Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J
1981-01-01
We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619
NASA Technical Reports Server (NTRS)
Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.
1989-01-01
The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene
USDA-ARS?s Scientific Manuscript database
This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...
Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences
NASA Technical Reports Server (NTRS)
Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.
1995-01-01
Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.
USDA-ARS?s Scientific Manuscript database
This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...
Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.
Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L
1996-01-01
Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200
Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan
2013-09-01
Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu
2011-06-01
To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
Patarca, R; Dorta, B; Ramirez, J L
1982-01-01
As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.
Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng
2017-05-10
Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .
Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.
Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A
2016-05-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Skin microbiome surveys are strongly influenced by experimental design
Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.
2016-01-01
Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039
Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A
2016-07-01
Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.
Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J
2010-04-01
This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.
Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang
2006-01-01
Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš
2016-09-01
Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.
Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group
NASA Astrophysics Data System (ADS)
Lloyd, K. G.; Biddle, J.; Teske, A.
2011-12-01
Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.
Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.
2010-01-01
Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113
Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.
2003-01-01
The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285
Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong
2013-07-04
Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.
High-resolution phylogenetic microbial community profiling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singer, Esther; Coleman-Derr, Devin; Bowman, Brett
2014-03-17
The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016
Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas
2016-01-01
probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809
How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?
Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T
2018-03-15
The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.
Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.
2017-01-01
RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661
Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li
2013-10-01
According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.
Röder, Christoph; König, Helmut; Fröhlich, Jürgen
2007-09-01
Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.
Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko
1998-01-01
By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas
2016-09-23
The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.
Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.
2010-01-01
The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2005-01-01
Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024
Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.
Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier
2014-01-01
Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.
Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C
2013-01-01
The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.
Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.
2013-01-01
The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343
Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.
2011-01-01
Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433
A new version of the RDP (Ribosomal Database Project)
NASA Technical Reports Server (NTRS)
Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;
1999-01-01
The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.
Common 5S rRNA variants are likely to be accepted in many sequence contexts
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.
2018-01-01
ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035
Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.
Berry, David; Gutierrez, Tony
2017-01-01
Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.
Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung
2011-01-01
Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154
Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.
2011-01-01
Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774
Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan
2018-05-17
Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.
Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung
2007-01-01
This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845
MetaMetaDB: a database and analytic system for investigating microbial habitability.
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.
Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.
2007-12-04
The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Metagenomics uncovers gaps in amplicon-based detection of microbial diversity
Eloe-Fadrosh, Emiley A.; Ivanova, Natalia N.; Woyke, Tanja; ...
2016-02-01
Our view of microbial diversity has expanded greatly over the past 40 years, primarily through the wide application of PCR-based surveys of the small-subunit ribosomal RNA (SSU rRNA) gene. Yet significant gaps in knowledge remain due to well-recognized limitations of this method. Here in this paper, we systematically survey primer fidelity in SSU rRNA gene sequences recovered from over 6,000 assembled metagenomes sampled globally. Our findings show that approximately 10% of environmental microbial sequences might be missed from classical PCR-based SSU rRNA gene surveys, mostly members of the Candidate Phyla Radiation (CPR) and as yet uncharacterized Archaea. In conclusion, thesemore » results underscore the extent of uncharacterized microbial diversity and provide fruitful avenues for describing additional phylogenetic lineages.« less
Sun, Beili; Zhou, Dongrui; Tu, Jing; Lu, Zuhong
2017-01-01
The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
NASA Technical Reports Server (NTRS)
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.
Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K
2016-02-01
A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050
Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.
Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo
2016-01-01
High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507
Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H
1996-01-01
Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850
Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward
2013-08-01
Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.
Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.
He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong
2012-06-01
The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.
2011-01-01
Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978
Panosyan, Hovik; Birkeland, Nils-Kåre
2014-11-01
The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
rpoB Gene Sequencing for Identification of Corynebacterium Species
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2004-01-01
The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970
MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability
Yang, Ching-chia; Iwasaki, Wataru
2014-01-01
MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242
PanFP: Pangenome-based functional profiles for microbial communities
Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren; ...
2015-09-26
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less
PanFP: pangenome-based functional profiles for microbial communities.
Jun, Se-Ran; Robeson, Michael S; Hauser, Loren J; Schadt, Christopher W; Gorin, Andrey A
2015-09-26
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost-effective way to screen samples of interest for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. We present a computational method called pangenome-based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU's taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome's functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8-0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed-reference OTU picking strategies against specific reference sequence databases. We developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub ( https://github.com/srjun/PanFP ).
NASA Technical Reports Server (NTRS)
Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.
1995-01-01
Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.
Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C
2005-03-01
The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.
Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.
Habibi, Gh
2012-01-01
Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.
PCR detection of uncultured rumen bacteria.
Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan
2012-07-01
16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren
For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less
Jiang, Xuexia; Jiao, Nianzhi
2016-09-01
Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.
Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin
2015-03-01
The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei
2013-01-01
Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms. PMID:24058905
Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei
2013-01-01
Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.
Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.
2016-01-01
Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332
New Erwinia-Like Organism Causing Cervical Lymphadenitis▿
Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo
2008-01-01
The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665
Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes
NASA Technical Reports Server (NTRS)
Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.
1987-01-01
A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.
Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia
2014-08-01
We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing
Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro
2017-01-01
Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100
Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies
NASA Technical Reports Server (NTRS)
Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1991-01-01
Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".
Hoshino, Tatsuhiko; Inagaki, Fumio
2017-01-01
Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.
Detection and molecular status of Isospora sp. from the domestic pigeon (Columba livia domestica).
Matsubara, Ryuma; Fukuda, Yasuhiro; Murakoshi, Fumi; Nomura, Osamu; Suzuki, Toru; Tada, Chika; Nakai, Yutaka
2017-10-01
The domestic pigeon, Columba livia domestica, is reared for meat production, as a pet, or for racing. Few reports have characterized the parasitic protists from the genus Isospora isolated from Columbiformes. We detected Isospora-like oocysts from C. livia reared for racing. The oocyst contained two sporocysts, and each sporocyst included four sporozoites. The sporulated oocysts (n=4) were spherical; their mean diameters were 25.6 (24.0-27.2)×24.7 (23.4-26.0) μm. Micropyles, polar granules, and oocyst residuum were absent. The mean length and width of the sporocysts (n=8) were 19.5 (18.5-20.5) and 11.2 (10.2-12.1) μm, respectively. Stieda and sub-Stieda bodies were observed. Single-oocyst PCR revealed two different 18S rRNA gene sequences and one 28S rRNA gene sequence in a single oocyst of Isospora sp. Based on a phylogenetic analysis of the 18S rRNA gene, the two sequences made a group which fell within a cluster of known avian Isospora species. A tree based on the 28S rRNA gene sequence indicated that sequences from the pigeon Isospora sp. fell within a cluster of avian Isospora species. Both trees failed to clarify the phylogenetic relationships among the avian Isospora species due to limited resolution. Because the morphological description of Isospora sp. is based on only four oocysts, Isospora sp. is not proposed as a novel species here. This is the first description of Isospora sp. isolated from the domestic pigeon C. livia. Copyright © 2017 Elsevier B.V. All rights reserved.
Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.
2011-01-01
Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895
Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R
2011-09-01
Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.
NASA Astrophysics Data System (ADS)
Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.
2011-10-01
Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.
Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S
2016-02-25
Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
Genetic speciation of environmental Legionella isolates in Thailand.
Paveenkittiporn, Wantana; Dejsirilert, Surang; Kalambaheti, Thareerat
2012-10-01
Legionella-like organisms were isolated during 2003-2007 from various water resources by culturing on selective media of Wadowsky-Yee-Okuda agar. The 256 isolates were identified as belonging to the Legionella genus based on detection of 108 bp PCR product of the 5S rRNA gene, while the inclusion as Legionella pneumophila were confirmed by PCR detection of a specific mip gene region of 168 bp. The 50 isolates, identified as non-pneumophila, were then subjected to DNA tree analysis, based on mip gene of ~650 bp and rnpB genes product ranged from 304 to 354 bp. Phylogenetic tree was constructed to predict their species in relative to the available database. The isolates of which their speciation, based on those two genes were inconclusive, were then investigated for the almost full-length of 16S rRNA sequences. The isolates were assigned as 16 known Legionella species, and proposed seven novel species based on their unique 16S rRNA sequence. Copyright © 2012 Elsevier B.V. All rights reserved.
Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A
2017-01-01
We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.
NASA Technical Reports Server (NTRS)
Fox, G. E.
1985-01-01
Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.
Occurrence and characterization of hitherto unknown Streptomyces species in semi-arid soils.
Kumar, Surendra; Priya, E; Singh Solanki, Dilip; Sharma, Ruchika; Gehlot, Praveen; Pathak, Rakesh; Singh, S K
2016-09-01
Streptomyces the predominant genus of Actinobacteria and plays an important role in the recycling of soil organic matter and production of important secondary metabolites. The occurrence and diversity assessment of Streptomyces species revealed alkaline and poor nutrient status of soils of semi-arid region of Jodhpur, Rajasthan. The morphological and biochemical characterization of 21 Streptomyces isolates facilitated Genus level identification but were insufficient to designate species. Species designation based on 16S rRNA gene delineated 21 isolates into 14 Streptomyces species. Upon BLAST search, the test isolates exhibited 98 to 100% identities with that of the best aligned sequences of the NCBI database. The GC content of 16S rRNA gene sequences of all the Streptomyces isolates tested ranged from 59.03% to 60.94%. The multiple sequence alignment of all the 21 Streptomyces isolates generated a phylogram with high bootstrap values indicating reliable grouping of isolates based on nucleotide sequence variations by way of insertion, deletion and substitutions and 16S rRNA length polymorphism. Some of the Streptomyces species molecularly identified under present study are reported for the first time from semi-arid region of Jodhpur.
Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J
2008-06-01
We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.
Wickersheim, Michelle L; Blumenstiel, Justin P
2013-11-01
A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.
Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco
2014-01-01
Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence.
Bavykin, Sergei G.; Mirzabekov, Andrei D.
2007-10-30
The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.
2011-01-01
High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204
Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.
Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R
2013-01-01
The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.
Tian, Yang; Li, Yan Hong
2017-01-01
To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity
NASA Technical Reports Server (NTRS)
Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr
1992-01-01
16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.
Curtiss, W C; Vournakis, J N
1984-01-01
Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.
Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek
2014-01-01
The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.
Reclassification of Actinobacillus muris as Muribacter muris gen. nov., comb. nov.
Nicklas, Werner; Bisgaard, Magne; Aalbæk, Bent; Kuhnert, Peter; Christensen, Henrik
2015-10-01
To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains, mainly from mice and rats, were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole-genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intragroup similarities of 96.7 and 97.2 % for the 16S rRNA and rpoB genes, respectively. The highest 16S rRNA gene sequence similarity to a taxon with a validly published name outside the group was 95.9 %, to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium', with 88.4 % similarity. A new genus and a new combination, Muribacter muris gen. nov., comb. nov., are proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons, with major divergence from the existing genera of the family Pasteurellaceae. The new genus has the characteristics of [A.] muris with the emendation that acid formation from ( - )-d-mannitol and hydrolysis of aesculin are variable, while the α-glucosidase test is positive. There is no requirement for exogenously supplied NAD (V factor) for the majority of strains investigated; however, one strain was found to require NAD. The major fatty acids of the type strain of Muribacter muris were C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I, C16 : 1ω7c and C16 : 0, which is in line with most genera of the Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).
Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke
2017-09-18
Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B.V. All rights reserved.
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
Wei, Yulong; Silke, Jordan R; Xia, Xuhua
2017-12-15
Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Prevotella timonensis sp. nov., isolated from a human breast abscess.
Glazunova, Olga O; Launay, Thierry; Raoult, Didier; Roux, Véronique
2007-04-01
Gram-negative anaerobic rods were isolated from a human breast abscess. Based on genotypic and phenotypic characteristics, the novel strain belonged to the genus Prevotella. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that it was closely related to Prevotella buccalis (94 % 16S rRNA gene sequence similarity), Prevotella salivae (90 %) and Prevotella oris (89.1 %). The major cellular fatty acid was C(14 : 0) (19.5 %). The new isolate represents a novel species in the genus Prevotella, for which the name Prevotella timonensis sp. nov. is proposed. The type strain is strain 4401737(T) (=CIP 108522(T)=CCUG 50105(T)).
Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.
Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji
2017-02-28
High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pan, W J; Blackburn, E H
1995-01-01
The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211
Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M
2015-01-01
Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.
Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora
Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.
1999-01-01
The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Root-Bernstein, Robert; Root-Bernstein, Meredith
2016-05-21
We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Three new non-ascosporic, ascomycetous yeast genera are proposed based on their isolation from currently described species and genera. Phylogenetic placement of the genera was determined from analysis of nuclear gene sequences for D1/D2 large subunit rRNA, small subunit rRNA, translation elongation...
The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...
Lynch, T; Gregson, D; Church, D L
2016-03-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Gregson, D.; Church, D. L.
2016-01-01
Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258
Benchmarking of Methods for Genomic Taxonomy
Larsen, Mette V.; Cosentino, Salvatore; Lukjancenko, Oksana; ...
2014-02-26
One of the first issues that emerges when a prokaryotic organism of interest is encountered is the question of what it is—that is, which species it is. The 16S rRNA gene formed the basis of the first method for sequence-based taxonomy and has had a tremendous impact on the field of microbiology. Nevertheless, the method has been found to have a number of shortcomings. In this paper, we trained and benchmarked five methods for whole-genome sequence-based prokaryotic species identification on a common data set of complete genomes: (i) SpeciesFinder, which is based on the complete 16S rRNA gene; (ii) Reads2Typemore » that searches for species-specific 50-mers in either the 16S rRNA gene or the gyrB gene (for the Enterobacteraceae family); (iii) the ribosomal multilocus sequence typing (rMLST) method that samples up to 53 ribosomal genes; (iv) TaxonomyFinder, which is based on species-specific functional protein domain profiles; and finally (v) KmerFinder, which examines the number of cooccurring k-mers (substrings of k nucleotides in DNA sequence data). The performances of the methods were subsequently evaluated on three data sets of short sequence reads or draft genomes from public databases. In total, the evaluation sets constituted sequence data from more than 11,000 isolates covering 159 genera and 243 species. Our results indicate that methods that sample only chromosomal, core genes have difficulties in distinguishing closely related species which only recently diverged. Finally, the KmerFinder method had the overall highest accuracy and correctly identified from 93% to 97% of the isolates in the evaluations sets.« less
Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing
2016-04-14
The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..
Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi
2018-04-01
A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).
High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions
Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.
2014-01-01
In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853
Harrison, Nigel A; Davis, Robert E; Oropeza, Carlos; Helmick, Ericka E; Narváez, María; Eden-Green, Simon; Dollet, Michel; Dickinson, Matthew
2014-06-01
In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100% identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0-99.6% identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d'Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5% sequence identity with all previously described members of 'Candidatus Phytoplasma'. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of 'Candidatus Phytoplasma', justifying its recognition as the reference strain of a novel taxon, 'Candidatus Phytoplasma palmicola'. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d'Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Chen, Yi-Guang; Li, Wen-Jun; Cui, Xiao-Long; Jiang, Cheng-Lin; Xu, Li-Hua
2006-10-01
One facultative alkaliphilic actinomycete strain YIM 90022 was isolated from hypersaline alkaline soil in Qinghai province, China. An almost-complete 16S rRNA gene sequence (1500 bp) for strain YIM 90022 was obtained. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 90022 was closely related to four members of the genus Nocardiopsis with 16S rRNA gene sequence similarity values of 98.8% (N. exhalans DSM 44407T), 98.5% (N. prasina DSM 43845T), 98.4% (N. metallicus DSM 44598T) and 97.8% (N. listeri DSM 40297T), but represented a distinct phylogenetic lineage. Repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting was evaluated on strain YIM 90022 and its closest relatives to investigate their genetic relatedness. The analysis of the rep-PCR genomic fingerprints showed that strain YIM 90022 was distinguishable from its closest relatives. The polyphasic taxonomic data presented in this study, including its morphology, physiological and biochemical characteristics, chemotaxonomy, 16S rRNA gene sequence-based phylogenetic analysis and rep-PCR genomic fingerprinting, supported the view that strain YIM 90022 represented a potential new species of the genus Nocardiopsis. The fermentation broth of strain YIM 90022 strongly inhibited growth of cell series of gastric cancer, lung cancer, mammary cancer, melanoma cancer, renal cancer and uterus cancer. Strain YIM 90022 grew well on most tested media, producing exuberant vegetative hyphae and aerial hyphae. The vegetative hyphae are long and fragmented. Light yellow to deep brown diffusible pigments were produced on ISP 2, ISP 3 and ISP 6. Growth of the strain occurred in the pH range 6.0-12.0, with optimal pH8.5. The NaCl tolerate range was 0-15% (W/V). Cell walls contain meso-diaminopimelic acid and have no diagnostic sugars. Polar lipids are phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethylethanolamine. Major menaquinones are MK-10 (H4, H6). The DNA G + C content is 71.5 mol %.
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C
2014-08-29
Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
NASA Technical Reports Server (NTRS)
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
Scholz, Christian F. P.; Poulsen, Knud
2012-01-01
The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329
Weissella ghanensis sp. nov., isolated from a Ghanaian cocoa fermentation.
De Bruyne, Katrien; Camu, Nicholas; Lefebvre, Karen; De Vuyst, Luc; Vandamme, Peter
2008-12-01
During a study on lactic acid bacteria (and their species diversity) in spontaneous heap fermentations of Ghanaian cocoa beans, two strains, designated 215(T) and 194B, were isolated. A phylogenetic analysis based on 16S rRNA gene sequences demonstrated that these strains represented a distinct lineage close to the genus Weissella and showing only 92.1 % 16S rRNA gene sequence similarity with respect to their closest neighbour, Weissella soli LMG 20113(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and physiological and biochemical tests confirmed the unique taxonomic position of the two novel isolates. On the basis of the results of the morphological and biochemical tests and 16S rRNA gene sequence analysis, strains 215(T) and 194B represent the most peripheral lineage of the genus Weissella, for which we propose the name Weissella ghanensis sp. nov. The type strain is 215(T) (=LMG 24286(T)=DSM 19935(T)).
Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
Ling, Alison L.; Robertson, Charles E.; Harris, J. Kirk; Frank, Daniel N.; Kotter, Cassandra V.; Stevens, Mark J.; Pace, Norman R.; Hernandez, Mark T.
2015-01-01
Microbially-induced concrete corrosion in headspaces threatens wastewater infrastructure worldwide. Models for predicting corrosion rates in sewer pipe networks rely largely on information from culture-based investigations. In this study, the succession of microbes associated with corroding concrete was characterized over a one-year monitoring campaign using rRNA sequence-based phylogenetic methods. New concrete specimens were exposed in two highly corrosive manholes (high concentrations of hydrogen sulfide and carbon dioxide gas) on the Colorado Front Range for up to a year. Community succession on corroding surfaces was assessed using Illumina MiSeq sequencing of 16S bacterial rRNA amplicons and Sanger sequencing of 16S universal rRNA clones. Microbial communities associated with corrosion fronts presented distinct succession patterns which converged to markedly low α-diversity levels (< 10 taxa) in conjunction with decreasing pH. The microbial community succession pattern observed in this study agreed with culture-based models that implicate acidophilic sulfur-oxidizer Acidithiobacillus spp. in advanced communities, with two notable exceptions. Early communities exposed to alkaline surface pH presented relatively high α-diversity, including heterotrophic, nitrogen-fixing, and sulfur-oxidizing genera, and one community exposed to neutral surface pH presented a diverse transition community comprised of less than 20% sulfur-oxidizers. PMID:25748024
Ling, Alison L; Robertson, Charles E; Harris, J Kirk; Frank, Daniel N; Kotter, Cassandra V; Stevens, Mark J; Pace, Norman R; Hernandez, Mark T
2015-01-01
Microbially-induced concrete corrosion in headspaces threatens wastewater infrastructure worldwide. Models for predicting corrosion rates in sewer pipe networks rely largely on information from culture-based investigations. In this study, the succession of microbes associated with corroding concrete was characterized over a one-year monitoring campaign using rRNA sequence-based phylogenetic methods. New concrete specimens were exposed in two highly corrosive manholes (high concentrations of hydrogen sulfide and carbon dioxide gas) on the Colorado Front Range for up to a year. Community succession on corroding surfaces was assessed using Illumina MiSeq sequencing of 16S bacterial rRNA amplicons and Sanger sequencing of 16S universal rRNA clones. Microbial communities associated with corrosion fronts presented distinct succession patterns which converged to markedly low α-diversity levels (< 10 taxa) in conjunction with decreasing pH. The microbial community succession pattern observed in this study agreed with culture-based models that implicate acidophilic sulfur-oxidizer Acidithiobacillus spp. in advanced communities, with two notable exceptions. Early communities exposed to alkaline surface pH presented relatively high α-diversity, including heterotrophic, nitrogen-fixing, and sulfur-oxidizing genera, and one community exposed to neutral surface pH presented a diverse transition community comprised of less than 20% sulfur-oxidizers.
FunGene: the functional gene pipeline and repository.
Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R
2013-01-01
Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.
How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys
Berney, Cédric; Fahrni, José; Pawlowski, Jan
2004-01-01
Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975
Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid
2014-01-01
Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.
Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H
2005-01-01
To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W
1995-04-01
Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.
Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †
Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary
2008-01-01
Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877
USDA-ARS?s Scientific Manuscript database
Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...
USDA-ARS?s Scientific Manuscript database
The 10 species of Streptomyces implicated as the etiological agents in scab disease of potatoes or soft rot disease of sweet potatoes are distributed among 7 different phylogenetic clades in analyses based on 16S rRNA gene sequences, but high sequence similarity of this gene among Streptomyces speci...
USDA-ARS?s Scientific Manuscript database
Phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species having very similar gross morphology. These species, including Streptomyces bambergiensis, Streptomyces chlorus, Streptomyces...
Li, Yong; Xue, Han; Sang, Sheng-Qi; Lin, Cai-Li; Wang, Xi-Zhuo
2017-01-01
Two Gram-stain negative aerobic bacterial strains were isolated from the bark tissue of Populus × euramericana. The novel isolates were investigated using a polyphasic approach including 16S rRNA gene sequencing, genome sequencing, average nucleotide identity (ANI) and both phenotypic and chemotaxonomic assays. The genome core gene sequence and 16S rRNA gene phylogenies suggest that the novel isolates are different from the genera Snodgrassella and Stenoxybacter. Additionally, the ANI, G+C content, main fatty acids and phospholipid profile data supported the distinctiveness of the novel strain from genus Snodgrassella. Therefore, based on the data presented, the strains constitute a novel species of a novel genus within the family Neisseriaceae, for which the name Populibacter corticis gen. nov., sp. nov. is proposed. The type strain is 15-3-5T (= CFCC 13594T = KCTC 42251T).
Kämpfer, Peter; Falsen, Enevold; Busse, Hans-Jürgen
2008-01-01
Pseudomonas mephitica CCUG 2513(T) has been reinvestigated to clarify its taxonomic position. 16S rRNA gene sequence comparisons demonstrated that this strain clusters phylogenetically closely with Janthinobacterium lividum (99.8% sequence similarity to the type strain). Investigation of fatty acid patterns, polar lipid profiles, polyamine patterns and quinone systems supported this delineation. Substrate utilization profiles and biochemical characteristics displayed no differences from the type strain of J. lividum, CCUG 2344(T). Therefore, the reclassification of Pseudomonas mephitica as a later heterotypic synonym of Janthinobacterium lividum is proposed, based upon the estimated phylogenetic position derived from 16S rRNA gene sequence data and chemotaxonomic and biochemical data.
MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.
Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming
2016-01-01
High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.
2001-01-01
The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085
de Sousa, Keyla Carstens Marques; Herrera, Heitor Miraglia; Secato, Caroline Tostes; Oliveira, André do Vale; Santos, Filipe Martins; Rocha, Fabiana Lopes; Barreto, Wanessa Teixeira Gomes; Macedo, Gabriel Carvalho; de Andrade Pinto, Pedro Cordeiro Estrela; Machado, Rosangela Zacarias; Costa, Mirela Tinucci; André, Marcos Rogério
2017-07-01
Hemotropic mycoplasmas are known to cause anemia in several mammalian species. The present work aimed to investigate the occurrence of Mycoplasma spp. in wild mammals, domestic dogs and their respective ectoparasites, in southern Pantanal region, central-western Brazil. Between August 2013 and March 2015, 31 Nasua nasua, 78 Cerdocyon thous, seven Leopardus pardalis, 42 dogs, 110 wild rodents, and 30 marsupials were trapped and ectoparasites (ticks and fleas) found parasitizing the animals were collected. Mammals and ectoparasites DNA samples were submitted to conventional PCR assays for Mycoplasma spp. targeting 16S rRNA and RnaseP genes. Twenty-four N. nasua, three C. thous, two domestic dogs, one L. pardalis and one wild rodent were positive for 16S rRNA PCR protocols. Fourteen N. nasua samples were also positive in RnaseP PCR. No marsupial or arthropod showed positivity for Mycoplasma spp. The phylogenetic analyses based on 16S rRNA gene showed that all sequences obtained from dogs, two sequences obtained from C. thous and ten sequences obtained from N. nasua showed to be closely related to Mycoplasma haemocanis/Mycoplasma haemofelis species. Genotypes closely related to 'Candidatus Mycoplasma haemominutum' and Mycoplasma haemomuris were detected in the L. pardalis and in the wild rodent, respectively. Probably a novel Mycoplasma genotype, closely related to a sequence obtained from a Brazilian capybara was detected in 14 N. nasua, based on a concatenated phylogenetic analysis of 16S rRNA and RnaseP genes. The present study revealed that wild animals in southern Pantanal region, Brazil, are exposed to different species of hemoplasmas. Copyright © 2017 Elsevier B.V. All rights reserved.
Vela, Ana I; Casas-Díaz, Encarna; Lavín, Santiago; Domínguez, Lucas; Fernández-Garayzábal, Jose F
2015-09-01
Four isolates of an unknown Gram-stain-positive, catalase-negative coccus-shaped organism, isolated from the pharynx of four wild rabbits, were characterized by phenotypic and molecular genetic methods. The micro-organisms were tentatively assigned to the genus Streptococcus based on cellular morphological and biochemical criteria, although the organisms did not appear to correspond to any species with a validly published name. Comparative 16S rRNA gene sequencing confirmed their identification as members of the genus Streptococcus, being most closely related phylogenetically to Streptococcus porcorum 682-03(T) (96.9% 16S rRNA gene sequence similarity). Analysis of rpoB and sodA gene sequences showed divergence values between the novel species and S. porcorum 682-03(T) (the closest phylogenetic relative determined from 16S rRNA gene sequences) of 18.1 and 23.9%, respectively. The novel bacterial isolate could be distinguished from the type strain of S. porcorum by several biochemical characteristics, such as the production of glycyl-tryptophan arylamidase and α-chymotrypsin, and the non-acidification of different sugars. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be assigned to a novel species of the genus Streptococcus, and named Streptococcus pharyngis sp. nov. The type strain is DICM10-00796B(T) ( = CECT 8754(T) = CCUG 66496(T)).
Lee, Chang Soo; Lee, Jiyoung
2010-09-01
A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.
Toxicity phenotype does not correlate with phylogeny of Cylindrospermopsis raciborskii strains.
Stucken, Karina; Murillo, Alejandro A; Soto-Liebe, Katia; Fuentes-Valdés, Juan J; Méndez, Marco A; Vásquez, Mónica
2009-02-01
Cylindrospermopsis raciborskii is a species of freshwater, bloom-forming cyanobacterium. C. raciborskii produces toxins, including cylindrospermopsin (hepatotoxin) and saxitoxin (neurotoxin), although non toxin-producing strains are also observed. In spite of differences in toxicity, C. raciborskii strains comprise a monophyletic group, based upon 16S rRNA gene sequence identities (greater than 99%). We performed phylogenetic analyses; 16S rRNA gene and 16S-23S rRNA gene internally transcribed spacer (ITS-1) sequence comparisons, and genomic DNA restriction fragment length polymorphism (RFLP), resolved by pulsed-field gel electrophoresis (PFGE), of strains of C. raciborskii, obtained mainly from the Australian phylogeographic cluster. Our results showed no correlation between toxic phenotype and phylogenetic association in the Australian strains. Analyses of the 16S rRNA gene and the respective ITS-1 sequences (long L, and short S) showed an independent evolution of each ribosomal operon. The genes putatively involved in the cylindrospermopsin biosynthetic pathway were present in one locus and only in the hepatotoxic strains, demonstrating a common genomic organization for these genes and the absence of mutated or inactivated biosynthetic genes in the non toxic strains. In summary, our results support the hypothesis that the genes involved in toxicity may have been transferred as an island by processes of gene lateral transfer, rather than convergent evolution.
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment
2013-01-01
Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.
Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L
2007-04-10
To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.
NASA Technical Reports Server (NTRS)
Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.
1994-01-01
When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.
Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia
Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen
2016-01-01
Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821
de Gier, Camilla; Kirkham, Lea-Ann S.
2015-01-01
Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279
Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A
2016-04-01
Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H
1996-01-01
Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607
Uhlik, Ondrej; Strejcek, Michal; Junkova, Petra; Sanda, Miloslav; Hroudova, Miluse; Vlcek, Cestmir; Mackova, Martina; Macek, Tomas
2011-01-01
Bacteria that are able to utilize biphenyl as a sole source of carbon were extracted and isolated from polychlorinated biphenyl (PCB)-contaminated soil vegetated by horseradish. Isolates were identified using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The usage of MALDI Biotyper for the classification of isolates was evaluated and compared to 16S rRNA gene sequence analysis. A wide spectrum of bacteria was isolated, with Arthrobacter, Serratia, Rhodococcus, and Rhizobium being predominant. Arthrobacter isolates also represented the most diverse group. The use of MALDI Biotyper in many cases permitted the identification at the level of species, which was not achieved by 16S rRNA gene sequence analyses. However, some isolates had to be identified by 16S rRNA gene analyses if MALDI Biotyper-based identification was at the level of probable or not reliable identification, usually due to a lack of reference spectra included in the database. Overall, this study shows the possibility of using MALDI-TOF MS and MALDI Biotyper for the fast and relatively nonlaborious identification/classification of soil isolates. At the same time, it demonstrates the dominant role of employing 16S rRNA gene analyses for the identification of recently isolated strains that can later fill the gaps in the protein-based identification databases. PMID:21821747
Ngugi, David Kamanda; Stingl, Ulrich
2012-01-01
Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592
Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.
Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H
2014-05-01
Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
NASA Technical Reports Server (NTRS)
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
Petti, C. A.; Polage, C. R.; Schreckenberger, P.
2005-01-01
Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109
A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria.
Sasaki, Mizuki; Omobowale, Olutayo; Ohta, Kaisaku; Tozuka, Morito; Matsuu, Aya; Hirata, Haruyuki; Nottidge, Helen Oyebukola; Ikadai, Hiromi; Oyamada, Takashi
2008-07-01
The prevalence of Hepatozoon canis infections in dogs in Nigeria was surveyed using molecular methods. DNA was extracted from blood samples obtained from 400 dogs. A primer set that amplified the Babesia canis 18S rRNA gene, which has high similarity to the H. canis 18S rRNA gene, was used for the PCR. As a result, samples from 81 dogs (20.3%) produced 757 bp bands, which differed from the 698 bp band that corresponded to B. canis infection. The sequence of the PCR products of 10 samples were determined, all of which corresponded with the H. canis sequence.
Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan
2014-02-01
Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.
Anaerobic Ammonium-Oxidizing Bacteria in Cow Manure Composting.
Wang, Tingting; Cheng, Lijun; Zhang, Wenhao; Xu, Xiuhong; Meng, Qingxin; Sun, Xuewei; Liu, Huajing; Li, Hongtao; Sun, Yu
2017-07-28
Composting is widely used to transform waste into valuable agricultural organic fertilizer. Anaerobic ammonium-oxidizing (anammox) bacteria play an important role in the global nitrogen cycle, but their role in composting remains poorly understood. In the present study, the community structure, diversity, and abundance of anammox bacteria were analyzed using cloning and sequencing methods by targeting the 16S rRNA gene and the hydrazine oxidase gene ( hzo ) in samples isolated from compost produced from cow manure and rice straw. A total of 25 operational taxonomic units were classified based on 16S rRNA gene clone libraries, and 14 operational taxonomic units were classified based on hzo gene clone libraries. The phylogenetic tree analysis of the 16S rRNA gene and deduced HZO protein sequences from the corresponding encoding genes indicated that the majority of the obtained clones were related to the known anammox bacteria Candidatus "Brocadia," Candidatus "Kuenenia," and Candidatus "Scalindua." The abundances of anammox bacteria were determined by quantitative PCR, and between 2.13 × 10 5 and 1.15 × 10 6 16S rRNA gene copies per gram of compost were found. This study provides the first demonstration of the existence of anammox bacteria with limited diversity in cow manure composting.
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied Microbiology.
Pseudopropionibacterium sp. nov., a novel red-pigmented species isolated from human gingival sulcus.
Saito, Masanori; Shinozaki-Kuwahara, Noriko; Tsudukibashi, Osamu; Hashizume-Takizawa, Tomomi; Kobayashi, Ryoki; Kurita-Ochiai, Tomoko
2018-04-24
Strain SK-1 T is a novel Gram stain-positive, pleomorphic, rod-shaped, non-spore forming, and non-motile organism, designated SK-1 T , isolated from human gingival sulcus that produces acetic acid, propionic acid, lactic acid, and succinic acid as end products of glucose fermentation. Strain SK-1 T had the closest relatedness to Pseudopropionibacterium (Propionibacterium) propionicum with sequence homologies of the 16S rRNA and RNA polymerase β subunit (rpoB) genes of 96.6% and 93.1%, respectively. The genomic DNA G + C content of the isolate was 61.8 mol%. Based on the sequence data of the 16S rRNA and housekeeping (rpoB) genes, we propose a novel taxon, Pseudopropionibacterium rubrum sp. nov. (type strain SK-1 T = JCM 31317T= DSM 100122T). The 16S rRNA and rpoB gene sequences of strain SK-1 T were deposited to the DNA Data Bank of Japan under the accession numbers LC002971 and LC102236, respectively. © 2018 The Societies and John Wiley & Sons Australia, Ltd.
Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John
2014-01-01
Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.
Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad
2014-11-01
Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.
Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish
USDA-ARS?s Scientific Manuscript database
RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...
Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis
USDA-ARS?s Scientific Manuscript database
In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki
2005-12-01
Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.
Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra
2017-11-01
Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.
Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics
Wittekindt, Nicola E.; Padhi, Abinash; Schuster, Stephan C.; Qi, Ji; Zhao, Fangqing; Tomsho, Lynn P.; Kasson, Lindsay R.; Packard, Michael; Cross, Paul C.; Poss, Mary
2010-01-01
The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.
Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax
Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis
2013-01-01
The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509
van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L
1991-06-01
In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.
Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿
Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu
2008-01-01
The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345
Li, Ou; Xiao, Rong; Sun, Lihua; Guan, Chenglin; Kong, Dedong; Hu, Xiufang
2017-01-01
As an epiphyte orchid, Dendrobium catenatum relies on microorganisms for requisite nutrients. Metagenome pyrosequencing based on 16S rRNA and nifH genes was used to characterize the bacterial and diazotrophic communities associated with D. catenatum collected from 5 districts in China. Based on Meta-16S rRNA sequencing, 22 bacterial phyla and 699 genera were identified, distributed as 125 genera from 8 phyla and 319 genera from 10 phyla shared by all the planting bases and all the tissues, respectively. The predominant Proteobacteria varied from 71.81% (GZ) to 96.08% (YN), and Delftia (10.39-38.42%), Burkholderia (2.71-15.98%), Escherichia/Shigella (4.90-25.12%), Pseudomonas (2.68-30.72%) and Sphingomonas (1.83-2.05%) dominated in four planting bases. Pseudomonas (17.94-22.06%), Escherichia/Shigella (6.59-11.59%), Delftia (9.65-22.14%) and Burkholderia (3.12-11.05%) dominated in all the tissues. According to Meta-nifH sequencing, 4 phyla and 45 genera were identified, while 17 genera and 24 genera from 4 phyla were shared by all the planting bases and all the tissues, respectively. Burkholderia and Bradyrhizobium were the most popular in the planting bases, followed by Methylovirgula and Mesorhizobium. Mesorhizobium was the most popular in different tissues, followed by Beijerinckia, Xanthobacter, and Burkholderia. Among the genera, 39 were completely overlapped with the results based on the 16S rRNA gene. In conclusion, abundant bacteria and diazotrophs were identified in common in different tissues of D. catenatum from five planting bases, which might play a great role in the supply of nutrients such as nitrogen. The exact abundance of phylum and genus on the different tissues from different planting bases need deeper sequencing with more samples.
Yang, Lei; Naylor, Gavin J P
2016-01-01
We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.
Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander
2010-04-01
Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V
2017-12-28
The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the phylogeny of blue-flowered flax species and also reveal intra- and interspecific divergence of the rRNA gene sequences.
Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing
2018-03-01
Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong
2016-01-01
Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.
Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.
Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F
1989-10-20
Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.
The sponge microbiome project.
Moitinho-Silva, Lucas; Nielsen, Shaun; Amir, Amnon; Gonzalez, Antonio; Ackermann, Gail L; Cerrano, Carlo; Astudillo-Garcia, Carmen; Easson, Cole; Sipkema, Detmer; Liu, Fang; Steinert, Georg; Kotoulas, Giorgos; McCormack, Grace P; Feng, Guofang; Bell, James J; Vicente, Jan; Björk, Johannes R; Montoya, Jose M; Olson, Julie B; Reveillaud, Julie; Steindler, Laura; Pineda, Mari-Carmen; Marra, Maria V; Ilan, Micha; Taylor, Michael W; Polymenakou, Paraskevi; Erwin, Patrick M; Schupp, Peter J; Simister, Rachel L; Knight, Rob; Thacker, Robert W; Costa, Rodrigo; Hill, Russell T; Lopez-Legentil, Susanna; Dailianis, Thanos; Ravasi, Timothy; Hentschel, Ute; Li, Zhiyong; Webster, Nicole S; Thomas, Torsten
2017-10-01
Marine sponges (phylum Porifera) are a diverse, phylogenetically deep-branching clade known for forming intimate partnerships with complex communities of microorganisms. To date, 16S rRNA gene sequencing studies have largely utilised different extraction and amplification methodologies to target the microbial communities of a limited number of sponge species, severely limiting comparative analyses of sponge microbial diversity and structure. Here, we provide an extensive and standardised dataset that will facilitate sponge microbiome comparisons across large spatial, temporal, and environmental scales. Samples from marine sponges (n = 3569 specimens), seawater (n = 370), marine sediments (n = 65) and other environments (n = 29) were collected from different locations across the globe. This dataset incorporates at least 268 different sponge species, including several yet unidentified taxa. The V4 region of the 16S rRNA gene was amplified and sequenced from extracted DNA using standardised procedures. Raw sequences (total of 1.1 billion sequences) were processed and clustered with (i) a standard protocol using QIIME closed-reference picking resulting in 39 543 operational taxonomic units (OTU) at 97% sequence identity, (ii) a de novo clustering using Mothur resulting in 518 246 OTUs, and (iii) a new high-resolution Deblur protocol resulting in 83 908 unique bacterial sequences. Abundance tables, representative sequences, taxonomic classifications, and metadata are provided. This dataset represents a comprehensive resource of sponge-associated microbial communities based on 16S rRNA gene sequences that can be used to address overarching hypotheses regarding host-associated prokaryotes, including host specificity, convergent evolution, environmental drivers of microbiome structure, and the sponge-associated rare biosphere. © The Authors 2017. Published by Oxford University Press.
An Archaea 5S rRNA analog is stably expressed in Escherichia coli
NASA Technical Reports Server (NTRS)
Yang, Y.; Fox, G. E.
1996-01-01
Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
Previous studies have shown that culture-based methods tend to underestimate the densities and diversity of bacterial populations inhabiting water distribution systems (WDS). In this study, the phylogenetic diversity of drinking water bacteria was assessed using sequence analysis...
Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla; Iyer, Venkateswaran K
2011-03-01
Pneumocystis pneumonia (PCP), a common and serious opportunistic infection in immunocompromised patients, is caused by Pneumocystis jirovecii (formerly known as Pneumocystis carinii f. sp. hominis). The aim of the present study was to describe the prevalence and distribution of genotypes of P. jirovecii based on sequence polymorphisms at mitochondrial large subunit ribosomal RNA (mt LSU rRNA) region in both HIV and non-HIV immunocompromised individuals with a positive PCR result for PCP in a tertiary health care centre in northern India. From January 2005 to October 2008, 50 patients [22 HIV-seropositive individuals, 10 post-renal transplant (PRT) recipients, 3 cancer patients, and 15 patients with various other kinds of immunosuppression] were found to be positive for P. jirovecii using PCR at the mt LSU rRNA gene. Genotyping of the positive samples was performed at the mt LSU rRNA locus. Genotype 2 was the most common accounting for 42% of total types. This was followed by the genotypes 3 (24%), 1 (20%), and 4 (8%). Mixed infection was observed in 3 cases (6%). The rates of genotype distribution were similar in HIV-seropositive individuals, cancer patients, and in patients with other kinds of immunosuppression. In the PRT recipients, genotype 1 was the most prevalent type (80%). This is the first study describing the prevalence of genotypes in HIV-infected and HIV-uninfected, immunocompromised patients based on the mt LSU rRNA gene from the Indian subcontinent. The most prevalent genotype observed was type 2 in contrast to many studies from other parts of the world where genotype 1 was the most prevalent type, suggesting geographical variation. Copyright © 2010 Elsevier GmbH. All rights reserved.
Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R
2010-05-01
To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.
Streptococcus caprae sp. nov., isolated from Iberian ibex (Capra pyrenaica hispanica).
Vela, A I; Mentaberre, G; Lavín, S; Domínguez, L; Fernández-Garayzábal, J F
2016-01-01
Biochemical and molecular genetic studies were performed on a novel Gram-stain-positive, catalase-negative, coccus-shaped organism isolated from tonsil samples of two Iberian ibexes. The micro-organism was identified as a streptococcal species based on its cellular, morphological and biochemical characteristics. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus, but the organism did not correspond to any species of this genus. The nearest phylogenetic relative of the unknown coccus from ibex was Streptococcus porci 2923-03T (96.6 % 16S rRNA gene sequence similarity). Analysis based on rpoB and sodA gene sequences revealed sequence similarity values lower than 86.0 and 83.8 %, respectively, from the type strains of recognized Streptococcus species. The novel bacterial isolate was distinguished from Streptococcus porci and other Streptococcus species using biochemical tests. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as representing a novel species of the genus Streptococcus, for which the name Streptococcus caprae sp. nov. is proposed. The type strain is DICM07-02790-1CT ( = CECT 8872T = CCUG 67170T).
NASA Technical Reports Server (NTRS)
Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.
1995-01-01
Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.
Sahajpal, Vivek; Goyal, S P
2010-06-01
The exhibits obtained in wildlife offence cases quite often present a challenging situation for the forensic expert. The selection of proper approach for analysis is vital for a successful analysis. A generalised forensic analysis approach should proceed from the use of non-destructive techniques (morphological and microscopic examination) to partially destructive and finally destructive techniques (DNA analysis). The findings of non-destructive techniques may sometime be inconclusive but they definitely help in steering further forensic analysis in a proper direction. We describe a recent case where a very small dried skin piece (<0.05 mg) with just one small trimmed guard hair (0.4 cm) on it was received for species identification. The single guard hair was examined microscopically to get an indication of the type of species. We also describe the extraction procedure with a lower amount of sample, using an automated extraction method (Qiagen Biorobot EZ1) and PCR amplification of three mitochondrial genes (16s rRNA, 12s rRNA and cytochrome b) for species identification. Microscopic examination of the single hair indicated a viverrid species but the initial DNA analysis with 16s rRNA (through NCBI BLAST) showed the highest homology (93%) with a hyaenid species (Hyaena hyaena). However, further DNA analysis based on 12s rRNA and cytochrome b gene proved that the species was indeed a viverrid i.e. Viverricula indica (small Indian civet). The highest homology shown with a Hyaenid species by the 16s rRNA sequence from the case sample was due to lack of a 16s rRNA sequence for Viverricula indica in the NCBI data base. The case highlights the importance of morphological and microscopic examinations in wildlife offence cases. With respect to DNA extraction technology we found that automatic extraction method of Biorobot EZ1 (Qiagen) is quite useful with less amount of sample (much below recommended amount). Copyright 2009 Forensic Science Society. Published by Elsevier Ireland Ltd. All rights reserved.
Koren, Omry; Knights, Dan; Gonzalez, Antonio; Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E
2013-01-01
Recent analyses of human-associated bacterial diversity have categorized individuals into 'enterotypes' or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes.
Waldron, Levi; Segata, Nicola; Knight, Rob; Huttenhower, Curtis; Ley, Ruth E.
2013-01-01
Recent analyses of human-associated bacterial diversity have categorized individuals into ‘enterotypes’ or clusters based on the abundances of key bacterial genera in the gut microbiota. There is a lack of consensus, however, on the analytical basis for enterotypes and on the interpretation of these results. We tested how the following factors influenced the detection of enterotypes: clustering methodology, distance metrics, OTU-picking approaches, sequencing depth, data type (whole genome shotgun (WGS) vs.16S rRNA gene sequence data), and 16S rRNA region. We included 16S rRNA gene sequences from the Human Microbiome Project (HMP) and from 16 additional studies and WGS sequences from the HMP and MetaHIT. In most body sites, we observed smooth abundance gradients of key genera without discrete clustering of samples. Some body habitats displayed bimodal (e.g., gut) or multimodal (e.g., vagina) distributions of sample abundances, but not all clustering methods and workflows accurately highlight such clusters. Because identifying enterotypes in datasets depends not only on the structure of the data but is also sensitive to the methods applied to identifying clustering strength, we recommend that multiple approaches be used and compared when testing for enterotypes. PMID:23326225
Zhu, Xiao-Feng; Zhang, Dian-Peng; Yang, Sen; Zhang, Qing-Wen
2017-03-01
Three yeast strains designated as S44, XF1 and XF2, respectively, were isolated from Scolytus scheryrewi Semenov of apricot tree in Shule County, Xinjiang, China, and were demonstrated to be a new member of the genus Candida by sequence comparisons of 26S rRNA gene D1/D2 domain and internal transcribed spacer (ITS) region. BLASTn alignments on NCBI showed that the similarity of 26S rRNA gene sequences of S44 (type strain) to all sequences of other Candida yeasts was very low (≦93 %). The phylogenetic tree based on the 26S rRNA gene D1/D2 domain and ITS region sequences revealed that the strain S44 is closely related to C. blattae, C. dosseyi, C. pruni, C. asparagi, C. fructus and C. musae. However, the strain S44 is distinguished from these Candida species by the physiological characteristics. Moreover, the strain S44 formed typical pseudohyphae when grown on cornmeal agar at 25 °C for 7 days, but did not form ascospores in sporulation medium for 3-4 weeks. Therefore, the name Candida xinjiangensis is proposed for the novel species, with S44 (=KCTC T 27747) as the type strain.
Karami, Solmaz; Maleki, Afshin; Karimi, Ebrahim; Poormazaheri, Helen; Zandi, Shiva; Davari, Behrooz; Salimi, Yahya Zand; Gharibi, Fardin; Kalantar, Enayatollah
2016-12-01
Recently, there has been increasing interest to clean up the soils contaminated with herbicide. Our aim was to determine the bioremediation of 2,4-dichlorophenoxyacetic acid (2,4-D) from wheat fields which have a long history of herbicide in Sanandaj. Based on our literature survey, this study is the first report to isolate and identify antimicrobial resistant bacteria from polluted wheat field soils in Sanandaj which has the capacity to degrade 2,4-D. From 150 2,4-D-exposed soil samples, five different bacteria were isolated and identified based on biochemical tests and 16S ribosomal RNA (rRNA). Pseudomonas has been the most frequently isolated genus. By sequencing the 16S rRNA gene of the isolated bacteria, the strains were detected and identified as a member of the genus Pseudomonas sp, Entrobacter sp, Bacillus sp, Seratia sp, and Staphylococcus sp. The sequence of Sanandaj 1 isolate displayed 87% similarity with the 16S rRNA gene of a Pseudomonas sp (HE995788). Similarly, all the isolates were compared to standard strains based on 16S rRNA. Small amounts of 2,4-D could be transmitted to a depth of 10-20 cm; however, in the depth of 20-40 cm, we could not detect the 2,4-D. The isolates were resistant to various antibiotics particularly, penicillin, ampicillin, and amoxicillin.
A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples
de Vries, Michel; Deijs, Martin; Canuti, Marta; van Schaik, Barbera D. C.; Faria, Nuno R.; van de Garde, Martijn D. B.; Jachimowski, Loes C. M.; Jebbink, Maarten F.; Jakobs, Marja; Luyf, Angela C. M.; Coenjaerts, Frank E. J.; Claas, Eric C. J.; Molenkamp, Richard; Koekkoek, Sylvie M.; Lammens, Christine; Leus, Frank; Goossens, Herman; Ieven, Margareta; Baas, Frank; van der Hoek, Lia
2011-01-01
In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material. PMID:21283679
Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...
2015-02-06
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less
Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.
2015-01-01
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760
Characterization of a novel variant of Mycobacterium chimaera.
van Ingen, J; Hoefsloot, W; Buijtels, P C A M; Tortoli, E; Supply, P; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D
2012-09-01
In this study, nonchromogenic mycobacteria were isolated from pulmonary samples of three patients in the Netherlands. All isolates had identical, unique 16S rRNA gene and 16S-23S ITS sequences, which were closely related to those of Mycobacterium chimaera and Mycobacterium marseillense. The biochemical features of the isolates differed slightly from those of M. chimaera, suggesting that the isolates may represent a possible separate species within the Mycobacterium avium complex (MAC). However, the cell-wall mycolic acid pattern, analysed by HPLC, and the partial sequences of the hsp65 and rpoB genes were identical to those of M. chimaera. We concluded that the isolates represent a novel variant of M. chimaera. The results of this analysis have led us to question the currently used methods of species definition for members of the genus Mycobacterium, which are based largely on 16S rRNA or rpoB gene sequencing. Definitions based on a single genetic target are likely to be insufficient. Genetic divergence, especially in the MAC, yields strains that cannot be confidently assigned to a specific species based on the analysis of a single genetic target.
Ancient DNA analysis reveals woolly rhino evolutionary relationships.
Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine
2003-09-01
With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.
Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie
2009-11-01
Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.
Molecular Detection of Campylobacter spp. in California Gull (Larus californicus) Excreta ▿ †
Lu, Jingrang; Ryu, Hodon; Santo Domingo, Jorge W.; Griffith, John F.; Ashbolt, Nicholas
2011-01-01
We examined the prevalence, quantity, and diversity of Campylobacter species in the excreta of 159 California gull (Larus californicus) samples using culture-, PCR-, and quantitative PCR (qPCR)-based detection assays. Campylobacter prevalence and abundance were relatively high in the gull excreta examined; however, C. jejuni and C. lari were detected in fewer than 2% of the isolates and DNA extracts from the fecal samples that tested positive. Moreover, molecular and sequencing data indicated that most L. californicus campylobacters were novel (<97% 16S rRNA gene sequence identity to known Campylobacter species) and not closely related to species commonly associated with human illness. Campylobacter estimates were positively related with those of fecal indicators, including a gull fecal marker based on the Catellicoccus marimammalium 16S rRNA gene. PMID:21622785
Maheux, Andrée F; Bouchard, Sébastien; Bérubé, Ève; Bergeron, Michel G
2017-06-01
The MI, Chromocult ® coliform, and Compass CC chromogenic culture-based methods used to assess water quality by the detection of Escherichia coli and total coliforms were compared in terms of their specificity and sensitivity, using 16S rRNA sequencing for colony identification. A sewage water sample was divided in 2-μL subsamples for testing by all three culture-based methods. All growing colonies were harvested and subjected to 16S rRNA sequencing. Test results showed that all E. coli colonies were correctly identified by all three methods, for a specificity and a sensitivity of 100%. However, for the total coliform detection, the MI agar, Chromocult ® coliform agar, and Compass CC agar were specific for only 69.2% (9/13), 47.2% (25/53), and 40.5% (17/42), whereas sensitive for 97.8% (45/46), 97.5% (39/40), and 85.7% (24/28), respectively. Thus, given the low level of specificity of these methods for the detection of total coliforms, confirming the identity of total coliform colonies could help to take public health decisions, in particular for cities connected to a public drinking water distribution system since the growth of few putative total coliform colonies on chromogenic agar is problematic and can lead to unnecessary and costly boiling notices from public health authorities.
Description of Drinking Water Bacterial Communities Using 16S rRNA Gene Sequence Analyses
Descriptions of bacterial communities inhabiting water distribution systems (WDS) have mainly been accomplished using culture-based approaches. Due to the inherent selective nature of culture-based approaches, the majority of bacteria inhabiting WDS remain uncharacterized. The go...
Equally parsimonious pathways through an RNA sequence space are not equally likely
NASA Technical Reports Server (NTRS)
Lee, Y. H.; DSouza, L. M.; Fox, G. E.
1997-01-01
An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.
Vd’ačný, Peter; Bourland, William A.; Orsi, William; Epstein, Slava S.; Foissner, Wilhelm
2012-01-01
The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria + Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. PMID:22789763
Vd'ačný, Peter; Bourland, William A; Orsi, William; Epstein, Slava S; Foissner, Wilhelm
2012-11-01
The class Litostomatea is a highly diverse ciliate taxon comprising hundreds of free-living and endocommensal species. However, their traditional morphology-based classification conflicts with 18S rRNA gene phylogenies indicating (1) a deep bifurcation of the Litostomatea into Rhynchostomatia and Haptoria+Trichostomatia, and (2) body polarization and simplification of the oral apparatus as main evolutionary trends in the Litostomatea. To test whether 18S rRNA molecules provide a suitable proxy for litostomatean evolutionary history, we used eighteen new ITS1-5.8S rRNA-ITS2 region sequences from various free-living litostomatean orders. These single- and multiple-locus analyses are in agreement with previous 18S rRNA gene phylogenies, supporting that both 18S rRNA gene and ITS region sequences are effective tools for resolving phylogenetic relationships among the litostomateans. Despite insertions, deletions and mutational saturations in the ITS region, the present study shows that ITS1 and ITS2 molecules can be used to infer phylogenetic relationships not only at species level but also at higher taxonomic ranks when their secondary structure information is utilized to aid alignment. Copyright © 2012 Elsevier Inc. All rights reserved.
Zhai, Bintao; Niu, Qingli; Yang, Jifei; Liu, Zhijie; Liu, Junlong; Yin, Hong; Zeng, Qiaoying
2017-02-01
Lyme disease caused by Borrelia burgdorferi sensu lato (s.l.) is a common disease of domestic animals and wildlife worldwide. Sika deer is first-grade state-protected wildlife animals in China and have economic consequences for humans. It is reported that sika deer may serve as an important reservoir host for several species of B. burgdorferi s.l. and may transmit these species to humans and animals. However, little is known about the presence of Borrelia pathogens in sika deer in China. In this study, the existence and prevalence of Borrelia sp. in sika deer from four regions of Jilin Province in China was assessed. Seventy-one blood samples of sika deer were collected and tested by nested-PCRs based on 16S ribosomal RNA (16S rRNA), outer surface protein A (OspA), flagenllin (fla), and 5S-23S rRNA intergenic spacer (5S-23S rRNA) genes of B. burgdorferi s.l. Six (8.45%) samples were positive for Borrelia sp. based on sequences of 4 genes. The positive samples were detected 18 for 16S rRNA, 10 for OspA, 16 for fla and 6 for 5S-23S, with the positive rates 25.35% (95% CI=3.8-35.6), 14.08% (95% CI=3.0-21.6), 22.54% (95% CI=4.3-36.9) and 8.45% (95% CI=1.7-22.9), respectively. Sequence analysis of the positive PCR products revealed that the partial 4 genes sequences in this study were all most similar to the sequences of B. garinii and B. burgdorferi sensu stricto (s.s.), no other Borrelia genospecies were found. This is the first report of Borrelia pathogens in sika deer in China. The findings in this study indicated that sika deer as potential natural host and may spread Lyme disease pathogen to animals, ticks, and even humans. Copyright © 2016. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lukjancenko, Oksana
2012-06-01
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
Lukjancenko, Oksana
2018-01-10
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
USDA-ARS?s Scientific Manuscript database
Previous phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species that exhibited very similar gross morphology in producing open looped (Retinaculum-Apertum) to spiral (Spira) chains...
NASA Astrophysics Data System (ADS)
De La Cruz-Agüero, José; García-Rodríguez, Francisco Javier; Cota-Gómez, Víctor Manuel; Melo-Barrera, Felipe Neri; González-Armas, Rogelio
2012-06-01
Fresh and preserved (type material) specimens of the black ghost chimaera Hydrolagus melanophasma were compared for morphometric characteristics. A molecular comparison was also performed on two mitochondrial gene sequences (12S rRNA and 16S rRNA gene sequences). While significant differences in measurements were found, the differences were not attributable to sexual dimorphism or the quality of the specimens, but to the sample size and the type of statistical tests. The result of the genetic characterization showed that 12S rRNA and 16S rRNA genes represented robust molecular markers that characterized the species.
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons
Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.
2017-01-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Gawor, Jan; Grzesiak, Jakub; Sasin-Kurowska, Joanna; Borsuk, Piotr; Gromadka, Robert; Górniak, Dorota; Świątecki, Aleksander; Aleksandrzak-Piekarczyk, Tamara; Zdanowski, Marek K
2016-07-01
Polaromonas is one of the most abundant genera found on glacier surfaces, yet its ecology remains poorly described. Investigations made to date point towards a uniform distribution of Polaromonas phylotypes across the globe. We compared 43 Polaromonas isolates obtained from surfaces of Arctic and Antarctic glaciers to address this issue. 16S rRNA gene sequences, intergenic transcribed spacers (ITS) and metabolic fingerprinting showed great differences between hemispheres but also between neighboring glaciers. Phylogenetic distance between Arctic and Antarctic isolates indicated separate species. The Arctic group clustered similarly, when constructing dendrograms based on 16S rRNA gene and ITS sequences, as well as metabolic traits. The Antarctic strains, although almost identical considering 16S rRNA genes, diverged into 2 groups based on the ITS sequences and metabolic traits, suggesting recent niche separation. Certain phenotypic traits pointed towards cell adaptation to specific conditions on a particular glacier, like varying pH levels. Collected data suggest, that seeding of glacial surfaces with Polaromonas cells transported by various means, is of greater efficiency on local than global scales. Selection mechanisms present of glacial surfaces reduce the deposited Polaromonas diversity, causing subsequent adaptation to prevailing environmental conditions. Furthermore, interactions with other supraglacial microbiota, like algae cells may drive postselectional niche separation and microevolution within the Polaromonas genus.
Brissac, Terry; Merçot, Hervé; Gros, Olivier
2011-01-01
The first studies of the 16S rRNA gene diversity of the bacterial symbionts found in lucinid clams did not clarify how symbiotic associations had evolved in this group. Indeed, although species-specific associations deriving from a putative ancestral symbiotic association have been described (coevolution scenario), associations between the same bacterial species and various host species (opportunistic scenario) have also been described. Here, we carried out a comparative molecular analysis of hosts, based on 18S and 28S rRNA gene sequences, and of symbionts, based on 16S rRNA gene sequences, to determine as to which evolutionary scenario led to modern lucinid/symbiont associations. For all sequences analyzed, we found only three bacterial symbiont species, two of which are harbored by lucinids colonizing mangrove swamps. The last symbiont is the most common and was found to be independent of biotope or depth. Another interesting feature is the similarity of ctenidial organization of lucinids from the Philippines to those described previously, with the exception that two bacterial morphotypes were observed in two different species (Gloverina rectangularis and Myrtea flabelliformis). Thus, there is apparently no specific association between Lucinidae and their symbionts, the association taking place according to which bacterial species is present in the environment. FEMS Microbiology Ecology © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. No claim to original French government works.
Tsuchida, Sayaka; Kitahara, Maki; Nguema, Pierre Philippe Mbehang; Norimitsu, Saeko; Fujita, Shiho; Yamagiwa, Juichi; Ngomanda, Alfred; Ohkuma, Moriya; Ushida, Kazunari
2014-12-01
Four strains of Gram-staining-positive, anaerobic rods were isolated from the faeces of western lowland gorillas (Gorilla gorilla gorilla). Three strains, KZ01(T), KZ02 and KZ03, were isolated at the Kyoto City Zoo, Japan, and one strain, GG02, was isolated in the Moukalaba-Doudou National Park, Gabon. These strains were investigated taxonomically. These strains belonged to the Lactobacillus reuteri phylogenetic group according to phylogenetic analysis based on 16S rRNA gene sequences and specific phenotypic characteristics. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strains KZ01(T), KZ02, KZ03 and GG02 formed a single monophyletic cluster and had a distinct line of descent. Based on sequence similarity of the 16S rRNA gene, Lactobacillus fermentum JCM 1173(T) (96.6 %) was the closest neighbour to these novel strains, although it was clear that these strains belonged to a different species. Partial pheS sequences also supported these relationships. DNA-DNA relatedness between strain KZ01(T) and L. fermentum JCM 1173(T) was less than 22 % and the DNA G+C content of strain KZ01(T) was 50.7 mol%. The cell-wall peptidoglycan type was A4β (l-Orn-d-Asp) and the major fatty acids were C16 : 0, C18 : 1ω9c and C19 : 1 cyclo 9,10. Therefore, based on phylogenetic, phenotypic and physiological evidence, these strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus gorillae sp. nov. is proposed. The type strain is KZ01(T) ( = JCM 19575(T) = DSM 28356(T)). © 2014 IUMS.
De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y
1992-01-01
The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081
Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis
2010-04-01
An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.
Zhao, Junwei; Shi, Linlin; Li, Wenchao; Wang, Jiabin; Wang, Han; Tian, Yuanyuan; Xiang, Wensheng; Wang, Xiangjing
2018-02-01
Two novel actinomycete isolates, designated strains NEAU-A4 T and NEAU-A3, were isolated from rhizosphere soil of wheat (Triticumaestivum L.) and characterized using a polyphasic approach. Morphological and chemotaxonomic characteristics of the two strains coincided with those of the genus Streptomyces. The 16S rRNA gene sequence analysis showed that the two isolates exhibited 99.6 % 16S rRNA gene sequence similarity with each other and that they were most closely related to Streptomyces violaceorectus DSM 40279 T (98.8, 99.0 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that the two strains clustered together and formed a separate subclade. Furthermore, a combination of DNA-DNA hybridization results and some physiological and biochemical properties demonstrated that the two strains could be distinguished from its closest relative. Therefore, it is proposed that strains NEAU-A4 T and NEAU-A3 should be classified as representatives of a novel species of the genus Streptomyces, for which the name Streptomycestritici sp. nov. is proposed. The type strain is NEAU-A4 T (=CGMCC 4.7393 T =DSM 104540 T ).
Microbial identification by immunohybridization assay of artificial RNA labels
NASA Technical Reports Server (NTRS)
Kourentzi, Katerina D.; Fox, George E.; Willson, Richard C.
2002-01-01
Ribosomal RNA (rRNA) and engineered stable artificial RNAs (aRNAs) are frequently used to monitor bacteria in complex ecosystems. In this work, we describe a solid-phase immunocapture hybridization assay that can be used with low molecular weight RNA targets. A biotinylated DNA probe is efficiently hybridized in solution with the target RNA, and the DNA-RNA hybrids are captured on streptavidin-coated plates and quantified using a DNA-RNA heteroduplex-specific antibody conjugated to alkaline phosphatase. The assay was shown to be specific for both 5S rRNA and low molecular weight (LMW) artificial RNAs and highly sensitive, allowing detection of as little as 5.2 ng (0.15 pmol) in the case of 5S rRNA. Target RNAs were readily detected even in the presence of excess nontarget RNA. Detection using DNA probes as small as 17 bases targeting a repetitive artificial RNA sequence in an engineered RNA was more efficient than the detection of a unique sequence.
Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.
Chun, J; Huq, A; Colwell, R R
1999-05-01
Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike
2013-12-01
Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel
2011-04-28
The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.
Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal
2005-04-11
We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.
Weber, Carolyn F.; King, Gary M.
2017-01-01
Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796
Weber, Carolyn F; King, Gary M
2017-01-01
Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).
Kudlai, Olena; Kostadinova, Aneta; Pulis, Eric E; Tkach, Vasyl V
2015-03-01
Drepanocephalus auritus n. sp. is described based on specimens from the double-crested cormorant Phalacrocorax auritus (Lesson) in North America. The new species differs from its congeners in its very narrow, elongate body, long uterine field and widely separated testes. Sequences of the nuclear rRNA gene cluster, spanning the 3' end of the nuclear ribosomal 18S rRNA gene, internal transcribed spacer region (ITS1+5.8S gene+ITS2) and partial 28S gene (2,345 bp), were identical in specimens collected from North Dakota, Minnesota and Mississippi, USA. Sequences of the 651 bp long fragment of the mitochondrial cox1 gene exhibited very low intraspecific variability (< 1%). Comparisons of the newly-generated sequences with those available in the GenBank indicate that the sequences from North America published under the name D. spathans Dietz, 1909 in fact represent D. auritus n. sp.
Complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus).
Li, Linmiao; Li, Min; Wu, Zhengjun; Chen, Jinping
2015-01-01
We have characterized the complete mitochondrial genome of Cynopterus sphinx (Pteropodidae: Cynopterus) and described its organization in this study. The total length of C. sphinx complete mitochondrial genome was 16,895 bp with the base composition of 32.54% A, 14.05% G, 25.82% T and 27.59% C. The complete mitochondrial genome included 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA) and 1 control region (D-loop). The control region was 1435 bp long with the sequence CATACG repeat 64 times. Three protein-coding genes (ND1, COI and ND4) were ended with incomplete stop codon TA or T.
Novel magnetite-producing magnetotactic bacteria belonging to the Gammaproteobacteria.
Lefèvre, Christopher T; Viloria, Nathan; Schmidt, Marian L; Pósfai, Mihály; Frankel, Richard B; Bazylinski, Dennis A
2012-02-01
Two novel magnetotactic bacteria (MTB) were isolated from sediment and water collected from the Badwater Basin, Death Valley National Park and southeastern shore of the Salton Sea, respectively, and were designated as strains BW-2 and SS-5, respectively. Both organisms are rod-shaped, biomineralize magnetite, and are motile by means of flagella. The strains grow chemolithoautotrophically oxidizing thiosulfate and sulfide microaerobically as electron donors, with thiosulfate oxidized stoichiometrically to sulfate. They appear to utilize the Calvin-Benson-Bassham cycle for autotrophy based on ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity and the presence of partial sequences of RubisCO genes. Strains BW-2 and SS-5 biomineralize chains of octahedral magnetite crystals, although the crystals of SS-5 are elongated. Based on 16S rRNA gene sequences, both strains are phylogenetically affiliated with the Gammaproteobacteria class. Strain SS-5 belongs to the order Chromatiales; the cultured bacterium with the highest 16S rRNA gene sequence identity to SS-5 is Thiohalocapsa marina (93.0%). Strain BW-2 clearly belongs to the Thiotrichales; interestingly, the organism with the highest 16S rRNA gene sequence identity to this strain is Thiohalospira alkaliphila (90.2%), which belongs to the Chromatiales. Each strain represents a new genus. This is the first report of magnetite-producing MTB phylogenetically associated with the Gammaproteobacteria. This finding is important in that it significantly expands the phylogenetic diversity of the MTB. Physiology of these strains is similar to other MTB and continues to demonstrate their potential in nitrogen, iron, carbon and sulfur cycling in natural environments.
Huang, Xuhua; Qi, Guangjun; Pan, Zhixin; Zhu, Fangrong; Huang, Yuanjiao; Wu, Yonghu
2014-11-01
A microsporidian, CmM2, was isolated from Cnaphalocrocis medinalis. The biological characters, molecular analysis and pathogenicity of CmM2 were studied. The spore of CmM2 is long oval in shape and 3.45 ± 0.25 × 1.68 ± 0.18 µm in size, the life cycle includes meronts, sporonts, sporoblasts, and spores, with typical diplokaryon in each stage, propagated in binary fission. There is positive coagulation reaction between CmM2 and the polyclonal antibody of Nosema bombycis (N.b.). CmM2 spores is binuclear, and has 10-12 polar filament coils. The small subunit ribosomal RNA (SSU rRNA) gene sequence of CmM2 was obtained by PCR amplification and sequencing, the phylogenetic tree based on SSU rRNA sequences had been constructed, and the similarity and genetic distance of SSU rRNA sequences were analyzed, showed that CmM2 was grouped in the Nosema clade. The 50% infectious concentration of CmM2 to Bombyx mori is 4.72 × 10(4) spores ml(-1) , and the germinative infection rate is 12.33%. The results showed that CmM2 is classified into genus Nosema, as Nosema sp. CmM2, and has a heavy infectivity to B. mori. The result indicated as well that it is valuable taxonomic determination for microsporidian isolates based on both biological characters and molecular evidence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Phylogeny of Kinorhyncha Based on Morphology and Two Molecular Loci
Sørensen, Martin V.; Dal Zotto, Matteo; Rho, Hyun Soo; Herranz, Maria; Sánchez, Nuria; Pardos, Fernando; Yamasaki, Hiroshi
2015-01-01
The phylogeny of Kinorhyncha was analyzed using morphology and the molecular loci 18S rRNA and 28S rRNA. The different datasets were analyzed separately and in combination, using maximum likelihood and Bayesian Inference. Bayesian inference of molecular sequence data in combination with morphology supported the division of Kinorhyncha into two major clades: Cyclorhagida comb. nov. and Allomalorhagida nom. nov. The latter clade represents a new kinorhynch class, and accommodates Dracoderes, Franciscideres, a yet undescribed genus which is closely related with Franciscideres, and the traditional homalorhagid genera. Homalorhagid monophyly was not supported by any analyses with molecular sequence data included. Analysis of the combined molecular and morphological data furthermore supported a cyclorhagid clade which included all traditional cyclorhagid taxa, except Dracoderes that no longer should be considered a cyclorhagid genus. Accordingly, Cyclorhagida is divided into three main lineages: Echinoderidae, Campyloderidae, and a large clade, ‘Kentrorhagata’, which except for species of Campyloderes, includes all species with a midterminal spine present in adult individuals. Maximum likelihood analysis of the combined datasets produced a rather unresolved tree that was not regarded in the following discussion. Results of the analyses with only molecular sequence data included were incongruent at different points. However, common for all analyses was the support of several major clades, i.e., Campyloderidae, Kentrorhagata, Echinoderidae, Dracoderidae, Pycnophyidae, and a clade with Paracentrophyes + New Genus and Franciscideres (in those analyses where the latter was included). All molecular analyses including 18S rRNA sequence data furthermore supported monophyly of Allomalorhagida. Cyclorhagid monophyly was only supported in analyses of combined 18S rRNA and 28S rRNA (both ML and BI), and only in a restricted dataset where taxa with incomplete information from 28S rRNA had been omitted. Analysis of the morphological data produced results that were similar with those from the combined molecular and morphological analysis. E.g., the morphological data also supported exclusion of Dracoderes from Cyclorhagida. The main differences between the morphological analysis and analyses based on the combined datasets include: 1) Homalorhagida appears as monophyletic in the morphological tree only, 2) the morphological analyses position Franciscideres and the new genus within Cyclorhagida near Zelinkaderidae and Cateriidae, whereas analyses including molecular data place the two genera inside Allomalorhagida, and 3) species of Campyloderes appear in a basal trichotomy within Kentrorhagata in the morphological tree, whereas analysis of the combined datasets places species of Campyloderes as a sister clade to Echinoderidae and Kentrorhagata. PMID:26200115
Shahinas, Dea; Silverman, Michael; Sittler, Taylor; Chiu, Charles; Kim, Peter; Allen-Vercoe, Emma; Weese, Scott; Wong, Andrew; Low, Donald E.; Pillai, Dylan R.
2012-01-01
ABSTRACT Fecal microbiome transplantation by low-volume enema is an effective, safe, and inexpensive alternative to antibiotic therapy for patients with chronic relapsing Clostridium difficile infection (CDI). We explored the microbial diversity of pre- and posttransplant stool specimens from CDI patients (n = 6) using deep sequencing of the 16S rRNA gene. While interindividual variability in microbiota change occurs with fecal transplantation and vancomycin exposure, in this pilot study we note that clinical cure of CDI is associated with an increase in diversity and richness. Genus- and species-level analysis may reveal a cocktail of microorganisms or products thereof that will ultimately be used as a probiotic to treat CDI. PMID:23093385
Yan, Pengze; Li, Mingcong; Wei, Guangshan; Li, Han; Gao, Zheng
2015-01-01
Nitrite-dependent anaerobic methane oxidation (n-damo) is performed by "Candidatus Methylomirabilis oxyfera" (M. oxyfera), which connects the carbon and nitrogen global nutrient cycles. In the present study, M. oxyfera-like bacteria sequences were successfully recovered from Yellow River Estuary sediments using specific primers for 16S rRNA and pmoA genes. A M. oxyfera-like sequences analysis based on the 16S rRNA gene revealed greater diversity compared with the pmoA gene; the 16S rRNA gene sequences retrieved from the Yellow River Estuary sediments belong to groups A as well as B and were mainly found in freshwater habitats. Quantitative PCR showed that 16S rRNA gene abundance varied from 9.28±0.11×10(3) to 2.10±0.13×10(5) copies g(-1) (dry weight), and the pmoA gene abundance ranged from 8.63±0.50×10(3) to 1.83±0.18×10(5) copies g(-1) (dry weight). A correlation analysis showed that the total organic carbon (TOC) and ammonium (NH4(+)) as well as the ratio of total phosphorus to total nitrogen (TP/TN) influenced the M. oxyfera-like bacteria distribution in the Yellow River Estuary sediments. These findings will aid in understanding the n-damo bacterial distribution pattern as well as their correlation with surrounding environmental factors in temperate estuarine ecosystems.
Single cell genomics of uncultured marine alveolates shows paraphyly of basal dinoflagellates.
Strassert, Jürgen F H; Karnkowska, Anna; Hehenberger, Elisabeth; Del Campo, Javier; Kolisko, Martin; Okamoto, Noriko; Burki, Fabien; Janouškovec, Jan; Poirier, Camille; Leonard, Guy; Hallam, Steven J; Richards, Thomas A; Worden, Alexandra Z; Santoro, Alyson E; Keeling, Patrick J
2018-01-01
Marine alveolates (MALVs) are diverse and widespread early-branching dinoflagellates, but most knowledge of the group comes from a few cultured species that are generally not abundant in natural samples, or from diversity analyses of PCR-based environmental SSU rRNA gene sequences. To more broadly examine MALV genomes, we generated single cell genome sequences from seven individually isolated cells. Genes expected of heterotrophic eukaryotes were found, with interesting exceptions like presence of proteorhodopsin and vacuolar H + -pyrophosphatase. Phylogenetic analysis of concatenated SSU and LSU rRNA gene sequences provided strong support for the paraphyly of MALV lineages. Dinoflagellate viral nucleoproteins were found only in MALV groups that branched as sister to dinokaryotes. Our findings indicate that multiple independent origins of several characteristics early in dinoflagellate evolution, such as a parasitic life style, underlie the environmental diversity of MALVs, and suggest they have more varied trophic modes than previously thought.
Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.
2013-01-01
While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812
No need to replace an "anomalous" primate (Primates) with an "anomalous" bear (Carnivora, Ursidae).
Gutiérrez, Eliécer E; Pine, Ronald H
2015-01-01
By means of mitochondrial 12S rRNA sequencing of putative "yeti", "bigfoot", and other "anomalous primate" hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an "anomalous primate", but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursusmaritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursusarctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropodamelanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics.
Polkinghorne, A.; Miller, T. L.; Groff, J. M.; LaPatra, S. E.; Nowak, B. F.
2013-01-01
Three cohorts of farmed yellowtail kingfish (Seriola lalandi) from South Australia were examined for Chlamydia-like organisms associated with epitheliocystis. To characterize the bacteria, 38 gill samples were processed for histopathology, electron microscopy, and 16S rRNA amplification, sequencing, and phylogenetic analysis. Microscopically, the presence of membrane-enclosed cysts was observed within the gill lamellae. Also observed was hyperplasia of the epithelial cells with cytoplasmic vacuolization and fusion of the gill lamellae. Transmission electron microscopy revealed morphological features of the reticulate and intermediate bodies typical of members of the order Chlamydiales. A novel 1,393-bp 16S chlamydial rRNA sequence was amplified from gill DNA extracted from fish in all cohorts over a 3-year period that corresponded to the 16S rRNA sequence amplified directly from laser-dissected cysts. This sequence was only 87% similar to the reported “Candidatus Piscichlamydia salmonis” (AY462244) from Atlantic salmon and Arctic charr. Phylogenetic analysis of this sequence against 35 Chlamydia and Chlamydia-like bacteria revealed that this novel bacterium belongs to an undescribed family lineage in the order Chlamydiales. Based on these observations, we propose this bacterium of yellowtail kingfish be known as “Candidatus Parilichlamydia carangidicola” and that the new family be known as “Candidatus Parilichlamydiaceae.” PMID:23275507
Molecular confirmation of Hepatozoon canis in Mauritius.
Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel
2018-01-01
In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-02-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-01-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here. PMID:10688367
Miyazaki, Akio; Shigaki, Toshiro; Koinuma, Hiroaki; Iwabuchi, Nozomu; Rauka, Gou Bue; Kembu, Alfred; Saul, Josephine; Watanabe, Kiyoto; Nijo, Takamichi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2018-01-01
Bogia coconut syndrome (BCS) is one of the lethal yellowing (LY)-type diseases associated with phytoplasma presence that are seriously threatening coconut cultivation worldwide. It has recently emerged, and is rapidly spreading in northern parts of the island of New Guinea. BCS-associated phytoplasmas collected in different regions were compared in terms of 16S rRNA gene sequences, revealing high identity among them represented by strain BCS-Bo R . Comparative analysis of the 16S rRNA gene sequences revealed that BCS-Bo R shared less than a 97.5 % similarity with other species of 'Candidatus Phytoplasma', with a maximum value of 96.08 % (with strain LY; GenBank accession no. U18747). This result indicates the necessity and propriety of a novel taxon for BCS phytoplasmas according to the recommendations of the IRPCM. Phylogenetic analysis was also conducted on 16S rRNA gene sequences, resulting in a monophyletic cluster composed of BCS-Bo R and other LY-associated phytoplasmas. Other phytoplasmas on the island of New Guinea associated with banana wilt and arecanut yellow leaf diseases showed high similarities to BCS-Bo R and were closely related to BCS phytoplasmas. Based on the uniqueness of their 16S rRNA gene sequences, a novel taxon 'Ca.Phytoplasma noviguineense' is proposed for these phytoplasmas found on the island of New Guinea, with strain BCS-Bo R (GenBank accession no. LC228755) as the reference strain. The novel taxon is described in detail, including information on the symptoms of associated diseases and additional genetic features of the secY gene and rp operon.
Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.
2000-01-01
Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993
USDA-ARS?s Scientific Manuscript database
In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...
Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun
2017-10-06
Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.
Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho
2016-01-01
DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.
Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R
As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.
NASA Technical Reports Server (NTRS)
Winker, S.; Woese, C. R.
1991-01-01
The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.
A multi-omic future for microbiome studies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jansson, Janet K.; Baker, Erin S.
2016-04-26
Microbes constitute about a third of the Earth’s biomass and play critical roles in sustaining life. While results from multiple sequence-based studies have illustrated the importance of microbial communities for human health and the environment, additional technological developments are still needed to gain more insight into their functions [1]. To date, the majority of sequencing studies have focused on the 16S rRNA gene as a phylogenetic marker. This approach has enabled exploration of microbial compositions in a range of sample types, while bypassing the need for cultivation. 16S rRNA gene sequencing has also enabled a vast majority of microorganisms nevermore » previously isolated in culture to be identified and placed into a phylogenetic context [2]. These technologies have been utilized to map the locations of microbes inhabiting various locations of the body [3]. Similarly, sequencing has been used to determine the identities and distributions of microorganisms inhabiting different ecosystems [4, 5], and efforts in single cell sequencing of the microbiome have helped fill in missing branches of the phylogenetic tree [6].« less
Sato, Mitsuharu; Miyazaki, Kentaro
2017-01-01
Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992
Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R
2006-01-01
As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639
USDA-ARS?s Scientific Manuscript database
The phylogenetic utility of sequence variation from five chloroplast DNA intergenic spacer (IGS) regions: trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM was examined in the genus Juglans. A total of seventeen taxa representing the four sections within Juglans and an outgroup taxon, ...
TaxI: a software tool for DNA barcoding using distance methods
Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel
2005-01-01
DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755
CATCh, an Ensemble Classifier for Chimera Detection in 16S rRNA Sequencing Studies
Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen
2014-01-01
In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546
Avershina, Ekaterina; Angell, Inga Leena; Simpson, Melanie; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut
2018-05-01
The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types ( Bifidobacterium longum and Enterococcus faecalis ). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis . We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.
Angell, Inga Leena; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut
2018-01-01
The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation. PMID:29724017
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil
2014-03-01
Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.
Trojan, Daniela; Schreiber, Lars; Bjerg, Jesper T; Bøggild, Andreas; Yang, Tingting; Kjeldsen, Kasper U; Schramm, Andreas
2016-07-01
Cable bacteria are long, multicellular filaments that can conduct electric currents over centimeter-scale distances. All cable bacteria identified to date belong to the deltaproteobacterial family Desulfobulbaceae and have not been isolated in pure culture yet. Their taxonomic delineation and exact phylogeny is uncertain, as most studies so far have reported only short partial 16S rRNA sequences or have relied on identification by a combination of filament morphology and 16S rRNA-targeted fluorescence in situ hybridization with a Desulfobulbaceae-specific probe. In this study, nearly full-length 16S rRNA gene sequences of 16 individual cable bacteria filaments from freshwater, salt marsh, and marine sites of four geographic locations are presented. These sequences formed a distinct, monophyletic sister clade to the genus Desulfobulbus and could be divided into six coherent, species-level clusters, arranged as two genus-level groups. The same grouping was retrieved by phylogenetic analysis of full or partial dsrAB genes encoding the dissimilatory sulfite reductase. Based on these results, it is proposed to accommodate cable bacteria within two novel candidate genera: the mostly marine "Candidatus Electrothrix", with four candidate species, and the mostly freshwater "Candidatus Electronema", with two candidate species. This taxonomic framework can be used to assign environmental sequences confidently to the cable bacteria clade, even without morphological information. Database searches revealed 185 16S rRNA gene sequences that affiliated within the clade formed by the proposed cable bacteria genera, of which 120 sequences could be assigned to one of the six candidate species, while the remaining 65 sequences indicated the existence of up to five additional species. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.
van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L
1992-10-01
The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.
Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.
Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo
2011-05-01
A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T) = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.
Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.
Mishima, Y; Mitsuma, T; Ogata, K
1985-01-01
An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977
Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S
2005-11-01
Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.
Robinett, C C; O'Connor, A; Dunaway, M
1997-01-01
We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359
Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin
2017-01-01
Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413
Lee, I-M; Bottner-Parker, K D; Zhao, Y; Bertaccini, A; Davis, R E
2012-09-01
The pigeon pea witches'-broom phytoplasma group (16SrIX) comprises diverse strains that cause numerous diseases in leguminous trees and herbaceous crops, vegetables, a fruit, a nut tree and a forest tree. At least 14 strains have been reported worldwide. Comparative phylogenetic analyses of the highly conserved 16S rRNA gene and the moderately conserved rplV (rpl22)-rpsC (rps3) and secY genes indicated that the 16SrIX group consists of at least six distinct genetic lineages. Some of these lineages cannot be readily differentiated based on analysis of 16S rRNA gene sequences alone. The relative genetic distances among these closely related lineages were better assessed by including more variable genes [e.g. ribosomal protein (rp) and secY genes]. The present study demonstrated that virtual RFLP analyses using rp and secY gene sequences allowed unambiguous identification of such lineages. A coding system is proposed to designate each distinct rp and secY subgroup in the 16SrIX group.
Li, Ou; Sun, Lihua; Guan, Chenglin; Kong, Dedong
2017-01-01
As an epiphyte orchid, Dendrobium catenatum relies on microorganisms for requisite nutrients. Metagenome pyrosequencing based on 16S rRNA and nifH genes was used to characterize the bacterial and diazotrophic communities associated with D. catenatum collected from 5 districts in China. Based on Meta-16S rRNA sequencing, 22 bacterial phyla and 699 genera were identified, distributed as 125 genera from 8 phyla and 319 genera from 10 phyla shared by all the planting bases and all the tissues, respectively. The predominant Proteobacteria varied from 71.81% (GZ) to 96.08% (YN), and Delftia (10.39–38.42%), Burkholderia (2.71–15.98%), Escherichia/Shigella (4.90–25.12%), Pseudomonas (2.68–30.72%) and Sphingomonas (1.83–2.05%) dominated in four planting bases. Pseudomonas (17.94–22.06%), Escherichia/Shigella (6.59–11.59%), Delftia (9.65–22.14%) and Burkholderia (3.12–11.05%) dominated in all the tissues. According to Meta-nifH sequencing, 4 phyla and 45 genera were identified, while 17 genera and 24 genera from 4 phyla were shared by all the planting bases and all the tissues, respectively. Burkholderia and Bradyrhizobium were the most popular in the planting bases, followed by Methylovirgula and Mesorhizobium. Mesorhizobium was the most popular in different tissues, followed by Beijerinckia, Xanthobacter, and Burkholderia. Among the genera, 39 were completely overlapped with the results based on the 16S rRNA gene. In conclusion, abundant bacteria and diazotrophs were identified in common in different tissues of D. catenatum from five planting bases, which might play a great role in the supply of nutrients such as nitrogen. The exact abundance of phylum and genus on the different tissues from different planting bases need deeper sequencing with more samples. PMID:28931073
Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio
2008-01-01
In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order—this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia. PMID:18310338
da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L
2004-01-01
To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.
Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.
Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan
2013-01-01
Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.
Suh, E R; Waring, R B
1990-01-01
It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465
Identification of Mycobacterium spp. of veterinary importance using rpoB gene sequencing
2011-01-01
Background Studies conducted on Mycobacterium spp. isolated from human patients indicate that sequencing of a 711 bp portion of the rpoB gene can be useful in assigning a species identity, particularly for members of the Mycobacterium avium complex (MAC). Given that MAC are important pathogens in livestock, companion animals, and zoo/exotic animals, we were interested in evaluating the use of rpoB sequencing for identification of Mycobacterium isolates of veterinary origin. Results A total of 386 isolates, collected over 2008 - June 2011 from 378 animals (amphibians, reptiles, birds, and mammals) underwent PCR and sequencing of a ~ 711 bp portion of the rpoB gene; 310 isolates (80%) were identified to the species level based on similarity at ≥ 98% with a reference sequence. The remaining 76 isolates (20%) displayed < 98% similarity with reference sequences and were assigned to a clade based on their location in a neighbor-joining tree containing reference sequences. For a subset of 236 isolates that received both 16S rRNA and rpoB sequencing, 167 (70%) displayed a similar species/clade assignation for both sequencing methods. For the remaining 69 isolates, species/clade identities were different with each sequencing method. Mycobacterium avium subsp. hominissuis was the species most frequently isolated from specimens from pigs, cervids, companion animals, cattle, and exotic/zoo animals. Conclusions rpoB sequencing proved useful in identifying Mycobacterium isolates of veterinary origin to clade, species, or subspecies levels, particularly for assemblages (such as the MAC) where 16S rRNA sequencing alone is not adequate to demarcate these taxa. rpoB sequencing can represent a cost-effective identification tool suitable for routine use in the veterinary diagnostic laboratory. PMID:22118247
Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2013-11-01
A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).
Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.
1998-01-01
We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678
McKee, B. D.; Habera, L.; Vrana, J. A.
1992-01-01
In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825
Using secondary structure to identify ribosomal numts: cautionary examples from the human genome.
Olson, Link E; Yoder, Anne D
2002-01-01
The identification of inadvertently sequenced mitochondrial pseudogenes (numts) is critical to any study employing mitochondrial DNA sequence data. Failure to discriminate numts correctly can confound phylogenetic reconstruction and studies of molecular evolution. This is especially problematic for ribosomal mtDNA genes. Unlike protein-coding loci, whose pseudogenes tend to accumulate diagnostic frameshift or premature stop mutations, functional ribosomal genes are not constrained to maintain a reading frame and can accumulate insertion-deletion events of varying length, particularly in nonpairing regions. Several authors have advocated using structural features of the transcribed rRNA molecule to differentiate functional mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA gene and three known 12S numts from the human genome in the context of anthropoid phylogeny and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts exhibits striking concordance with secondary structure models, with little, if any, indication of their pseudogene status, and would likely escape detection based on structural criteria alone. Furthermore, we show that the unwitting inclusion of a particularly ancient (18-25 Myr old) and surprisingly cryptic human numt in a phylogenetic analysis would yield a well-supported but dramatically incorrect conclusion regarding anthropoid relationships. Though we endorse the use of secondary structure models for inferring positional homology wholeheartedly, we caution against reliance on structural criteria for the discrimination of rRNA numts, given the potential fallibility of this approach.
NASA Astrophysics Data System (ADS)
Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng
2015-07-01
This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.
Weber, Felix; Mylnikov, Alexander P; Jürgens, Klaus; Wylezich, Claudia
2017-03-01
The study of cultured strains has a long tradition in protistological research and has greatly contributed to establishing the morphology, taxonomy, and ecology of many protist species. However, cultivation-independent techniques, based on 18S rRNA gene sequences, have demonstrated that natural protistan assemblages mainly consist of hitherto uncultured protist lineages. This mismatch impedes the linkage of environmental diversity data with the biological features of cultured strains. Thus, novel taxa need to be obtained in culture to close this knowledge gap. In this study, traditional cultivation techniques were applied to samples from coastal surface waters and from deep oxygen-depleted waters of the Baltic Sea. Based on 18S rRNA gene sequencing, 126 monoclonal cultures of heterotrophic protists were identified. The majority of the isolated strains were affiliated with already cultured and described taxa, mainly chrysophytes and bodonids. This was likely due to "culturing bias" but also to the eutrophic nature of the Baltic Sea. Nonetheless, ~ 12% of the isolates in our culture collection showed highly divergent 18S rRNA gene sequences compared to those of known organisms and thus may represent novel taxa, either at the species level or at the genus level. Moreover, we also obtained evidence that some of the isolated taxa are ecologically relevant, under certain conditions, in the Baltic Sea. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.
Phylogenetic diversity of Flavobacteria isolated from the North Sea on solid media.
Hahnke, Richard L; Harder, Jens
2013-10-01
Flavobacteria are abundant in the North Sea, an epeiric sea on the continental shelf of Europe. However, this abundance has so far not been reflected by the number of strains in culture collections. In this study, Flavobacteria were isolated from pelagic and benthic samples, such as seawater, phytoplankton, sediment and its porewater, and from surfaces of animals and seaweeds on agar plates with a variety of carbon sources. Dilution cultivation with a new medium, incubation at low temperatures and with long incubation times, and colony screening by a Flavobacteria-Cytophagia-specific PCR detecting 16S rRNA gene sequences led to a collection of phylogenetically diverse strains. Two strains affiliated with Flammeovirgaceae and seven strains affiliated with Cyclobacteriaceae, whereas within the Flavobacteriaceae 20 isolated strains presumably represented seven novel candidate genera and 355 strains affiliated with 26 of 80 validly described marine Flavobacteriaceae genera, based on a genus boundary of 95.0% 16S rRNA gene sequence identity. The majority of strains (276) affiliated with 37 known species in 16 genera (based on a boundary of 98.7% 16S rRNA gene sequence identity), whereas 79 strains likely represented 42 novel species in 22 established Flavobacteriaceae genera. Pigmentation, iridescence, gliding motility, agar lysis, and flexirubin as a chemical marker supported the taxonomy at the species level. This study demonstrated the culturability on solid medium of phylogenetically diverse Flavobacteria originating from the North Sea. Copyright © 2013 Elsevier GmbH. All rights reserved.
Arbefeville, S; Harris, A; Ferrieri, P
2017-09-01
Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU rDNA Fungal Identification Kit was equivalent to the in-house developed ITS regions assay to identify fungi at the genus level. The MycoBank database gave a better curated database and thus allowed a better genus and species identification for both D2 region of the LSU rRNA gene and ITS regions. Copyright © 2017 Elsevier B.V. All rights reserved.
Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha
2004-11-01
A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.
Zdanowski, Marek K; Weglenski, Piotr; Golik, Pawel; Sasin, Joanna M; Borsuk, Piotr; Zmuda, Magdalena J; Stankovic, Anna
2004-11-01
The total number of bacteria and culturable bacteria in Adélie penguin (Pygoscelis adeliae) guano was determined during 42 days of decomposition in a location adjacent to the rookery in Admiralty Bay, King George Island, Antarctica. Of the culturable bacteria, 72 randomly selected colonies were described using 49 morpho-physiological tests, 27 of which were subsequently considered significant in characterizing and differentiating the isolates. On the basis of the nucleotide sequence of a fragment of the 16S rRNA gene in each of 72 pure isolates, three major phylogenetic groups were identified, namely the Moraxellaceae/Pseudomonadaceae (29 isolates), the Flavobacteriaceae (14), and the Micrococcaceae (29). Grouping of the isolates on the basis of morpho-physiological tests (whether 49 or 27 parameters) showed similar results to those based on 16S rRNA gene sequences. Clusters were characterized by considerable intra-cluster variation in both 16S rRNA gene sequences and morpho-physiological responses. High diversity in abundance and morphometry of total bacterial communities during penguin guano decomposition was supported by image analysis of epifluorescence micrographs. The results indicate that the bacterial community in penguin guano is not only one of the richest in Antarctica, but is extremely diverse, both phylogenetically and morpho-physiologically.
Comparing K-mer based methods for improved classification of 16S sequences.
Vinje, Hilde; Liland, Kristian Hovde; Almøy, Trygve; Snipen, Lars
2015-07-01
The need for precise and stable taxonomic classification is highly relevant in modern microbiology. Parallel to the explosion in the amount of sequence data accessible, there has also been a shift in focus for classification methods. Previously, alignment-based methods were the most applicable tools. Now, methods based on counting K-mers by sliding windows are the most interesting classification approach with respect to both speed and accuracy. Here, we present a systematic comparison on five different K-mer based classification methods for the 16S rRNA gene. The methods differ from each other both in data usage and modelling strategies. We have based our study on the commonly known and well-used naïve Bayes classifier from the RDP project, and four other methods were implemented and tested on two different data sets, on full-length sequences as well as fragments of typical read-length. The difference in classification error obtained by the methods seemed to be small, but they were stable and for both data sets tested. The Preprocessed nearest-neighbour (PLSNN) method performed best for full-length 16S rRNA sequences, significantly better than the naïve Bayes RDP method. On fragmented sequences the naïve Bayes Multinomial method performed best, significantly better than all other methods. For both data sets explored, and on both full-length and fragmented sequences, all the five methods reached an error-plateau. We conclude that no K-mer based method is universally best for classifying both full-length sequences and fragments (reads). All methods approach an error plateau indicating improved training data is needed to improve classification from here. Classification errors occur most frequent for genera with few sequences present. For improving the taxonomy and testing new classification methods, the need for a better and more universal and robust training data set is crucial.
Das, Subhadeep; Singh, Deeksha; Madduluri, Madhavi; Chandrababunaidu, Mathu Malar; Gupta, Akash
2015-01-01
We report here the draft genome sequence of Tolypothrix campylonemoides VB511288, isolated from building facades in Santiniketan, India. The members of this genus produce several compounds of commercial importance. The draft assembly is 10,627,177 bases in 135 scaffolds, and it contains 7,886 protein-coding genes, 994 pseudogenes, 18 rRNA genes, and 76 tRNA genes. PMID:25838485
Molecular diversity of the rumen microbiome of Norwegian reindeer on natural summer pasture.
Sundset, Monica A; Edwards, Joan E; Cheng, Yan Fen; Senosiain, Roberto S; Fraile, Maria N; Northwood, Korinne S; Praesteng, Kirsti E; Glad, Trine; Mathiesen, Svein D; Wright, André-Denis G
2009-02-01
The molecular diversity of the rumen microbiome was investigated in five semi-domesticated adult female Norwegian reindeer (Rangifer tarandus tarandus) grazing on natural summer pastures on the coast of northern Norway (71.00 degrees N, 25.30 degrees E). Mean population densities (numbers per gram wet weight) of methanogenic archaea, rumen bacteria and ciliate protozoa, estimated using quantitative real-time polymerase chain reaction (PCR), were 3.17x10(9), 5.17x10(11) and 4.02x10(7), respectively. Molecular diversity of rumen methanogens was revealed using a 16S rRNA gene library (54 clones) constructed using pooled PCR products from the whole rumen contents of the five individual reindeer. Based upon a similarity criterion of <97%, a total of 19 distinct operational taxonomic units (OTUs) were identified, nine of which are potential new species. The 16S rRNA sequences generated from the reindeer rumen exhibited a high degree of sequence similarity to methanogens affiliated with the families Methanobacteriaceae (14 OTUs) and Methanosarcinaceae (one OTU). Four of the OTUs detected belonged to a group of uncultivated archaea previously found in domestic ruminants and thought to be dominant in the rumen together with Methanobrevibacter spp. Denaturing gradient gel electrophoresis profiling of the rumen bacterial 16S rRNA gene and the protozoal 18S rRNA gene indicated a high degree of animal variation, although some bands were common to all individuals. Automated ribosomal intergenic spacer analysis (ARISA) profiling of the ruminal Neocallimastigales population indicated that the reindeer are likely to contain more than one type of anaerobic fungus. The ARISA profile from one animal was distinct from the other four. This is the first molecular investigation of the ruminal methanogenic archaea in reindeer, revealing higher numbers than expected based on methane emission data available. Also, many of the reindeer archaeal 16S rRNA gene sequences were similar to those reported in domesticated ruminants in Australia, Canada, China, New Zealand and Venezuela, supporting previous findings that there seems to be no host type or geographical effect on the methanogenic archaea community structure in ruminants.
Zhang, Honghai; Chen, Lei
2011-03-01
The dhole (Cuon alpinus) is the only existent species in the genus Cuon (Carnivora: Canidae). In the present study, the complete mitochondrial genome of the dhole was sequenced. The total length is 16672 base pairs which is the shortest in Canidae. Sequence analysis revealed that most mitochondrial genomic functional regions were highly consistent among canid animals except the CSB domain of the control region. The difference in length among the Canidae mitochondrial genome sequences is mainly due to the number of short segments of tandem repeated in the CSB domain. Phylogenetic analysis was progressed based on the concatenated data set of 14 mitochondrial genes of 8 canid animals by using maximum parsimony (MP), maximum likelihood (ML) and Bayesian (BI) inference methods. The genera Vulpes and Nyctereutes formed a sister group and split first within Canidae, followed by that in the Cuon. The divergence in the genus Canis was the latest. The divarication of domestic dogs after that of the Canis lupus laniger is completely supported by all the three topologies. Pairwise sequence divergence data of different mitochondrial genes among canid animals were also determined. Except for the synonymous substitutions in protein-coding genes, the control region exhibits the highest sequence divergences. The synonymous rates are approximately two to six times higher than those of the non-synonymous sites except for a slightly higher rate in the non-synonymous substitution between Cuon alpinus and Vulpes vulpes. 16S rRNA genes have a slightly faster sequence divergence than 12S rRNA and tRNA genes. Based on nucleotide substitutions of tRNA genes and rRNA genes, the times since divergence between dhole and other canid animals, and between domestic dogs and three subspecies of wolves were evaluated. The result indicates that Vulpes and Nyctereutes have a close phylogenetic relationship and the divergence of Nyctereutes is a little earlier. The Tibetan wolf may be an archaic pedigree within wolf subspecies. The genetic distance between wolves and domestic dogs is less than that among different subspecies of wolves. The domestication of dogs was about 1.56-1.92 million years ago or even earlier.
Diversity analysis of lactic acid bacteria in takju, Korean rice wine.
Jin, Jianbo; Kim, So-Young; Jin, Qing; Eom, Hyun-Ju; Han, Nam Soo
2008-10-01
To investigate the lactic acid bacterial population in Korean traditional rice wines, biotyping was performed using cell morphology and whole-cell protein pattern analysis by SDSPAGE, and then the isolates were identified by 16S rRNA sequencing analysis. Based on the morphological characteristics, 103 LAB isolates were detected in wine samples, characterized by whole-cell protein pattern analysis, and they were then divided into 18 patterns. By gene sequencing of 16S rRNA, the isolates were identified as Lactobacillus paracasei, Lb. arizonensis, Lb. plantarum, Lb. harbinensis, Lb. parabuchneri, Lb. brevis, and Lb. hilgardii when listed by their frequency of occurrence. It was found that the difference in bacterial diversity between rice and grape wines depends on the raw materials, especially the composition of starch and glucose.
Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo
2009-04-01
For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.
High-resolution phylogenetic microbial community profiling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin
Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less
High-resolution phylogenetic microbial community profiling
Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...
2016-02-09
Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less
Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.
Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O
2008-04-01
Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.
Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes
Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.
2012-01-01
Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300
Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T
1998-01-01
Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science
Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.
2017-01-01
Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578
Fast, accurate and easy-to-pipeline methods for amplicon sequence processing
NASA Astrophysics Data System (ADS)
Antonielli, Livio; Sessitsch, Angela
2016-04-01
Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.
Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne
2011-06-01
Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences
Wright, Erik S.; Yilmaz, L. Safak
2012-01-01
DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057
Distribution and diversity of Verrucomicrobia methanotrophs in geothermal and acidic environments.
Sharp, Christine E; Smirnova, Angela V; Graham, Jaime M; Stott, Matthew B; Khadka, Roshan; Moore, Tim R; Grasby, Stephen E; Strack, Maria; Dunfield, Peter F
2014-06-01
Recently, methanotrophic members of the phylum Verrucomicrobia have been described, but little is known about their distribution in nature. We surveyed methanotrophic bacteria in geothermal springs and acidic wetlands via pyrosequencing of 16S rRNA gene amplicons. Putative methanotrophic Verrucomicrobia were found in samples covering a broad temperature range (22.5-81.6°C), but only in acidic conditions (pH 1.8-5.0) and only in geothermal environments, not in acidic bogs or fens. Phylogenetically, three 16S rRNA gene sequence clusters of putative methanotrophic Verrucomicrobia were observed. Those detected in high-temperature geothermal samples (44.1-81.6°C) grouped with known thermoacidiphilic 'Methylacidiphilum' isolates. A second group dominated in moderate-temperature geothermal samples (22.5-40.1°C) and a representative mesophilic methanotroph from this group was isolated (strain LP2A). Genome sequencing verified that strain LP2A possessed particulate methane monooxygenase, but its 16S rRNA gene sequence identity to 'Methylacidiphilum infernorum' strain V4 was only 90.6%. A third group clustered distantly with known methanotrophic Verrucomicrobia. Using pmoA-gene targeted quantitative polymerase chain reaction, two geothermal soil profiles showed a dominance of LP2A-like pmoA sequences in the cooler surface layers and 'Methylacidiphilum'-like pmoA sequences in deeper, hotter layers. Based on these results, there appears to be a thermophilic group and a mesophilic group of methanotrophic Verrucomicrobia. However, both were detected only in acidic geothermal environments. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
No need to replace an “anomalous” primate (Primates) with an “anomalous” bear (Carnivora, Ursidae)
Gutiérrez, Eliécer E.; Pine, Ronald H.
2015-01-01
Abstract By means of mitochondrial 12S rRNA sequencing of putative “yeti”, “bigfoot”, and other “anomalous primate” hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an “anomalous primate”, but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursus maritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursus arctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropoda melanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics. PMID:25829853
Koskey, Amber M.; Fisher, Jenny C.; Traudt, Mary F.; Newton, Ryan J.
2014-01-01
Gulls are prevalent in beach environments and can be a major source of fecal contamination. Gulls have been shown to harbor a high abundance of fecal indicator bacteria (FIB), such as Escherichia coli and enterococci, which can be readily detected as part of routine beach monitoring. Despite the ubiquitous presence of gull fecal material in beach environments, the associated microbial community is relatively poorly characterized. We generated comprehensive microbial community profiles of gull fecal samples using Roche 454 and Illumina MiSeq platforms to investigate the composition and variability of the gull fecal microbial community and to measure the proportion of FIB. Enterococcaceae and Enterobacteriaceae were the two most abundant families in our gull samples. Sequence comparisons between short-read data and nearly full-length 16S rRNA gene clones generated from the same samples revealed Catellicoccus marimammalium as the most numerous taxon among all samples. The identification of bacteria from gull fecal pellets cultured on membrane-Enterococcus indoxyl-β-d-glucoside (mEI) plates showed that the dominant sequences recovered in our sequence libraries did not represent organisms culturable on mEI. Based on 16S rRNA gene sequencing of gull fecal isolates cultured on mEI plates, 98.8% were identified as Enterococcus spp., 1.2% were identified as Streptococcus spp., and none were identified as C. marimammalium. Illumina deep sequencing indicated that gull fecal samples harbor significantly higher proportions of C. marimammalium 16S rRNA gene sequences (>50-fold) relative to typical mEI culturable Enterococcus spp. C. marimammalium therefore can be confidently utilized as a genetic marker to identify gull fecal pollution in the beach environment. PMID:24242244
Takeet, Michael I; Oyewusi, Adeoye J; Abakpa, Simon A V; Daramola, Olukayode O; Peters, Sunday O
2017-03-01
Adequate knowledge of the genetic diversity among Babesia species infecting dogs is necessary for a better understanding of the epidemiology and control of canine babesiosis. Hence, this study determined the genetic diversity among the Babesia rossi detected in dogs presented for routine examination in Veterinary Hospitals in Abeokuta, Nigeria. Blood were randomly collected from 209 dogs. Field-stained thin smears were made and DNA extracted from the blood. Partial region of the 18S small subunit ribosomal RNA (rRNA) gene was amplified, sequenced and analysed. Babesia species was detected in 16 (7.7%) of the dogs by microscopy. Electrophoresed PCR products from 39 (18.66%) dogs revealed band size of 450 bp and 2 (0.95%) dogs had band size of 430 bp. The sequences obtained from 450 bp amplicon displayed homology of 99.74% (387/388) with partial sequences of 18S rRNA gene of Babesia rossi in the GeneBank. Of the two sequences that had 430 bp amplicon, one was identified as T. annulata and second as T. ovis. A significantly (p<0.05) higher prevalence of B. rossi was detected by PCR compared to microscopy. The mean PCV of Babesia infected dogs was significantly (p<0.05) lower than non-infected dogs. Phylogenetic analysis revealed minimal diversity among B. rossi with the exception of one sequence that was greatly divergent from the others. This study suggests that more than one genotype of B. rossi may be in circulation among the dog population in the study area and this may have potential implication on clinical outcome of canine babesiosis.
Criado, A; Martinez, J; Buling, A; Barba, J C; Merino, S; Jefferies, R; Irwin, P J
2006-12-20
As a continuation of our studies on molecular epizootiology of piroplasmosis in Spain and other countries, we present in this contribution the finding of new hosts for some piroplasms, as well as information on their 18S rRNA gene sequences. Genetic data were complemented with sequences of apocytochrome b gene (whenever possible). The following conclusions were drawn from these molecular studies: Theileria annulata is capable of infecting dogs, since it was diagnosed in a symptomatic animal. According to cytochrome b sequences, isolates from cows and dog present slight differences. The same isolates showed, however, identical sequence in the 18S rRNA gene. This exemplifies well the usefulness of the mitochondrial gene for examining infra-specific variation. Babesia bovis is an occasional parasite of equines, since it was detected in two symptomatic horses. We found evidence of genetic polymorphism occurring in the 18S rRNA gene of Spanish T. equi-like and B. ovis isolates. B. bennetti from Spanish seagull is loosely related to B. ovis, and might represent a genetically distinct branch of babesids. A partial sequence of a cytochrome b pseudogene was obtained for the first time in Babesia canis rossi from South Africa. The pseudogene is distantly related to B. bigemina cytochrome b gene. These new findings confirm the ability of some piroplasms to infect multiple hosts, as well as the existence of a relatively wide genetic polymorphisms with respect to the cytochrome b gene. On the other hand, the existence of mtDNA-like pseudogenes of possible nuclear location in piroplasms is interesting due to their possible impact on molecular phylogeny studies.
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective
NASA Technical Reports Server (NTRS)
Gutell, R. R.; Larsen, N.; Woese, C. R.
1994-01-01
The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical modification (in the isolated rRNA), which suggests that considerable higher-order structure remains to be found (although all of it may not involve base-base interactions and so may not be detectable by comparative analysis). The agreement between the higher-order structure of the small-subunit rRNA and protection against chemical modification is not perfect, however; some bases shown to covary canonically are accessible to chemical modification (45).(ABSTRACT TRUNCATED AT 400 WORDS).
Hu, Xiaozhong; Fan, Yangbo; Warren, Alan
2015-08-01
The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.
Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.
Schmidt, Mariane; Priemé, Anders; Stougaard, Peter
2006-12-01
Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.
Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin
2013-08-01
[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.
Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L
2018-01-01
Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.
Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome
USDA-ARS?s Scientific Manuscript database
We report the first study of the bacterial microbiome of ovine interdigital skin based on 16S rRNA by pyrosequencing and conventional cloning with Sanger-sequencing. Ovine foot rot is an infectious, contagious disease of sheep that causes severe lameness and economic loss from decreased flock produc...
Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.
2009-01-01
The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351
Tremblay, Julien
2018-01-22
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien
2012-06-01
Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.
1992-01-01
Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.
Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.
Ren, Xiaopu; Li, Mingyang; Guo, Dongqi
2016-09-01
A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).
Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla
2013-01-01
Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.
2011-01-01
Theileria parasites cause a benign infection of cattle in parts of Australia where they are endemic, but have, in recent years, been suspected of being responsible for a number of outbreaks of disease in cattle near the coast of New South Wales. The objective of this study was to identify and characterize the species of Theileria in cattle on six farms in New South Wales where disease outbreaks have occurred, and compare with Theileria from three disease-free farms in Queensland that is endemic for Theileria. Special reference was made to sub-typing of T. orientalis by type-specific PCR and sequencing of the small subunit (SSU) rRNA gene, and sequence analysis of the gene encoding a polymorphic merozoite/piroplasm surface protein (MPSP) that may be under immune selection. Nucleotide sequencing of SSU rRNA and MPSP genes revealed the presence of four Theileria genotypes: T. orientalis (buffeli), T. orientalis (ikeda), T. orientalis (chitose) and T. orientalis type 4 (MPSP) or type C (SSU rRNA). The majority of animals showed mixed infections while a few showed single infection. When MPSP nucleotide sequences were translated into amino acids, base transition did not change amino acid composition of the protein product, suggesting possible silent polymorphism. The occurrence of ikeda and type 4 (type C) previously not reported to occur and silent mutation is thought to have enhanced parasite evasion of the host immune response causing the outbreak. PMID:21338493
Bourland, William; Rotterova, Johana; Čepička, Ivan
2017-06-01
Metopid ciliates occupy terrestrial, freshwater, and marine habitats worldwide, playing important roles as predominant consumers of bacteria, flagellates, algae, and diatoms in hypoxic environments. Metopus and Brachonella are the most species-rich metopid genera, however most of their species have not been studied by modern methods Here, we report the morphologic, morphometric and molecular characterization, and phylogeny of Metopus es and Brachonella contorta, both types of their respective genera, collected in a broad global sampling effort. Five strains of M. es and three strains of B. contorta were studied in detail, providing the first correlation of morphology, morphometrics, and 18S rRNA gene sequencing for both. We submitted 29 new 18S rRNA gene sequences to GenBank. Phylogenetic analyses yielded trees of similar topology. A strongly supported Metopus es clade is sister to the Brachonella contorta clade. Our analysis shows genus Metopus is not monophyletic. The monophyly of Brachonella cannot yet be determined due to lack of sequences for other species of this genus in molecular databases. Both species appear to have a global distribution. Metopus es was not found in Africa, probably reflecting low sampling effort. Strains of both species showed low 18S rRNA gene sequence divergence despite wide geographic separation. Copyright © 2016 Elsevier GmbH. All rights reserved.
The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).
Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai
2016-01-01
In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.
Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.
2000-01-01
Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239
Kent, Angela D.; Smith, Dan J.; Benson, Barbara J.; Triplett, Eric W.
2003-01-01
Culture-independent DNA fingerprints are commonly used to assess the diversity of a microbial community. However, relating species composition to community profiles produced by community fingerprint methods is not straightforward. Terminal restriction fragment length polymorphism (T-RFLP) is a community fingerprint method in which phylogenetic assignments may be inferred from the terminal restriction fragment (T-RF) sizes through the use of web-based resources that predict T-RF sizes for known bacteria. The process quickly becomes computationally intensive due to the need to analyze profiles produced by multiple restriction digests and the complexity of profiles generated by natural microbial communities. A web-based tool is described here that rapidly generates phylogenetic assignments from submitted community T-RFLP profiles based on a database of fragments produced by known 16S rRNA gene sequences. Users have the option of submitting a customized database generated from unpublished sequences or from a gene other than the 16S rRNA gene. This phylogenetic assignment tool allows users to employ T-RFLP to simultaneously analyze microbial community diversity and species composition. An analysis of the variability of bacterial species composition throughout the water column in a humic lake was carried out to demonstrate the functionality of the phylogenetic assignment tool. This method was validated by comparing the results generated by this program with results from a 16S rRNA gene clone library. PMID:14602639
Vacek, A T; Bourque, D P
1980-09-01
Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.
Das, Subhadeep; Singh, Deeksha; Madduluri, Madhavi; Chandrababunaidu, Mathu Malar; Gupta, Akash; Adhikary, Siba Prasad; Tripathy, Sucheta
2015-04-02
We report here the draft genome sequence of Tolypothrix campylonemoides VB511288, isolated from building facades in Santiniketan, India. The members of this genus produce several compounds of commercial importance. The draft assembly is 10,627,177 bases in 135 scaffolds, and it contains 7,886 protein-coding genes, 994 pseudogenes, 18 rRNA genes, and 76 tRNA genes. Copyright © 2015 Das et al.
Genomic insights into the taxonomic status of the Bacillus cereus group
Liu, Yang; Lai, Qiliang; Göker, Markus; Meier-Kolthoff, Jan P.; Wang, Meng; Sun, Yamin; Wang, Lei; Shao, Zongze
2015-01-01
The identification and phylogenetic relationships of bacteria within the Bacillus cereus group are controversial. This study aimed at determining the taxonomic affiliations of these strains using the whole-genome sequence-based Genome BLAST Distance Phylogeny (GBDP) approach. The GBDP analysis clearly separated 224 strains into 30 clusters, representing eleven known, partially merged species and accordingly 19–20 putative novel species. Additionally, 16S rRNA gene analysis, a novel variant of multi-locus sequence analysis (nMLSA) and screening of virulence genes were performed. The 16S rRNA gene sequence was not sufficient to differentiate the bacteria within this group due to its high conservation. The nMLSA results were consistent with GBDP. Moreover, a fast typing method was proposed using the pycA gene, and where necessary, the ccpA gene. The pXO plasmids and cry genes were widely distributed, suggesting little correlation with the phylogenetic positions of the host bacteria. This might explain why classifications based on virulence characteristics proved unsatisfactory in the past. In summary, this is the first large-scale and systematic study of the taxonomic status of the bacteria within the B. cereus group using whole-genome sequences, and is likely to contribute to further insights into their pathogenicity, phylogeny and adaptation to diverse environments. PMID:26373441
Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.
Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel
2017-11-01
One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).
Lee, Seung-Hun; Kim, Kyoo-Tae; Kwon, Oh-Deog; Ock, Younsung; Kim, Taeil; Choi, Donghag; Kwak, Dongmi
2016-01-01
We describe for the first time the detection of Coxiella-like bacteria (CLB), Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae) by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.
Yu, Meng; Jia, Hongmei; Zhou, Chao; Yang, Yong; Zhao, Yang; Yang, Maohua; Zou, Zhongmei
2017-05-10
As a prevalent, life-threatening and highly recurrent psychiatric illness, depression is characterized by a wide range of pathological changes; however, its etiology remains incompletely understood. Accumulating evidence supports that gut microbiota affects not only gastrointestinal physiology but also central nervous system (CNS) function and behavior through the microbiota-gut-brain axis. To assess the impact of gut microbiota on fecal metabolic phenotype in depressive conditions, an integrated approach of 16S rRNA gene sequencing combined with ultra high-performance liquid chromatography-mass spectrometry (UHPLC-MS) based metabolomics was performed in chronic variable stress (CVS)-induced depression rat model. Interestingly, depression led to significant gut microbiota changes, at the phylum and genus levels in rats treated with CVS compared to controls. The relative abundances of the bacterial genera Marvinbryantia, Corynebacterium, Psychrobacter, Christensenella, Lactobacillus, Peptostreptococcaceae incertae sedis, Anaerovorax, Clostridiales incertae sedis and Coprococcus were significantly decreased, whereas Candidatus Arthromitus and Oscillibacter were markedly increased in model rats compared with normal controls. Meanwhile, distinct changes in fecal metabolic phenotype of depressive rats were also found, including lower levels of amino acids, and fatty acids, and higher amounts of bile acids, hypoxanthine and stercobilins. Moreover, there were substantial associations of perturbed gut microbiota genera with the altered fecal metabolites, especially compounds involved in the metabolism of tryptophan and bile acids. These results showed that the gut microbiota was altered in association with fecal metabolism in depressive conditions. These findings suggest that the 16S rRNA gene sequencing and LC-MS based metabolomics approach can be further applied to assess pathogenesis of depression. Copyright © 2017 Elsevier B.V. All rights reserved.
Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P
1999-12-01
The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.
NASA Technical Reports Server (NTRS)
Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)
1999-01-01
The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.
Allers, Elke; Wright, Jody J; Konwar, Kishori M; Howes, Charles G; Beneze, Erica; Hallam, Steven J; Sullivan, Matthew B
2013-02-01
Marine Group A (MGA) is a candidate phylum of Bacteria that is ubiquitous and abundant in the ocean. Despite being prevalent, the structural and functional properties of MGA populations remain poorly constrained. Here, we quantified MGA diversity and population structure in relation to nutrients and O(2) concentrations in the oxygen minimum zone (OMZ) of the Northeast subarctic Pacific Ocean using a combination of catalyzed reporter deposition fluorescence in situ hybridization (CARD-FISH) and 16S small subunit ribosomal RNA (16S rRNA) gene sequencing (clone libraries and 454-pyrotags). Estimates of MGA abundance as a proportion of total bacteria were similar across all three methods although estimates based on CARD-FISH were consistently lower in the OMZ (5.6%±1.9%) than estimates based on 16S rRNA gene clone libraries (11.0%±3.9%) or pyrotags (9.9%±1.8%). Five previously defined MGA subgroups were recovered in 16S rRNA gene clone libraries and five novel subgroups were defined (HF770D10, P262000D03, P41300E03, P262000N21 and A714018). Rarefaction analysis of pyrotag data indicated that the ultimate richness of MGA was very nearly sampled. Spearman's rank analysis of MGA abundances by CARD-FISH and O(2) concentrations resulted in significant correlation. Analyzed in more detail by 16S rRNA pyrotag sequencing, MGA operational taxonomic units affiliated with subgroups Arctic95A-2 and A714018 comprised 0.3-2.4% of total bacterial sequences and displayed strong correlations with decreasing O(2) concentration. This study is the first comprehensive description of MGA diversity using complementary techniques. These results provide a phylogenetic framework for interpreting future studies on ecotype selection among MGA subgroups, and suggest a potentially important role for MGA in the ecology and biogeochemistry of OMZs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
2016-05-03
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Silva, F.V.; Simões-Araújo, J.L.; Silva Júnior, J.P.; Xavier, G.R.; Rumjanek, N.G.
2012-01-01
The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata) plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis) and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction) using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium. PMID:24031880
Bhusri, Benjaporn; Sariya, Ladawan; Mongkolphan, Chalisa; Suksai, Parut; Kaewchot, Supakarn; Changbunjong, Tanasak
2017-09-01
Hepatozoon spp. are protozoan parasites that infect a wide range of domestic and wild animals. The infection occurs by ingestion of an infected tick. This study was carried out to detect and characterize Hepatozoon spp. in ticks collected from captive lions ( Panthera leo ) in Thailand based on the partial 18S rRNA gene sequence. A total of 30 ticks were collected and identified as Rhipicephalus sanguineus . The collected ticks were separated into 10 tick pools by sex and life stages. Of the 10 tick pools examined, only one (10%) was found to be infected with the Hepatozoon species. Sequencing and phylogenetic analysis showed a clustering of the partial 18S rRNA gene sequence like that of H. felis from the GenBank database. This is the first report of H. felis in R. sanguineus ticks collected from captive lions in Thailand. Our results indicated that R. sanguineus may be a possible vector of feline Hepatozoon in Thailand.
NASA Technical Reports Server (NTRS)
Woese, C. R.; Achenbach, L.; Rouviere, P.; Mandelco, L.
1991-01-01
A major and too little recognized source of artifact in phylogenetic analysis of molecular sequence data is compositional difference among sequences. The problem becomes particularly acute when alignments contain ribosomal RNAs from both mesophilic and thermophilic species. Among prokaryotes the latter are considerably higher in G + C content than the former, which often results in artificial clustering of thermophilic lineages and their being placed artificially deep in phylogenetic trees. In this communication we review archaeal phylogeny in the light of this consideration, focusing in particular on the phylogenetic position of the sulfate reducing species Archaeoglobus fulgidus, using both 16S rRNA and 23S rRNA sequences. The analysis shows clearly that the previously reported deep branching of the A. fulgidus lineage (very near the base of the euryarchaeal side of the archaeal tree) is incorrect, and that the lineage actually groups with a previously recognized unit that comprises the Methanomicrobiales and extreme halophiles.
Rekadwad, Bhagwan N; Gonzalez, Juan M
2017-08-01
A report on 16S rRNA gene sequence re-analysis and digitalization is presented using Lysinibacillus species (one example) deposited in National Microbial Repositories in India. Lysinibacillus species 16S rRNA gene sequences were digitalized to provide quick response (QR) codes, Chaose Game Representation (CGR) and Frequency of Chaose Game Representation (FCGR). GC percentage, phylogenetic analysis, and principal component analysis (PCA) are tools used for the differentiation and reclassification of the strains under investigation. The seven reasons supporting the statements made by us as misclassified Lysinibacillus species deposited in National Microbial Depositories are given in this paper. Based on seven reasons, bacteria deposited in National Microbial Repositories such as Lysinibacillus and many other needs reanalyses for their exact identity. Leaves of identity with type strains of related species shows difference 2 to 8 % suggesting that reclassification is needed to correctly assign species names to the analyzed Lysinibacillus strains available in National Microbial Repositories.
Liu, Xin-Zhan; Groenewald, Marizeth; Boekhout, Teun; Bai, Feng-Yan
2018-01-01
Two strains, GT-165 T and GT-261, isolated from plant leaves collected from Gutian Mountain in Zhejiang province in China were identified as a novel species of the genus Kondoa by the sequence analysis of the internal transcribed spacer (ITS) region, the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and the RNA polymerase II second largest subunit (RPB2), complemented by physiological tests. Phylogenetic analysis based on the concatenated sequences of ITS, D1/D2 and RPB2 showed that the closest known relatives of the new species are three undescribed Kondoa species and Kondoa thailandica. The ITS and D1/D2 sequences of the new species differ from the closely related species by 11-22% and 2-9%, respectively. The name Kondoa gutianensis f.a. sp. nov. (MB 820648, holotype = CGMCC 2.5703 T ; isotype: CBS 14811 T = CGMCC 2.5703 T ) is proposed to accommodate the new taxon.
Campylobacter canadensis sp. nov., from captive whooping cranes in Canada.
Inglis, G Douglas; Hoar, Bryanne M; Whiteside, Douglas P; Morck, Douglas W
2007-11-01
Ten isolates of an unknown Campylobacter species were isolated from cloacal swabs obtained from captive adult whooping cranes (Grus americana). All isolates were identified as Campylobacter based on generic PCR and grouped with other Campylobacter species based on 23S rRNA gene sequence. None of the isolates could be identified by species-specific PCR for known taxa, and all ten isolates formed a robust clade that was very distinct from known Campylobacter species based on 16S rRNA, rpoB and cpn60 gene sequences. The results of 16S rRNA gene nucleotide sequence (
Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.
Ravikumar, S; Fredimoses, M; Gnanadesigan, M
2012-02-01
To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.
Claesson, Rolf; Sjögren, Ulf; Esberg, Anders; Brundin, Malin; Granlund, Margareta
2017-12-01
There are few reports on the bacterial species Actinomyces radicidentis in the literature. In this study, putative A. radicidentis isolates were collected from 16 root canal samples from 601 examined patients. The isolates were examined by biochemical tests, 16S rRNA gene sequencing, Arbitrarily-primed (AP-) PCR, antibiotic susceptibility testing, and MALDI-TOF analyses. In parallel, two A. radicidentis reference strains and two putative A. radicidentis isolates from United Kingdom were tested. Sixteen of the 18 isolates were confirmed as A. radicidentis. The remaining two isolates, both of which were isolated from root canals (one from Sweden and the other from the UK), but were identified as Actinomyces haliotis by sequencing ∼ 1300 base pairs of the 16S rRNA-gene. This isolates had a divergent, but between them similar, AP-PCR pattern, and a common distribution of sequence signatures in the 16S rRNA gene, but were not identified by MALDI-TOF. A. haliotis is a close relative to A. radicidentis, hitherto only been described from a sea-snail. The identity of A. haliotis was confirmed by a phylogenetic tree based on 16S rRNA gene sequences with species specific sequences included, and by additional biochemical tests. The examined bacteria exhibited similar antibiotic susceptibility patterns when tested for 10 separate antibiotic classes with E-tests (bioMérieux). The MIC 90 for β-lactams (benzylpenicillin and cefuroxime) and vancomycin was 0.5 mg/L, for colistin and ciprofloxacin 8 mg/mL and for the other antibiotic classes ≤ 25 mg/mL The isolation of A. haliotis from infected dental root canals cast doubt on the accepted opinion that all Actinomyces infections have an endogenous source. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C
2013-01-16
The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.
2012-06-01
During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.
NASA Astrophysics Data System (ADS)
Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.
2012-11-01
During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.
Chen, Tsute; Siddiqui, Huma; Olsen, Ingar
2017-01-01
Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica . All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/.
Chen, Tsute; Siddiqui, Huma; Olsen, Ingar
2017-01-01
Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica. All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/. PMID:28261563
Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, M.D.; Shoffner, J.M.; Wallace, D.C.
1996-01-22
The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients ormore » 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.« less
Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C
2015-03-11
A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-12-31
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.
Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita
2010-01-01
Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215
The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...
Root-knot nematodes in golf course greens of the western United States
USDA-ARS?s Scientific Manuscript database
A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...
Flynn, A N; Lyndon, C A; Church, D L
2013-08-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.
Peak, K. Kealy; Duncan, Kathleen E.; Luna, Vicki A.; King, Debra S.; McCarthy, Peter J.; Cannons, Andrew C.
2011-01-01
Bacillus strains with >99.7% 16S rRNA gene sequence similarity were characterized with DNA:DNA hybridization, cellular fatty acid (CFA) analysis, and testing of 100 phenotypic traits. When paired with the most closely related type strain, percent DNA:DNA similarities (% S) for six Bacillus strains were all far below the recommended 70% threshold value for species circumscription with Bacillus nealsonii. An apparent genomic group of four Bacillus strain pairings with 94%–70% S was contradicted by the failure of the strains to cluster in CFA- and phenotype-based dendrograms as well as by their differentiation with 9–13 species level discriminators such as nitrate reduction, temperature range, and acid production from carbohydrates. The novel Bacillus strains were monophyletic and very closely related based on 16S rRNA gene sequence. Coherent genomic groups were not however supported by similarly organized phenotypic clusters. Therefore, the strains were not effectively circumscribed within the taxonomic species definition. PMID:22046187
Molecular characterization of trichomonads from feces of dogs with diarrhea.
Gookin, Jody L; Birkenheuer, Adam J; St John, Victoria; Spector, Michelle; Levy, Michael G
2005-08-01
Trichomonads are occasionally observed in the feces of dogs with diarrhea. On the basis of superficial morphological appearance, these infections have been attributed to opportunistic overgrowth of the commensal, Pentatrichomonas hominis. However, molecular characterization of canine trichomonads has never been reported. This study was performed to determine, by means of rRNA gene sequence analysis, the identity of trichomonads observed in feces from dogs with diarrhea. Total DNA was isolated from fecal samples obtained from a 3-mo-old mixed breed dog and litter of German Shepherd puppies having profuse liquid diarrhea containing numerous trichomonads. Total DNA was subject to PCR amplification of partial 18S rRNA gene or 5.8S, ITS1, ITS2, and partial 18S and 28S rRNA genes using species-specific and universal primers, respectively. Products of 642 and 1864 base-pair length were amplified and cloned. On the basis of rRNA gene sequence, the trichomonads observed in the single dog and the litter of puppies shared 100% identity with Tritrichomonas foetus and P. hominis, respectively. The present study is the first to establish the molecular identity of trichomonads infecting dogs with diarrhea. These studies validate the longstanding assumption that canine trichomoniasis may be attributed to P. hominis. Importantly, these studies additionally recognize that canine trichomoniasis may also be caused by infection with T. foetus.
Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T
2017-02-01
To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.
Pechar, Radko; Killer, Jiří; Mekadim, Chahrazed; Geigerová, Martina; Rada, Vojtěch
2017-11-01
Occurrence of bifidobacteria, known as health-promoting probiotic microorganisms, in the digestive tract of wild pigs (Sus scrofa) has not been examined yet. One hundred forty-nine fructose-6-phosphate phosphoketolase positive bacterial strains were isolated from colonic content of twenty-two individuals of wild pigs originated from four localities in the Czechia. Based on PCR-DGGE technique targeting the variable V3 region of the 16S rRNA genes, strains were initially differentiated into four groups represented by: (i) probably a new Bifidobacterium species (89 strains), (ii) B. boum/B. thermophilum/B. thermacidophilum subsp. porcinum/B. thermacidophilum subsp. thermacidophilum (sub)species (49 strains), (iii) Pseudoscardovia suis (7 strains), and (iv) B. pseudolongum subsp. globosum/B. pseudolongum subsp. pseudolongum (4 strains), respectively. Given the fact that DGGE technique did not allow to differentiate the representatives of thermophilic bifidobacteria and B. pseudolongum subspecies, strains were further classified by the 16S rRNA and thrS gene sequences. Primers targeting the variable regions of the latter gene were designed to be applicable in identification and phylogeny of Bifidobacteriaceae family. The 16S rRNA-derived phylogenetic study classified members of the first group into five subgroups in a separated cluster of thermophilic bifidobacteria. Comparable results were obtained by the thrS-derived phylogenetic analysis. Remarkably, variability among thrS sequences was higher compared with 16S rRNA gene sequences. Overall, molecular genetic techniques application allowed to identify a new Bifidobacterium phylotype which is predominant in the digestive tract of examined wild pigs.
Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E
2000-09-01
Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.
Lee, I M; Bartoszyk, I M; Gundersen-Rindal, D E; Davis, R E
1997-07-01
A phylogenetic analysis by parsimony of 16S rRNA gene sequences (16S rDNA) revealed that species and subspecies of Clavibacter and Rathayibacter form a discrete monophyletic clade, paraphyletic to Corynebacterium species. Within the Clavibacter-Rathayibacter clade, four major phylogenetic groups (subclades) with a total of 10 distinct taxa were recognized: (I) species C. michiganensis; (II) species C. xyli; (III) species R. iranicus and R. tritici; and (IV) species R. rathayi. The first three groups form a monophyletic cluster, paraphyletic to R. rathayi. On the basis of the phylogeny inferred, reclassification of members of Clavibacter-Rathayibacter group is proposed. A system for classification of taxa in Clavibacter and Rathayibacter was developed based on restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S rDNA sequences. The groups delineated on the basis of RFLP patterns of 16S rDNA coincided well with the subclades delineated on the basis of phylogeny. In contrast to previous classification systems, which are based primarily on phenotypic properties and are laborious, the RFLP analyses allow for rapid differentiation among species and subspecies in the two genera.
Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions
Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake
2015-01-01
Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756
[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].
Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu
2002-12-01
Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.
Benardini, James N; Vaishampayan, Parag A; Schwendner, Petra; Swanner, Elizabeth; Fukui, Youhei; Osman, Sharif; Satomi, Masakata; Venkateswaran, Kasthuri
2011-06-01
A novel Gram-positive, motile, endospore-forming, aerobic bacterium was isolated from the NASA Phoenix Lander assembly clean room that exhibits 100 % 16S rRNA gene sequence similarity to two strains isolated from a deep subsurface environment. All strains are rod-shaped, endospore-forming bacteria, whose endospores are resistant to UV radiation up to 500 J m(-2). A polyphasic taxonomic study including traditional phenotypic tests, fatty acid analysis, 16S rRNA gene sequencing and DNA-DNA hybridization analysis was performed to characterize these novel strains. The 16S rRNA gene sequencing convincingly grouped these novel strains within the genus Paenibacillus as a separate cluster from previously described species. The similarity of 16S rRNA gene sequences among the novel strains was identical but only 98.1 to 98.5 % with their nearest neighbours Paenibacillus barengoltzii ATCC BAA-1209(T) and Paenibacillus timonensis CIP 108005(T). The menaquinone MK-7 was dominant in these novel strains as shown in other species of the genus Paenibacillus. The DNA-DNA hybridization dissociation value was <45 % with the closest related species. The novel strains had DNA G+C contents of 51.9 to 52.8 mol%. Phenotypically, the novel strains can be readily differentiated from closely related species by the absence of urease and gelatinase and the production of acids from a variety of sugars including l-arabinose. The major fatty acid was anteiso-C(15 : 0) as seen in P. barengoltzii and P. timonensis whereas the proportion of C(16 : 0) was significantly different from the closely related species. Based on phylogenetic and phenotypic results, it was concluded that these strains represent a novel species of the genus Paenibacillus, for which the name Paenibacillus phoenicis sp. nov. is proposed. The type strain is 3PO2SA(T) ( = NRRL B-59348(T) = NBRC 106274(T)).
Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F
2015-03-01
Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.
Molecular characterization of Trichuris serrata.
Ketzis, Jennifer K; Verma, Ashutosh; Burgess, Graham
2015-05-01
Trichuris serrata, a whipworm of cats, can cause inflammation in the cecum and upper portion of the large intestine. It is unknown if the virulence and pathology of T. serrata differ from Trichuris campanula, the other species in cats. Distinguishing the species based on egg size is challenging. In addition, Trichuris eggs can be difficult to distinguish from Capillaria spp. This paper presents the first molecular description of T. serrata. The 18S ribosomal RNA (rRNA) gene was sequenced from male adult worms sourced from two unrelated cats on St. Kitts. Based on the analysis of 651 base pairs, T. serrata was found to be different than any other Trichuris species for which published sequencing of the 18S rRNA gene is available. A dendrogram was developed using Molecular Evolutionary Genetics Analysis version 6.0, and evolutionary history was inferred using the minimum evolution method. T. serrata was found to be most closely related to Trichuris vulpis, the Trichuris of dogs. Further development of the methodology could enable distinguishing T. serrata, T. campanula, and Capillaria spp. infections in cats and aid in diagnosis.
Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing
NASA Astrophysics Data System (ADS)
Chen, K.
2017-01-01
With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).
Phylogenetic relationships among superfamilies of Neritimorpha (Mollusca: Gastropoda).
Uribe, Juan E; Colgan, Don; Castro, Lyda R; Kano, Yasunori; Zardoya, Rafael
2016-11-01
Despite the extraordinary morphological and ecological diversity of Neritimorpha, few studies have focused on the phylogenetic relationships of this lineage of gastropods, which includes four extant superfamilies: Neritopsoidea, Hydrocenoidea, Helicinoidea, and Neritoidea. Here, the nucleotide sequences of the complete mitochondrial genomes of Georissa bangueyensis (Hydrocenoidea), Neritina usnea (Neritoidea), and Pleuropoma jana (Helicinoidea) and the nearly complete mt genomes of Titiscania sp. (Neritopsoidea) and Theodoxus fluviatilis (Neritoidea) were determined. Phylogenetic reconstructions using probabilistic methods were based on mitochondrial (13 protein coding genes and two ribosomal rRNA genes), nuclear (partial 28S rRNA, 18S rRNA, actin, and histone H3 genes) and combined sequence data sets. All phylogenetic analyses except one converged on a single, highly supported tree in which Neritopsoidea was recovered as the sister group of a clade including Helicinoidea as the sister group of Hydrocenoidea and Neritoidea. This topology agrees with the fossil record and supports at least three independent invasions of land by neritimorph snails. The mitochondrial genomes of Titiscania sp., G. bangueyensis, N. usnea, and T. fluviatilis share the same gene organization previously described for Nerita mt genomes whereas that of P. jana has undergone major rearrangements. We sequenced about half of the mitochondrial genome of another species of Helicinoidea, Viana regina, and confirmed that this species shares the highly derived gene order of P. jana. Copyright © 2016 Elsevier Inc. All rights reserved.
Gaetbulicola byunsanensis gen. nov., sp. nov., isolated from tidal flat sediment.
Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang
2010-01-01
A Gram-negative, non-motile and pleomorphic bacterial strain, SMK-114(T), which belongs to the class Alphaproteobacteria, was isolated from a tidal flat sample collected in Byunsan, Korea. Strain SMK-114(T) grew optimally at pH 7.0-8.0 and 25-30 degrees C and in the presence of 2 % (w/v) NaCl. A neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showed that strain SMK-114(T) formed a cluster with Octadecabacter species, with which it exhibited 16S rRNA gene sequence similarity values of 95.2-95.4 %. This cluster was part of the clade comprising Thalassobius species with a bootstrap resampling value of 76.3 %. Strain SMK-114(T) exhibited 16S rRNA gene sequence similarity values of 95.1-96.3 % to members of the genus Thalassobius. It contained Q-10 as the predominant ubiquinone and C(18 : 1)omega7c as the major fatty acid. The DNA G+C content was 60.0 mol%. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-114(T) is considered to represent a novel species in a new genus for which the name Gaetbulicola byunsanensis gen. nov., sp. nov. is proposed. The type strain of Gaetbulicola byunsanensis is SMK-114(T) (=KCTC 22632(T) =CCUG 57612(T)).
Huber, R; Huber, H; Stetter, K O
2000-12-01
Ecological studies have shown that water-containing terrestrial, subterranean and submarine high-temperature environments harbor a great diversity of hyperthermophilic prokaryotes, growing fastest at temperatures of 80 degrees C or above. The investigations included cultivation, isolation and detailed analysis of these hyperthermophiles as well as in situ 16S rRNA gene sequence analysis and in situ hybridization studies. For a safe and fast isolation of novel hyperthermophiles from mixed cultures, a new, plating-independent isolation technique was developed, based on the use of a laser microscope ('optical tweezers'). This method, combined with 16S rRNA gene sequence analysis and whole-cell hybridization using fluorescently labelled oligonucleotide probes, even allows the recovery of pure cultures of phylogenetically predicted organisms harboring novel 16S rRNA gene sequences. In their natural habitats, hyperthermophiles form complex food webs, consisting of primary producers and consumers of organic material. Their metabolic potential includes various types of aerobic and anaerobic respiration and different modes of fermentation. In hydrothermal and geothermal environments, hyperthermophiles have important ecological functions in biogeochemical processes. Members of the Sulfolobales are able to mobilize heavy metals from sulfidic ores like pyrite or chalcopyrite. Biomineralization processes of hyperthermophiles include the formation of magnetite from iron or the precipitation of arsenate as realgar, a reaction performed by a novel hyperthermophile that was isolated from Pisciarelli Solfatara, Naples, Italy.
Yang, Xiumin; Sugita, Takashi; Takashima, Masako; Hiruma, Masataro; Li, Ruoyu; Sudo, Hajime; Ogawa, Hideoki; Ikeda, Shigaku
2009-04-01
Trichophyton rubrum is the most common pathogen causing dermatophytosis worldwide. Recent genetic investigations showed that the microorganism originated in Africa and then spread to Europe and North America via Asia. We investigated the intraspecific diversity of T. rubrum isolated from two closely located Asian countries, Japan and China. A total of 150 clinical isolates of T. rubrum obtained from Japanese and Chinese patients were analyzed by randomly amplified polymorphic DNA (RAPD) and DNA sequence analysis of the non-transcribed spacer (NTS) region in the rRNA gene. RAPD analysis divided the 150 strains into two major clusters, A and B. Of the Japanese isolates, 30% belonged to cluster A and 70% belonged to cluster B, whereas 91% of the Chinese isolates were in cluster A. The NTS region of the rRNA gene was divided into four major groups (I-IV) based on DNA sequencing. The majority of Japanese isolates were type IV (51%), and the majority of Chinese isolates were type III (75%). These results suggest that although Japan and China are neighboring countries, the origins of T. rubrum isolates from these countries may not be identical. These findings provide information useful for tracing the global transmission routes of T. rubrum.
Rhodes, M.W.; Kator, H.; Kotob, S.; van Berkum, P.; Kaattari, I.; Vogelbein, W.; Quinn, F.; Floyd, M.M.; Butler, W.R.; Ottinger, C.A.
2003-01-01
Slowly growing, non-pigmented mycobacteria were isolated from striped bass (Morone saxatilis) during an epizootic of mycobacteriosis in the Chesapeake Bay. Growth characteristics, acid-fastness and results of 16S rRNA gene sequencing were consistent with those of the genus Mycobacterium. A unique profile of biochemical reactions was observed among the 21 isolates. A single cluster of eight peaks identified by analysis of mycolic acids (HPLC) resembled those of reference patterns but differed in peak elution times from profiles of reference species of the Mycobacterium tuberculosis complex. One isolate (M175T) was placed within the slowly growing mycobacteria by analysis of aligned 16S rRNA gene sequences and was proximate in phylogeny to Mycobacterium ulcerans and Mycobacterium marinum. However, distinct nucleotide differences were detected in the 16S rRNA gene sequence among M175T, M. ulcerans and M. marinum (99.2% similarity). Isolate M175T could be differentiated from other slowly growing, non-pigmented mycobacteria by its inability to grow at 37??C, production of niacin and urease, absence of nitrate reductase and resistance to isoniazid (1 ??g ml-1), thiacetazone and thiophene-2-carboxylic hydrazide. Based upon these genetic and phenotypic differences, isolate M175T (= ATCC 700981T = NCTC 13215T) is proposed as the type strain of a novel species, Mycobacterium shottsii sp. nov.
Khan, Haseeb A; Arif, Ibrahim A; Bahkali, Ali H; Al Farhan, Ahmad H; Al Homaidan, Ali A
2008-10-06
This investigation was aimed to compare the inference of antelope phylogenies resulting from the 16S rRNA, cytochrome-b (cyt-b) and d-loop segments of mitochondrial DNA using three different computational models including Bayesian (BA), maximum parsimony (MP) and unweighted pair group method with arithmetic mean (UPGMA). The respective nucleotide sequences of three Oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) and an out-group (Addax nasomaculatus) were aligned and subjected to BA, MP and UPGMA models for comparing the topologies of respective phylogenetic trees. The 16S rRNA region possessed the highest frequency of conserved sequences (97.65%) followed by cyt-b (94.22%) and d-loop (87.29%). There were few transitions (2.35%) and none transversions in 16S rRNA as compared to cyt-b (5.61% transitions and 0.17% transversions) and d-loop (11.57% transitions and 1.14% transversions) while comparing the four taxa. All the three mitochondrial segments clearly differentiated the genus Addax from Oryx using the BA or UPGMA models. The topologies of all the gamma-corrected Bayesian trees were identical irrespective of the marker type. The UPGMA trees resulting from 16S rRNA and d-loop sequences were also identical (Oryx dammah grouped with Oryx leucoryx) to Bayesian trees except that the UPGMA tree based on cyt-b showed a slightly different phylogeny (Oryx dammah grouped with Oryx gazella) with a low bootstrap support. However, the MP model failed to differentiate the genus Addax from Oryx. These findings demonstrate the efficiency and robustness of BA and UPGMA methods for phylogenetic analysis of antelopes using mitochondrial markers.
Khan, Haseeb A.; Arif, Ibrahim A.; Bahkali, Ali H.; Al Farhan, Ahmad H.; Al Homaidan, Ali A.
2008-01-01
This investigation was aimed to compare the inference of antelope phylogenies resulting from the 16S rRNA, cytochrome-b (cyt-b) and d-loop segments of mitochondrial DNA using three different computational models including Bayesian (BA), maximum parsimony (MP) and unweighted pair group method with arithmetic mean (UPGMA). The respective nucleotide sequences of three Oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) and an out-group (Addax nasomaculatus) were aligned and subjected to BA, MP and UPGMA models for comparing the topologies of respective phylogenetic trees. The 16S rRNA region possessed the highest frequency of conserved sequences (97.65%) followed by cyt-b (94.22%) and d-loop (87.29%). There were few transitions (2.35%) and none transversions in 16S rRNA as compared to cyt-b (5.61% transitions and 0.17% transversions) and d-loop (11.57% transitions and 1.14% transversions) while comparing the four taxa. All the three mitochondrial segments clearly differentiated the genus Addax from Oryx using the BA or UPGMA models. The topologies of all the gamma-corrected Bayesian trees were identical irrespective of the marker type. The UPGMA trees resulting from 16S rRNA and d-loop sequences were also identical (Oryx dammah grouped with Oryx leucoryx) to Bayesian trees except that the UPGMA tree based on cyt-b showed a slightly different phylogeny (Oryx dammah grouped with Oryx gazella) with a low bootstrap support. However, the MP model failed to differentiate the genus Addax from Oryx. These findings demonstrate the efficiency and robustness of BA and UPGMA methods for phylogenetic analysis of antelopes using mitochondrial markers. PMID:19204824
Rapid Detection & Identification of Bacillus Species using MALDI-TOF/TOF and Biomarker Database
2006-06-01
rRNA sequence analysis. Multilocus enzyme electrophoresis ( MEE ) and comparative DNA sequence analysis suggest that they may represent a single species...adaptation of the MEE method [63] but with greater discrimination [64]. All of these new PCR-based subtyping methods are certainly superior and more...Demirev, P.A., Lin, J.S., Pineda , F.J., and Fenselau, C. (2001). Bioinformatics and mass spectrometry for microorganism identification: proteome-wide
Szczecińska, Monika; Sawicki, Jakub
2015-09-15
The European continent is presently colonized by nine species of the genus Pulsatilla, five of which are encountered only in mountainous regions of southwest and south-central Europe. The remaining four species inhabit lowlands in the north-central and eastern parts of the continent. Most plants of the genus Pulsatilla are rare and endangered, which is why most research efforts focused on their biology, ecology and hybridization. The objective of this study was to develop genomic resources, including complete plastid genomes and nuclear rRNA clusters, for three sympatric Pulsatilla species that are most commonly found in Central Europe. The results will supply valuable information about genetic variation, which can be used in the process of designing primers for population studies and conservation genetics research. The complete plastid genomes together with the nuclear rRNA cluster can serve as a useful tool in hybridization studies. Six complete plastid genomes and nuclear rRNA clusters were sequenced from three species of Pulsatilla using the Illumina sequencing technology. Four junctions between single copy regions and inverted repeats and junctions between the identified locally-collinear blocks (LCB) were confirmed by Sanger sequencing. Pulsatilla genomes of 120 unique genes had a total length of approximately 161-162 kb, and 21 were duplicated in the inverted repeats (IR) region. Comparative plastid genomes of newly-sequenced Pulsatilla and the previously-identified plastomes of Aconitum and Ranunculus species belonging to the family Ranunculaceae revealed several variations in the structure of the genome, but the gene content remained constant. The nuclear rRNA cluster (18S-ITS1-5.8S-ITS2-26S) of studied Pulsatilla species is 5795 bp long. Among five analyzed regions of the rRNA cluster, only Internal Transcribed Spacer 2 (ITS2) enabled the molecular delimitation of closely-related Pulsatilla patens and Pulsatilla vernalis. The determination of complete plastid genome and nuclear rRNA cluster sequences in three species of the genus Pulsatilla is an important contribution to our knowledge of the evolution and phylogeography of those endangered taxa. The resulting data can be used to identify regions that are particularly useful for barcoding, phylogenetic and phylogeographic studies. The investigated taxa can be identified at each stage of development based on their species-specific SNPs. The nuclear and plastid genomic resources enable advanced studies on hybridization, including identification of parent species, including their roles in that process. The identified nonsynonymous mutations could play an important role in adaptations to changing environments. The results of the study will also provide valuable information about the evolution of the plastome structure in the family Ranunculaceae.
Szczecińska, Monika; Sawicki, Jakub
2015-01-01
Background: The European continent is presently colonized by nine species of the genus Pulsatilla, five of which are encountered only in mountainous regions of southwest and south-central Europe. The remaining four species inhabit lowlands in the north-central and eastern parts of the continent. Most plants of the genus Pulsatilla are rare and endangered, which is why most research efforts focused on their biology, ecology and hybridization. The objective of this study was to develop genomic resources, including complete plastid genomes and nuclear rRNA clusters, for three sympatric Pulsatilla species that are most commonly found in Central Europe. The results will supply valuable information about genetic variation, which can be used in the process of designing primers for population studies and conservation genetics research. The complete plastid genomes together with the nuclear rRNA cluster can serve as a useful tool in hybridization studies. Methodology/principal findings: Six complete plastid genomes and nuclear rRNA clusters were sequenced from three species of Pulsatilla using the Illumina sequencing technology. Four junctions between single copy regions and inverted repeats and junctions between the identified locally-collinear blocks (LCB) were confirmed by Sanger sequencing. Pulsatilla genomes of 120 unique genes had a total length of approximately 161–162 kb, and 21 were duplicated in the inverted repeats (IR) region. Comparative plastid genomes of newly-sequenced Pulsatilla and the previously-identified plastomes of Aconitum and Ranunculus species belonging to the family Ranunculaceae revealed several variations in the structure of the genome, but the gene content remained constant. The nuclear rRNA cluster (18S-ITS1-5.8S-ITS2-26S) of studied Pulsatilla species is 5795 bp long. Among five analyzed regions of the rRNA cluster, only Internal Transcribed Spacer 2 (ITS2) enabled the molecular delimitation of closely-related Pulsatilla patens and Pulsatilla vernalis. Conclusions/significance: The determination of complete plastid genome and nuclear rRNA cluster sequences in three species of the genus Pulsatilla is an important contribution to our knowledge of the evolution and phylogeography of those endangered taxa. The resulting data can be used to identify regions that are particularly useful for barcoding, phylogenetic and phylogeographic studies. The investigated taxa can be identified at each stage of development based on their species-specific SNPs. The nuclear and plastid genomic resources enable advanced studies on hybridization, including identification of parent species, including their roles in that process. The identified nonsynonymous mutations could play an important role in adaptations to changing environments. The results of the study will also provide valuable information about the evolution of the plastome structure in the family Ranunculaceae. PMID:26389887
Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J
2018-05-29
Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.
Sharma, Kishor; Tollervey, David
1999-01-01
The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548
Molecular diversity of drinking water bacterial communities using 16S rRNA gene sequence analyses
Our understanding of the microbial community structure of drinking water distribution system has relied on culture-based methods. However, recent studies have suggested that the majority of bacteria inhabiting distribution systems are unable to grow on artificial media. The goal ...
Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard
2010-01-30
Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial species. Summarized, by phylogenetic learning we are able to situate and evaluate FAME-based bacterial species classification in a more informative context.
2010-01-01
Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial species. Summarized, by phylogenetic learning we are able to situate and evaluate FAME-based bacterial species classification in a more informative context. PMID:20113515
Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman
2018-01-01
The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.
[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].
Petrov, N B; Vladychenskaia, N S
2005-01-01
Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.
The rRNA evolution and procaryotic phylogeny
NASA Technical Reports Server (NTRS)
Fox, G. E.
1986-01-01
Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.
Flynn, A. N.; Lyndon, C. A.
2013-01-01
A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532
Springer, M S; Amrine, H M; Burk, A; Stanhope, M J
1999-03-01
We concatenated sequences for four mitochondrial genes (12S rRNA, tRNA valine, 16S rRNA, cytochrome b) and four nuclear genes [aquaporin, alpha 2B adrenergic receptor (A2AB), interphotoreceptor retinoid-binding protein (IRBP), von Willebrand factor (vWF)] into a multigene data set representing 11 eutherian orders (Artiodactyla, Hyracoidea, Insectivora, Lagomorpha, Macroscelidea, Perissodactyla, Primates, Proboscidea, Rodentia, Sirenia, Tubulidentata). Within this data set, we recognized nine mitochondrial partitions (both stems and loops, for each of 12S rRNA, tRNA valine, and 16S rRNA; and first, second, and third codon positions of cytochrome b) and 12 nuclear partitions (first, second, and third codon positions, respectively, of each of the four nuclear genes). Four of the 21 partitions (third positions of cytochrome b, A2AB, IRBP, and vWF) showed significant heterogeneity in base composition across taxa. Phylogenetic analyses (parsimony, minimum evolution, maximum likelihood) based on sequences for all 21 partitions provide 99-100% bootstrap support for Afrotheria and Paenungulata. With the elimination of the four partitions exhibiting heterogeneity in base composition, there is also high bootstrap support (89-100%) for cow + horse. Statistical tests reject Altungulata, Anagalida, and Ungulata. Data set heterogeneity between mitochondrial and nuclear genes is most evident when all partitions are included in the phylogenetic analyses. Mitochondrial-gene trees associate cow with horse, whereas nuclear-gene trees associate cow with hedgehog and these two with horse. However, after eliminating third positions of A2AB, IRBP, and vWF, nuclear data agree with mitochondrial data in supporting cow + horse. Nuclear genes provide stronger support for both Afrotheria and Paenungulata. Removal of third positions of cytochrome b results in improved performance for the mitochondrial genes in recovering these clades.
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D
2016-12-15
Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.
Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun
2014-07-01
Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.
Liu, Mingjian; Fan, Xinpeng; Gao, Feng; Gao, Shan; Yu, Yuhe; Warren, Alan; Huang, Jie
2016-11-01
A cryptic species of the Tetrahymena pyriformis complex, Tetrahymena australis, has been known for a long time but never properly diagnosed based on taxonomic methods. The species name is thus invalid according to the International Code of Zoological Nomenclature. Recently, a population isolated from a freshwater lake in Wuhan, China was investigated using live observations, silver staining methods and gene sequence data. This organism can be separated from other described species of the T. pyriformis complex by its relatively small body size, the number of somatic kineties and differences in sequences of two genes, namely the small subunit ribosomal RNA (SSU rRNA) and the mitochondrial cytochrome c oxidase subunit I (cox1). We compared the SSU rRNA gene sequences of all available Tetrahymena species to reveal the nucleotide differences within this genus. The sequence of the Wuhan population is identical to two sequences of a previously isolated strain of T. australis (ATCC #30831). Phylogenetic analyses indicate that these three sequences (X56167, M98015, KT334373) cluster with Tetrahymena shanghaiensis (EF070256) in a polytomy. However, sequence divergence of the cox1 gene between the Wuhan population and another strain of T. australis (ATCC #30271) is 1.4%, suggesting that these may represent different subspecies. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming
2013-01-01
Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.
Esteves, Francisco; Gaspar, Jorge; Tavares, Adélcia; Moser, Inês; Antunes, Francisco; Mansinho, Kamal; Matos, Olga
2010-03-01
Pneumocystis jirovecii pneumonia (PcP) is an important opportunistic infection among immunocompromised patients. Genetic characterization of P. jirovecii isolated from HIV-positive patients, based on identification of multiple nucleotide sequences at eight distinct loci, was achieved by using PCR with DNA sequencing and RFLP. The present study showed that the mitochondrial large-subunit rRNA (mtLSU rRNA), the cytochrome b (CYB), the superoxide dismutase (SOD), the beta-tubulin (beta-tub), the dihydrofolate reductase (DHFR) and the dihydropteroate synthase (DHPS) loci sequences were more variable and therefore giving additional information than the thioredoxin reductase (Trr1) and the thymidylate synthase (TS) genes. Genotyping at those six most informative loci enabled the identification of 48 different P. jirovecii multilocus genotypes (MLGs). Significant statistical associations between infecting P. jirovecii genotypes and patients' age groups or PcP clinical status were found. Also, mtLSU rRNA sequences and specific genotypes from other three loci (CYB, SOD, and DHFR) were statistically associated. The results suggested large recombination between most P. jirovecii MLGs. However, one MLG occurred at a higher frequency than would be expected according to panmictic expectations, suggesting linkage disequilibrium and clonal propagation. The persistence of this specific MLG may be a consequence of clonal reproduction of this successful genotypic array in a P. jirovecii population with epidemic structure. The present study provided the description of multiple genomic regions of P. jirovecii, improving the understanding of genetic variability and frequency distribution of polymorphic genotypes, and exploring the criteria of clonality by testing over-representation of MLGs.
Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui
2012-06-01
This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (<18% of sequences shared) than sites (>25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Cultivable Anaerobic Microbiota of Severe Early Childhood Caries▿¶
Tanner, A. C. R.; Mathney, J. M. J.; Kent, R. L.; Chalmers, N. I.; Hughes, C. V.; Loo, C. Y.; Pradhan, N.; Kanasi, E.; Hwang, J.; Dahlan, M. A.; Papadopolou, E.; Dewhirst, F. E.
2011-01-01
Severe early childhood caries (ECC), while strongly associated with Streptococcus mutans using selective detection (culture, PCR), has also been associated with a widely diverse microbiota using molecular cloning approaches. The aim of this study was to evaluate the microbiota of severe ECC using anaerobic culture. The microbial composition of dental plaque from 42 severe ECC children was compared with that of 40 caries-free children. Bacterial samples were cultured anaerobically on blood and acid (pH 5) agars. Isolates were purified, and partial sequences for the 16S rRNA gene were obtained from 5,608 isolates. Sequence-based analysis of the 16S rRNA isolate libraries from blood and acid agars of severe ECC and caries-free children had >90% population coverage, with greater diversity occurring in the blood isolate library. Isolate sequences were compared with taxon sequences in the Human Oral Microbiome Database (HOMD), and 198 HOMD taxa were identified, including 45 previously uncultivated taxa, 29 extended HOMD taxa, and 45 potential novel groups. The major species associated with severe ECC included Streptococcus mutans, Scardovia wiggsiae, Veillonella parvula, Streptococcus cristatus, and Actinomyces gerensceriae. S. wiggsiae was significantly associated with severe ECC children in the presence and absence of S. mutans detection. We conclude that anaerobic culture detected as wide a diversity of species in ECC as that observed using cloning approaches. Culture coupled with 16S rRNA identification identified over 74 isolates for human oral taxa without previously cultivated representatives. The major caries-associated species were S. mutans and S. wiggsiae, the latter of which is a candidate as a newly recognized caries pathogen. PMID:21289150
Preveena, Jagadesan; Bhore, Subhash J
2013-01-01
In traditional medicine, Tridax procumbens Linn. is used in the treatment of injuries and wounds. The bacterial endophytes (BEs) of medicinal plants could produce medicinally important metabolites found in their hosts; and hence, the involvement of BEs in conferring wound healing properties to T. Procumbens cannot be ruled out. But, we do not know which types of BEs are associated with T. Procumbens. The objective of this study was to investigate the fast growing and cultivable BEs associated with T. procumbens. Leaves and stems of healthy T. Procumbens plants were collected and cultivable BEs were isolated from surface-sterilized leaf and stem tissue samples using Luria-Bertani (LB) agar (medium) at standard conditions. A polymerase chain reaction was employed to amplify 16S rRNA coding gene fragments from the isolates. Cultivable endophytic bacterial isolates (EBIs) were identified using 16S rRNA gene nucleotide sequence similarity based method of bacterial identification. Altogether, 50 culturable EBIs were isolated. 16S rRNA gene nucleotide sequences analysis using the Basic Local Alignment Search Tool (BLAST) revealed identities of the EBIs. Analysis reveals that cultivable Bacillus spp., Cronobacter sakazakii, Enterobacter spp., Lysinibacillus sphaericus, Pantoea spp., Pseudomonas spp. and Terribacillus saccharophilus are associated with T. Procumbens. Based on the results, we conclude that 24 different types of culturable BEs are associated with traditionally used medicinal plant, T. Procumbens, and require further study.
Dalmay, Tamas
2018-01-01
RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379
Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.
Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N
1998-10-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.
Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria
Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.
1998-01-01
The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806
Agarivorans gilvus sp. nov. Isolated From Seaweed
USDA-ARS?s Scientific Manuscript database
A novel agarase-producing, non-endospore-forming marine bacterium WH0801T was isolated from a fresh seaweed sample collected from the coast of Weihai, China. Preliminary characterization based on 16S rRNA gene sequence analysis showed that WH0801T shared 96.1% identity with Agarivorans albus MKT 10...
Several swine-specific microbial source tracking methods are based on PCR assays targeting Bacteroidales 16S rRNA gene sequences. The limited application of these assays can be explained by the poor understanding of their molecular diversity in fecal sources and environmental wat...
Biogeography of sulfur-oxidizing Acidithiobacillus populations in extremely acidic cave biofilms
Jones, Daniel S; Schaperdoth, Irene; Macalady, Jennifer L
2016-01-01
Extremely acidic (pH 0–1.5) Acidithiobacillus-dominated biofilms known as snottites are found in sulfide-rich caves around the world. Given the extreme geochemistry and subsurface location of the biofilms, we hypothesized that snottite Acidithiobacillus populations would be genetically isolated. We therefore investigated biogeographic relationships among snottite Acidithiobacillus spp. separated by geographic distances ranging from meters to 1000s of kilometers. We determined genetic relationships among the populations using techniques with three levels of resolution: (i) 16S rRNA gene sequencing, (ii) 16S–23S intergenic transcribed spacer (ITS) region sequencing and (iii) multi-locus sequencing typing (MLST). We also used metagenomics to compare functional gene characteristics of select populations. Based on 16S rRNA genes, snottites in Italy and Mexico are dominated by different sulfur-oxidizing Acidithiobacillus spp. Based on ITS sequences, Acidithiobacillus thiooxidans strains from different cave systems in Italy are genetically distinct. Based on MLST of isolates from Italy, genetic distance is positively correlated with geographic distance both among and within caves. However, metagenomics revealed that At. thiooxidans populations from different cave systems in Italy have different sulfur oxidation pathways and potentially other significant differences in metabolic capabilities. In light of those genomic differences, we argue that the observed correlation between genetic and geographic distance among snottite Acidithiobacillus populations is partially explained by an evolutionary model in which separate cave systems were stochastically colonized by different ancestral surface populations, which then continued to diverge and adapt in situ. PMID:27187796
Rivera-Posada, J A; Pratchett, M; Cano-Gomez, A; Arango-Gomez, J D; Owens, L
2011-09-09
We used a polyphasic approach for precise identification of bacterial flora (Vibrionaceae) isolated from crown-of-thorns starfish (COTS) from Lizard Island (Great Barrier Reef, Australia) and Guam (U.S.A., Western Pacific Ocean). Previous 16S rRNA gene phylogenetic analysis was useful to allocate and identify isolates within the Photobacterium, Splendidus and Harveyi clades but failed in the identification of Vibrio harveyi-like isolates. Species of the V harveyi group have almost indistinguishable phenotypes and genotypes, and thus, identification by standard biochemical tests and 16S rRNA gene analysis is commonly inaccurate. Biochemical profiling and sequence analysis of additional topA and mreB housekeeping genes were carried out for definitive identification of 19 bacterial isolates recovered from sick and wild COTS. For 8 isolates, biochemical profiles and topA and mreB gene sequence alignments with the closest relatives (GenBank) confirmed previous 16S rRNA-based identification: V. fortis and Photobacterium eurosenbergii species (from wild COTS), and V natriegens (from diseased COTS). Further phylogenetic analysis based on topA and mreB concatenated sequences served to identify the remaining 11 V harveyi-like isolates: V. owensii and V. rotiferianus (from wild COTS), and V. owensii, V. rotiferianus, and V. harveyi (from diseased COTS). This study further confirms the reliability of topA-mreB gene sequence analysis for identification of these close species, and it reveals a wider distribution range of the potentially pathogenic V. harveyi group.
Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun
2017-08-01
We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.
An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum
NASA Technical Reports Server (NTRS)
Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.
1993-01-01
The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.
Schmitt, Bryan H; Cunningham, Scott A; Dailey, Aaron L; Gustafson, Daniel R; Patel, Robin
2013-03-01
Identification of anaerobic bacteria using phenotypic methods is often time-consuming; methods such as 16S rRNA gene sequencing are costly and may not be readily available. We evaluated 253 clinical isolates of anaerobic bacteria using the Bruker MALDI Biotyper (Bruker Daltonics, Billerica, MA) matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) system with a user-supplemented database and an on-plate formic acid-based preparation method and compared results to those of conventional identification using biochemical testing or 16S rRNA gene sequencing. A total of 179 (70.8%) and 232 (91.7%) isolates were correctly identified to the species and genus levels, respectively, using manufacturer-recommended score cutoffs. MALDI-TOF MS offers a rapid, inexpensive method for identification of anaerobic bacteria.
Strain variation in Mycobacterium marinum fish isolates.
Ucko, M; Colorni, A; Kvitt, H; Diamant, A; Zlotkin, A; Knibb, W R
2002-11-01
A molecular characterization of two Mycobacterium marinum genes, 16S rRNA and hsp65, was carried out with a total of 21 isolates from various species of fish from both marine and freshwater environments of Israel, Europe, and the Far East. The nucleotide sequences of both genes revealed that all M. marinum isolates from fish in Israel belonged to two different strains, one infecting marine (cultured and wild) fish and the other infecting freshwater (cultured) fish. A restriction enzyme map based on the nucleotide sequences of both genes confirmed the divergence of the Israeli marine isolates from the freshwater isolates and differentiated the Israeli isolates from the foreign isolates, with the exception of one of three Greek isolates from marine fish which was identical to the Israeli marine isolates. The second isolate from Greece exhibited a single base alteration in the 16S rRNA sequence, whereas the third isolate was most likely a new Mycobacterium species. Isolates from Denmark and Thailand shared high sequence homology to complete identity with reference strain ATCC 927. Combined analysis of the two gene sequences increased the detection of intraspecific variations and was thus of importance in studying the taxonomy and epidemiology of this aquatic pathogen. Whether the Israeli M. marinum strain infecting marine fish is endemic to the Red Sea and found extremely susceptible hosts in the exotic species imported for aquaculture or rather was accidentally introduced with occasional imports of fingerlings from the Mediterranean Sea could not be determined.
The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.
Kim, K S; Lee, S E; Jeong, H W; Ha, J H
1998-10-01
The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.
Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C
2012-04-01
Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.
Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins
2007-01-01
Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...
Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H
2016-03-01
A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.
Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo
2011-06-01
In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hu, Jun-Jie; Huang, Si; Wen, Tao; Esch, Gerald W; Liang, Yu; Li, Hong-Liang
2017-01-01
Sheep (Ovis aries) are intermediate hosts for at least six named species of Sarcocystis: S. tenella, S. arieticanis, S. gigantea, S. medusiformis, S. mihoensis, and S. microps. Here, only two species, S. tenella and S. arieticanis, were found in 79 of 86 sheep (91.9%) in Kunming, China, based on their morphological characteristics. Four genetic markers, i.e., 18S rRNA gene, 28S rRNA gene, mitochondrial cox1 gene, and ITS-1 region, were sequenced and characterized for the two species of Sarcocystis. Sequences of the three former markers for S. tenella shared high identities with those of S. capracanis in goats, i.e., 99.0%, 98.3%, and 93.6%, respectively; the same three marker sequences of S. arieticanis shared high identities with those of S. hircicanis in goats, i.e., 98.5%, 96.5%, and 92.5%, respectively. No sequences in GenBank were found to significantly resemble the ITS-1 regions of S. tenella and S. arieticanis. Identities of the four genetic markers for S. tenella and S. arieticanis were 96.3%, 95.4%, 82.5%, and 66.2%, respectively. © J.-J. Hu et al., published by EDP Sciences, 2017.
Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš
2013-01-01
There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757
Gene copy number variation and its significance in cyanobacterial phylogeny
2012-01-01
Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological characteristics of cyanobacteria. PMID:22894826
Streptococcus bovimastitidis sp. nov., isolated from a dairy cow with mastitis.
de Vries, Stefan P W; Hadjirin, Nazreen F; Lay, Elizabeth M; Zadoks, Ruth N; Peacock, Sharon J; Parkhill, Julian; Grant, Andrew J; McDougall, Scott; Holmes, Mark A
2018-01-01
Here we describe a new species of the genus Streptococcus that was isolated from a dairy cow with mastitis in New Zealand. Strain NZ1587 T was Gram-positive, coccus-shaped and arranged as chains, catalase and coagulase negative, γ-haemolytic and negative for Lancefield carbohydrates (A-D, F and G). The 16S rRNA sequence did not match sequences in the NCBI 16S rRNA or GreenGenes databases. Taxonomic classification of strain NZ1587 T was investigated using 16S rRNA and core genome phylogeny, genome-wide average nucleotide identity (ANI) and predicted DNA-DNA hybridisation (DDH) analyses. Phylogeny based on 16S rRNA was unable to resolve the taxonomic position of strain NZ1587 T , however NZ1587 T shared 99.4 % identity at the 16S rRNA level with a distinct branch of S. pseudoporcinus. Importantly, core genome phylogeny demonstrated that NZ1587 T grouped amongst the 'pyogenic' streptococcal species and formed a distinct branch supported by a 100 % bootstrap value. In addition, average nucleotide identity and inferred DNA-DNA hybridisation analyses showed that NZ1587 T represents a novel species. Biochemical profiling using the rapid ID 32 strep identification test enabled differentiation of strain NZ1587 T from closely related streptococcal species. In conclusion, strain NZ1587 T can be classified as a novel species, and we propose a novel taxon named Streptococcus bovimastitidis sp. nov.; the type strain is NZ1587 T . NZ1587 T has been deposited in the Culture Collection University of Gothenburg (CCUG 69277 T ) and the Belgian Co-ordinated Collections of Micro-organisms/LMG (LMG 29747).
Saha, Ratul; Donofrio, Robert S; Goeres, Darla M; Bagley, Susan T
2012-05-01
Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads.
Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra
2010-01-01
Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.
Al-Amoudi, Soha; Essack, Magbubah; Simões, Marta F; Bougouffa, Salim; Soloviev, Irina; Archer, John A C; Lafi, Feras F; Bajic, Vladimir B
2016-09-10
Microorganisms that inhabit unchartered unique soil such as in the highly saline and hot Red Sea lagoons on the Saudi Arabian coastline, represent untapped sources of potentially new bioactive compounds. In this study, a culture-dependent approach was applied to three types of sediments: mangrove mud (MN), microbial mat (MM), and barren soil (BS), collected from Rabigh harbor lagoon (RHL) and Al-Kharrar lagoon (AKL). The isolated bacteria were evaluated for their potential to produce bioactive compounds. The phylogenetic characterization of 251 bacterial isolates based on the 16S rRNA gene sequencing, supported their assignment to five different phyla: Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, and Planctomycetes. Fifteen putative novel species were identified based on a 16S rRNA gene sequence similarity to other strain sequences in the NCBI database, being ≤98%. We demonstrate that 49 of the 251 isolates exhibit the potential to produce antimicrobial compounds. Additionally, at least one type of biosynthetic gene sequence, responsible for the synthesis of secondary metabolites, was recovered from 25 of the 49 isolates. Moreover, 10 of the isolates had a growth inhibition effect towards Staphylococcus aureus, Salmonella typhimurium and Pseudomonas syringae. We report the previously unknown antimicrobial activity of B. borstelensis, P. dendritiformis and M. salipaludis against all three indicator pathogens. Our study demonstrates the evidence of diverse cultured microbes associated with the Red Sea harbor/lagoon environments and their potential to produce antimicrobial compounds.
Detection of Low-Level Cardinium and Wolbachia Infections in Culicoides
Mee, Peter T.; Weeks, Andrew R.; Walker, Peter J.; Hoffmann, Ary A.
2015-01-01
Bacterial endosymbionts have been identified as potentially useful biological control agents for a range of invertebrate vectors of disease. Previous studies of Culicoides (Diptera: Ceratopogonidae) species using conventional PCR assays have provided evidence of Wolbachia (1/33) and Cardinium (8/33) infections. Here, we screened 20 species of Culicoides for Wolbachia and Cardinium, utilizing a combination of conventional PCR and more sensitive quantitative PCR (qPCR) assays. Low levels of Cardinium DNA were detected in females of all but one of the Culicoides species screened, and low levels of Wolbachia were detected in females of 9 of the 20 Culicoides species. Sequence analysis based on partial 16S rRNA gene and gyrB sequences identified “Candidatus Cardinium hertigii” from group C, which has previously been identified in Culicoides from Japan, Israel, and the United Kingdom. Wolbachia strains detected in this study showed 98 to 99% sequence identity to Wolbachia previously detected from Culicoides based on the 16S rRNA gene, whereas a strain with a novel wsp sequence was identified in Culicoides narrabeenensis. Cardinium isolates grouped to geographical regions independent of the host Culicoides species, suggesting possible geographical barriers to Cardinium movement. Screening also identified Asaia bacteria in Culicoides. These findings point to a diversity of low-level endosymbiont infections in Culicoides, providing candidates for further characterization and highlighting the widespread occurrence of these endosymbionts in this insect group. PMID:26150447
Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min
2009-01-01
A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).
Liu, Zhenqiu; Hsiao, William; Cantarel, Brandi L; Drábek, Elliott Franco; Fraser-Liggett, Claire
2011-12-01
Direct sequencing of microbes in human ecosystems (the human microbiome) has complemented single genome cultivation and sequencing to understand and explore the impact of commensal microbes on human health. As sequencing technologies improve and costs decline, the sophistication of data has outgrown available computational methods. While several existing machine learning methods have been adapted for analyzing microbiome data recently, there is not yet an efficient and dedicated algorithm available for multiclass classification of human microbiota. By combining instance-based and model-based learning, we propose a novel sparse distance-based learning method for simultaneous class prediction and feature (variable or taxa, which is used interchangeably) selection from multiple treatment populations on the basis of 16S rRNA sequence count data. Our proposed method simultaneously minimizes the intraclass distance and maximizes the interclass distance with many fewer estimated parameters than other methods. It is very efficient for problems with small sample sizes and unbalanced classes, which are common in metagenomic studies. We implemented this method in a MATLAB toolbox called MetaDistance. We also propose several approaches for data normalization and variance stabilization transformation in MetaDistance. We validate this method on several real and simulated 16S rRNA datasets to show that it outperforms existing methods for classifying metagenomic data. This article is the first to address simultaneous multifeature selection and class prediction with metagenomic count data. The MATLAB toolbox is freely available online at http://metadistance.igs.umaryland.edu/. zliu@umm.edu Supplementary data are available at Bioinformatics online.
Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).
Douzery, E; Catzeflis, F M
1995-11-01
The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.
SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.
Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver
2012-07-15
In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.
Miftahussurur, Muhammad; Syam, Ari Fahrial; Nusi, Iswan Abbas; Makmun, Dadang; Waskito, Langgeng Agung; Zein, Lukman Hakim; Akil, Fardah; Uwan, Willy Brodus; Simanjuntak, David; Wibawa, I Dewa Nyoman; Waleleng, Jimmy Bradley; Saudale, Alexander Michael Joseph; Yusuf, Fauzi; Mustika, Syifa; Adi, Pangestu; Maimunah, Ummi; Maulahela, Hasan; Rezkitha, Yudith Annisa Ayu; Subsomwong, Phawinee; Nasronudin; Rahardjo, Dadik; Suzuki, Rumiko; Akada, Junko; Yamaoka, Yoshio
2016-01-01
Information regarding Helicobacter pylori antibiotic resistance in Indonesia was previously inadequate. We assessed antibiotic susceptibility for H. pylori in Indonesia, and determined the association between virulence genes or genetic mutations and antibiotic resistance. We recruited 849 dyspeptic patients who underwent endoscopy in 11 cities in Indonesia. E-test was used to determine the minimum inhibitory concentration of five antibiotics. PCR-based sequencing assessed mutations in 23S rRNA, rdxA, gyrA, gyrB, and virulence genes. Next generation sequencing was used to obtain full-length sequences of 23S rRNA, infB, and rpl22. We cultured 77 strains and identified 9.1% with clarithromycin resistance. Low prevalence was also found for amoxicillin and tetracycline resistance (5.2% and 2.6%, respectively). In contrast, high resistance rates to metronidazole (46.7%) and levofloxacin (31.2%) were demonstrated. Strains isolated from Sumatera Island had significantly higher metronidazole resistance than those from other locations. Metronidazole resistant strains had highly distributed rdxA amino acid substitutions and the 23S rRNA A2143G mutation was associated with clarithromycin resistance (42.9%). However, one strain with the highest MIC value had a novel mutation in rpl22 without an A2143G mutation. Mutation at Asn-87 and/or Asp-91 of gyrA was associated with levofloxacin-resistance and was related to gyrB mutations. In conclusions, although this is a pilot study for a larger survey, our current data show that Indonesian strains had the high prevalence of metronidazole and levofloxacin resistance with low prevalence of clarithromycin, amoxicillin, and tetracycline resistance. Nevertheless, clarithromycin- or metronidazole-based triple therapy should be administered with caution in some regions of Indonesia. PMID:27906990
Miftahussurur, Muhammad; Syam, Ari Fahrial; Nusi, Iswan Abbas; Makmun, Dadang; Waskito, Langgeng Agung; Zein, Lukman Hakim; Akil, Fardah; Uwan, Willy Brodus; Simanjuntak, David; Wibawa, I Dewa Nyoman; Waleleng, Jimmy Bradley; Saudale, Alexander Michael Joseph; Yusuf, Fauzi; Mustika, Syifa; Adi, Pangestu; Maimunah, Ummi; Maulahela, Hasan; Rezkitha, Yudith Annisa Ayu; Subsomwong, Phawinee; Nasronudin; Rahardjo, Dadik; Suzuki, Rumiko; Akada, Junko; Yamaoka, Yoshio
2016-01-01
Information regarding Helicobacter pylori antibiotic resistance in Indonesia was previously inadequate. We assessed antibiotic susceptibility for H. pylori in Indonesia, and determined the association between virulence genes or genetic mutations and antibiotic resistance. We recruited 849 dyspeptic patients who underwent endoscopy in 11 cities in Indonesia. E-test was used to determine the minimum inhibitory concentration of five antibiotics. PCR-based sequencing assessed mutations in 23S rRNA, rdxA, gyrA, gyrB, and virulence genes. Next generation sequencing was used to obtain full-length sequences of 23S rRNA, infB, and rpl22. We cultured 77 strains and identified 9.1% with clarithromycin resistance. Low prevalence was also found for amoxicillin and tetracycline resistance (5.2% and 2.6%, respectively). In contrast, high resistance rates to metronidazole (46.7%) and levofloxacin (31.2%) were demonstrated. Strains isolated from Sumatera Island had significantly higher metronidazole resistance than those from other locations. Metronidazole resistant strains had highly distributed rdxA amino acid substitutions and the 23S rRNA A2143G mutation was associated with clarithromycin resistance (42.9%). However, one strain with the highest MIC value had a novel mutation in rpl22 without an A2143G mutation. Mutation at Asn-87 and/or Asp-91 of gyrA was associated with levofloxacin-resistance and was related to gyrB mutations. In conclusions, although this is a pilot study for a larger survey, our current data show that Indonesian strains had the high prevalence of metronidazole and levofloxacin resistance with low prevalence of clarithromycin, amoxicillin, and tetracycline resistance. Nevertheless, clarithromycin- or metronidazole-based triple therapy should be administered with caution in some regions of Indonesia.
Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.
2013-01-01
Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416
Fontana, Carla; Favaro, Marco; Pelliccioni, Marco; Pistoia, Enrico Salvatore; Favalli, Cartesio
2005-01-01
Reliable automated identification and susceptibility testing of clinically relevant bacteria is an essential routine for microbiology laboratories, thus improving patient care. Examples of automated identification systems include the Phoenix (Becton Dickinson) and the VITEK 2 (bioMérieux). However, more and more frequently, microbiologists must isolate “difficult” strains that automated systems often fail to identify. An alternative approach could be the genetic identification of isolates; this is based on 16S rRNA gene sequencing and analysis. The aim of the present study was to evaluate the possible use of MicroSeq 500 (Applera) for sequencing the 16S rRNA gene to identify isolates whose identification is unobtainable by conventional systems. We analyzed 83 “difficult” clinical isolates: 25 gram-positive and 58 gram-negative strains that were contemporaneously identified by both systems—VITEK 2 and Phoenix—while genetic identification was performed by using the MicroSeq 500 system. The results showed that phenotypic identifications by VITEK 2 and Phoenix were remarkably similar: 74% for gram-negative strains (43 of 58) and 80% for gram-positive strains were concordant by both systems and also concordant with genetic characterization. The exceptions were the 15 gram-negative and 9 gram-positive isolates whose phenotypic identifications were contrasting or inconclusive. For these, the use of MicroSeq 500 was fundamental to achieving species identification. In clinical microbiology the use of MicroSeq 500, particularly for strains with ambiguous biochemical profiles (including slow-growing strains), identifies strains more easily than do conventional systems. Moreover, MicroSeq 500 is easy to use and cost-effective, making it applicable also in the clinical laboratory. PMID:15695654
Zhang, Junyi; Zhu, Congming; Guan, Rui; Xiong, Zhipeng; Zhang, Wen; Shi, Junzhe; Sheng, Yi; Zhu, Bingchuan; Tu, Jing; Ge, Qinyu; Chen, Ting; Lu, Zuhong
2017-05-01
Understanding of the bacterial community structure in drinking water resources helps to enhance the security of municipal water supplies. In this study, bacterial communities were surveyed in water and sediment during a heavy cyanobacterial bloom in a drinking water resource of Lake Taihu, China. A total of 325,317 high-quality sequences were obtained from different 16S ribosomal RNA (rRNA) regions (V3, V4, and V6) using the Miseq sequencing platform. A notable difference was shown between the water and sediment samples, as predominated by Cyanobacteria, Proteobacteria, and Actinobacteria in the water and Proteobacteria, Chloroflexi, and Verrucomicrobia in the sediment, respectively. The LD12 family dominated the water surface and was tightly associated with related indicators of cyanobacterial propagation, indicating involvement in the massive proliferation of cyanobacterial blooms. Alternatively, the genus Nitrospira dominated the sediment samples, which indicates that nitrite oxidation was very active in the sediment. Although pathogenic bacteria were not detected in a large amount, some genera such as Mycobacterium, Acinetobacter, and Legionella were still identified but in very low abundance. In addition, the effects of different V regions on bacterial diversity survey were evaluated. Overall, V4 and V3 were proven to be more promising V regions for bacterial diversity survey in water and sediment samples during heavy water blooms in Lake Taihu, respectively. As longer, cheaper, and faster DNA sequencing technologies become more accessible, we expect that bacterial community structures based on 16S rRNA amplicons as an indicator could be used alongside with physical and chemical indicators, to conduct comprehensive assessments for drinking water resource management.
Staley, C.; Sadowsky, M. J.; Gyawali, P.; Sidhu, J. P. S.; Palmer, A.; Beale, D. J.; Toze, S.
2015-01-01
In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (<3% of sequence reads). Source contributions determined via sequence analysis versus detection of molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. PMID:26231650
Jones, Christopher M; Stres, Blaz; Rosenquist, Magnus; Hallin, Sara
2008-09-01
Denitrification is a facultative respiratory pathway in which nitrite (NO2(-)), nitric oxide (NO), and nitrous oxide (N2O) are successively reduced to nitrogen gas (N(2)), effectively closing the nitrogen cycle. The ability to denitrify is widely dispersed among prokaryotes, and this polyphyletic distribution has raised the possibility of horizontal gene transfer (HGT) having a substantial role in the evolution of denitrification. Comparisons of 16S rRNA and denitrification gene phylogenies in recent studies support this possibility; however, these results remain speculative as they are based on visual comparisons of phylogenies from partial sequences. We reanalyzed publicly available nirS, nirK, norB, and nosZ partial sequences using Bayesian and maximum likelihood phylogenetic inference. Concomitant analysis of denitrification genes with 16S rRNA sequences from the same organisms showed substantial differences between the trees, which were supported by examining the posterior probability of monophyletic constraints at different taxonomic levels. Although these differences suggest HGT of denitrification genes, the presence of structural variants for nirK, norB, and nosZ makes it difficult to determine HGT from other evolutionary events. Additional analysis using phylogenetic networks and likelihood ratio tests of phylogenies based on full-length sequences retrieved from genomes also revealed significant differences in tree topologies among denitrification and 16S rRNA gene phylogenies, with the exception of the nosZ gene phylogeny within the data set of the nirK-harboring genomes. However, inspection of codon usage and G + C content plots from complete genomes gave no evidence for recent HGT. Instead, the close proximity of denitrification gene copies in the genomes of several denitrifying bacteria suggests duplication. Although HGT cannot be ruled out as a factor in the evolution of denitrification genes, our analysis suggests that other phenomena, such gene duplication/divergence and lineage sorting, may have differently influenced the evolution of each denitrification gene.
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Bradyrhizobium sacchari sp. nov., a legume nodulating bacterium isolated from sugarcane roots.
de Matos, Gustavo Feitosa; Zilli, Jerri Edson; de Araújo, Jean Luiz Simões; Parma, Marcia Maria; Melo, Itamar Soares; Radl, Viviane; Baldani, José Ivo; Rouws, Luc Felicianus Marie
2017-11-01
Members of the genus Bradyrhizobium are well-known as nitrogen-fixing microsymbionts of a wide variety of leguminous species, but they have also been found in different environments, notably as endophytes in non-legumes such as sugarcane. This study presents a detailed polyphasic characterization of four Bradyrhizobium strains (type strain BR 10280 T ), previously isolated from roots of sugarcane in Brazil. 16S rRNA sequence analysis, multilocus sequence analysis (MLSA) and analysis of the 16S-23S rRNA internal transcribed spacer showed that these strains form a novel clade close to, but different from B. huanghuaihaiense strain CCBAU 23303 T . Average nucleotide identity (ANI) analyses confirmed that BR 10280 T represents a novel species. Phylogenetic analysis based on nodC gene sequences also placed the strains close to CCBAU 23303 T , but different from this latter strain, the sugarcane strains did not nodulate soybean, although they effectively nodulated Vigna unguiculata, Cajanus cajan and Macroptilium atropurpureum. Physiological traits are in agreement with the placement of the strains in the genus Bradyrhizobium as a novel species for which the name Bradyrhizobium sacchari sp. nov. is proposed.
Antarctic ice core samples: culturable bacterial diversity.
Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R
2013-01-01
Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Fykse, Else Marie; Aarskaug, Tone; Madslien, Elisabeth H; Dybwad, Marius
2016-12-01
High-throughput amplicon sequencing of six biomass samples from a full-scale anaerobic reactor at a Norwegian wood and pulp factory using Biothane Biobed Expanded Granular Sludge Bed (EGSB) technology during start-up and first year of operation was performed. A total of 106,166 16S rRNA gene sequences (V3-V5 region) were obtained. The number of operational taxonomic units (OTUs) ranged from 595 to 2472, and a total of 38 different phyla and 143 families were observed. The predominant phyla were Bacteroidetes, Chloroflexi, Firmicutes, Proteobacteria, and Spirochaetes. A more diverse microbial community was observed in the inoculum biomass coming from an Upflow Anaerobic Sludge Blanket (USAB) reactor, reflecting an adaptation of the inoculum diversity to the specific conditions of the new reactor. In addition, no taxa classified as obligate pathogens were identified and potentially opportunistic pathogens were absent or observed in low abundances. No Legionella bacteria were identified by traditional culture-based and molecular methods. Copyright © 2016 Elsevier Ltd. All rights reserved.
Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis
Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung
2002-01-01
An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128
Young, C-C; Busse, H-J; Langer, S; Chu, Jiunn-Nan; Schumann, P; Arun, A B; Shen, Fo-Ting; Rekha, P D; Kämpfer, P
2010-04-01
Three Gram-positive, rod-shaped bacteria (strains CC-SBCK-209( T), CC-12309(T) and CC-5209(T)) were isolated from the stalk of the edible mushroom Agaricus blazei grown in the laboratory. 16S rRNA gene sequence analysis indicated that all three isolates clearly belonged to the genus Microbacterium. Strains CC-SBCK-209( T) and CC-12309(T) were most related closely to the type strain of Microbacterium halotolerans (95.9 and 96.1 % 16S rRNA gene sequence similarity, respectively). These two novel strains shared 97.9 % 16S rRNA gene sequence similarity. Levels of similarity to the type strains of all other recognized Microbacterium species were lower than 95.5 %. The third strain (CC-5209( T)) showed the highest 16S rRNA gene sequence similarity to the type strain of Microbacterium resistens (97.6 %); levels of similarity to the type strains of all other recognized Microbacterium species were lower than 96 %. The quinone systems of strains CC-SBCK-209(T), CC-12309(T) and CC-5209(T) consisted of MK-11/MK-12, MK-11/MK-10 and MK-13 as major compounds, respectively. All three strains contained ornithine in their peptidoglycan. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol and an unknown glycolipid. The polyamine pattern consisted of spermidine and spermine as predominant components. Fatty acid profiles (anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0 ) as major components) supported the affiliation of all three strains to the genus Microbacterium. The results of physiological and biochemical tests and DNA-DNA hybridization experiments allowed the clear phenotypic and genotypic differentiation of strains CC-SBCK-209(T) and CC-12309( T) from M. halotolerans and other closely related Microbacterium species. Strain CC-5209(T) could be differentiated clearly from M. resistens both genotypically and phenotypically. Based on these data, the novel strains are considered to represent three novel species of the genus Microbacterium. The names proposed for these organisms are Microbacterium agarici sp. nov. [type strain CC-SBCK-209( T) (=DSM 21798(T)=CCM 7686(T))], Microbacterium humi sp. nov. [type strain CC-12309(T) (=DSM 21799(T)=CCM 7687(T))] and Microbacterium pseudoresistens sp. nov. [type strain CC-5209(T) (=DSM 22185(T)=CCM 7688(T))].
Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne
2006-01-01
Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.
Bacterial communities in the phylloplane of Prunus species.
Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong
2015-04-01
Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Maruyama, Takuro; Kawahara, Nobuo; Yokoyama, Kazumasa; Makino, Yukiko; Fukiharu, Toshimitsu; Goda, Yukihiro
2006-11-10
"Magic mushroom (MM)" is the name most commonly given to psychoactive fungi containing the hallucinogenic components: psilocin (1) and psilocybin (2). We investigated the rRNA gene (internal transcribed spacer (ITS) and large subunit (LSU)) of two Panaeolus species and four Psilocybe species fungi (of these, two are non-psilocybin species). On the basis of sequence alignment, we improved the identification system developed in our previous study. In this paper, we describe the new system capable of distinguishing MMs from non-psilocybin Psilocybe species, its application data and the phylogeny of MM species.
Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi
2006-01-01
Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020
2003-12-01
populations. (ii) Characterization of Dehalococeoides sp . strain FL2. The isolate, designate d Dehalococcoides sp . strain FL2, reductively...Pinellas group of the Dehalococcoides cluster, and demonstrated that strain FL2 shared an identical 165 rRNA gene sequence with Dehalococcoides sp ...strain CBDBI, a chlorobenzene-dechlorinating strain. The 165 rRNA gene sequence of Dehalococcoides sp . strain FL2 was submitted to GenBank (AF357918.2
Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi
2018-01-28
The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.
Microbial Characterization of Qatari Barchan Sand Dunes
Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.
2016-01-01
This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399
Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.
Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James
2002-12-01
Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.
Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons
Fischer, Sandra; Kumar, Neeraj
2017-01-01
The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056
Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.
Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas
2017-01-01
The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.
Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang
2008-09-01
A Gram-negative, non-motile, pleomorphic bacterial strain, designated SMK-142(T), was isolated from a tidal flat of the Yellow Sea, Korea, and was subjected to a polyphasic taxonomic study. Strain SMK-142(T) grew optimally at pH 7.0-8.0, 25 degrees C and in the presence of 2% (w/v) NaCl. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain SMK-142(T) clustered with Lutibacter litoralis with which it exhibited a 16S rRNA gene sequence similarity value of 91.2%. This cluster joined the clade comprising the genera Tenacibaculum and Polaribacter at a high bootstrap resampling value. Strain SMK-142(T) contained MK-6 as the predominant menaquinone and iso-C(15:0), iso-C(15:1) and iso-C(17:0) 3-OH as the major fatty acids. The DNA G+C content was 37.2 mol%. Strain SMK-142(T) was differentiated from three phylogenetically related genera, Lutibacter, Tenacibaculum and Polaribacter, on the basis of low 16S rRNA gene sequence similarity values and differences in fatty acid profiles and in some phenotypic properties. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-142(T) represents a novel genus and species for which the name Aestuariicola saemankumensis gen. nov., sp. nov. is proposed (phylum Bacteroidetes, family Flavobacteriaceae). The type strain of the type species, Aestuariicola saemankumensis sp. nov., is SMK-142(T) (=KCTC 22171(T)=CCUG 55329(T)).
Dridi, Bédis; Henry, Mireille; El Khéchine, Amel; Raoult, Didier; Drancourt, Michel
2009-01-01
Background The low and variable prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae DNA in human stool contrasts with the paramount role of these methanogenic Archaea in digestion processes. We hypothesized that this contrast is a consequence of the inefficiencies of current protocols for archaeon DNA extraction. We developed a new protocol for the extraction and PCR-based detection of M. smithii and M. stadtmanae DNA in human stool. Methodology/Principal Findings Stool specimens collected from 700 individuals were filtered, mechanically lysed twice, and incubated overnight with proteinase K prior to DNA extraction using a commercial DNA extraction kit. Total DNA was used as a template for quantitative real-time PCR targeting M. smithii and M. stadtmanae 16S rRNA and rpoB genes. Amplification of 16S rRNA and rpoB yielded positive detection of M. smithii in 95.7% and M. stadtmanae in 29.4% of specimens. Sequencing of 16S rRNA gene PCR products from 30 randomly selected specimens (15 for M. smithii and 15 for M. stadtmanae) yielded a sequence similarity of 99–100% using the reference M. smithii ATCC 35061 and M. stadtmanae DSM 3091 sequences. Conclusions/Significance In contrast to previous reports, these data indicate a high prevalence of the methanogens M. smithii and M. stadtmanae in the human gut, with the former being an almost ubiquitous inhabitant of the intestinal microbiome. PMID:19759898
Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko
2018-01-01
Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.
Pseudoclavibacter caeni sp. nov., isolated from sludge of a sewage disposal plant.
Srinivasan, Sathiyaraj; Kim, Hyun Sook; Kim, Myung Kyum; Lee, Myungjin
2012-04-01
A Gram-positive, strictly aerobic, rod-shaped, non-motile bacterial strain, designated MJ28T, was isolated from a sludge sample from the Daejeon sewage disposal plant in South Korea. A polyphasic approach was applied to study the taxonomic position of strain MJ28T. Strain MJ28T showed highest 16S rRNA gene sequence similarity to Pseudoclavibacter soli KP02T (95.2 %). Levels of 16S rRNA gene sequence similarity to the type strains of other Pseudoclavibacter species were less than 94.0 %. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain MJ28T belonged to the clade formed by members of the genus Pseudoclavibacter in the family Microbacteriaceae. The G+C content of the genomic DNA of strain MJ28T was 65.8 mol%. The chemotaxonomic characteristics of strain MJ28T showed features typical of the genus Pseudoclavibacter, with MK-9 as the predominant respiratory quinone, 2,4-diaminobutryic acid as the diamino acid in the peptidoglycan, and anteiso-C17:0 (44.6 %), anteiso-C15:0 (35.7 %) and C16:0 (9.5 %) as the major fatty acids. On the basis of phylogenetic inference, fatty acid profile and other phenotypic properties, strain MJ28T is considered to represent a novel species of the genus Pseudoclavibacter, for which the name Pseudoclavibacter caeni sp. nov. is proposed. The type strain is MJ28T (=KCTC 19773T=JCM 16921T).
Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H
2006-08-01
Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps
Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz
2015-01-01
In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450
Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli
2016-03-30
The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status.
Micromonospora halotolerans sp. nov., isolated from the rhizosphere of a Pisum sativum plant.
Carro, Lorena; Pukall, Rüdiger; Spröer, Cathrin; Kroppenstedt, Reiner M; Trujillo, Martha E
2013-06-01
A filamentous actinomycete strain designated CR18(T) was isolated on humic acid agar from the rhizosphere of a Pisum sativum plant collected in Spain. This isolate was observed to grow optimally at 28 °C, pH 7.0 and in the presence of 5 % NaCl. Phylogenetic analyses based on the 16S rRNA gene sequence indicated a close relationship with the type strains of Micromonospora chersina and Micromonospora endolithica. A further analysis based on a concatenated DNA sequence stretch of 4,523 bp that included partial sequences of the atpD, gyrB, recA, rpoB and 16S rRNA genes clearly differentiated the new strain from recognized Micromonospora species compared. DNA-DNA hybridization studies further supported the taxonomic position of strain CR18(T) as a novel genomic species. Chemotaxonomic analyses which included whole cell sugars, polar lipids, fatty acid profiles and menaquinone composition confirmed the affiliation of the new strain to the genus Micromonospora and also highlighted differences at the species level. These studies were finally complemented with an array of physiological tests to help differentiate between the new strain and its phylogenetic neighbours. Consequently, strain CR18(T) (= CECT 7890(T) = DSM 45598(T)) is proposed as the type strain of a novel species, Micromonospora halotolerans sp. nov.
Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.
2013-01-01
International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144
Moreira, Ana Paula B.; Duytschaever, Gwen; Chimetto Tonon, Luciane A.; Fróes, Adriana M.; de Oliveira, Louisi S.; Amado-Filho, Gilberto M.; Francini-Filho, Ronaldo B.; De Vos, Paul; Swings, Jean; Thompson, Cristiane C.
2014-01-01
Five novel strains of Photobacterium (A-394T, A-373, A-379, A-397 and A-398) were isolated from bleached coral Madracis decactis (scleractinian) in the remote St Peter & St Archipelago (SPSPA), Mid-Atlantic Ridge, Brazil. Healthy M. decactis specimens were also surveyed, but no strains were related to them. The novel isolates formed a distinct lineage based on the 16S rRNA, recA, and rpoA gene sequences analysis. Their closest phylogenetic neighbours were Photobacterium rosenbergii, P. gaetbulicola, and P. lutimaris, sharing 96.6 to 95.8% 16S rRNA gene sequence similarity. The novel species can be differentiated from the closest neighbours by several phenotypic and chemotaxonomic markers. It grows at pH 11, produces tryptophane deaminase, presents the fatty acid C18:0, but lacks C16:0 iso. The whole cell protein profile, based in MALDI-TOF MS, distinguished the strains of the novel species among each other and from the closest neighbors. In addition, we are releasing the whole genome sequence of the type strain. The name Photobacterium sanctipauli sp. nov. is proposed for this taxon. The G + C content of the type strain A-394T (= LMG27910T = CAIM1892T) is 48.2 mol%. PMID:25024905
USDA-ARS?s Scientific Manuscript database
Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including ‘Candidatus Phytoplasma australiens...
USDA-ARS?s Scientific Manuscript database
Current hypotheses of relationship among the species of the fruit fly genera Anastrepha and Toxotrypana are tested using sequence data from six DNA regions: the mitochondrial 16S rRNA gene; the 5’-region of the carbomoylphosphate synthase (CPS) domain of the rudimentary gene (CAD); the mitochondrial...
Nisin-Producing Lactococcus lactis Strains Isolated from Human Milk
Beasley, Shea S.; Saris, Per E. J.
2004-01-01
Characterization by partial 16S rRNA gene sequencing, ribotyping, and green fluorescent protein-based nisin bioassay revealed that 6 of 20 human milk samples contained nisin-producing Lactococcus lactis bacteria. This suggests that the history of humans consuming nisin is older than the tradition of consuming fermented milk products. PMID:15294850
A unique Mycobacterium species isolated from an epizootic of striped bass (Morone saxatilis).
Rhodes, M. W.; Kator, H.; Kotob, S.; van Berkum, P.; Kaattari, I.; Vogelbein, W.; Floyd, M. M.; Butler, W. R.; Quinn, F. D.; Ottinger, C.; Shotts, E.
2001-01-01
We isolated a Mycobacterium sp. resembling Mycobacterium marinum and M. ulcerans from diseased striped bass (Morone saxatilis) during an epizootic of mycobacteriosis in the Chesapeake Bay. This isolate may represent an undescribed Mycobacterium species, based on phenotypic characteristics and comparative 16S rRNA gene sequence. PMID:11747708
Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut
2018-06-01
Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.
Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi
2016-07-01
In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.
Suwannapoom, Chatmongkon; Yuan, Zhi-Yong; Chen, Jin-Min; Hou, Mian; Zhao, Hai-Peng; Wang, Li-Jun; Nguyen, Truong Son; Nguyen, Truong Q; Murphy, Robert W; Sullivan, Jaqueline; Mcleod, David S; Che, Jing
2016-03-21
Phylogenetic reconstructions derived from DNA sequence data play a central role in documenting the number of species in a complex. Such analyses are pointing to the existence of many cryptic species, especially in poorly understood groups such as the genus Limnonectes, and the L. kuhlii species complex in particular. To understand the Limnonectes frogs of China, we reconstruct the major matrilineal genealogy of Limnonectes from China and Southeast Asia based on 12S rRNA, tRNAVal and 16S rRNA gene sequences. Based on new data we recognize five species of Limnonectes in China including L. bannaensis, L. fujianensis, L. fragilis, L. taylori (new record), and a new species from southern China and Myanmar. Phylogenetically, the new species is more closely related to the clade comprising L. taylori, L. megastomias, L. isanensis, L. nguyenorum, and L. jarujini from Thailand than to other Chinese species. This study supports previous findings of sympatric members of a species complex that are not each other's closest relatives.
U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.
Morrissey, J P; Tollervey, D
1997-06-01
The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.
NASA Astrophysics Data System (ADS)
Deng, Yuangao; Xu, Gaochao; Sui, Liying
2015-07-01
A total of 26 isolates were obtained from solar salt ponds of different salinities (100, 150, 200, and 250) in Hangu Saltworks Co. Ltd., Tianjin, China. Phylogenetic analysis of 16S rRNA gene sequences indicated that five bacteria genera Halomonas, Salinicoccus, Oceanobacillus, Gracibacillus, and Salimicrobium and one archaea genera Halorubrum were present. The genus Halomonas was predominant with eight strains distributed in a salinity range of 100-200, followed by Halorubrum with six strains in salinity 250. Based on the genus and original sampling salinity, eight bacterial and two archaeal isolates were selected for further morphological, physiological, and biochemical characterization. All of the bacterial strains were moderately halophilic with the optimal salinity for growth being either 50 or 100, while two archaeal strains were extremely halophilic with an optimal growth salinity of 200. Additionally, we put forth strain SM.200-5 as a new candidate Salimicrobium species based on the phylogenic analysis of the 16S rRNA gene sequence and its biochemical characteristics when compared with known related species.
Kadri, Zaina; Vandamme, Peter; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; Elfahime, El Mostafa; Farricha, Omar El; Swings, Jean; Amar, Mohamed
2015-02-01
Biochemical and molecular genetic studies were performed on two unidentified Gram-stain positive, catalase and oxidase negative, non-hemolytic Streptococcus-like organisms recovered from raw camel milk in Morocco. Phenotypic characterization and comparative 16S rRNA gene sequencing demonstrated that the two strains were highly different from each other and that they did not correspond to any recognized species of the genus Streptococcus. Phylogenetic analysis based on 16S rRNA gene sequences showed the unidentified organisms each formed a hitherto unknown sub-line within the genus Streptococcus, displaying a close affinity with Streptococcus moroccensis, Streptococcus minor and Streptococcus ovis. DNA G+C content determination, MALDI-TOF mass spectrometry and biochemical tests demonstrated the bacterial isolates represent two novel species. Based on the phenotypic distinctiveness of the new bacteria and molecular genetic evidence, it is proposed to classify the two strains as Streptococcus tangierensis sp. nov., with CCMM B832(T) (=LMG 27683(T)) as the type strain, and Streptococcus cameli sp. nov., with CCMM B834(T) (=LMG 27685(T)) as the type strain.
Hepatozoon parasites (Apicomplexa: Adeleorina) in bats.
Pinto, C Miguel; Helgen, Kristofer M; Fleischer, Robert C; Perkins, Susan L
2013-08-01
We provide the first evidence of Hepatozoon parasites infecting bats. We sequenced a short fragment of the 18S rRNA gene (~600 base pairs) of Hepatozoon parasites from 3 Hipposideros cervinus bats from Borneo. Phylogenies inferred by model-based methods place these Hepatozoon within a clade formed by parasites of reptiles, rodents, and marsupials. We discuss the scenario that bats might be common hosts of Hepatozoon.
Novel variants of the 5S rRNA genes in Eruca sativa.
Singh, K; Bhatia, S; Lakshmikumaran, M
1994-02-01
The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)
USDA-ARS?s Scientific Manuscript database
The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...
NASA Technical Reports Server (NTRS)
Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr
1992-01-01
A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.
Gaby, John Christian; Buckley, Daniel H
2014-01-01
We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm.