybridization (FISH) revealed that Rickettsia is always associated with thelytokous P. soemius and that no other bacteria that manipulate reproduction are present. Molecular analyses and FISH showed that Rickettsia is distributed in the reproductive tissues and is transovarially transmitted from mothers to offspring. Comparison of antibiotic-treated females and untreated females showed that infection had no cost. Phylogenetic analyses of 16S rRNA and gltA gene sequences placed the symbiont of P. soemius in the bellii group and indicated that there have been two separate origins of the parthenogenesis-inducing phenotype in the genus Rickettsia. A possible route for evolution of induction of parthenogenesis in the two distantly related Rickettsia lineages is discussed.
Giorgini, M.; Bernardo, U.; Monti, M. M.; Nappo, A. G.; Gebiola, M.
2010-01-01
Bacteria in the genus Rickettsia are intracellular symbionts of disparate groups of organisms. Some Rickettsia strains infect vertebrate animals and plants, where they cause diseases, but most strains are vertically inherited symbionts of invertebrates. In insects Rickettsia symbionts are known to have diverse effects on hosts ranging from influencing host fitness to manipulating reproduction. Here we provide evidence that a Rickettsia symbiont causes thelytokous parthenogenesis (in which mothers produce only daughters from unfertilized eggs) in a parasitoid wasp, Pnigalio soemius (Hymenoptera: Eulophidae). Feeding antibiotics to thelytokous female wasps resulted in production of progeny that were almost all males. Cloning and sequencing of a fragment of the 16S rRNA gene amplified with universal primers, diagnostic PCR screening of symbiont lineages associated with manipulation of reproduction, and fluorescence in situ hybridization (FISH) revealed that Rickettsia is always associated with thelytokous P. soemius and that no other bacteria that manipulate reproduction are present. Molecular analyses and FISH showed that Rickettsia is distributed in the reproductive tissues and is transovarially transmitted from mothers to offspring. Comparison of antibiotic-treated females and untreated females showed that infection had no cost. Phylogenetic analyses of 16S rRNA and gltA gene sequences placed the symbiont of P. soemius in the bellii group and indicated that there have been two separate origins of the parthenogenesis-inducing phenotype in the genus Rickettsia. A possible route for evolution of induction of parthenogenesis in the two distantly related Rickettsia lineages is discussed. PMID:20173065
Trexler, Ryan; Solomon, Caroline; Brislawn, Colin J.; Wright, Justin R.; Rosenberger, Abigail; McClure, Erin E.; Grube, Alyssa M.; Peterson, Mark P.; Keddache, Mehdi; Mason, Olivia U.; Hazen, Terry C.; Grant, Christopher J.; Lamendella, Regina
2014-01-01
Hydraulic fracturing and horizontal drilling have increased dramatically in Pennsylvania Marcellus shale formations, however the potential for major environmental impacts are still incompletely understood. High-throughput sequencing of the 16S rRNA gene was performed to characterize the microbial community structure of water, sediment, bryophyte, and biofilm samples from 26 headwater stream sites in northwestern Pennsylvania with different histories of fracking activity within Marcellus shale formations. Further, we describe the relationship between microbial community structure and environmental parameters measured. Approximately 3.2 million 16S rRNA gene sequences were retrieved from a total of 58 samples. Microbial community analyses showed significant reductions in species richness as well as evenness in sites with Marcellus shale activity. Beta diversity analyses revealed distinct microbial community structure between sites with and without Marcellus shale activity. For example, operational taxonomic units (OTUs) within the Acetobacteracea, Methylocystaceae, Acidobacteriaceae, and Phenylobacterium were greater than three log-fold more abundant in MSA+ sites as compared to MSA− sites. Further, several of these OTUs were strongly negatively correlated with pH and positively correlated with the number of wellpads in a watershed. It should be noted that many of the OTUs enriched in MSA+ sites are putative acidophilic and/or methanotrophic populations. This study revealed apparent shifts in the autochthonous microbial communities and highlighted potential members that could be responding to changing stream conditions as a result of nascent industrial activity in these aquatic ecosystems. PMID:25408683
Metagenomic Analysis of Ammonia-Oxidizing Archaea Affiliated with the Soil Group
Bartossek, Rita; Spang, Anja; Weidler, Gerhard; Lanzen, Anders; Schleper, Christa
2012-01-01
Ammonia-oxidizing archaea (AOA) have recently been recognized as a significant component of many microbial communities and represent one of the most abundant prokaryotic groups in the biosphere. However, only few AOA have been successfully cultivated so far and information on the physiology and genomic content remains scarce. We have performed a metagenomic analysis to extend the knowledge of the AOA affiliated with group I.1b that is widespread in terrestrial habitats and of which no genome sequences has been described yet. A fosmid library was generated from samples of a radioactive thermal cave (46°C) in the Austrian Central Alps in which AOA had been found as a major part of the microbial community. Out of 16 fosmids that possessed either an amoA or 16S rRNA gene affiliating with AOA, 5 were fully sequenced, 4 of which grouped with the soil/I.1b (Nitrososphaera-) lineage, and 1 with marine/I.1a (Nitrosopumilus-) lineage. Phylogenetic analyses of amoBC and an associated conserved gene were congruent with earlier analyses based on amoA and 16S rRNA genes and supported the separation of the soil and marine group. Several putative genes that did not have homologs in currently available marine Thaumarchaeota genomes indicated that AOA of the soil group contain specific genes that are distinct from their marine relatives. Potential cis-regulatory elements around conserved promoter motifs found upstream of the amo genes in sequenced (meta-) genomes differed in marine and soil group AOA. On one fosmid, a group of genes including amoA and amoB were flanked by identical transposable insertion sequences, indicating that amoAB could potentially be co-mobilized in the form of a composite transposon. This might be one of the mechanisms that caused the greater variation in gene order compared to genomes in the marine counterparts. Our findings highlight the genetic diversity within the two major and widespread lineages of Thaumarchaeota. PMID:22723795
2015-01-01
Nematodes inhabiting benthic deep-sea ecosystems account for >90% of the total metazoan abundances and they have been hypothesised to be hyper-diverse, but their biodiversity is still largely unknown. Metabarcoding could facilitate the census of biodiversity, especially for those tiny metazoans for which morphological identification is difficult. We compared, for the first time, different DNA extraction procedures based on the use of two commercial kits and a previously published laboratory protocol and tested their suitability for sequencing analyses of 18S rDNA of marine nematodes. We also investigated the reliability of Roche 454 sequencing analyses for assessing the biodiversity of deep-sea nematode assemblages previously morphologically identified. Finally, intra-genomic variation in 18S rRNA gene repeats was investigated by Illumina MiSeq in different deep-sea nematode morphospecies to assess the influence of polymorphisms on nematode biodiversity estimates. Our results indicate that the two commercial kits should be preferred for the molecular analysis of biodiversity of deep-sea nematodes since they consistently provide amplifiable DNA suitable for sequencing. We report that the morphological identification of deep-sea nematodes matches the results obtained by metabarcoding analysis only at the order-family level and that a large portion of Operational Clustered Taxonomic Units (OCTUs) was not assigned. We also show that independently from the cut-off criteria and bioinformatic pipelines used, the number of OCTUs largely exceeds the number of individuals and that 18S rRNA gene of different morpho-species of nematodes displayed intra-genomic polymorphisms. Our results indicate that metabarcoding is an important tool to explore the diversity of deep-sea nematodes, but still fails in identifying most of the species due to limited number of sequences deposited in the public databases, and in providing quantitative data on the species encountered. These aspects should be carefully taken into account before using metabarcoding in quantitative ecological research and monitoring programmes of marine biodiversity. PMID:26701112
Dell'Anno, Antonio; Carugati, Laura; Corinaldesi, Cinzia; Riccioni, Giulia; Danovaro, Roberto
2015-01-01
Nematodes inhabiting benthic deep-sea ecosystems account for >90% of the total metazoan abundances and they have been hypothesised to be hyper-diverse, but their biodiversity is still largely unknown. Metabarcoding could facilitate the census of biodiversity, especially for those tiny metazoans for which morphological identification is difficult. We compared, for the first time, different DNA extraction procedures based on the use of two commercial kits and a previously published laboratory protocol and tested their suitability for sequencing analyses of 18S rDNA of marine nematodes. We also investigated the reliability of Roche 454 sequencing analyses for assessing the biodiversity of deep-sea nematode assemblages previously morphologically identified. Finally, intra-genomic variation in 18S rRNA gene repeats was investigated by Illumina MiSeq in different deep-sea nematode morphospecies to assess the influence of polymorphisms on nematode biodiversity estimates. Our results indicate that the two commercial kits should be preferred for the molecular analysis of biodiversity of deep-sea nematodes since they consistently provide amplifiable DNA suitable for sequencing. We report that the morphological identification of deep-sea nematodes matches the results obtained by metabarcoding analysis only at the order-family level and that a large portion of Operational Clustered Taxonomic Units (OCTUs) was not assigned. We also show that independently from the cut-off criteria and bioinformatic pipelines used, the number of OCTUs largely exceeds the number of individuals and that 18S rRNA gene of different morpho-species of nematodes displayed intra-genomic polymorphisms. Our results indicate that metabarcoding is an important tool to explore the diversity of deep-sea nematodes, but still fails in identifying most of the species due to limited number of sequences deposited in the public databases, and in providing quantitative data on the species encountered. These aspects should be carefully taken into account before using metabarcoding in quantitative ecological research and monitoring programmes of marine biodiversity.
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Leclercq, Sébastien; Dittmer, Jessica; Bouchon, Didier; Cordaux, Richard
2014-02-01
Bacterial gut communities of arthropods are highly diverse and tightly related to host feeding habits. However, our understanding of the origin and role of the symbionts is often hindered by the lack of genetic information. "Candidatus Hepatoplasma crinochetorum" is a Mollicutes symbiont found in the midgut glands of terrestrial isopods. The only available nucleotide sequence for this symbiont is a partial 16S rRNA gene sequence. Here, we present the 657,101 bp assembled genome of Candidatus Hepatoplasma crinochetorum isolated from the terrestrial isopod Armadillidium vulgare. While previous 16S rRNA gene-based analyses have provided inconclusive results regarding the phylogenetic position of Candidatus Hepatoplasma crinochetorum within Mollicutes, we performed a phylogenomic analysis of 127 Mollicutes orthologous genes which confidently branches the species as a sister group to the Hominis group of Mycoplasma. Several genome properties of Candidatus Hepatoplasma crinochetorum are also highlighted compared with other Mollicutes genomes, including adjacent tryptophan tRNA genes, which further our understanding of the evolutionary dynamics of these genes in Mollicutes, and the presence of a probably inactivated CRISPR/Cas system, which constitutes a testimony of past interactions between Candidatus Hepatoplasma crinochetorum and mobile genetic elements, despite their current lack in this streamlined genome. Overall, the availability of the complete genome sequence of Candidatus Hepatoplasma crinochetorum paves the way for further investigation of its ecology and evolution.
DNA barcode reference data for the Korean herpetofauna and their applications.
Jeong, Tae Jin; Jun, Jumin; Han, Sanghoon; Kim, Hyun Tae; Oh, Kyunghee; Kwak, Myounghai
2013-11-01
Recently, amphibians and reptiles have drawn attention because of declines in species and populations caused mainly by habitat loss, overexploitation and climate change. This study constructed a DNA barcode database for the Korean herpetofauna, including all the recorded amphibians and 68% of the recorded reptiles, to provide a useful, standardized tool for species identification in monitoring and management. A total of 103 individuals from 18 amphibian and 17 reptile species were used to generate barcode sequences using partial sequences of the mitochondrial cytochrome c oxidase subunit I (COI) gene and to compare it with other suggested barcode loci. Comparing 16S rRNA, cytochrome b (Cytb) and COI for amphibians and 12S rRNA, Cytb and COI for reptiles, our results revealed that COI is better than the other markers in terms of a high level of sequence variation without length variation and moderate amplification success. Although the COI marker had no clear barcoding gap because of the high level of intraspecific variation, all of the analysed individuals from the same species clustered together in a neighbour-joining tree. High intraspecific variation suggests the possibility of cryptic species. Finally, using this database, confiscated snakes were identified as Elaphe schrenckii, designated as endangered in Korea and a food contaminant was identified as the lizard Takydromus amurensis. © 2013 John Wiley & Sons Ltd.
Proposal of Mucilaginibacter galii sp. nov. isolated from leaves of Galium album.
Aydogan, Ebru L; Busse, Hans-Jürgen; Moser, Gerald; Müller, Christoph; Kämpfer, Peter; Glaeser, Stefanie P
2017-05-01
A pale-pink-pigmented, Gram-stain-negative, rod-shaped, non-spore-forming bacterial strain, PP-F2F-G47T, was isolated from the phyllosphere of the herbaceous plant Galium album. Phylogenetic analysis based on the nearly full-length 16S rRNA gene sequence revealed highest sequence similarity to the type strains of Mucilaginibacter daejeonensis (96.2 %), Mucilaginibacter dorajii (95.7 %) and Mucilaginibacter phyllosphaerae (95.5 %). 16S rRNA gene sequence similarities to all other type strains were below 95.5 %. The predominant cellular fatty acids of the strain were C16 : 1ω7c/iso-C15 : 0 2-OH (measured as summed feature 3) and iso-C15 : 0. The major compound in the polyamine pattern was sym-homospermidine and major quinone was menaquinone MK-7. The polar lipid profile was composed of phosphatidylethanolamine and several unidentified aminolipipids, phospholipids, aminophospholipids and lipids without a functional group. A sphingophospholipid could not be detected but a ninhydrin-positive alkaline-stable lipid was visible. The diagnostic diamino acid of the peptidoglycan was meso-diaminopimelic acid. Based on phylogenetic, chemotaxonomic and phenotypic analyses a novel species is proposed, Mucilaginibacter galii sp. nov., with PP-F2F-G47T (=CCM 8711T=CIP 111182T=LMG 29767T) as the type strain.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Tiago, Igor; Veríssimo, António
2013-06-01
Microbial and functional diversity were assessed, from a serpentinization-driven subterrestrial alkaline aquifer - Cabeço de Vide Aquifer (CVA) in Portugal. DGGE analyses revealed the presence of a stable microbial community. By 16S rRNA gene libraries and pyrosequencing analyses, a diverse bacterial composition was determined, contrasting with low archaeal diversity. Within Bacteria the majority of the populations were related to organisms or sequences affiliated to class Clostridia, but members of classes Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Deinococci, Gammaproteobacteria and of the phyla Bacteroidetes, Chloroflexi and Nitrospira were also detected. Domain Archaea encompassed mainly sequences affiliated to Euryarchaeota. Only form I RuBisCO - cbbL was detected. Autotrophic carbon fixation via the rTCA, 3-HP and 3-HP/4H-B cycles could not be confirmed. The detected APS reductase alpha subunit - aprA sequences were phylogenetically related to sequences of sulfate-reducing bacteria belonging to Clostridia, and also to sequences of chemolithoautothrophic sulfur-oxidizing bacteria belonging to Betaproteobacteria. Sequences of methyl coenzyme M reductase - mcrA were phylogenetically affiliated to sequences belonging to Anaerobic Methanotroph group 1 (ANME-1). The populations found and the functional key markers detected in CVA suggest that metabolisms related to H2 , methane and/or sulfur may be the major driving forces in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Chaw, S M; Parkinson, C L; Cheng, Y; Vincent, T M; Palmer, J D
2000-04-11
Phylogenetic relationships among the five groups of extant seed plants are presently quite unclear. For example, morphological studies consistently identify the Gnetales as the extant sister group to angiosperms (the so-called "anthophyte" hypothesis), whereas a number of molecular studies recover gymnosperm monophyly, and few agree with the morphology-based placement of Gnetales. To better resolve these and other unsettled issues, we have generated a new molecular data set of mitochondrial small subunit rRNA sequences, and have analyzed these data together with comparable data sets for the nuclear small subunit rRNA gene and the chloroplast rbcL gene. All nuclear analyses strongly ally Gnetales with a monophyletic conifers, whereas all mitochondrial analyses and those chloroplast analyses that take into account saturation of third-codon position transitions actually place Gnetales within conifers, as the sister group to the Pinaceae. Combined analyses of all three genes strongly support this latter relationship, which to our knowledge has never been suggested before. The combined analyses also strongly support monophyly of extant gymnosperms, with cycads identified as the basal-most group of gymnosperms, Ginkgo as the next basal, and all conifers except for Pinaceae as sister to the Gnetales + Pinaceae clade. According to these findings, the Gnetales may be viewed as extremely divergent conifers, and the many morphological similarities between angiosperms and Gnetales (e.g., double fertilization and flower-like reproductive structures) arose independently.
Chaw, Shu-Miaw; Parkinson, Christopher L.; Cheng, Yuchang; Vincent, Thomas M.; Palmer, Jeffrey D.
2000-01-01
Phylogenetic relationships among the five groups of extant seed plants are presently quite unclear. For example, morphological studies consistently identify the Gnetales as the extant sister group to angiosperms (the so-called “anthophyte” hypothesis), whereas a number of molecular studies recover gymnosperm monophyly, and few agree with the morphology-based placement of Gnetales. To better resolve these and other unsettled issues, we have generated a new molecular data set of mitochondrial small subunit rRNA sequences, and have analyzed these data together with comparable data sets for the nuclear small subunit rRNA gene and the chloroplast rbcL gene. All nuclear analyses strongly ally Gnetales with a monophyletic conifers, whereas all mitochondrial analyses and those chloroplast analyses that take into account saturation of third-codon position transitions actually place Gnetales within conifers, as the sister group to the Pinaceae. Combined analyses of all three genes strongly support this latter relationship, which to our knowledge has never been suggested before. The combined analyses also strongly support monophyly of extant gymnosperms, with cycads identified as the basal-most group of gymnosperms, Ginkgo as the next basal, and all conifers except for Pinaceae as sister to the Gnetales + Pinaceae clade. According to these findings, the Gnetales may be viewed as extremely divergent conifers, and the many morphological similarities between angiosperms and Gnetales (e.g., double fertilization and flower-like reproductive structures) arose independently. PMID:10760277
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
NASA Technical Reports Server (NTRS)
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.
Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N
1998-10-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.
Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria
Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.
1998-01-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806
An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum
NASA Technical Reports Server (NTRS)
Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.
1993-01-01
The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.
Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C
2012-04-01
Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.
Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.
2018-01-01
ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615
Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins
2007-01-01
Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...
Bavykin, Sergei G.; Mirzabekov, Andrei D.
2007-10-30
The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.
Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu
2004-02-18
By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.
Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš
2013-01-01
There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757
Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León
2014-01-01
Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.
Isolation of Brucella inopinata-Like Bacteria from White's and Denny's Tree Frogs.
Kimura, Masanobu; Une, Yumi; Suzuki, Michio; Park, Eun-Sil; Imaoka, Koichi; Morikawa, Shigeru
2017-05-01
Brucella inopinata strain BO1 and B. sp. strain BO2 isolated from human patients, respectively, are genetically different from classical Brucella species. We isolated bacteria of the genus Brucella from two species of wild-caught tropical frogs kept in the facilities in Japan: White's tree frog, which inhabits Oceania, and Denny's tree frog, which inhabits Southeast Asia. Phylogenetic analyses based on 16S rRNA and recA gene sequences and multilocus sequence analysis showed that two isolates of Brucella spp. showed significant similarity to BO1, BO2, and the isolates from other wild-caught frogs. These results suggest that a variety of frog species are susceptible to a novel clade of Brucella bacteria, including B. inopinata.
Saturnispora bothae sp. nov., isolated from rotting wood.
Morais, Camila G; Lara, Carla A; Borelli, Beatriz M; Cadete, Raquel M; Moreira, Juliana D; Lachance, Marc-André; Rosa, Carlos A
2016-10-01
Two strains representing a novel species of the genus Saturnispora were isolated from rotting wood samples collected in an Atlantic Rainforest site in Brazil. Analyses of the sequences of the D1/D2 domains of the rRNA gene showed that this novel species belongs to a subclade in the Saturnispora clade formed by Saturnispora sanitii, Saturnispora sekii, Saturnispora silvae and Saturnisporasuwanaritii. The novel species differed in D1/D2 sequences by 60 or more nucleotide substitutions from these species. The strains produced asci with one to four hemispherical ascospores. A novel species named Saturnispora bothae sp. nov. is proposed to accommodate these isolates. The type strain is UFMG-CM-Y292T (=CBS 13484T). The MycoBank number is MB 817127.
Yang, Yi; Higgins, Steven A.; Yan, Jun; ...
2017-08-15
Here, organohalide-respiring bacteria play key roles in the natural chlorine cycle; however, most of the current knowledge is based on cultures from contaminated environments. We demonstrate that grape pomace compost without prior exposure to chlorinated solvents harbors a Dehalogenimonas ( Dhgm) species capable of using chlorinated ethenes, including the human carcinogen and common groundwater pollutant vinyl chloride (VC) as electron acceptors. Grape pomace microcosms and derived solid-free enrichment cultures were able to dechlorinate trichloroethene (TCE) to less chlorinated daughter products including ethene. 16S rRNA gene amplicon and qPCR analyses revealed the predominance of Dhgm sequences, but no Dehalococcoides mccartyi (more » Dhc) biomarker genes were detected. The enumeration of Dhgm 16S rRNA genes demonstrated VC-dependent growth, and 6.55 ± 0.64 x 10 8 cells were produced per µmole of chloride released. Metagenome sequencing enabled the assembly of a Dhgm draft genome, and 52 putative reductive dehalogenase (RDase) genes were identified. Proteomic workflows identified a putative VC RDase with 49% and 56.1% amino acid similarity to the known VC RDases VcrA and BvcA, respectively. A survey of 1,173 groundwater samples collected from 111 chlorinated solvent-contaminated sites revealed that Dhgm 16S rRNA genes were frequently detected and outnumbered Dhc in 65% of the samples. Dhgm may be more relevant contributors to chlorinated solvent reductive dechlorination in contaminated aquifers than is currently recognized, and non-polluted environments are a source of strictly organohalide-respiring bacteria with novel RDase genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Yi; Higgins, Steven A.; Yan, Jun
Here, organohalide-respiring bacteria play key roles in the natural chlorine cycle; however, most of the current knowledge is based on cultures from contaminated environments. We demonstrate that grape pomace compost without prior exposure to chlorinated solvents harbors a Dehalogenimonas ( Dhgm) species capable of using chlorinated ethenes, including the human carcinogen and common groundwater pollutant vinyl chloride (VC) as electron acceptors. Grape pomace microcosms and derived solid-free enrichment cultures were able to dechlorinate trichloroethene (TCE) to less chlorinated daughter products including ethene. 16S rRNA gene amplicon and qPCR analyses revealed the predominance of Dhgm sequences, but no Dehalococcoides mccartyi (more » Dhc) biomarker genes were detected. The enumeration of Dhgm 16S rRNA genes demonstrated VC-dependent growth, and 6.55 ± 0.64 x 10 8 cells were produced per µmole of chloride released. Metagenome sequencing enabled the assembly of a Dhgm draft genome, and 52 putative reductive dehalogenase (RDase) genes were identified. Proteomic workflows identified a putative VC RDase with 49% and 56.1% amino acid similarity to the known VC RDases VcrA and BvcA, respectively. A survey of 1,173 groundwater samples collected from 111 chlorinated solvent-contaminated sites revealed that Dhgm 16S rRNA genes were frequently detected and outnumbered Dhc in 65% of the samples. Dhgm may be more relevant contributors to chlorinated solvent reductive dechlorination in contaminated aquifers than is currently recognized, and non-polluted environments are a source of strictly organohalide-respiring bacteria with novel RDase genes.« less
Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).
Douzery, E; Catzeflis, F M
1995-11-01
The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.
Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies
NASA Technical Reports Server (NTRS)
Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1991-01-01
Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".
Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed; Sanglard, Dominique
2013-01-01
From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches.
Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed
2013-01-01
From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches. PMID:23077122
Almazán, Consuelo; González-Álvarez, Vicente H; Fernández de Mera, Isabel G; Cabezas-Cruz, Alejandro; Rodríguez-Martínez, Rafael; de la Fuente, José
2016-03-01
The tick-borne pathogens Ehrlichia canis and Anaplasma platys are the causative agents of canine monocytic ehrlichiosis (CME) and canine cyclic thrombocytopenia (CCT). Although molecular evidence of E. canis has been shown, phylogenetic analysis of this pathogen has not been performed and A. platys has not been identified in Mexico, where the tick vector Rhipicephalus sanguineus sensu lato (s.l.) is common. The aim of this research was to screen, identify and characterize E. canis and A. platys by PCR and phylogenetic analysis in dogs from La Comarca Lagunera, a region formed by three municipalities, Torreon, Gomez-Palacio and Lerdo, in the Northern states of Coahuila and Durango, Mexico. Blood samples and five engorged R. sanguineus s.l. ticks per animal were collected from 43 females and 57 male dogs presented to veterinary clinics or lived in the dog shelter from La Comarca Lagunera. All the sampled dogs were apparently healthy and PCR for Anaplasma 16S rRNA, Ehrlichia 16S rRNA, and E. canis trp36 were performed. PCR products were sequenced and used for phylogenetic analysis. PCR products were successfully amplified in 31% of the samples using primers for Anaplasma 16S rRNA, while 10% and 4% amplified products using primers for Ehrlichia 16S rRNA and E. canis trp36 respectively. Subsequent sequencing and phylogenetic analyses of these products showed that three samples corresponded to A. platys and four to E. canis. Based on the analysis of trp36 we confirmed that the E. canis strains isolated from Mexico belong to a conservative clade of E. canis and are closely related to strains from USA. In conclusion, this is the first molecular identification of A. platys and the first molecular characterization and phylogenetic study of both A. platys and E. canis in dogs in Mexico. Copyright © 2015 Elsevier GmbH. All rights reserved.
Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J
2015-06-19
The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and large-scale molecular epidemiology and disease ecology studies based on the most accessible life-cycle stages of eye flukes.
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.
Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W
1995-04-01
Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.
Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne
2006-01-01
Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.
Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays.
Mehnaz, Samina; Weselowski, Brian; Lazarovits, George
2007-12-01
Two free-living nitrogen-fixing bacterial strains, N6 and N7(T), were isolated from corn rhizosphere. A polyphasic taxonomic approach, including morphological characterization, Biolog analysis, DNA-DNA hybridization, and 16S rRNA, cpn60 and nifH gene sequence analysis, was taken to analyse the two strains. 16S rRNA gene sequence analysis indicated that strains N6 and N7(T) both belonged to the genus Azospirillum and were closely related to Azospirillum oryzae (98.7 and 98.8 % similarity, respectively) and Azospirillum lipoferum (97.5 and 97.6 % similarity, respectively). DNA-DNA hybridization of strains N6 and N7(T) showed reassociation values of 48 and 37 %, respectively, with A. oryzae and 43 % with A. lipoferum. Sequences of the nifH and cpn60 genes of both strains showed 99 and approximately 95 % similarity, respectively, with those of A. oryzae. Chemotaxonomic characteristics (Q-10 as quinone system, 18 : 1omega7c as major fatty acid) and G+C content of the DNA (67.6 mol%) were also similar to those of members of the genus Azospirillum. Gene sequences and Biolog and fatty acid analysis showed that strains N6 and N7(T) differed from the closely related species A. lipoferum and A. oryzae. On the basis of these results, it is proposed that these nitrogen-fixing strains represent a novel species. The name Azospirillum zeae sp. nov. is suggested, with N7(T) (=NCCB 100147(T)=LMG 23989(T)) as the type strain.
Sulaiman, Irshad M; Jacobs, Emily; Simpson, Steven; Kerdahi, Khalil
2017-06-01
The primary mission of the U.S. Food and Drug Administration is to enforce the Food, Drug, and Cosmetic Act and regulate food, drug, and cosmetic products. Thus, this agency monitors the presence of pathogenic microorganisms in these products, including canned foods, as one of the regulatory action criteria and also ensures that these products are safe for human consumption. This study was carried out to investigate the effectiveness of pathogen control and integrity of ready-to-eat canned food containing Black Bean Corn Poblano Salsa. A total of nine unopened and recalled canned glass jars from the same lot were examined initially by conventional microbiologic protocols that involved a two-step enrichment, followed by streaking on selective agar plates, for the presence of gram-positive and gram-negative bacteria. Of the eight subsamples examined for each sample, all subsamples of one of the containers were found positive for the presence of slow-growing rod-shaped, gram-positive, facultative anaerobic bacteria. The recovered isolates were subsequently sequenced at rRNA and gyrB loci. Afterward, multilocus sequence typing (MLST) was performed characterizing 11 additional known MLST loci (clpX, dnaA, dnaK, groEL, murC, murE, pepX, pyrG, recA, rpoB, and uvrC). Analyses of the nucleotide sequences of rRNA, gyrB, and 11 MLST loci confirmed these gram-positive bacteria recovered from canned food to be Lactobacillus fermentum . Thus, the DNA sequencing of housekeeping MLST genes can provide species identification of L. fermentum and can be used in the canned food monitoring program of public health importance.
Lagkouvardos, Ilias; Weinmaier, Thomas; Lauro, Federico M; Cavicchioli, Ricardo; Rattei, Thomas; Horn, Matthias
2014-01-01
In the era of metagenomics and amplicon sequencing, comprehensive analyses of available sequence data remain a challenge. Here we describe an approach exploiting metagenomic and amplicon data sets from public databases to elucidate phylogenetic diversity of defined microbial taxa. We investigated the phylum Chlamydiae whose known members are obligate intracellular bacteria that represent important pathogens of humans and animals, as well as symbionts of protists. Despite their medical relevance, our knowledge about chlamydial diversity is still scarce. Most of the nine known families are represented by only a few isolates, while previous clone library-based surveys suggested the existence of yet uncharacterized members of this phylum. Here we identified more than 22 000 high quality, non-redundant chlamydial 16S rRNA gene sequences in diverse databases, as well as 1900 putative chlamydial protein-encoding genes. Even when applying the most conservative approach, clustering of chlamydial 16S rRNA gene sequences into operational taxonomic units revealed an unexpectedly high species, genus and family-level diversity within the Chlamydiae, including 181 putative families. These in silico findings were verified experimentally in one Antarctic sample, which contained a high diversity of novel Chlamydiae. In our analysis, the Rhabdochlamydiaceae, whose known members infect arthropods, represents the most diverse and species-rich chlamydial family, followed by the protist-associated Parachlamydiaceae, and a putative new family (PCF8) with unknown host specificity. Available information on the origin of metagenomic samples indicated that marine environments contain the majority of the newly discovered chlamydial lineages, highlighting this environment as an important chlamydial reservoir. PMID:23949660
Vibrio aphrogenes sp. nov., in the Rumoiensis clade isolated from a seaweed.
Tanaka, Mami; Endo, Shoko; Kotake, Fumihito; Al-Saari, Nurhidayu; Amin, A K M Rohul; Feng, Gao; Mino, Sayaka; Doi, Hidetaka; Ogura, Yoshitoshi; Hayashi, Tetsuya; Suda, Wataru; Hattori, Masahira; Yumoto, Isao; Sawabe, Toko; Sawabe, Tomoo; Araki, Toshiyoshi
2017-01-01
A novel strain Vibrio aphrogenes sp. nov. strain CA-1004T isolated from the surface of seaweed collected on the coast of Mie Prefecture in 1994 [1] was characterized using polyphasic taxonomy including multilocus sequence analysis (MLSA) and a genome based comparison. Both phylogenetic analyses on the basis of 16S rRNA gene sequences and MLSA based on eight protein-coding genes (gapA, gyrB, ftsZ, mreB, pyrH, recA, rpoA, and topA) showed the strain could be placed in the Rumoiensis clade in the genus Vibrio. Sequence similarities of the 16S rRNA gene and the multilocus genes against the Rumoiensis clade members, V. rumoiensis, V. algivorus, V. casei, and V. litoralis, were low enough to propose V. aphrogenes sp. nov. strain CA-1004T as a separate species. The experimental DNA-DNA hybridization data also revealed that the strain CA-1004T was separate from four known Rumoiensis clade species. The G+C content of the V. aphrogenes strain was determined as 42.1% based on the genome sequence. Major traits of the strain were non-motile, halophilic, fermentative, alginolytic, and gas production. A total of 27 traits (motility, growth temperature range, amylase, alginase and lipase productions, and assimilation of 19 carbon compounds) distinguished the strain from the other species in the Rumoiensis clade. The name V. aphrogenes sp. nov. is proposed for this species in the Rumoiensis clade, with CA-1004T as the type strain (JCM 31643T = DSM 103759T).
Zhang, Yanying; Yang, Qingsong; Ling, Juan; Van Nostrand, Joy D; Shi, Zhou; Zhou, Jizhong; Dong, Junde
2017-01-01
Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high - throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.
Zhang, Yanying; Yang, Qingsong; Ling, Juan; Van Nostrand, Joy D.; Shi, Zhou; Zhou, Jizhong; Dong, Junde
2017-01-01
Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata, Avicennia marina, and Ceriops tagal, was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem. PMID:29093705
Fuerst, J A; Gwilliam, H G; Lindsay, M; Lichanska, A; Belcher, C; Vickers, J E; Hugenholtz, P
1997-01-01
Bacteria phenotypically resembling members of the phylogenetically distinct planctomycete group of the domain Bacteria were isolated from postlarvae of the giant tiger prawn, Penaeus monodon. A selective medium designed in the light of planctomycete antibiotic resistance characteristics was used for this isolation. Planctomycetes were isolated from both healthy and monodon baculovirus-infected prawn postlarvae. The predominant colony type recovered from postlarvae regardless of viral infection status was nonpigmented. Other, less commonly observed types were pink or orange pigmented. A planctomycete-specific 16S rRNA-directed probe was designed and used to screen the isolates for their identity as planctomycetes prior to molecular phylogenetic characterization. 16S rRNA genes from nine prawn isolates together with two planctomycete reference strains (Planctomyces brasiliensis and Gemmata obscuriglobus) were sequenced and compared with reference sequences from the planctomycetes and other members of the domain Bacteria. Phylogenetic analyses and sequence signatures of the 16S rRNA genes demonstrated that the prawn isolates were members of the planctomycete group. Five representatives of the predominant nonpigmented colony type were members of the Pirellula group within the planctomycetes, as were three pink-pigmented colony type representatives. Homology values and tree topology indicated that representatives of the nonpigmented and pink-pigmented colony types formed two discrete clusters within the Pirellula group, not identical to any known Pirellula species. A sole representative of the orange colony type was a member of the Planctomyces group, virtually identical in 16S rDNA sequence to P. brasiliensis, and exhibited distinctive morphology. PMID:8979353
Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.
2016-01-01
Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332
2003-12-01
populations. (ii) Characterization of Dehalococeoides sp . strain FL2. The isolate, designate d Dehalococcoides sp . strain FL2, reductively...Pinellas group of the Dehalococcoides cluster, and demonstrated that strain FL2 shared an identical 165 rRNA gene sequence with Dehalococcoides sp ...strain CBDBI, a chlorobenzene-dechlorinating strain. The 165 rRNA gene sequence of Dehalococcoides sp . strain FL2 was submitted to GenBank (AF357918.2
Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan
2018-05-17
Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.
New Erwinia-Like Organism Causing Cervical Lymphadenitis▿
Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo
2008-01-01
The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665
Metatranscriptomics reveals the hydrolytic potential of peat-inhabiting Planctomycetes.
Ivanova, Anastasia A; Wegner, Carl-Eric; Kim, Yongkyu; Liesack, Werner; Dedysh, Svetlana N
2018-06-01
Members of the phylum Planctomycetes are common inhabitants of northern Sphagnum-dominated wetlands. Evidence is accumulating that, in these environments, some planctomycetes may be involved in degrading polymeric organic matter. The experimental data, however, remain scarce due to the low number of characterized representatives of this phylum. In a previous study, we used metatranscriptomics to assess the activity response of peat-inhabiting microorganisms to biopolymers abundantly present in native peat. The community responses to cellulose, xylan, pectin, and chitin availability were analysed relative to unamended controls. Here, we re-analysed these metatranscriptomes and retrieved a total of 1,602,783 rRNA and 35,522 mRNA sequences affiliated with the Planctomycetes. Each of the four polymers induced specific planctomycete responses. These were most pronounced on chitin. The two groups with increased 16S rRNA transcript pools were Gemmata- and Phycisphaera-like planctomycetes. Among uncultivated members of the Planctomycetaceae, two increased transcript pools were detected in pectin-amended samples and belonged to Pirellula-like bacteria. The analysis of taxonomically assigned mRNA reads confirmed the specific response of Gemmata-related planctomycetes to chitin amendment suggesting the presence of chitinolytic capabilities in these bacteria.
Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi
2018-01-28
The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.
Microbial Characterization of Qatari Barchan Sand Dunes
Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.
2016-01-01
This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399
Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.
Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James
2002-12-01
Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.
Sisinthy, Shivaji; Chakraborty, Dwaipayan; Adicherla, Harikrishna; Gundlapally, Sathyanarayana Reddy
2017-09-01
Phylogenetic analyses were performed for members of the family Chromatiaceae, signature nucleotides deduced and the genus Alishewanella transferred to Chromatiaceae. Phylogenetic analyses were executed for the genera Alishewanella, Arsukibacterium and Rheinheimera and the genus Rheinheimera is proposed to be split, with the creation of the Pararheinheimera gen. nov. Furthermore, the species Rheinheimera longhuensis, is transferred to the genus Alishewanella as Alishewanella longhuensis comb. nov. Besides, the genera Alishewanella and Rheinheimera are also emended. Strain LNK-7.1 T was isolated from a water sample from the Lonar Lake, India. Cells were Gram-negative, motile rods, positive for catalase, oxidase, phosphatase, contained C 16:0 , C 17:1 ω8c, summed feature3 (C 16:1 ω6c and/or C 16:1 ω7c) and summed feature 8 (C 18:1 ω7c) as major fatty acids, PE and PG as the major lipids and Q-8 as the sole respiratory quinone. Phylogenetic analyses using NJ, ME, ML and Maximum parsimony, based on 16S rRNA gene sequences, identified Alishewanella tabrizica RCRI4 T as the closely related species of strain LNK-7.1 T with a 16S rRNA gene sequence similarity of 98.13%. The DNA-DNA similarity between LNK-7.1 T and the closely related species (A. tabrizica) was only 12.0% and, therefore, strain LNK-7.1 T was identified as a novel species of the genus Alishewanella with the proposed name Alishewanella alkalitolerans sp. nov. In addition phenotypic characteristics confirmed the species status to strain LNK-7.1 T . The type strain of A. alkalitolerans is LNK-7.1 T (LMG 29592 T = KCTC 52279 T ), isolated from a water sample collected from the Lonar lake, India.
Ogawa, Diogo M. O.; Moriya, Shigeharu; Tsuboi, Yuuri; Date, Yasuhiro; Prieto-da-Silva, Álvaro R. B.; Rádis-Baptista, Gandhi; Yamane, Tetsuo; Kikuchi, Jun
2014-01-01
We propose the technique of biogeochemical typing (BGC typing) as a novel methodology to set forth the sub-systems of organismal communities associated to the correlated chemical profiles working within a larger complex environment. Given the intricate characteristic of both organismal and chemical consortia inherent to the nature, many environmental studies employ the holistic approach of multi-omics analyses undermining as much information as possible. Due to the massive amount of data produced applying multi-omics analyses, the results are hard to visualize and to process. The BGC typing analysis is a pipeline built using integrative statistical analysis that can treat such huge datasets filtering, organizing and framing the information based on the strength of the various mutual trends of the organismal and chemical fluctuations occurring simultaneously in the environment. To test our technique of BGC typing, we choose a rich environment abounding in chemical nutrients and organismal diversity: the surficial freshwater from Japanese paddy fields and surrounding waters. To identify the community consortia profile we employed metagenomics as high throughput sequencing (HTS) for the fragments amplified from Archaea rRNA, universal 16S rRNA and 18S rRNA; to assess the elemental content we employed ionomics by inductively coupled plasma optical emission spectroscopy (ICP-OES); and for the organic chemical profile, metabolomics employing both Fourier transformed infrared (FT-IR) spectroscopy and proton nuclear magnetic resonance (1H-NMR) all these analyses comprised our multi-omics dataset. The similar trends between the community consortia against the chemical profiles were connected through correlation. The result was then filtered, organized and framed according to correlation strengths and peculiarities. The output gave us four BGC types displaying uniqueness in community and chemical distribution, diversity and richness. We conclude therefore that the BGC typing is a successful technique for elucidating the sub-systems of organismal communities with associated chemical profiles in complex ecosystems. PMID:25330259
Ogawa, Diogo M O; Moriya, Shigeharu; Tsuboi, Yuuri; Date, Yasuhiro; Prieto-da-Silva, Álvaro R B; Rádis-Baptista, Gandhi; Yamane, Tetsuo; Kikuchi, Jun
2014-01-01
We propose the technique of biogeochemical typing (BGC typing) as a novel methodology to set forth the sub-systems of organismal communities associated to the correlated chemical profiles working within a larger complex environment. Given the intricate characteristic of both organismal and chemical consortia inherent to the nature, many environmental studies employ the holistic approach of multi-omics analyses undermining as much information as possible. Due to the massive amount of data produced applying multi-omics analyses, the results are hard to visualize and to process. The BGC typing analysis is a pipeline built using integrative statistical analysis that can treat such huge datasets filtering, organizing and framing the information based on the strength of the various mutual trends of the organismal and chemical fluctuations occurring simultaneously in the environment. To test our technique of BGC typing, we choose a rich environment abounding in chemical nutrients and organismal diversity: the surficial freshwater from Japanese paddy fields and surrounding waters. To identify the community consortia profile we employed metagenomics as high throughput sequencing (HTS) for the fragments amplified from Archaea rRNA, universal 16S rRNA and 18S rRNA; to assess the elemental content we employed ionomics by inductively coupled plasma optical emission spectroscopy (ICP-OES); and for the organic chemical profile, metabolomics employing both Fourier transformed infrared (FT-IR) spectroscopy and proton nuclear magnetic resonance (1H-NMR) all these analyses comprised our multi-omics dataset. The similar trends between the community consortia against the chemical profiles were connected through correlation. The result was then filtered, organized and framed according to correlation strengths and peculiarities. The output gave us four BGC types displaying uniqueness in community and chemical distribution, diversity and richness. We conclude therefore that the BGC typing is a successful technique for elucidating the sub-systems of organismal communities with associated chemical profiles in complex ecosystems.
Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H
2006-08-01
Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.
Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C
2015-01-01
Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M
2015-01-01
Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.
Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps
Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz
2015-01-01
In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450
Identification of fungi in shotgun metagenomics datasets
Donovan, Paul D.; Gonzalez, Gabriel; Higgins, Desmond G.
2018-01-01
Metagenomics uses nucleic acid sequencing to characterize species diversity in different niches such as environmental biomes or the human microbiome. Most studies have used 16S rRNA amplicon sequencing to identify bacteria. However, the decreasing cost of sequencing has resulted in a gradual shift away from amplicon analyses and towards shotgun metagenomic sequencing. Shotgun metagenomic data can be used to identify a wide range of species, but have rarely been applied to fungal identification. Here, we develop a sequence classification pipeline, FindFungi, and use it to identify fungal sequences in public metagenome datasets. We focus primarily on animal metagenomes, especially those from pig and mouse microbiomes. We identified fungi in 39 of 70 datasets comprising 71 fungal species. At least 11 pathogenic species with zoonotic potential were identified, including Candida tropicalis. We identified Pseudogymnoascus species from 13 Antarctic soil samples initially analyzed for the presence of bacteria capable of degrading diesel oil. We also show that Candida tropicalis and Candida loboi are likely the same species. In addition, we identify several examples where contaminating DNA was erroneously included in fungal genome assemblies. PMID:29444186
Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong
2008-08-01
In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.