[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

PubMed

Petrov, N B; Vladychenskaia, N S

2005-01-01

Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

High-resolution phylogenetic microbial community profiling

DOE PAGES

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

2016-02-09

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Reclassification of Actinobacillus muris as Muribacter muris gen. nov., comb. nov.

PubMed

Nicklas, Werner; Bisgaard, Magne; Aalbæk, Bent; Kuhnert, Peter; Christensen, Henrik

2015-10-01

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains, mainly from mice and rats, were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole-genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intragroup similarities of 96.7 and 97.2 % for the 16S rRNA and rpoB genes, respectively. The highest 16S rRNA gene sequence similarity to a taxon with a validly published name outside the group was 95.9 %, to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium', with 88.4 % similarity. A new genus and a new combination, Muribacter muris gen. nov., comb. nov., are proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons, with major divergence from the existing genera of the family Pasteurellaceae. The new genus has the characteristics of [A.] muris with the emendation that acid formation from ( - )-d-mannitol and hydrolysis of aesculin are variable, while the α-glucosidase test is positive. There is no requirement for exogenously supplied NAD (V factor) for the majority of strains investigated; however, one strain was found to require NAD. The major fatty acids of the type strain of Muribacter muris were C14 : 0, C14 : 0 3-OH/iso-C16 : 1 I, C16 : 1ω7c and C16 : 0, which is in line with most genera of the Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).

Four new species of Metschnikowia and the transfer of seven Candida species to Metschnikowia and Clavispora as new combinations

USDA-ARS?s Scientific Manuscript database

From comparisons of ITS1-5.8S-ITS2 and gene sequences for nuclear D1/D2 LSU rRNA, nuclear SSU (18S) rRNA, translation elongation factor 1-a (EF1-a) and RNA polymerase II subunit 2 (RPB2), the following four new ascosporogenous yeast species were resolved and are described as Metschnikowia anglica (N...

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

PubMed Central

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

PubMed

Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

2014-01-01

Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

NASA Astrophysics Data System (ADS)

Antonielli, Livio; Sessitsch, Angela

2016-04-01

Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

Digital data for quick response (QR) codes of alkalophilic Bacillus pumilus to identify and to compare bacilli isolated from Lonar Crator Lake, India

PubMed Central

Rekadwad, Bhagwan N.; Khobragade, Chandrahasya N.

2016-01-01

Microbiologists are routinely engaged isolation, identification and comparison of isolated bacteria for their novelty. 16S rRNA sequences of Bacillus pumilus were retrieved from NCBI repository and generated QR codes for sequences (FASTA format and full Gene Bank information). 16SrRNA were used to generate quick response (QR) codes of Bacillus pumilus isolated from Lonar Crator Lake (19° 58′ N; 76° 31′ E), India. Bacillus pumilus 16S rRNA gene sequences were used to generate CGR, FCGR and PCA. These can be used for visual comparison and evaluation respectively. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. This generated digital data helps to evaluate and compare any Bacillus pumilus strain, minimizes laboratory efforts and avoid misinterpretation of the species. PMID:27141529

Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

PubMed

Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

2005-10-01

Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

Reclassification of Pseudomonas mephitica Claydon and Hammer 1939 as a later heterotypic synonym of Janthinobacterium lividum (Eisenberg 1891) De Ley et al. 1978.

PubMed

Kämpfer, Peter; Falsen, Enevold; Busse, Hans-Jürgen

2008-01-01

Pseudomonas mephitica CCUG 2513(T) has been reinvestigated to clarify its taxonomic position. 16S rRNA gene sequence comparisons demonstrated that this strain clusters phylogenetically closely with Janthinobacterium lividum (99.8% sequence similarity to the type strain). Investigation of fatty acid patterns, polar lipid profiles, polyamine patterns and quinone systems supported this delineation. Substrate utilization profiles and biochemical characteristics displayed no differences from the type strain of J. lividum, CCUG 2344(T). Therefore, the reclassification of Pseudomonas mephitica as a later heterotypic synonym of Janthinobacterium lividum is proposed, based upon the estimated phylogenetic position derived from 16S rRNA gene sequence data and chemotaxonomic and biochemical data.

Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

PubMed

Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

2006-01-01

Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

Prevotella timonensis sp. nov., isolated from a human breast abscess.

PubMed

Glazunova, Olga O; Launay, Thierry; Raoult, Didier; Roux, Véronique

2007-04-01

Gram-negative anaerobic rods were isolated from a human breast abscess. Based on genotypic and phenotypic characteristics, the novel strain belonged to the genus Prevotella. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that it was closely related to Prevotella buccalis (94 % 16S rRNA gene sequence similarity), Prevotella salivae (90 %) and Prevotella oris (89.1 %). The major cellular fatty acid was C(14 : 0) (19.5 %). The new isolate represents a novel species in the genus Prevotella, for which the name Prevotella timonensis sp. nov. is proposed. The type strain is strain 4401737(T) (=CIP 108522(T)=CCUG 50105(T)).

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

'Candidatus Phytoplasma palmicola', associated with a lethal yellowing-type disease of coconut (Cocos nucifera L.) in Mozambique.

PubMed

Harrison, Nigel A; Davis, Robert E; Oropeza, Carlos; Helmick, Ericka E; Narváez, María; Eden-Green, Simon; Dollet, Michel; Dickinson, Matthew

2014-06-01

In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100% identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0-99.6% identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d'Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5% sequence identity with all previously described members of 'Candidatus Phytoplasma'. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of 'Candidatus Phytoplasma', justifying its recognition as the reference strain of a novel taxon, 'Candidatus Phytoplasma palmicola'. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d'Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.

Digital data for Quick Response (QR) codes of thermophiles to identify and compare the bacterial species isolated from Unkeshwar hot springs (India).

PubMed

Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

2016-03-01

16S rRNA sequences of morphologically and biochemically identified 21 thermophilic bacteria isolated from Unkeshwar hot springs (19°85'N and 78°25'E), Dist. Nanded (India) has been deposited in NCBI repository. The 16S rRNA gene sequences were used to generate QR codes for sequences (FASTA format and full Gene Bank information). Diversity among the isolates is compared with known isolates and evaluated using CGR, FCGR and PCA i.e. visual comparison and evaluation respectively. Considerable biodiversity was observed among the identified bacteria isolated from Unkeshwar hot springs. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/.

Phenotypic and phylogenetic characterization of ruminal tannin-tolerant bacteria.

PubMed

Nelson, K E; Thonney, M L; Woolston, T K; Zinder, S H; Pell, A N

1998-10-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed.

Phenotypic and Phylogenetic Characterization of Ruminal Tannin-Tolerant Bacteria

PubMed Central

Nelson, Karen E.; Thonney, Michael L.; Woolston, Tina K.; Zinder, Stephen H.; Pell, Alice N.

1998-01-01

The 16S rRNA sequences and selected phenotypic characteristics were determined for six recently isolated bacteria that can tolerate high levels of hydrolyzable and condensed tannins. Bacteria were isolated from the ruminal contents of animals in different geographic locations, including Sardinian sheep (Ovis aries), Honduran and Colombian goats (Capra hircus), white-tail deer (Odocoileus virginianus) from upstate New York, and Rocky Mountain elk (Cervus elaphus nelsoni) from Oregon. Nearly complete sequences of the small-subunit rRNA genes, which were obtained by PCR amplification, cloning, and sequencing, were used for phylogenetic characterization. Comparisons of the 16S rRNA of the six isolates showed that four of the isolates were members of the genus Streptococcus and were most closely related to ruminal strains of Streptococcus bovis and the recently described organism Streptococcus gallolyticus. One of the other isolates, a gram-positive rod, clustered with the clostridia in the low-G+C-content group of gram-positive bacteria. The sixth isolate, a gram-negative rod, was a member of the family Enterobacteriaceae in the gamma subdivision of the class Proteobacteria. None of the 16S rRNA sequences of the tannin-tolerant bacteria examined was identical to the sequence of any previously described microorganism or to the sequence of any of the other organisms examined in this study. Three phylogenetically distinct groups of ruminal bacteria were isolated from four species of ruminants in Europe, North America, and South America. The presence of tannin-tolerant bacteria is not restricted by climate, geography, or host animal, although attempts to isolate tannin-tolerant bacteria from cows on low-tannin diets failed. PMID:9758806

Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

PubMed

Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

2012-04-01

Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

Saccharothrix ghardaiensis sp. nov., an actinobacterium isolated from Saharan soil.

PubMed

Bouznada, Khaoula; Bouras, Noureddine; Mokrane, Salim; Chaabane Chaouch, Fawzia; Zitouni, Abdelghani; Pötter, Gabriele; Spröer, Cathrin; Klenk, Hans-Peter; Sabaou, Nasserdine

2017-03-01

The taxonomic position of a new Saccharothrix strain, designated MB46 T , isolated from a Saharan soil sample collected in Mzab region (Ghardaïa province, South Algeria) was established following a polyphasic approach. The novel microorganism has morphological and chemical characteristics typical of the members of the genus Saccharothrix and formed a phyletic line at the periphery of the Saccharothrix espanaensis subcluster in the 16S rRNA gene dendrograms. Results of the 16S rRNA gene sequence comparisons revealed that strain MB46 T shares high degrees of similarity with S. espanaensis DSM 44229 T (99.2%), Saccharothrix variisporea DSM 43911 T (98.7%) and Saccharothrix texasensis NRRL B-16134 T (98.6%). However, the new strain exhibited only 12.5-17.5% DNA relatedness to the neighbouring Saccharothrix spp. On the basis of phenotypic characteristics, 16S rRNA gene sequence comparisons and DNA-DNA hybridizations, strain MB46 T is concluded to represent a novel species of the genus Saccharothrix, for which the name Saccharothrix ghardaiensis sp. nov. (type strain MB46 T  = DSM 46886 T  = CECT 9046 T ) is proposed.

Toxicity phenotype does not correlate with phylogeny of Cylindrospermopsis raciborskii strains.

PubMed

Stucken, Karina; Murillo, Alejandro A; Soto-Liebe, Katia; Fuentes-Valdés, Juan J; Méndez, Marco A; Vásquez, Mónica

2009-02-01

Cylindrospermopsis raciborskii is a species of freshwater, bloom-forming cyanobacterium. C. raciborskii produces toxins, including cylindrospermopsin (hepatotoxin) and saxitoxin (neurotoxin), although non toxin-producing strains are also observed. In spite of differences in toxicity, C. raciborskii strains comprise a monophyletic group, based upon 16S rRNA gene sequence identities (greater than 99%). We performed phylogenetic analyses; 16S rRNA gene and 16S-23S rRNA gene internally transcribed spacer (ITS-1) sequence comparisons, and genomic DNA restriction fragment length polymorphism (RFLP), resolved by pulsed-field gel electrophoresis (PFGE), of strains of C. raciborskii, obtained mainly from the Australian phylogeographic cluster. Our results showed no correlation between toxic phenotype and phylogenetic association in the Australian strains. Analyses of the 16S rRNA gene and the respective ITS-1 sequences (long L, and short S) showed an independent evolution of each ribosomal operon. The genes putatively involved in the cylindrospermopsin biosynthetic pathway were present in one locus and only in the hepatotoxic strains, demonstrating a common genomic organization for these genes and the absence of mutated or inactivated biosynthetic genes in the non toxic strains. In summary, our results support the hypothesis that the genes involved in toxicity may have been transferred as an island by processes of gene lateral transfer, rather than convergent evolution.

The status of the species Enterobacter siamensisKhunthongpan et al. 2014. Request for an Opinion.

PubMed

Kämpfer, Peter; Doijad, Swapnil; Chakraborty, Trinad; Glaeser, Stefanie P

2016-01-01

In the course of a taxonomic study describing novel species of the genus Enterobacter it was found that the 16S rRNA gene sequence of the type strain of Enterobacter siamensis, obtained both directly from the authors of the publication on Enterobacter siamensis and from the Korean Collection for Type Cultures (C2361T and KCTC 23282T, respectively), was not congruent with the 16S rRNA gene sequence deposited in the GenBank database under the accession number HQ888848, which was applied for phylogenetic analysis in the species proposal. The remaining deposit in the Japanese type culture collection, NBRC 107138T, showed an identical 16S rRNA gene sequence to the other two cultures and overall, this sequence differed at 35 positions in comparison with the 1429 bp sequence published under the accession number HQ888848.Therefore, the type strain of this species cannot be included in any further scientific comparative study. It is proposed that the Judicial Commission of the International Committee on Systematics of Prokaryotes place the name Enterobacter siamensis on the list of rejected names, if a suitable replacement for the type strain is not found or a neotype strain is not proposed within two years following the publication of this Request for an Opinion.

Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

PubMed Central

Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

2008-01-01

We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

PubMed

Arbefeville, S; Harris, A; Ferrieri, P

2017-09-01

Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU rDNA Fungal Identification Kit was equivalent to the in-house developed ITS regions assay to identify fungi at the genus level. The MycoBank database gave a better curated database and thus allowed a better genus and species identification for both D2 region of the LSU rRNA gene and ITS regions. Copyright © 2017 Elsevier B.V. All rights reserved.

Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

PubMed Central

Dalmay, Tamas

2018-01-01

RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

Digital data for Quick Response (QR) codes of thermophiles to identify and compare the bacterial species isolated from Unkeshwar hot springs (India)

PubMed Central

Rekadwad, Bhagwan N.; Khobragade, Chandrahasya N.

2015-01-01

16S rRNA sequences of morphologically and biochemically identified 21 thermophilic bacteria isolated from Unkeshwar hot springs (19°85′N and 78°25′E), Dist. Nanded (India) has been deposited in NCBI repository. The 16S rRNA gene sequences were used to generate QR codes for sequences (FASTA format and full Gene Bank information). Diversity among the isolates is compared with known isolates and evaluated using CGR, FCGR and PCA i.e. visual comparison and evaluation respectively. Considerable biodiversity was observed among the identified bacteria isolated from Unkeshwar hot springs. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. PMID:26793757

Comparison of reduced metagenome and 16S rRNA gene sequencing for determination of genetic diversity and mother-child overlap of the gut associated microbiota.

PubMed

Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut

2018-06-01

Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.

Evolution of nuclear ribosomal RNAs in kinetoplastid protozoa: perspectives on the age and origins of parasitism.

PubMed Central

Fernandes, A P; Nelson, K; Beverley, S M

1993-01-01

Molecular evolutionary relationships within the protozoan order Kinetoplastida were deduced from comparisons of the nuclear small and large subunit ribosomal RNA (rRNA) gene sequences. These studies show that relationships among the trypanosomatid protozoans differ from those previously proposed from studies of organismal characteristics or mitochondrial rRNAs. The genera Leishmania, Endotrypanum, Leptomonas, and Crithidia form a closely related group, which shows progressively more distant relationships to Phytomonas and Blastocrithidia, Trypanosoma cruzi, and lastly Trypanosoma brucei. The rooting of the trypanosomatid tree was accomplished by using Bodo caudatus (family Bodonidae) as an outgroup, a status confirmed by molecular comparisons with other eukaryotes. The nuclear rRNA tree agrees well with data obtained from comparisons of other nuclear genes. Differences with the proposed mitochondrial rRNA tree probably reflect the lack of a suitable outgroup for this tree, as the topologies are otherwise similar. Small subunit rRNA divergences within the trypanosomatids are large, approaching those among plants and animals, which underscores the evolutionary antiquity of the group. Analysis of the distribution of different parasitic life-styles of these species in conjunction with a probable timing of evolutionary divergences suggests that vertebrate parasitism arose multiple times in the trypanosomatids. PMID:8265597

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics.

PubMed

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica . All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/.

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics

PubMed Central

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica. All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/. PMID:28261563

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Candida xinjiangensis sp. nov., a new anamorphic yeast species isolated from Scolytus scheryrewi Semenov in China.

PubMed

Zhu, Xiao-Feng; Zhang, Dian-Peng; Yang, Sen; Zhang, Qing-Wen

2017-03-01

Three yeast strains designated as S44, XF1 and XF2, respectively, were isolated from Scolytus scheryrewi Semenov of apricot tree in Shule County, Xinjiang, China, and were demonstrated to be a new member of the genus Candida by sequence comparisons of 26S rRNA gene D1/D2 domain and internal transcribed spacer (ITS) region. BLASTn alignments on NCBI showed that the similarity of 26S rRNA gene sequences of S44 (type strain) to all sequences of other Candida yeasts was very low (≦93 %). The phylogenetic tree based on the 26S rRNA gene D1/D2 domain and ITS region sequences revealed that the strain S44 is closely related to C. blattae, C. dosseyi, C. pruni, C. asparagi, C. fructus and C. musae. However, the strain S44 is distinguished from these Candida species by the physiological characteristics. Moreover, the strain S44 formed typical pseudohyphae when grown on cornmeal agar at 25 °C for 7 days, but did not form ascospores in sporulation medium for 3-4 weeks. Therefore, the name Candida xinjiangensis is proposed for the novel species, with S44 (=KCTC T 27747) as the type strain.

High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

PubMed Central

Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

2014-01-01

In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to Dehalococcoides strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siddaramappa, Shivakumara; Delano, Susana; Green, Lance D.

2012-01-01

Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore forming, Gram negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) its unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) its phylogenetic position distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9{sup T} contains 1,720 predicted proteinmore » coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus.« less

Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

PubMed

Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

1999-09-01

Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

A new species of Drepanocephalus Dietz, 1909 (Digenea: Echinostomatidae) from the double-crested cormorant Phalacrocorax auritus (Lesson) (Aves: Phalacrocoracidae) in North America.

PubMed

Kudlai, Olena; Kostadinova, Aneta; Pulis, Eric E; Tkach, Vasyl V

2015-03-01

Drepanocephalus auritus n. sp. is described based on specimens from the double-crested cormorant Phalacrocorax auritus (Lesson) in North America. The new species differs from its congeners in its very narrow, elongate body, long uterine field and widely separated testes. Sequences of the nuclear rRNA gene cluster, spanning the 3' end of the nuclear ribosomal 18S rRNA gene, internal transcribed spacer region (ITS1+5.8S gene+ITS2) and partial 28S gene (2,345 bp), were identical in specimens collected from North Dakota, Minnesota and Mississippi, USA. Sequences of the 651 bp long fragment of the mitochondrial cox1 gene exhibited very low intraspecific variability (< 1%). Comparisons of the newly-generated sequences with those available in the GenBank indicate that the sequences from North America published under the name D. spathans Dietz, 1909 in fact represent D. auritus n. sp.

The sponge microbiome project.

PubMed

Moitinho-Silva, Lucas; Nielsen, Shaun; Amir, Amnon; Gonzalez, Antonio; Ackermann, Gail L; Cerrano, Carlo; Astudillo-Garcia, Carmen; Easson, Cole; Sipkema, Detmer; Liu, Fang; Steinert, Georg; Kotoulas, Giorgos; McCormack, Grace P; Feng, Guofang; Bell, James J; Vicente, Jan; Björk, Johannes R; Montoya, Jose M; Olson, Julie B; Reveillaud, Julie; Steindler, Laura; Pineda, Mari-Carmen; Marra, Maria V; Ilan, Micha; Taylor, Michael W; Polymenakou, Paraskevi; Erwin, Patrick M; Schupp, Peter J; Simister, Rachel L; Knight, Rob; Thacker, Robert W; Costa, Rodrigo; Hill, Russell T; Lopez-Legentil, Susanna; Dailianis, Thanos; Ravasi, Timothy; Hentschel, Ute; Li, Zhiyong; Webster, Nicole S; Thomas, Torsten

2017-10-01

Marine sponges (phylum Porifera) are a diverse, phylogenetically deep-branching clade known for forming intimate partnerships with complex communities of microorganisms. To date, 16S rRNA gene sequencing studies have largely utilised different extraction and amplification methodologies to target the microbial communities of a limited number of sponge species, severely limiting comparative analyses of sponge microbial diversity and structure. Here, we provide an extensive and standardised dataset that will facilitate sponge microbiome comparisons across large spatial, temporal, and environmental scales. Samples from marine sponges (n = 3569 specimens), seawater (n = 370), marine sediments (n = 65) and other environments (n = 29) were collected from different locations across the globe. This dataset incorporates at least 268 different sponge species, including several yet unidentified taxa. The V4 region of the 16S rRNA gene was amplified and sequenced from extracted DNA using standardised procedures. Raw sequences (total of 1.1 billion sequences) were processed and clustered with (i) a standard protocol using QIIME closed-reference picking resulting in 39 543 operational taxonomic units (OTU) at 97% sequence identity, (ii) a de novo clustering using Mothur resulting in 518 246 OTUs, and (iii) a new high-resolution Deblur protocol resulting in 83 908 unique bacterial sequences. Abundance tables, representative sequences, taxonomic classifications, and metadata are provided. This dataset represents a comprehensive resource of sponge-associated microbial communities based on 16S rRNA gene sequences that can be used to address overarching hypotheses regarding host-associated prokaryotes, including host specificity, convergent evolution, environmental drivers of microbiome structure, and the sponge-associated rare biosphere. © The Authors 2017. Published by Oxford University Press.

Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

PubMed

Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

2015-01-01

Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

PubMed

Li, X; De Boer, S H

1995-10-01

Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Ballistosporomyces changbaiensis sp. nov. and Ballistosporomyces bomiensis sp. nov., two novel species isolated from shrub plant leaves.

PubMed

Han, Pei-Jie; Li, Ai-Hua; Wang, Qi-Ming; Bai, Feng-Yan

2016-07-01

Four strains, CB 266(T), CB 272, XZ 44D1(T) and XZ 49D2, isolated from shrub plant leaves in China were identified as two novel species of the genus Ballistosporomyces by the sequence analysis of the small subunit of ribosomal RNA (SSU rRNA), the D1/D2 domains of the large subunit of rRNA (LSU rRNA) and internal transcribed spacer (ITS) + 5.8S rRNA region, and physiological comparisons. Ballistosporomyces changbaiensis sp. nov. (type strain CB 266(T) = CGMCC 2.02298(T) = CBS 10124(T), Mycobank number MB 815700) and Ballistosporomyces bomiensis sp. nov. (type strain XZ 44D1(T) = CGMCC 2.02661(T) = CBS 12512(T), Mycobank number MB 815701) are proposed to accommodate these two new species.

Performance evaluation of canine-associated Bacteroidales assays in a multi-laboratory comparison study

EPA Science Inventory

The contribution of fecal pollution from dogs in urbanized areas can be significant and is an often underestimated problem. Microbial source tracking methods (MST) utilizing quantitative PCR of dog-associated gene sequences encoding 16S rRNA of Bacteroidales are a useful tool to ...

Evolution of blue-flowered species of genus Linum based on high-throughput sequencing of ribosomal RNA genes.

PubMed

Bolsheva, Nadezhda L; Melnikova, Nataliya V; Kirov, Ilya V; Speranskaya, Anna S; Krinitsina, Anastasia A; Dmitriev, Alexey A; Belenikin, Maxim S; Krasnov, George S; Lakunina, Valentina A; Snezhkina, Anastasiya V; Rozhmina, Tatiana A; Samatadze, Tatiana E; Yurkevich, Olga Yu; Zoshchuk, Svyatoslav A; Amosova, Аlexandra V; Kudryavtseva, Anna V; Muravenko, Olga V

2017-12-28

The species relationships within the genus Linum have already been studied several times by means of different molecular and phylogenetic approaches. Nevertheless, a number of ambiguities in phylogeny of Linum still remain unresolved. In particular, the species relationships within the sections Stellerolinum and Dasylinum need further clarification. Also, the question of independence of the species of the section Adenolinum still remains unanswered. Moreover, the relationships of L. narbonense and other species of the section Linum require further clarification. Additionally, the origin of tetraploid species of the section Linum (2n = 30) including the cultivated species L. usitatissimum has not been explored. The present study examines the phylogeny of blue-flowered species of Linum by comparisons of 5S rRNA gene sequences as well as ITS1 and ITS2 sequences of 35S rRNA genes. High-throughput sequencing has been used for analysis of multicopy rRNA gene families. In addition to the molecular phylogenetic analysis, the number and chromosomal localization of 5S and 35S rDNA sites has been determined by FISH. Our findings confirm that L. stelleroides forms a basal branch from the clade of blue-flowered flaxes which is independent of the branch formed by species of the sect. Dasylinum. The current molecular phylogenetic approaches, the cytogenetic analysis as well as different genomic DNA fingerprinting methods applied previously did not discriminate certain species within the sect. Adenolinum. The allotetraploid cultivated species L. usitatissimum and its wild ancestor L. angustifolium (2n = 30) could originate either as the result of hybridization of two diploid species (2n = 16) related to the modern L. gandiflorum and L. decumbens, or hybridization of a diploid species (2n = 16) and a diploid ancestor of modern L. narbonense (2n = 14). High-throughput sequencing of multicopy rRNA gene families allowed us to make several adjustments to the phylogeny of blue-flowered flax species and also reveal intra- and interspecific divergence of the rRNA gene sequences.

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

PANGEA: pipeline for analysis of next generation amplicons

PubMed Central

Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz FW; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

2010-01-01

High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including preprocessing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the χ2 step, are joined into one program called the ‘backbone’. PMID:20182525

PANGEA: pipeline for analysis of next generation amplicons.

PubMed

Giongo, Adriana; Crabb, David B; Davis-Richardson, Austin G; Chauliac, Diane; Mobberley, Jennifer M; Gano, Kelsey A; Mukherjee, Nabanita; Casella, George; Roesch, Luiz F W; Walts, Brandon; Riva, Alberto; King, Gary; Triplett, Eric W

2010-07-01

High-throughput DNA sequencing can identify organisms and describe population structures in many environmental and clinical samples. Current technologies generate millions of reads in a single run, requiring extensive computational strategies to organize, analyze and interpret those sequences. A series of bioinformatics tools for high-throughput sequencing analysis, including pre-processing, clustering, database matching and classification, have been compiled into a pipeline called PANGEA. The PANGEA pipeline was written in Perl and can be run on Mac OSX, Windows or Linux. With PANGEA, sequences obtained directly from the sequencer can be processed quickly to provide the files needed for sequence identification by BLAST and for comparison of microbial communities. Two different sets of bacterial 16S rRNA sequences were used to show the efficiency of this workflow. The first set of 16S rRNA sequences is derived from various soils from Hawaii Volcanoes National Park. The second set is derived from stool samples collected from diabetes-resistant and diabetes-prone rats. The workflow described here allows the investigator to quickly assess libraries of sequences on personal computers with customized databases. PANGEA is provided for users as individual scripts for each step in the process or as a single script where all processes, except the chi(2) step, are joined into one program called the 'backbone'.

Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

NASA Technical Reports Server (NTRS)

Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

1987-01-01

A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov., isolated from flowers in French Guiana.

PubMed

Amoikon, Tiemele Laurent Simon; Grondin, Cécile; Djéni, Théodore N'Dédé; Jacques, Noémie; Casaregola, Serge

2018-05-21

Analysis of yeasts isolated from various biotopes in French Guiana led to the identification of two strains isolated from flowers and designated CLIB 1634 T and CLIB 1707 T . Comparison of the D1/D2 domain of the large subunit (LSU D1/D2) rRNA gene sequences of CLIB 1634 T and CLIB 1707 T to those in the GenBank database revealed that these strains belong to the Starmerella clade. Strain CLIB 1634 T was shown to diverge from the closely related Starmerella apicola type strain CBS 2868 T with a sequence divergence of 1.34 and 1.30 %, in the LSU D1/D2 rRNA gene and internal transcribed spacer (ITS) sequences respectively. Strain CLIB 1634 T and Candida apicola CBS 2868 T diverged by 3.81 and 14.96 % at the level of the protein-coding gene partial sequences EF-1α and RPB2, respectively. CLIB 1707 T was found to have sequence divergence of 3.88 and 9.16 % in the LSU D1/D2 rRNA gene and ITS, respectively, from that of the most closely related species Starmerella ratchasimensis type strain CBS 10611 T . The species Starmerella reginensis f.a., sp. nov. and Starmerella kourouensis f.a., sp. nov. are proposed to accommodate strains CLIB 1634 T (=CBS 15247 T ) and CLIB 1707 T (=CBS 15257 T ), respectively.

No need to replace an "anomalous" primate (Primates) with an "anomalous" bear (Carnivora, Ursidae).

PubMed

Gutiérrez, Eliécer E; Pine, Ronald H

2015-01-01

By means of mitochondrial 12S rRNA sequencing of putative "yeti", "bigfoot", and other "anomalous primate" hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an "anomalous primate", but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursusmaritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursusarctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropodamelanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics.

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

PubMed

Branciamore, Sergio; Di Giulio, Massimo

2012-04-01

The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

The cyanobiont in an Azolla fern is neither Anabaena nor Nostoc.

PubMed

Baker, Judith A; Entsch, Barrie; McKay, David B

2003-12-05

The cyanobacterial symbionts in the fern Azolla have generally been ascribed to either the Anabaena or Nostoc genera. By using comparisons of the sequences of the phycocyanin intergenic spacer and a fragment of the 16S rRNA, we found that the cyanobiont from an Azolla belongs to neither of these genera.

Complete Genome Sequence of Paenibacillus strain Y4.12MC10, a Novel Paenibacillus lautus strain Isolated from Obsidian Hot Spring in Yellowstone National Park

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mead, David; Lucas, Susan; Copeland, A

2012-01-01

Paenibacillus speciesY412MC10 was one of a number of organisms initially isolated from Obsidian Hot Spring, Yellowstone National Park, Montana, USA. The isolate Y412MC10 was initially classified as a Geobacillus sp. based on its isolation conditions and similarity to other organisms isolated from hot springs at Yellowstone National Park. Comparison of 16 S rRNA sequences within the Bacillales indicated that Geobacillus sp.Y412MC10 clustered with Paenibacillus species and not Geobacillus; the 16S rRNA analysis indicated the organism was a strain of Paenibacillus lautus. Lucigen Corp. prepared genomic DNA and the genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute.more » The genome of Paenibacillus lautus strain Y412MC10 consists of one circular chromosome of 7,121,665 bp with an average G+C content of 51.2%. The Paenibacillus sp.Y412MC10 genome sequence was deposited at the NCBI in October 2009 (NC{_}013406). Comparison to other Paenibacillus species shows the organism lacks nitrogen fixation, antibiotic production and social interaction genes reported in other Paenibacilli. Over 25% of the proteins predicted by the Y412MC10 genome share no identity with the closest sequenced Paenibacillus species; most of these are predicted hypothetical proteins and their specific function in the environment is unknown.« less

Comparison of Helicobacter spp. in Cheetahs (Acinonyx jubatus) with and without gastritis.

PubMed

Terio, K A; Munson, L; Marker, L; Aldridge, B M; Solnick, J V

2005-01-01

Chronic gastritis causes significant morbidity and mortality in captive cheetahs but is rare in wild cheetahs despite colonization by abundant spiral bacteria. This research aimed to identify the Helicobacter species that were associated with gastritis in captive cheetahs but are apparently commensal in wild cheetahs. Helicobacter species were characterized by PCR amplification and sequencing of the 16S rRNA, urease, and cagA genes and by transmission electron microscopy of frozen or formalin-fixed paraffin-embedded gastric samples from 33 cheetahs infected with Helicobacter organisms (10 wild without gastritis and 23 captive with gastritis). Samples were screened for mixed infections by denaturant gel gradient electrophoresis of the 16S rRNA gene and by transmission electron microscopy. There was no association between Helicobacter infection and the presence or severity of gastritis. Eight cheetahs had 16S rRNA sequences that were most similar (98 to 99%) to H. pylori. Twenty-five cheetahs had sequences that were most similar (97 to 99%) to "H. heilmannii" or H. felis. No cheetahs had mixed infections. The ultrastructural morphology of all bacteria was most consistent with "H. heilmannii," even when 16S rRNA sequences were H. pylori-like. The urease gene from H. pylori-like bacteria could not be amplified with primers for either "H. heilmannii" or H. pylori urease, suggesting that this bacteria is neither H. pylori nor "H. heilmannii." The cagA gene was not identified in any case. These findings question a direct role for Helicobacter infection in the pathogenesis of gastritis and support the premise that host factors account for the differences in disease between captive and wild cheetah populations.

Comparison of Helicobacter spp. in Cheetahs (Acinonyx jubatus) with and without Gastritis

PubMed Central

Terio, K. A.; Munson, L.; Marker, L.; Aldridge, B. M.; Solnick, J. V.

2005-01-01

Chronic gastritis causes significant morbidity and mortality in captive cheetahs but is rare in wild cheetahs despite colonization by abundant spiral bacteria. This research aimed to identify the Helicobacter species that were associated with gastritis in captive cheetahs but are apparently commensal in wild cheetahs. Helicobacter species were characterized by PCR amplification and sequencing of the 16S rRNA, urease, and cagA genes and by transmission electron microscopy of frozen or formalin-fixed paraffin-embedded gastric samples from 33 cheetahs infected with Helicobacter organisms (10 wild without gastritis and 23 captive with gastritis). Samples were screened for mixed infections by denaturant gel gradient electrophoresis of the 16S rRNA gene and by transmission electron microscopy. There was no association between Helicobacter infection and the presence or severity of gastritis. Eight cheetahs had 16S rRNA sequences that were most similar (98 to 99%) to H. pylori. Twenty-five cheetahs had sequences that were most similar (97 to 99%) to “H. heilmannii” or H. felis. No cheetahs had mixed infections. The ultrastructural morphology of all bacteria was most consistent with “H. heilmannii,” even when 16S rRNA sequences were H. pylori-like. The urease gene from H. pylori-like bacteria could not be amplified with primers for either “H. heilmannii” or H. pylori urease, suggesting that this bacteria is neither H. pylori nor “H. heilmannii.” The cagA gene was not identified in any case. These findings question a direct role for Helicobacter infection in the pathogenesis of gastritis and support the premise that host factors account for the differences in disease between captive and wild cheetah populations. PMID:15634976

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

PubMed

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-02-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

PubMed Central

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here. PMID:10688367

Phylogenetic comparison of the methanogenic communities from an acidic, oligotrophic fen and an anaerobic digester treating municipal wastewater sludge.

PubMed

Steinberg, Lisa M; Regan, John M

2008-11-01

Methanogens play a critical role in the decomposition of organics under anaerobic conditions. The methanogenic consortia in saturated wetland soils are often subjected to large temperature fluctuations and acidic conditions, imposing a selective pressure for psychro- and acidotolerant community members; however, methanogenic communities in engineered digesters are frequently maintained within a narrow range of mesophilic and circumneutral conditions to retain system stability. To investigate the hypothesis that these two disparate environments have distinct methanogenic communities, the methanogens in an oligotrophic acidic fen and a mesophilic anaerobic digester treating municipal wastewater sludge were characterized by creating clone libraries for the 16S rRNA and methyl coenzyme M reductase alpha subunit (mcrA) genes. A quantitative framework was developed to assess the differences between these two communities by calculating the average sequence similarity for 16S rRNA genes and mcrA within a genus and family using sequences of isolated and characterized methanogens within the approved methanogen taxonomy. The average sequence similarities for 16S rRNA genes within a genus and family were 96.0 and 93.5%, respectively, and the average sequence similarities for mcrA within a genus and family were 88.9 and 79%, respectively. The clone libraries of the bog and digester environments showed no overlap at the species level and almost no overlap at the family level. Both libraries were dominated by clones related to uncultured methanogen groups within the Methanomicrobiales, although members of the Methanosarcinales and Methanobacteriales were also found in both libraries. Diversity indices for the 16S rRNA gene library of the bog and both mcrA libraries were similar, but these indices indicated much lower diversity in the 16S digester library than in the other three libraries.

Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

PubMed

Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

2014-11-01

Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.

PCR detection of Anaplasma phagocytophilum in goat flocks in an area endemic for tick-borne fever in Switzerland.

PubMed

Silaghi, C; Scheuerle, M C; Friche Passos, L M; Thiel, C; Pfister, K

2011-02-01

Central Switzerland is a highly endemic region for tick-borne fever (TBF) in cattle, however, little is known about A. phagocytophilum in goats. In the present study, 72 animals from six goat flocks (373 EDTA blood-samples) in Central Switzerland were analysed for A. phagocytophilum DNA. A real-time PCR targeting the msp2 gene of A. phagocytophilum was performed and in positive samples the partial 165 rRNA, groEL and msp4 gene were amplified for sequence analysis. Four DNA extracts were positive. Different sequence types on basis of the amplified genes were found. For comparison, sequences of A. phagocytophilum from 12 cattle (originating from Switzerland and Southern Germany) were analysed. The 165 rRNA gene sequences from cattle were all identical amongst each other, but the groEL and msp4 gene differed depending on the origin of the cattle samples and differed from the variants from goats. This study clearly provides molecular evidence for the presence of different types of A. phagocytophilum in goat flocks in Switzerland, a fact which deserves more thorough attention in clinical studies.

Comparison of Microbiomes between Red Poultry Mite Populations (Dermanyssus gallinae): Predominance of Bartonella-like Bacteria.

PubMed

Hubert, Jan; Erban, Tomas; Kopecky, Jan; Sopko, Bruno; Nesvorna, Marta; Lichovnikova, Martina; Schicht, Sabine; Strube, Christina; Sparagano, Olivier

2017-11-01

Blood feeding red poultry mites (RPM) serve as vectors of pathogenic bacteria and viruses among vertebrate hosts including wild birds, poultry hens, mammals, and humans. The microbiome of RPM has not yet been studied by high-throughput sequencing. RPM eggs, larvae, and engorged adult/nymph samples obtained in four poultry houses in Czechia were used for microbiome analyses by Illumina amplicon sequencing of the 16S ribosomal RNA (rRNA) gene V4 region. A laboratory RPM population was used as positive control for transcriptome analysis by pyrosequencing with identification of sequences originating from bacteria. The samples of engorged adult/nymph stages had 100-fold more copies of 16S rRNA gene copies than the samples of eggs and larvae. The microbiome composition showed differences among the four poultry houses and among observed developmental stadia. In the adults' microbiome 10 OTUs comprised 90 to 99% of all sequences. Bartonella-like bacteria covered between 30 and 70% of sequences in RPM microbiome and 25% bacterial sequences in transcriptome. The phylogenetic analyses of 16S rRNA gene sequences revealed two distinct groups of Bartonella-like bacteria forming sister groups: (i) symbionts of ants; (ii) Bartonella genus. Cardinium, Wolbachia, and Rickettsiella sp. were found in the microbiomes of all tested stadia, while Spiroplasma eriocheiris and Wolbachia were identified in the laboratory RPM transcriptome. The microbiomes from eggs, larvae, and engorged adults/nymphs differed. Bartonella-like symbionts were found in all stadia and sampling sites. Bartonella-like bacteria was the most diversified group within the RPM microbiome. The presence of identified putative pathogenic bacteria is relevant with respect to human and animal health issues while the identification of symbiontic bacteria can lead to new control methods targeting them to destabilize the arthropod host.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

PubMed

Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

2017-09-01

Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

Microbial Analysis of Bite Marks by Sequence Comparison of Streptococcal DNA

PubMed Central

Kennedy, Darnell M.; Stanton, Jo-Ann L.; García, José A.; Mason, Chris; Rand, Christy J.; Kieser, Jules A.; Tompkins, Geoffrey R.

2012-01-01

Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA) gene, 16S–23S intergenic spacer (ITS) and RNA polymerase beta subunit (rpoB). High throughput sequencing (GS FLX 454), followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants. PMID:23284761

Microbial diversity in degraded and non-degraded petroleum samples and comparison across oil reservoirs at local and global scales.

PubMed

Sierra-Garcia, Isabel Natalia; Dellagnezze, Bruna M; Santos, Viviane P; Chaves B, Michel R; Capilla, Ramsés; Santos Neto, Eugenio V; Gray, Neil; Oliveira, Valeria M

2017-01-01

Microorganisms have shown their ability to colonize extreme environments including deep subsurface petroleum reservoirs. Physicochemical parameters may vary greatly among petroleum reservoirs worldwide and so do the microbial communities inhabiting these different environments. The present work aimed at the characterization of the microbiota in biodegraded and non-degraded petroleum samples from three Brazilian reservoirs and the comparison of microbial community diversity across oil reservoirs at local and global scales using 16S rRNA clone libraries. The analysis of 620 16S rRNA bacterial and archaeal sequences obtained from Brazilian oil samples revealed 42 bacterial OTUs and 21 archaeal OTUs. The bacterial community from the degraded oil was more diverse than the non-degraded samples. Non-degraded oil samples were overwhelmingly dominated by gammaproteobacterial sequences with a predominance of the genera Marinobacter and Marinobacterium. Comparisons of microbial diversity among oil reservoirs worldwide suggested an apparent correlation of prokaryotic communities with reservoir temperature and depth and no influence of geographic distance among reservoirs. The detailed analysis of the phylogenetic diversity across reservoirs allowed us to define a core microbiome encompassing three bacterial classes (Gammaproteobacteria, Clostridia, and Bacteroidia) and one archaeal class (Methanomicrobia) ubiquitous in petroleum reservoirs and presumably owning the abilities to sustain life in these environments.

Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

USDA-ARS?s Scientific Manuscript database

This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

PubMed Central

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

2013-01-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

PubMed

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

2013-10-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain.

PubMed

Criado-Fornelio, A; Rey-Valeiron, C; Buling, A; Barba-Carretero, J C; Jefferies, R; Irwin, P

2007-03-31

The prevalence of hematozoan infections (Hepatozoon canis and Babesia sp., particularly Babesia canis vogeli) in canids from Venezuela, Thailand and Spain was studied by amplification and sequencing of the 18S rRNA gene. H. canis infections caused simultaneously by two different isolates were confirmed by RFLP analysis in samples from all the geographic regions studied. In Venezuela, blood samples from 134 dogs were surveyed. Babesia infections were found in 2.24% of the dogs. Comparison of sequences of the 18S rRNA gene indicated that protozoan isolates were genetically identical to B. canis vogeli from Japan and Brazil. H. canis infected 44.77 per cent of the dogs. A representative sample of Venezuelan H. canis isolates (21.6% of PCR-positives) was sequenced. Many of them showed 18S rRNA gene sequences identical to H. canis Spain 2, albeit two less frequent genotypes were found in the sample studied. In Thailand, 20 dogs were analyzed. No infections caused by Babesia were diagnosed, whereas 30 per cent of the dogs were positive to hematozoan infection. Two protozoa isolates showing 99.7-100% identity to H. canis Spain 2 were found. In Spain, 250 dogs were studied. B. canis vogeli infected 0.01% of the animals. The sequence of the 18S rRNA gene in Spanish isolates of this protozoa was closely related to those previously deposited in GenBank (> 99% identity). Finally, 20 red foxes were screened for hematozoans employing semi-nested PCR and primers designed to detect Babesia/Theileria. Fifty percent of the foxes were positive to Theileria annae. In addition, it was found that the PCR assay was able as well to detect Hepatozoon infections. Thirty five percent of the foxes were infected with two different H. canis isolates showing 99.8-100% identity to Curupira 1 from Brazil.

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

Complete mitochondrial genome of the moon jellyfish, Aurelia sp. nov. (Cnidaria, Scyphozoa).

PubMed

Hwang, Dae-Sik; Park, Eunji; Won, Yong-Jin; Lee, Jae-Seong

2014-02-01

We sequenced 16,971 bp of the linear mitochondrial DNA of the moon jellyfish Aurelia sp. nov. and characterized it by comparing with Aurelia aurita. They had 13 protein-coding genes (PCGs), 16S rRNA and 12S rRNA with three tRNAs (tRNA-Leu, tRNA-Ser(TGA), tRNA-Met). Both have another two PCGs, orf969 and orf324 with telomeres at both ends. After comparison of Aurelia sp. nov. with Aurelia aurita, we found low-protein similarity of orf969 (59%) and orf324 (75%), respectively, while the other 13 PCGs showed 80% to 98% protein similarities.

No need to replace an “anomalous” primate (Primates) with an “anomalous” bear (Carnivora, Ursidae)

PubMed Central

Gutiérrez, Eliécer E.; Pine, Ronald H.

2015-01-01

Abstract By means of mitochondrial 12S rRNA sequencing of putative “yeti”, “bigfoot”, and other “anomalous primate” hair samples, a recent study concluded that two samples, presented as from the Himalayas, do not belong to an “anomalous primate”, but to an unknown, anomalous type of ursid. That is, that they match 12S rRNA sequences of a fossil Polar Bear (Ursus maritimus), but neither of modern Polar Bears, nor of Brown Bears (Ursus arctos), the closest relative of Polar Bears, and one that occurs today in the Himalayas. We have undertaken direct comparison of sequences; replication of the original comparative study; inference of phylogenetic relationships of the two samples with respect to those from all extant species of Ursidae (except for the Giant Panda, Ailuropoda melanoleuca) and two extinct Pleistocene species; and application of a non-tree-based population aggregation approach for species diagnosis and identification. Our results demonstrate that the very short fragment of the 12S rRNA gene sequenced by Sykes et al. is not sufficiently informative to support the hypotheses provided by these authors with respect to the taxonomic identity of the individuals from which these sequences were obtained. We have concluded that there is no reason to believe that the two samples came from anything other than Brown Bears. These analyses afforded an opportunity to test the monophyly of morphologically defined species and to comment on both their phylogenetic relationships and future efforts necessary to advance our understanding of ursid systematics. PMID:25829853

Pyrosequencing of Bacterial Symbionts within Axinella corrugata Sponges: Diversity and Seasonal Variability

PubMed Central

White, James R.; Patel, Jignasa; Ottesen, Andrea; Arce, Gabriela; Blackwelder, Patricia; Lopez, Jose V.

2012-01-01

Background Marine sponge species are of significant interest to many scientific fields including marine ecology, conservation biology, genetics, host-microbe symbiosis and pharmacology. One of the most intriguing aspects of the sponge “holobiont” system is the unique physiology, interaction with microbes from the marine environment and the development of a complex commensal microbial community. However, intraspecific variability and temporal stability of sponge-associated bacterial symbionts remain relatively unknown. Methodology/Principal Findings We have characterized the bacterial symbiont community biodiversity of seven different individuals of the Caribbean reef sponge Axinella corrugata, from two different Florida reef locations during variable seasons using multiplex 454 pyrosequencing of 16 S rRNA amplicons. Over 265,512 high-quality 16 S rRNA sequences were generated and analyzed. Utilizing versatile bioinformatics methods and analytical software such as the QIIME and CloVR packages, we have identified 9,444 distinct bacterial operational taxonomic units (OTUs). Approximately 65,550 rRNA sequences (24%) could not be matched to bacteria at the class level, and may therefore represent novel taxa. Differentially abundant classes between seasonal Axinella communities included Gammaproteobacteria, Flavobacteria, Alphaproteobacteria, Cyanobacteria, Acidobacter and Nitrospira. Comparisons with a proximal outgroup sponge species (Amphimedon compressa), and the growing sponge symbiont literature, indicate that this study has identified approximately 330 A. corrugata-specific symbiotic OTUs, many of which are related to the sulfur-oxidizing Ectothiorhodospiraceae. This family appeared exclusively within A. corrugata, comprising >34.5% of all sequenced amplicons. Other A. corrugata symbionts such as Deltaproteobacteria, Bdellovibrio, and Thiocystis among many others are described. Conclusions/Significance Slight shifts in several bacterial taxa were observed between communities sampled during spring and fall seasons. New 16 S rDNA sequences and concomitant identifications greatly expand the microbial community profile for this model reef sponge, and will likely be useful as a baseline for any future comparisons regarding sponge microbial community dynamics. PMID:22701613

Phylogenetic analysis of nitrite, nitric oxide, and nitrous oxide respiratory enzymes reveal a complex evolutionary history for denitrification.

PubMed

Jones, Christopher M; Stres, Blaz; Rosenquist, Magnus; Hallin, Sara

2008-09-01

Denitrification is a facultative respiratory pathway in which nitrite (NO2(-)), nitric oxide (NO), and nitrous oxide (N2O) are successively reduced to nitrogen gas (N(2)), effectively closing the nitrogen cycle. The ability to denitrify is widely dispersed among prokaryotes, and this polyphyletic distribution has raised the possibility of horizontal gene transfer (HGT) having a substantial role in the evolution of denitrification. Comparisons of 16S rRNA and denitrification gene phylogenies in recent studies support this possibility; however, these results remain speculative as they are based on visual comparisons of phylogenies from partial sequences. We reanalyzed publicly available nirS, nirK, norB, and nosZ partial sequences using Bayesian and maximum likelihood phylogenetic inference. Concomitant analysis of denitrification genes with 16S rRNA sequences from the same organisms showed substantial differences between the trees, which were supported by examining the posterior probability of monophyletic constraints at different taxonomic levels. Although these differences suggest HGT of denitrification genes, the presence of structural variants for nirK, norB, and nosZ makes it difficult to determine HGT from other evolutionary events. Additional analysis using phylogenetic networks and likelihood ratio tests of phylogenies based on full-length sequences retrieved from genomes also revealed significant differences in tree topologies among denitrification and 16S rRNA gene phylogenies, with the exception of the nosZ gene phylogeny within the data set of the nirK-harboring genomes. However, inspection of codon usage and G + C content plots from complete genomes gave no evidence for recent HGT. Instead, the close proximity of denitrification gene copies in the genomes of several denitrifying bacteria suggests duplication. Although HGT cannot be ruled out as a factor in the evolution of denitrification genes, our analysis suggests that other phenomena, such gene duplication/divergence and lineage sorting, may have differently influenced the evolution of each denitrification gene.

Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

PubMed Central

Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

2016-01-01

Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

Evolutionary Origin and Conserved Structural Building Blocks of Riboswitches and Ribosomal RNAs: Riboswitches as Probable Target Sites for Aminoglycosides Interaction.

PubMed

Mehdizadeh Aghdam, Elnaz; Barzegar, Abolfazl; Hejazi, Mohammad Saeid

2014-01-01

Riboswitches, as noncoding RNA sequences, control gene expression through direct ligand binding. Sporadic reports on the structural relation of riboswitches with ribosomal RNAs (rRNA), raises an interest in possible similarity between riboswitches and rRNAs evolutionary origins. Since aminoglycoside antibiotics affect microbial cells through binding to functional sites of the bacterial rRNA, finding any conformational and functional relation between riboswitches/rRNAs is utmost important in both of medicinal and basic research. Analysis of the riboswitches structures were carried out using bioinformatics and computational tools. The possible functional similarity of riboswitches with rRNAs was evaluated based on the affinity of paromomycin antibiotic (targeting "A site" of 16S rRNA) to riboswitches via docking method. There was high structural similarity between riboswitches and rRNAs, but not any particular sequence based similarity between them was found. The building blocks including "hairpin loop containing UUU", "peptidyl transferase center conserved hairpin A loop"," helix 45" and "S2 (G8) hairpin" as high identical rRNA motifs were detected in all kinds of riboswitches. Surprisingly, binding energies of paromomycin with different riboswitches are considerably better than the binding energy of paromomycin with "16S rRNA A site". Therefore the high affinity of paromomycin to bind riboswitches in comparison with rRNA "A site" suggests a new insight about riboswitches as possible targets for aminoglycoside antibiotics. These findings are considered as a possible supporting evidence for evolutionary origin of riboswitches/rRNAs and also their role in the exertion of antibiotics effects to design new drugs based on the concomitant effects via rRNA/riboswitches.

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

PubMed

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Analysis of the Gull Fecal Microbial Community Reveals the Dominance of Catellicoccus marimammalium in Relation to Culturable Enterococci

PubMed Central

Koskey, Amber M.; Fisher, Jenny C.; Traudt, Mary F.; Newton, Ryan J.

2014-01-01

Gulls are prevalent in beach environments and can be a major source of fecal contamination. Gulls have been shown to harbor a high abundance of fecal indicator bacteria (FIB), such as Escherichia coli and enterococci, which can be readily detected as part of routine beach monitoring. Despite the ubiquitous presence of gull fecal material in beach environments, the associated microbial community is relatively poorly characterized. We generated comprehensive microbial community profiles of gull fecal samples using Roche 454 and Illumina MiSeq platforms to investigate the composition and variability of the gull fecal microbial community and to measure the proportion of FIB. Enterococcaceae and Enterobacteriaceae were the two most abundant families in our gull samples. Sequence comparisons between short-read data and nearly full-length 16S rRNA gene clones generated from the same samples revealed Catellicoccus marimammalium as the most numerous taxon among all samples. The identification of bacteria from gull fecal pellets cultured on membrane-Enterococcus indoxyl-β-d-glucoside (mEI) plates showed that the dominant sequences recovered in our sequence libraries did not represent organisms culturable on mEI. Based on 16S rRNA gene sequencing of gull fecal isolates cultured on mEI plates, 98.8% were identified as Enterococcus spp., 1.2% were identified as Streptococcus spp., and none were identified as C. marimammalium. Illumina deep sequencing indicated that gull fecal samples harbor significantly higher proportions of C. marimammalium 16S rRNA gene sequences (>50-fold) relative to typical mEI culturable Enterococcus spp. C. marimammalium therefore can be confidently utilized as a genetic marker to identify gull fecal pollution in the beach environment. PMID:24242244

Ribosomal RNA gene detection and targeted culture of novel nitrogen-responsive fungal taxa from temperate pine forest soil.

PubMed

Hesse, Cedar N; Torres-Cruz, Terry J; Tobias, Terri Billingsley; Al-Matruk, Maryam; Porras-Alfaro, Andrea; Kuske, Cheryl R

Soil fungal communities are responsible for carbon and nitrogen (N) cycling. The high complexity of the soil fungal community and the high proportion of taxonomically unidentifiable sequences confound ecological interpretations in field studies because physiological information is lacking for many organisms known only by their rRNA sequences. This situation forces experimental comparisons to be made at broader taxonomic racks where functions become difficult to infer. The objective of this study was to determine OTU (operational taxonomic units) level responses of the soil fungal community to N enrichment in a temperate pine forest experiment and to use the sequencing data to guide culture efforts of novel N-responsive fungal taxa. Replicate samples from four soil horizons (up to 10 cm depth) were obtained from ambient, enriched CO 2 and N-fertilization plots. Through a fungal large subunit rRNA gene (LSU) sequencing survey, we identified two novel fungal clades that were abundant in our soil sampling (representing up to 27% of the sequences in some samples) and responsive to changes in soil N. The two N-responsive taxa with no predicted taxonomic association were targeted for isolation and culturing from specific soil samples where their sequences were abundant. Representatives of both OTUs were successfully cultured using a filtration approach. One taxon (OTU6) was most closely related to Saccharomycotina; the second taxon (OTU69) was most closely related to Mucoromycotina. Both taxa likely represent novel species. This study shows how observation of specific OTUs level responses to altered N status in a large rRNA gene field survey provided the impetus to design targeted culture approaches for isolation of novel N-responsive fungal taxa.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sunita,S.; Zhenxing, H.; Swaathi, J.

2006-01-01

Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. Themore » structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.« less

Pedobacter tournemirensis sp. nov., isolated from a fault water sample of a deep Toarcian argillite layer.

PubMed

Urios, Laurent; Intertaglia, Laurent; Magot, Michel

2013-01-01

A Gram-negative bacterium, designated TF5-37.2-LB10(T), was isolated from subsurface water of the Toarcian geological layer of Tournemire, France. Cells were non-motile straight rods that formed cream to light pink colonies on 10-fold diluted LB agar. Strain TF5-37.2-LB10(T) contained menaquinone 7 and its major fatty acids were iso-C(15 : 0), summed feature 3 (iso-C(15 : 0) 2-OH and/or C(16 : 1)ω7c), iso-C(17 : 0) 3-OH and iso-C(17 : 1)ω9c. The G+C content of the genomic DNA was 46 mol%. Phylogenetic analysis of the 16S rRNA gene sequence placed strain TF5-37.2-LB10(T) within the genus Pedobacter, family Sphingobacteriaceae. Pedobacter composti TR6-06(T) and Pedobacter oryzae DSM 19973(T) were the closest phylogenetic relatives (93.5 and 93.3 % 16S rRNA gene sequence similarity, respectively). On the basis of 16S rRNA gene sequence comparison and physiological and biochemical characteristics, strain TF5-37.2-LB10(T) represents a novel species of the genus Pedobacter, for which the name Pedobacter tournemirensis sp. nov. is proposed. The type strain is TF5-37.2-LB10(T) (= DSM 23085(T) = CIP 110085(T) = MOLA 820(T)).

Comparison of plastid 16S rRNA (rrn16) genes from Helicosporidium spp.: evidence supporting the reclassification of Helicosporidia as green algae (Chlorophyta).

PubMed

Tartar, Aurélien; Boucias, Drion G; Becnel, James J; Adams, Byron J

2003-11-01

The Helicosporidia are invertebrate pathogens that have recently been identified as non-photosynthetic green algae (Chlorophyta). In order to confirm the algal nature of the genus Helicosporidium, the presence of a retained chloroplast genome in Helicosporidia cells was investigated. Fragments homologous to plastid 16S rRNA (rrn16) genes were amplified successfully from cellular DNA extracted from two different Helicosporidium isolates. The fragment sequences are 1269 and 1266 bp long, are very AT-rich (60.7 %) and are similar to homologous genes sequenced from non-photosynthetic green algae. Maximum-parsimony, maximum-likelihood and neighbour-joining methods were used to infer phylogenetic trees from an rrn16 sequence alignment. All trees depicted the Helicosporidia as sister taxa to the non-photosynthetic, pathogenic alga Prototheca zopfii. Moreover, the trees identified Helicosporidium spp. as members of a clade that included the heterotrophic species Prototheca spp. and the mesotrophic species Chlorella protothecoides. The clade is always strongly supported by bootstrap values, suggesting that all these organisms share a most recent common ancestor. Phylogenetic analyses inferred from plastid 16S rRNA genes confirmed that the Helicosporidia are non-photosynthetic green algae, close relatives of the genus Prototheca (Chlorophyta, Trebouxiophyceae). Such phylogenetic affinities suggest that Helicosporidium spp. are likely to possess Prototheca-like organelles and organelle genomes.

[Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

PubMed

Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

2013-07-04

Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

PubMed

Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

2017-04-01

Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of 16S rRNA gene was used as gold standard in this study, it could not correctly identify S. capitis and S. xylosus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

PubMed Central

Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

2003-01-01

The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

Identification, characterization and description of Arcobacter faecis sp. nov., isolated from a human waste septic tank.

PubMed

Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H

2016-03-01

A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.

A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari.

PubMed

Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

2011-06-01

In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Streptococcus caprae sp. nov., isolated from Iberian ibex (Capra pyrenaica hispanica).

PubMed

Vela, A I; Mentaberre, G; Lavín, S; Domínguez, L; Fernández-Garayzábal, J F

2016-01-01

Biochemical and molecular genetic studies were performed on a novel Gram-stain-positive, catalase-negative, coccus-shaped organism isolated from tonsil samples of two Iberian ibexes. The micro-organism was identified as a streptococcal species based on its cellular, morphological and biochemical characteristics. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus, but the organism did not correspond to any species of this genus. The nearest phylogenetic relative of the unknown coccus from ibex was Streptococcus porci 2923-03T (96.6 % 16S rRNA gene sequence similarity). Analysis based on rpoB and sodA gene sequences revealed sequence similarity values lower than 86.0 and 83.8 %, respectively, from the type strains of recognized Streptococcus species. The novel bacterial isolate was distinguished from Streptococcus porci and other Streptococcus species using biochemical tests. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as representing a novel species of the genus Streptococcus, for which the name Streptococcus caprae sp. nov. is proposed. The type strain is DICM07-02790-1CT ( = CECT 8872T = CCUG 67170T).

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Occurrence of Stolbur Phytoplasma Disease in Spreading Type Petunia hybrida Cultivars in Korea

PubMed Central

Chung, Bong Nam; Jeong, Myeong Il; Choi, Seung Kook; Joa, Jae Ho; Choi, Kyeong San; Choi, In Myeong

2013-01-01

In January 2012, spreading type petunia cv. Wave Pink plants showing an abnormal growth habit of sprouting unusual multiple plantlets from the lateral buds were collected from a greenhouse in Gwacheon, Gyeonggi Province, Korea. The presence of phytoplasma was investigated using PCR with the primer pairs P1/P6, and R16F1/R1 for nested-PCR. In the nested PCR, 1,096 bp PCR products were obtained, and through sequencing 12 Pet-Stol isolates were identified. Comparison of the nucleotide sequences of 16S rRNA gene of the 12 Pet-Stol isolates with other phytoplasmas belonging to aster yellows or Stolbur showed that Pet-Stol isolates were members of Stolbur. The presence of phytoplasma in petunia was also confirmed by microscopic observation of the pathogens. In this study, Stolbur phytoplasma was identified from spreading type petunia cultivars by sequence analysis of 16S rRNA gene of phytoplasma and microscopic observation of phytoplasma bodies. This is the first report of Stolbur phytoplasma in commercial Petunia hybrida cultivars. PMID:25288978

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

PubMed

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

The complete chloroplast genome of Aconitum chiisanense Nakai (Ranunculaceae).

PubMed

Lim, Chae Eun; Kim, Goon-Bo; Baek, Seunghoon; Han, Su-Min; Yu, Hee-Ju; Mun, Jeong-Hwan

2017-01-01

We determined the complete chloroplast DNA sequence of Aconitum chiisanense Nakai, a rare Aconitum species endemic to Korea. The chloroplast genome is 155 934 bp in length and contains 4 rRNA, 30 tRNA, and 78 protein-coding genes. Phylogenetic analysis revealed that the chloroplast genome of A. chiisanense is closely related to that of A. barbatum var. puberulum. Sequence comparison with other Ranunculaceae chloroplasts identified a unique deletion in the rps16 gene of A. chiisanense chloroplast DNA that can serve as a molecular marker for species identification.

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

PubMed

Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

2008-08-01

Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

Isolation and identification of multidrug-resistant Staphylococcus haemolyticus from a laboratory-breeding mouse.

PubMed

Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu

2011-06-01

To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

PubMed

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

PubMed

Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

2012-07-15

In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

Methanobacterium aarhusense sp. nov., a novel methanogen isolated from a marine sediment (Aarhus Bay, Denmark).

PubMed

Shlimon, Adris Georgis; Friedrich, Michael W; Niemann, Helge; Ramsing, Niels Birger; Finster, Kai

2004-05-01

Strain H2-LR(T), a 5-18 micro m long and 0.7 micro m wide filamentous, mesophilic, moderately halophilic, non-motile hydrogenotrophic methanogen, was isolated from marine sediment of Aarhus Bay, Denmark, 1.7 m below the sediment surface. On the basis of 16S rRNA gene comparison with sequences of known methanogens, strain H2-LR(T) could be affiliated to the genus Methanobacterium. The strain forms a distinct line of descent within this genus, with Methanobacterium oryzae (95.9 % sequence identity) and Methanobacterium bryantii (95.7 % sequence identity) as its closest relatives. The 16S rRNA-based affiliation was supported by comparison of the mcrA gene, which encodes the alpha-subunit of methyl-coenzyme M reductase. Strain H2-LR(T) grew only on H(2)/CO(2). The DNA G+C content is 34.9 mol%. Optimum growth temperature was 45 degrees C. The strain grew equally well at pH 7.5 and 8. No growth or methane production was observed below pH 5 or above pH 9. Strain H2-LR(T) grew well within an NaCl concentration range of 100 and 900 mM. No growth or methane production was observed at 1 M NaCl. At 50 mM NaCl, growth and methane production were reduced. Based on 16S rRNA gene sequence analysis, the isolate is proposed to represent a novel taxon within the genus Methanobacterium, namely Methanobacterium aarhusense sp. nov. The type strain is H2-LR(T) (=DSM 15219(T)=ATCC BAA-828(T)).

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Gene copy number variation and its significance in cyanobacterial phylogeny

PubMed Central

2012-01-01

Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological characteristics of cyanobacteria. PMID:22894826

Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

PubMed

Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

2016-12-15

Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex

PubMed Central

Weber, Carolyn F.; King, Gary M.

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex.

PubMed

Weber, Carolyn F; King, Gary M

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).

Alignment-Independent Comparisons of Human Gastrointestinal Tract Microbial Communities in a Multidimensional 16S rRNA Gene Evolutionary Space▿

PubMed Central

Rudi, Knut; Zimonja, Monika; Kvenshagen, Bente; Rugtveit, Jarle; Midtvedt, Tore; Eggesbø, Merete

2007-01-01

We present a novel approach for comparing 16S rRNA gene clone libraries that is independent of both DNA sequence alignment and definition of bacterial phylogroups. These steps are the major bottlenecks in current microbial comparative analyses. We used direct comparisons of taxon density distributions in an absolute evolutionary coordinate space. The coordinate space was generated by using alignment-independent bilinear multivariate modeling. Statistical analyses for clone library comparisons were based on multivariate analysis of variance, partial least-squares regression, and permutations. Clone libraries from both adult and infant gastrointestinal tract microbial communities were used as biological models. We reanalyzed a library consisting of 11,831 clones covering complete colons from three healthy adults in addition to a smaller 390-clone library from infant feces. We show that it is possible to extract detailed information about microbial community structures using our alignment-independent method. Our density distribution analysis is also very efficient with respect to computer operation time, meeting the future requirements of large-scale screenings to understand the diversity and dynamics of microbial communities. PMID:17337554

Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

NASA Technical Reports Server (NTRS)

Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

1994-01-01

When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

PubMed Central

Fischer, Sandra; Kumar, Neeraj

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

PubMed

Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

Comparison of MI, Chromocult® coliform, and Compass CC chromogenic culture-based methods to detect Escherichia coli and total coliforms in water using 16S rRNA sequencing for colony identification.

PubMed

Maheux, Andrée F; Bouchard, Sébastien; Bérubé, Ève; Bergeron, Michel G

2017-06-01

The MI, Chromocult ® coliform, and Compass CC chromogenic culture-based methods used to assess water quality by the detection of Escherichia coli and total coliforms were compared in terms of their specificity and sensitivity, using 16S rRNA sequencing for colony identification. A sewage water sample was divided in 2-μL subsamples for testing by all three culture-based methods. All growing colonies were harvested and subjected to 16S rRNA sequencing. Test results showed that all E. coli colonies were correctly identified by all three methods, for a specificity and a sensitivity of 100%. However, for the total coliform detection, the MI agar, Chromocult ® coliform agar, and Compass CC agar were specific for only 69.2% (9/13), 47.2% (25/53), and 40.5% (17/42), whereas sensitive for 97.8% (45/46), 97.5% (39/40), and 85.7% (24/28), respectively. Thus, given the low level of specificity of these methods for the detection of total coliforms, confirming the identity of total coliform colonies could help to take public health decisions, in particular for cities connected to a public drinking water distribution system since the growth of few putative total coliform colonies on chromogenic agar is problematic and can lead to unnecessary and costly boiling notices from public health authorities.

Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene.

PubMed

Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi

2015-07-01

A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.

PubMed

Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

2007-03-01

A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

PubMed

Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

2016-03-01

Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

PubMed Central

Ampe, Frédéric

2000-01-01

Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria. PMID:10788405

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Influence of Molecular Resolution on Sequence-Based Discovery of Ecological Diversity among Synechococcus Populations in an Alkaline Siliceous Hot Spring Microbial Mat ▿ †

PubMed Central

Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.

2011-01-01

Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433

Ursidibacter maritimus gen. nov., sp. nov. and Ursidibacter arcticus sp. nov., two new members of the family Pasteurellaceae isolated from the oral cavity of bears.

PubMed

Johanne Hansen, Mie; Strøm Braaten, Mira; Miki Bojesen, Anders; Christensen, Henrik; Sonne, Christian; Dietz, Rune; Frost Bertelsen, Mads

2015-10-01

Thirty-three suspected strains of the family Pasteurellaceae isolated from the oral cavity of polar and brown bears were characterized by genotypic and phenotypic tests. Phylogenetic analysis of partial 16S rRNA gene and rpoB sequences showed that the investigated isolates formed two closely related monophyletic groups, representing two novel species of a new genus. Based on 16S rRNA gene sequence comparison Bibersteinia trehalosi was the closest related species with a validly published name, with 95.4 % similarity to the polar bear group and 94.4 % similarity to the brown bear group. Otariodibacter oris was the closest related species based on rpoB sequence comparison with a similarity of 89.8 % with the polar bear group and 90 % with the brown bear group. The new genus could be separated from existing genera of the family Pasteurellaceae by three to ten phenotypic characters, and the two novel species could be separated from each other by two phenotypic characters. It is proposed that the strains should be classified as representatives of a new genus, Ursidibacter gen. nov., with two novel species: the type species Ursidibacter maritimus sp. nov., isolated from polar bears (type strain Pb43106T = CCUG 65144T = DSM 28137T, DNA G+C content 39.3 mol%), and Ursidibacter arcticus sp. nov., isolated from brown bears (type strain Bamse61T = CCUG 65145T = DSM 28138T).

Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

PubMed

Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

2016-05-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Skin microbiome surveys are strongly influenced by experimental design

PubMed Central

Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

2016-01-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

Actinomyces timonensis sp. nov., isolated from a human clinical osteo-articular sample.

PubMed

Renvoise, Aurélie; Raoult, Didier; Roux, Véronique

2010-07-01

Gram-positive, non-spore-forming rods were isolated from a human osteo-articular sample (strain 7400942(T)). Based on cellular morphology and the results of biochemical analysis, this strain was tentatively identified as a novel species of the genus Actinomyces. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that the bacterium was closely related to the type strain of Actinomyces denticolens (96.9 % 16S rRNA gene sequence similarity). A comparison of biochemical traits showed that strain 7400942(T) was distinct from A. denticolens in a number of characteristics, i.e. in contrast with A. denticolens, strain 7400942(T) was negative for nitrate reduction and for beta-galactosidase, alpha-glucosidase and alanine arylamidase activities, it was positive for acid production from N-acetylglucosamine, melezitose and glycogen, and it was negative for acid production from turanose. Matrix-assisted laser-desorption/ionization time-of-flight MS protein analysis confirmed that strain 7400942(T) represents a novel species, as scores obtained for its spectra were significant (>2.2) only with strain 7400942(T). On the basis of phenotypic data and phylogenetic inference, it is proposed that this strain should be designated Actinomyces timonensis sp. nov.; the type strain is strain 7400942(T) (=CSUR P35(T)=CCUG 55928(T)).

Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

PubMed

Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

1991-06-01

The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

2010-01-01

Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Unexpected Importance of Potential Parasites in the Composition of the Freshwater Small-Eukaryote Community▿

PubMed Central

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2008-01-01

The diversity of small eukaryotes (0.2 to 5 μm) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types. PMID:18359836

Unexpected importance of potential parasites in the composition of the freshwater small-eukaryote community.

PubMed

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2008-05-01

The diversity of small eukaryotes (0.2 to 5 mum) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types.

Legionella confirmation in cooling tower water. Comparison of culture, real-time PCR and next generation sequencing.

PubMed

Farhat, Maha; Shaheed, Raja A; Al-Ali, Haider H; Al-Ghamdi, Abdullah S; Al-Hamaqi, Ghadeer M; Maan, Hawraa S; Al-Mahfoodh, Zainab A; Al-Seba, Hussain Z

2018-02-01

To investigate the presence of Legionella spp in cooling tower water. Legionella proliferation in cooling tower water has serious public health implications as it can be transmitted to humans via aerosols and cause Legionnaires' disease. Samples of cooling tower water were collected from King Fahd Hospital of the University (KFHU) (Imam Abdulrahman Bin Faisal University, 2015/2016). The water samples were analyzed by a standard Legionella culture method, real-time polymerase chain reaction (RT-PCR), and 16S rRNA next-generation sequencing. In addition, the bacterial community composition was evaluated. All samples were negative by conventional Legionella culture. In contrast, all water samples yielded positive results by real-time PCR (105 to 106 GU/L). The results of 16S rRNA next generation sequencing showed high similarity and reproducibility among the water samples. The majority of sequences were Alpha-, Beta-, and Gamma-proteobacteria, and Legionella was the predominant genus. The hydrogen-oxidizing gram-negative bacterium Hydrogenophaga was present at high abundance, indicating high metabolic activity. Sphingopyxis, which is known for its resistance to antimicrobials and as a pioneer in biofilm formation, was also detected. Our findings indicate that monitoring of Legionella in cooling tower water would be enhanced by use of both conventional culturing and molecular methods.

Evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus

NASA Technical Reports Server (NTRS)

Miller, S. R.; Castenholz, R. W.

2000-01-01

The extension of ecological tolerance limits may be an important mechanism by which microorganisms adapt to novel environments, but it may come at the evolutionary cost of reduced performance under ancestral conditions. We combined a comparative physiological approach with phylogenetic analyses to study the evolution of thermotolerance in hot spring cyanobacteria of the genus Synechococcus. Among the 20 laboratory clones of Synechococcus isolated from collections made along an Oregon hot spring thermal gradient, four different 16S rRNA gene sequences were identified. Phylogenies constructed by using the sequence data indicated that the clones were polyphyletic but that three of the four sequence groups formed a clade. Differences in thermotolerance were observed for clones with different 16S rRNA gene sequences, and comparison of these physiological differences within a phylogenetic framework provided evidence that more thermotolerant lineages of Synechococcus evolved from less thermotolerant ancestors. The extension of the thermal limit in these bacteria was correlated with a reduction in the breadth of the temperature range for growth, which provides evidence that enhanced thermotolerance has come at the evolutionary cost of increased thermal specialization. This study illustrates the utility of using phylogenetic comparative methods to investigate how evolutionary processes have shaped historical patterns of ecological diversification in microorganisms.

Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.

PubMed

Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel

2017-11-01

One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).

Pseudomonas aestus sp. nov., a plant growth-promoting bacterium isolated from mangrove sediments.

PubMed

Vasconcellos, Rafael L F; Santos, Suikinai Nobre; Zucchi, Tiago Domingues; Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Melo, Itamar Soares

2017-10-01

Strain CMAA 1215 T , a Gram-reaction-negative, aerobic, catalase positive, polarly flagellated, motile, rod-shaped (0.5-0.8 × 1.3-1.9 µm) bacterium, was isolated from mangrove sediments, Cananéia Island, Brazil. Analysis of the 16S rRNA gene sequences showed that strain CMAA 1215 T forms a distinct phyletic line within the Pseudomonas putida subclade, being closely related to P. plecoglossicida ATCC 700383 T , P. monteilii NBRC 103158 T , and P. taiwanensis BCRC 17751 T of sequence similarity of 98.86, 98.73, and 98.71%, respectively. Genomic comparisons of the strain CMAA 1215 T with its closest phylogenetic type strains using average nucleotide index (ANI) and DNA:DNA relatedness approaches revealed 84.3-85.3% and 56.0-63.0%, respectively. A multilocus sequence analysis (MLSA) performed concatenating 16S rRNA, gyrB and rpoB gene sequences from the novel species was related with Pseudomonas putida subcluster and formed a new phylogenetic lineage. The phenotypic, physiological, biochemical, and genetic characteristics support the assignment of CMAA 1215 T to the genus Pseudomonas, representing a novel species. The name Pseudomonas aestus sp.nov. is proposed, with CMAA 1215 T (=NRRL B-653100 T  = CBMAI 1962 T ) as the type strain.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

PubMed Central

Patarca, R; Dorta, B; Ramirez, J L

1982-01-01

As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

PubMed Central

Garcia, S; Kovařík, A

2013-01-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

PubMed

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

MetaMetaDB: a database and analytic system for investigating microbial habitability.

PubMed

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Sequence analysis of chloroplast chlB gene of medicinal Ephedra species and its application to authentication of Ephedra Herb.

PubMed

Guo, Yahong; Tsuruga, Ayako; Yamaguchi, Shigeharu; Oba, Koji; Iwai, Kasumi; Sekita, Setsuko; Mizukami, Hajime

2006-06-01

Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.

Complete mitochondrial genome sequence of Indian medium carp, Labeo gonius (Hamilton, 1822) and its comparison with other related carp species.

PubMed

Behera, Bijay Kumar; Kumari, Kavita; Baisvar, Vishwamitra Singh; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Jena, J K

2017-01-01

In the present study, the complete mitochondrial genome sequence of Labeo gonius is reported using PGM sequencer (Ion Torrent). The complete mitogenome of L. gonius is obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP) which is 16 614 bp in length. The mitogenome of L. gonius comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNA genes, and D-loop as control region along with gene order and organization, being similar to most of other fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of Labeo fimbriatus, as reported earlier. The phylogenetic analysis of Cypriniformes depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of L. gonius would be helpful in understanding the population genetics, phylogenetics, and evolution of Indian Carps.

Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens.

PubMed

Lewis, William H; Sendra, Kacper M; Embley, T Martin; Esteban, Genoveva F

2018-01-01

Many anaerobic ciliated protozoa contain organelles of mitochondrial ancestry called hydrogenosomes. These organelles generate molecular hydrogen that is consumed by methanogenic Archaea, living in endosymbiosis within many of these ciliates. Here we describe a new species of anaerobic ciliate, Trimyema finlayi n. sp., by using silver impregnation and microscopy to conduct a detailed morphometric analysis. Comparisons with previously published morphological data for this species, as well as the closely related species, Trimyema compressum , demonstrated that despite them being similar, both the mean cell size and the mean number of somatic kineties are lower for T. finlayi than for T. compressum , which suggests that they are distinct species. This was also supported by analysis of the 18S rRNA genes from these ciliates, the sequences of which are 97.5% identical (6 substitutions, 1479 compared bases), and in phylogenetic analyses these sequences grouped with other 18S rRNA genes sequenced from previous isolates of the same respective species. Together these data provide strong evidence that T. finlayi is a novel species of Trimyema , within the class Plagiopylea. Various microscopic techniques demonstrated that T. finlayi n. sp. contains polymorphic endosymbiotic methanogens, and analysis of the endosymbionts' 16S rRNA gene showed that they belong to the genus Methanocorpusculum , which was confirmed using fluorescence in situ hybridization with specific probes. Despite the degree of similarity and close relationship between these ciliates, T. compressum contains endosymbiotic methanogens from a different genus, Methanobrevibacter . In phylogenetic analyses of 16S rRNA genes, the Methanocorpusculum endosymbiont of T. finlayi n. sp. grouped with sequences from Methanomicrobia, including the endosymbiont of an earlier isolate of the same species, ' Trimyema sp.,' which was sampled approximately 22 years earlier, at a distant (∼400 km) geographical location. Identification of the same endosymbiont species in the two separate isolates of T. finlayi n. sp. provides evidence for spatial and temporal stability of the Methanocorpusculum-T. finlayi n. sp. endosymbiosis. T. finlayi n. sp. and T. compressum provide an example of two closely related anaerobic ciliates that have endosymbionts from different methanogen genera, suggesting that the endosymbionts have not co-speciated with their hosts.

Serological detection and molecular characterization of piroplasmids in equids in Brazil.

PubMed

Vieira, Maria Isabel Botelho; Costa, Márcio Machado; de Oliveira, Mateus Tonial; Gonçalves, Luiz Ricardo; André, Marcos Rogério; Machado, Rosangela Zacarias

2018-03-01

Equine piroplasmosis is a disease caused by the hemoparasites Babesia caballi and Theileria equi and is considered to be the most important parasitic infection affecting Equidae. The objective of the present study was to carry out an epidemiological molecular and serological survey for the presence of these two protozoal organisms in equids from the northwestern region of the State of Rio Grande do Sul (RS), south Brazil. For this purpose, blood samples were collected from 90 equids in the city of Passo Fundo, RS, Brazil. Those were animals used for sport activities, outdoor recreational riding, and work including cattle herding and mounted patrol. Anti-T. equi and anti-B. caballi IgG antibodies were detected in the sera of those animals by commercial ELISA kits. The molecular diagnosis of equine piroplasmosis due to T. equi or B. caballi (or both) consisted in the amplification of the 18S rRNA gene by nested PCR followed by sequencing of the amplified PCR product and sequence comparison and phylogenetic analysis of the isolates; 17 (18.9%) and 5 (5.55%) out of the 90 serum samples tested in this study were positive for T. equi and B. caballi, respectively. Piroplasmid 18S rRNA gene fragments were detected by PCR in 24.4% (22/90) of the samples analysed and shared 99-100% identity with sequences of T. equi by BLASTn. Samples for the phylogenetic analysis were divided into 2 groups. In group A, there was close phylogenetic relationship between 4 sequences and sequences previously reported along the US-Mexico border, in South Africa, and in Brazil. There was a phylogenetic proximity between 5 samples from group B and samples tested by other authors in the US and Spain. Variation of the 18S rRNA gene allowed the identification of 9 new T. equi genotypes in the geographical region studied. Copyright © 2017 Elsevier B.V. All rights reserved.

The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

PubMed Central

Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

2010-01-01

The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Equally parsimonious pathways through an RNA sequence space are not equally likely

NASA Technical Reports Server (NTRS)

Lee, Y. H.; DSouza, L. M.; Fox, G. E.

1997-01-01

An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

Comparison of community structures of Candidatus Methylomirabilis oxyfera-like bacteria of NC10 phylum in different freshwater habitats.

PubMed

Shen, Li-Dong; Wu, Hong-Sheng; Gao, Zhi-Qiu; Liu, Xu; Li, Ji

2016-05-09

Methane oxidation coupled to nitrite reduction is mediated by 'Candidatus Methylomirabilis oxyfera' (M. oxyfera), which belongs to the NC10 phylum. In this study, the community composition and diversity of M. oxyfera-like bacteria of NC10 phylum were examined and compared in four different freshwater habitats, including reservoir sediments (RS), pond sediments (PS), wetland sediments (WS) and paddy soils (PAS), by using Illumina-based 16S rRNA gene sequencing. The recovered NC10-related sequences accounted for 0.4-2.5% of the 16S rRNA pool in the examined habitats, and the highest percentage was found in WS. The diversity of NC10 bacteria were the highest in RS, medium in WS, and lowest in PS and PAS. The observed number of OTUs (operational taxonomic unit; at 3% cut-off) were 97, 46, 61 and 40, respectively, in RS, PS, WS and PAS. A heterogeneous distribution of NC10 bacterial communities was observed in the examined habitats, though group B members were the dominant bacteria in each habitat. The copy numbers of NC10 bacterial 16S rRNA genes ranged between 5.8 × 10(6) and 3.2 × 10(7) copies g(-1) sediment/soil in the examined habitats. These results are helpful for a systematic understanding of NC10 bacterial communities in different types of freshwater habitats.

New record of Apoholosticha sinica (Ciliophora, Urostylida) from the UK: morphology, 18S rRNA gene phylogeny and notes on morphogenesis.

PubMed

Hu, Xiaozhong; Fan, Yangbo; Warren, Alan

2015-08-01

The benthic urostylid ciliate Apoholosticha sinicaFan et al., 2014 was isolated from a salt marsh at Blakeney, UK, and reinvestigated using light microscopy and small-subunit rRNA gene sequencing. Morphologically, it corresponds well with the original description. Several stages of divisional morphogenesis and physiological reorganization were also observed from which the following could be deduced: (i) the oral apparatus is completely newly built in the proter; (ii) frontal-ventral-transverse cirral anlage II does not produce a buccal cirrus; (iii) each of the posteriormost three or four anlagen contributes one transverse cirrus at its posterior end; (iv) a row of frontoterminal cirri originates from the rearmost frontal-ventral-transverse cirral anlage; (v) the last midventral row is formed from the penultimate frontal-ventral-transverse cirral anlage. Based on new data, two diagnostic features were added to the genus definition: (i) the midventral complex is composed of midventral pairs and midventral row and (ii) pretransverse ventral cirri are absent. Based on a combination of morphological and morphogenetic data, the genus Apoholosticha is assigned to the recently erected subfamily Nothoholostichinae Paiva et al., 2014, which is consistent with sequence comparison and phylogenetic analyses based on SSU rRNA gene data. It is also concluded that this benthic species, previously reported only from China, is not an endemic form.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

PubMed Central

Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

A Comparison of Anammox Bacterial Abundance and Community Structures in Three Different Emerged Plants-Related Sediments.

PubMed

Chu, Jinyu; Zhang, Jinping; Zhou, Xiaohong; Liu, Biao; Li, Yimin

2015-09-01

Quantitative polymerase chain reaction (qPCR) assays and 16S rRNA gene clone libraries were used to document the abundance, diversity and community structure of anaerobic ammonia-oxidising (anammox) bacteria in the rhizosphere and non-rhizosphere sediments of three emergent macrophyte species (Iris pseudacorus, Thalia dealbata and Typha orientalis). The qPCR results confirmed the existence of anammox bacteria (AMX) with observed log number of gene copies per dry gram sediment ranging from 5.00 to 6.78. AMX was more abundant in T. orientalis-associated sediments than in the other two plant species. The I. pseudacorus- and T. orientalis-associated sediments had higher Shannon diversity values, indicating higher AMX diversity in these sediments. Based on the 16S rRNA gene, Candidatus 'Brocadia', Candidatus 'Kuenenia', Candidatus 'Jettenia' and new clusters were observed with the predominant Candidatus 'Kuenenia' cluster. The I. pseudacorus-associated sediments contained all the sequences of the C. 'Jettenia' cluster. Sequences obtained from T. orientalis-associated sediments contributed more than 90 % sequences in the new cluster, whereas none was found from I. pseudacorus. The new cluster was distantly related to known sequences; thus, this cluster was grouped outside the known clusters, indicating that the new cluster may be a new Planctomycetales genus. Further studies should be undertaken to confirm this finding.

Small subunit ribosomal RNA genes of tabanids and hippoboscids (Diptera: Brachycera): evolutionary relationships and comparison with other Diptera.

PubMed

Carreno, R A; Barta, J R

1998-11-01

The small subunit ribosomal RNA (SSU rRNA) genes of hippoboscid (Ornithoica vicina Walker) and tabanid (Chrysops niger Macquart) Diptera were sequenced to determine their phylogenetic position within the order and to determine whether or not extensive hypervariable regions in this gene are widespread in the Diptera. A parsimony analysis of an alignment containing 8 dipteran sequences produced a single most parsimonious tree that placed O. vicina as sister group to Drosophila melanogaster Meigen. The tabanid Chrysops niger was sister group to the asilomorphan taxa, and the sister group to the Brachycera was a Tipula sp. although this relationship was not supported by bootstrap analysis. The hippoboscid and tabanid sequences contain extensive hypervariable regions in the V2, V4, V6, and V7 regions as do other Diptera. When these regions of the alignment were excluded from the phylogenetic analysis, a single most parsimonious tree was found. This tree had an identical overall topology to the tree obtained from the total data set. The hypervariable regions in parts of the dipteran SSU rRNA genes were more extensive in the nematocerous dipteran sequences used in this study than in the other dipteran representatives; these hypervariable regions may be of more utility in inferring relationship among species and subspecies than at the suprageneric level.

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability

PubMed Central

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

NASA Technical Reports Server (NTRS)

Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

1995-01-01

Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Phylogenetic tree of 16s rRNA sequences from sulfate-reducing bacteria in a sandy marine sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devereux, R.; Mundfrom, G.W.

1994-01-01

Phylogenetic divergence among sulfate-reducing bateria in an estuarine sediment sample was investigated by PCR amplification and comparison of partial 16S rDNA sequences. Twenty unique 16S rDNA sequences were found, 12 from delta subclass bacteria based on overall sequence similarity (82-91%). Two successive PCR amplifications were used to obtain and clone the 16S rDNA. The first reaction used templates derived from phosphate-buffered saline washed sediment with primers designed to amplify nearly full-length bacterial domain 16S rDNA. A produce from a first reaction was used as template in a second reaction with primers designed to selectivity amplify a region of 16S rDNAmore » genes of sulfate-reducing bacteria. A phylogenetic tree incorporating the cloned sequences suggests the presence of yet to be cultivated lines of sulfate-reducing bacteria within the sediment sample.« less

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

[Community structure and phylogenetic analysis of cyanobacteria in cryoconite from surface of the Glacier No. 1 in the Tianshan Mountains].

PubMed

Ni, Xuejiao; Qi, Xing'e; Gu, Yanling; Zheng, Xiaoji; Dong, Juan; Ni, Yongqing; Cheng, Guodong

2014-11-04

The purpose of this study is to characterize the community composition and phylogenetic analysis of cyanobacteria from supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains, China. We amplified 16S rRNA genes from the extracted cryoconite DNA by PCR with 2 pairs of cyanobacteria-specific primers. Amplificon was used to construct 16S rRNA genes clone library. The estimation of species richness, diversity indices, and rarefaction curve of the 16S rRNA genes library were determined based on representative phylotypes (OTUs). Analysis of 16S rRNA gene sequences allowed grouping of 101 clones into 12 phylotypes (OTUs) using a cut-off of 97% identity. The phylogenetic analysis revealed that most of sequences affiliated to the order Oscillatoriales and Chroococcales except that three were unclassified. The clone library was dominated by representatives of the order Oscillatoriales (81% of the total clones), and the most abundant organisms within this order were in the genus Phormidium (68 clones) including clones grouping into four phylotypes. The only clone of Chroococcales was closely related to the genus Chamaesiphon with 97% similarity. In addition, comparison of soil chemical properties between different habitats indicated that supraglacial cryoconite supported significantly higher the content of available phosphorus and potassium, nitrate nitrogen and organic matter compared with the forefield of the Glacier No. 1. The diversity index of cyanobacteria were relatively high in supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains. The community structure was dominated by members of the genus Phormidium. This study may enrich our knowledge on biogeochemical processes and ecological distribution of cyanobacterial populations in glacial ecosystem.

'Streptomyces caelicus', an antibiotic-producing species of the genus Streptomyces, and Streptomyces canchipurensis Li et al. 2015 are later heterotypic synonyms of Streptomyces muensis Ningthoujam et al. 2014.

PubMed

Wink, Joachim; Schumann, Peter; Atasayar, Ewelina; Klenk, Hans-Peter; Zaburannyi, Nestor; Westermann, Martin; Martin, Karin; Glaeser, Stefanie P; Kämpfer, Peter

2017-04-01

'Streptomyces caelicus' DSM 40835 was first reported as the producer of the antibiotic griselimycin by some coworkers of Rhone Poulenc in 1971. The project on isolation of the antibiotic compound was stopped because of the bad solubility and selectivity of the compound towards Mycobacteria. At Sanofi-Aventis, Germany, the project was re-evaluated in 2007 and the gene cluster of griselimycin could be identified, characterized and was patented in 2013. At this time, 'S. caelicus' was an invalid name. During the strain characterization work, it was found that 'S. caelicus' belongs to the group of species of the genus Streptomyces which show an unusual heterogeneity of the 16S rRNA gene sequences. However, high 16S rRNA gene sequence similarities to Streptomyces muensis JCM 17576T and Streptomyces canchipurensis JCM 17575T were obvious. Here, we present a comparative description of 'Streptomyces caelicus' DS 9461 (=DSM 40835=NCCB 100592) with S. muensis and S. canchipurensis by use of a polyphasic taxonomy approach and additional comparison of some housekeeping genes by multilocus sequence analysis (MLSA). An emended description of Streptomyces muensis is provided as a result of this work.

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

PubMed

Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

2017-10-06

Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

NASA Technical Reports Server (NTRS)

Winker, S.; Woese, C. R.

1991-01-01

The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

Proposal of Vespertiliibacter pulmonis gen. nov., sp. nov. and two genomospecies as new members of the family Pasteurellaceae isolated from European bats.

PubMed

Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun

2014-07-01

Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.

Diagnostic accuracy of a standardized scheme for identification of Streptococcus uberis in quarter milk samples: A comparison between conventional bacteriological examination, modified Rambach agar medium culturing, and 16S rRNA gene sequencing.

PubMed

Wald, Regina; Baumgartner, Martina; Urbantke, Verena; Stessl, Beatrix; Wittek, Thomas

2017-02-01

Bacteriological examination of milk samples is a prerequisite for pathogen-specific therapy and aids in limiting antimicrobial resistance. The aims of this study were to establish a standardized scheme for reliable Streptococcus uberis identification in routine diagnosis and to evaluate the accuracy of conventional tests and growing patterns of Strep. uberis on a selective medium (modified Rambach agar medium, MRAM) using 16S rRNA gene sequencing analysis as a reference method. We obtained isolates of presumptive Strep. uberis (n = 336) from quarter milk samples of dairy cows with intramammary infections and classified the isolates into 2 clusters using biochemical characterization. In cluster 1 (n = 280), cocci grew as non-hemolytic colonies, hydrolyzing esculin, carrying no Lancefield antigen (A/B/C/D/G) or Christie Atkins Munch-Petersen factor, and their growth was inhibited on an Enterococcus agar. Production of β-d-galactosidase on MRAM was shown by 257 of the cluster 1 isolates (91.79%), and 16S rRNA gene sequencing verified 271 (96.79%) of the isolates to be Strep. uberis. In 264 isolates (94.29%), MRAM agreed with the sequencing results. In cluster 2 (n = 56), isolates showed different characteristics: 37 (66.07%) were β-d-galactosidase-positive, and based on 16S sequencing results, 36 (64.29%) were identified correctly as Strep. uberis using biochemical methods. Identification success in this group differed significantly between routine diagnosis and MRAM application: MRAM agreed with sequencing results in 47 isolates (83.93%). To identify Strep. uberis and differentiate it from other lactic acid bacteria in routine diagnosis, we suggest using catalase reaction, hemolysis, esculin hydrolysis, and growth on enterococci agar. Isolates that show a typical biochemical profile can be identified satisfactorily with these tests. For Strep. uberis isolates with divergent patterns, application of MRAM as a follow-up test increased the diagnostic accuracy to 94.64%. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The gut mycobiome of the Human Microbiome Project healthy cohort.

PubMed

Nash, Andrea K; Auchtung, Thomas A; Wong, Matthew C; Smith, Daniel P; Gesell, Jonathan R; Ross, Matthew C; Stewart, Christopher J; Metcalf, Ginger A; Muzny, Donna M; Gibbs, Richard A; Ajami, Nadim J; Petrosino, Joseph F

2017-11-25

Most studies describing the human gut microbiome in healthy and diseased states have emphasized the bacterial component, but the fungal microbiome (i.e., the mycobiome) is beginning to gain recognition as a fundamental part of our microbiome. To date, human gut mycobiome studies have primarily been disease centric or in small cohorts of healthy individuals. To contribute to existing knowledge of the human mycobiome, we investigated the gut mycobiome of the Human Microbiome Project (HMP) cohort by sequencing the Internal Transcribed Spacer 2 (ITS2) region as well as the 18S rRNA gene. Three hundred seventeen HMP stool samples were analyzed by ITS2 sequencing. Fecal fungal diversity was significantly lower in comparison to bacterial diversity. Yeast dominated the samples, comprising eight of the top 15 most abundant genera. Specifically, fungal communities were characterized by a high prevalence of Saccharomyces, Malassezia, and Candida, with S. cerevisiae, M. restricta, and C. albicans operational taxonomic units (OTUs) present in 96.8, 88.3, and 80.8% of samples, respectively. There was a high degree of inter- and intra-volunteer variability in fungal communities. However, S. cerevisiae, M. restricta, and C. albicans OTUs were found in 92.2, 78.3, and 63.6% of volunteers, respectively, in all samples donated over an approximately 1-year period. Metagenomic and 18S rRNA gene sequencing data agreed with ITS2 results; however, ITS2 sequencing provided greater resolution of the relatively low abundance mycobiome constituents. Compared to bacterial communities, the human gut mycobiome is low in diversity and dominated by yeast including Saccharomyces, Malassezia, and Candida. Both inter- and intra-volunteer variability in the HMP cohort were high, revealing that unlike bacterial communities, an individual's mycobiome is no more similar to itself over time than to another person's. Nonetheless, several fungal species persisted across a majority of samples, evidence that a core gut mycobiome may exist. ITS2 sequencing data provided greater resolution of the mycobiome membership compared to metagenomic and 18S rRNA gene sequencing data, suggesting that it is a more sensitive method for studying the mycobiome of stool samples.

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992

Characterization of Bacterial Communities Associated with the Tyrian Purple Producing Gland in a Marine Gastropod

PubMed Central

Ngangbam, Ajit Kumar; Baten, Abdul; Waters, Daniel L. E.; Whalan, Steve; Benkendorff, Kirsten

2015-01-01

Dicathais orbita is a marine mollusc recognised for the production of anticancer compounds that are precursors to Tyrian purple. This study aimed to assess the diversity and identity of bacteria associated with the Tyrian purple producing hypobranchial gland, in comparison with foot tissue, using a high-throughput sequencing approach. Taxonomic and phylogenetic analysis of variable region V1-V3 of 16S rRNA bacterial gene amplicons in QIIME and MEGAN were carried out. This analysis revealed a highly diverse bacterial assemblage associated with the hypobranchial gland and foot tissues of D. orbita. The dominant bacterial phylum in the 16S rRNA bacterial profiling data set was Proteobacteria followed by Bacteroidetes, Tenericutes and Spirochaetes. In comparison to the foot, the hypobranchial gland had significantly lower bacterial diversity and a different community composition, based on taxonomic assignment at the genus level. A higher abundance of indole producing Vibrio spp. and the presence of bacteria with brominating capabilities in the hypobranchial gland suggest bacteria have a potential role in biosynthesis of Tyrian purple in D. orbita. PMID:26488885

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

PubMed

Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

2017-11-02

Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had altered diversity profiles. Both bioinformatics 16S rRNA pipelines used in this study (OTU and paired end) presented similar taxonomic profiles at genus level. We determined that DNA extraction from ELBW faecal samples, particularly those infants receiving probiotic supplementation, should include a prolonged beat-beating step. Furthermore, use of the 16S rRNA (V1 + V2 + V3) and (V6 + V7 + V8) regions provides reliable representation of ELBW microbiota profiles, while inclusion of the (V4 + V5) region may not be appropriate for studies where Bifidobacterium constitutes a resident microbiota member.

Characterization and Evolution of Cell Division and Cell Wall Synthesis Genes in the Bacterial Phyla Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes and Phylogenetic Comparison with rRNA Genes▿ †

PubMed Central

Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio

2008-01-01

In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order—this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia. PMID:18310338

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

A new Notomastus (Annelida, Capitellidae) species from Korean waters, with genetic comparison based on three gene markers.

PubMed

Jeong, Man-Ki; Soh, Ho Young; Wi, Jin Hee; Suh, Hae-Lip

2018-01-01

Notomastus koreanus sp. n. , collected from the sublittoral muddy bottom of Korean waters, is described as a new species. The Korean new species closely resembles N. torquatus Hutchings & Rainer, 1979 in the chaetal arrangement and the details of abdominal segments, but differs in the position of genital pores and the absence of eyes. DNA sequences (mtCOI, 16S rRNA, and histone H3) of the new species were compared with all the available sequences of Notomastus species in the GenBank database. Three genes showed significant genetic differences between the new species and its congeners (COI: 51.2%, 16S: 38.1-47.3%, H3: 3.7-9.3%). This study also includes a comprehensive comparison of the new Korean Notomastus species with its most closely similar species, based on the morphological and genetic results.

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Identification of Non-diphtheriae Corynebacterium by Use of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

PubMed Central

Alatoom, Adnan A.; Cazanave, Charles J.; Cunningham, Scott A.; Ihde, Sherry M.

2012-01-01

We evaluated the Bruker Biotyper matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry for identification of 92 clinical isolates of Corynebacterium species in comparison to identification using rpoB or 16S rRNA gene sequencing. Eighty isolates (87%) yielded a score of ≥1.700, and all of these were correctly identified to the species level with the exception of Corynebacterium aurimucosum being misidentified as the closely related Corynebacterium minutissimum. PMID:22075579

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

PubMed

Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

2015-11-01

A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Subsampled open-reference clustering creates consistent, comprehensive OTU definitions and scales to billions of sequences.

PubMed

Rideout, Jai Ram; He, Yan; Navas-Molina, Jose A; Walters, William A; Ursell, Luke K; Gibbons, Sean M; Chase, John; McDonald, Daniel; Gonzalez, Antonio; Robbins-Pianka, Adam; Clemente, Jose C; Gilbert, Jack A; Huse, Susan M; Zhou, Hong-Wei; Knight, Rob; Caporaso, J Gregory

2014-01-01

We present a performance-optimized algorithm, subsampled open-reference OTU picking, for assigning marker gene (e.g., 16S rRNA) sequences generated on next-generation sequencing platforms to operational taxonomic units (OTUs) for microbial community analysis. This algorithm provides benefits over de novo OTU picking (clustering can be performed largely in parallel, reducing runtime) and closed-reference OTU picking (all reads are clustered, not only those that match a reference database sequence with high similarity). Because more of our algorithm can be run in parallel relative to "classic" open-reference OTU picking, it makes open-reference OTU picking tractable on massive amplicon sequence data sets (though on smaller data sets, "classic" open-reference OTU clustering is often faster). We illustrate that here by applying it to the first 15,000 samples sequenced for the Earth Microbiome Project (1.3 billion V4 16S rRNA amplicons). To the best of our knowledge, this is the largest OTU picking run ever performed, and we estimate that our new algorithm runs in less than 1/5 the time than would be required of "classic" open reference OTU picking. We show that subsampled open-reference OTU picking yields results that are highly correlated with those generated by "classic" open-reference OTU picking through comparisons on three well-studied datasets. An implementation of this algorithm is provided in the popular QIIME software package, which uses uclust for read clustering. All analyses were performed using QIIME's uclust wrappers, though we provide details (aided by the open-source code in our GitHub repository) that will allow implementation of subsampled open-reference OTU picking independently of QIIME (e.g., in a compiled programming language, where runtimes should be further reduced). Our analyses should generalize to other implementations of these OTU picking algorithms. Finally, we present a comparison of parameter settings in QIIME's OTU picking workflows and make recommendations on settings for these free parameters to optimize runtime without reducing the quality of the results. These optimized parameters can vastly decrease the runtime of uclust-based OTU picking in QIIME.

Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

PubMed

Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

2017-09-18

Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B.V. All rights reserved.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507

Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.

PubMed

Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O

2008-04-01

Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.

Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

PubMed Central

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

Molecular phylogenetics and systematics of the bivalve family Ostreidae based on rRNA sequence-structure models and multilocus species tree.

PubMed

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.

Colorectal Cancer and the Human Gut Microbiome: Reproducibility with Whole-Genome Shotgun Sequencing

PubMed Central

Hua, Xing; Zeller, Georg; Sunagawa, Shinichi; Voigt, Anita Y.; Hercog, Rajna; Goedert, James J.; Shi, Jianxin; Bork, Peer; Sinha, Rashmi

2016-01-01

Accumulating evidence indicates that the gut microbiota affects colorectal cancer development, but previous studies have varied in population, technical methods, and associations with cancer. Understanding these variations is needed for comparisons and for potential pooling across studies. Therefore, we performed whole-genome shotgun sequencing on fecal samples from 52 pre-treatment colorectal cancer cases and 52 matched controls from Washington, DC. We compared findings from a previously published 16S rRNA study to the metagenomics-derived taxonomy within the same population. In addition, metagenome-predicted genes, modules, and pathways in the Washington, DC cases and controls were compared to cases and controls recruited in France whose specimens were processed using the same platform. Associations between the presence of fecal Fusobacteria, Fusobacterium, and Porphyromonas with colorectal cancer detected by 16S rRNA were reproduced by metagenomics, whereas higher relative abundance of Clostridia in cancer cases based on 16S rRNA was merely borderline based on metagenomics. This demonstrated that within the same sample set, most, but not all taxonomic associations were seen with both methods. Considering significant cancer associations with the relative abundance of genes, modules, and pathways in a recently published French metagenomics dataset, statistically significant associations in the Washington, DC population were detected for four out of 10 genes, three out of nine modules, and seven out of 17 pathways. In total, colorectal cancer status in the Washington, DC study was associated with 39% of the metagenome-predicted genes, modules, and pathways identified in the French study. More within and between population comparisons are needed to identify sources of variation and disease associations that can be reproduced despite these variations. Future studies should have larger sample sizes or pool data across studies to have sufficient power to detect associations that are reproducible and significant after correction for multiple testing. PMID:27171425

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

PubMed Central

Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

2017-01-01

Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.

PubMed

Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne

2011-06-01

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Clostridium sphenoides Chronic Osteomyelitis Diagnosed Via Matrix-Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry, Conflicting With 16S rRNA Sequencing but Confirmed by Whole Genome Sequencing.

PubMed

Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A

2017-01-01

We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

A comparison of microbial communities in deep-sea polymetallic nodules and the surrounding sediments in the Pacific Ocean

NASA Astrophysics Data System (ADS)

Wu, Yue-Hong; Liao, Li; Wang, Chun-Sheng; Ma, Wei-Lin; Meng, Fan-Xu; Wu, Min; Xu, Xue-Wei

2013-09-01

Deep-sea polymetallic nodules, rich in metals such as Fe, Mn, and Ni, are potential resources for future exploitation. Early culturing and microscopy studies suggest that polymetallic nodules are at least partially biogenic. To understand the microbial communities in this environment, we compared microbial community composition and diversity inside nodules and in the surrounding sediments. Three sampling sites in the Pacific Ocean containing polymetallic nodules were used for culture-independent investigations of microbial diversity. A total of 1013 near full-length bacterial 16S rRNA gene sequences and 640 archaeal 16S rRNA gene sequences with ~650 bp from nodules and the surrounding sediments were analyzed. Bacteria showed higher diversity than archaea. Interestingly, sediments contained more diverse bacterial communities than nodules, while the opposite was detected for archaea. Bacterial communities tend to be mostly unique to sediments or nodules, with only 13.3% of sequences shared. The most abundant bacterial groups detected only in nodules were Pseudoalteromonas and Alteromonas, which were predicted to play a role in building matrix outside cells to induce or control mineralization. However, archaeal communities were mostly shared between sediments and nodules, including the most abundant OTU containing 290 sequences from marine group I Thaumarchaeota. PcoA analysis indicated that microhabitat (i.e., nodule or sediment) seemed to be a major factor influencing microbial community composition, rather than sampling locations or distances between locations.

Molecular characterization of Blastocystis isolates from children and rhesus monkeys in Kathmandu, Nepal.

PubMed

Yoshikawa, Hisao; Wu, Zhiliang; Pandey, Kishor; Pandey, Basu Dev; Sherchand, Jeevan Bahadur; Yanagi, Tetsuo; Kanbara, Hiroji

2009-03-23

To investigate the possible transmission of Blastocystis organisms between local rhesus monkeys and children in Kathmandu, Nepal, we compared the subtype (ST) and sequence of Blastocystis isolates from children with gastrointestinal symptoms and local rhesus monkeys. Twenty and 10 Blastocystis isolates were established from 82 and 10 fecal samples obtained from children and monkeys, respectively. Subtype analysis with seven sequence-tagged site (STS) primers indicated that the prevalence of Blastocystis sp. ST1, ST2 and ST3 was 20%, 20% and 60% in the child isolates, respectively. In contrast to human isolates, ST3 was not found in monkey isolates and the prevalence of ST1 and ST2 was 50% and 70%, respectively, including three mixed STs1 and 2 and one isolate not amplified by any STS primers, respectively. Since Blastocystis sp. ST2 has been reported as the most dominant genotype in the survey of Blastocystis infection among the various monkey species, sequence comparison of the 150bp variable region of the small subunit rRNA (SSU rRNA) gene was conducted among ST2 isolates of humans and monkeys. Sequence alignment of 24 clones developed from ST2 isolates of 4 humans and 4 monkeys showed three distinct subgroups, defined as ST2A, ST2B and ST2C. These three subgroups were shared between the child and monkey isolates. These results suggest that the local rhesus monkeys are a possible source of Blastocystis sp. ST2 infection of humans in Kathmandu.

PCR amplification and DNA sequencing of Demodex injai from otic secretions of a dog.

PubMed

Milosevic, Milivoj A; Frank, Linda A; Brahmbhatt, Rupal A; Kania, Stephen A

2013-04-01

The identification of Demodex mites from dogs is usually based on morphology and location. Mites with uncharacteristic features or from unusual locations, hosts or disease manifestations could represent new species not previously described; however, this is difficult to determine based on morphology alone. The goal of this study was to identify and confirm Demodex injai in association with otitis externa in a dog using PCR amplification and DNA sequencing. Otic samples were obtained from a beagle in which a long-bodied Demodex mite was identified. For comparison, Demodex mite samples were collected from a swab and scraping of the dorsal skin of a wire-haired fox terrier and an otic sample from a dog with generalized and otic demodicosis. To identify the Demodex mite, DNA was extracted, and 16S rRNA was amplified by PCR, sequenced and compared with Demodex sequences available in public databases and from separate samples morphologically diagnosed as D. injai and Demodex canis. PCR amplification of the long-bodied mite rRNA DNA obtained from otic samples was approximately 330 bp and was identical to that from the mite morphologically identified as D. injai obtained from the dorsal skin of a dog. Furthermore, the examined mite did not have any significant homology to any of the reported genes from Demodex spp. These results confirmed that the demodex mites in this case were D. injai. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

Identification of Habitat-Specific Biomes of Aquatic Fungal Communities Using a Comprehensive Nearly Full-Length 18S rRNA Dataset Enriched with Contextual Data

PubMed Central

Panzer, Katrin; Yilmaz, Pelin; Weiß, Michael; Reich, Lothar; Richter, Michael; Wiese, Jutta; Schmaljohann, Rolf; Labes, Antje; Imhoff, Johannes F.; Glöckner, Frank Oliver; Reich, Marlis

2015-01-01

Molecular diversity surveys have demonstrated that aquatic fungi are highly diverse, and that they play fundamental ecological roles in aquatic systems. Unfortunately, comparative studies of aquatic fungal communities are few and far between, due to the scarcity of adequate datasets. We combined all publicly available fungal 18S ribosomal RNA (rRNA) gene sequences with new sequence data from a marine fungi culture collection. We further enriched this dataset by adding validated contextual data. Specifically, we included data on the habitat type of the samples assigning fungal taxa to ten different habitat categories. This dataset has been created with the intention to serve as a valuable reference dataset for aquatic fungi including a phylogenetic reference tree. The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases.The combined data enabled us to infer fungal community patterns in aquatic systems. Pairwise habitat comparisons showed significant phylogenetic differences, indicating that habitat strongly affects fungal community structure. Fungal taxonomic composition differed considerably even on phylum and class level. Freshwater fungal assemblage was most different from all other habitat types and was dominated by basal fungal lineages. For most communities, phylogenetic signals indicated clustering of sequences suggesting that environmental factors were the main drivers of fungal community structure, rather than species competition. Thus, the diversification process of aquatic fungi must be highly clade specific in some cases. PMID:26226014

Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy

Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

ScienceCinema

Tremblay, Julien

2018-01-22

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien

2012-06-01

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Natronorubrum sediminis sp. nov., an archaeon isolated from a saline lake.

PubMed

Gutiérrez, M C; Castillo, A M; Corral, P; Minegishi, H; Ventosa, A

2010-08-01

Two novel haloalkaliphilic archaea, strains CG-6T and CG-4, were isolated from sediment of the hypersaline Lake Chagannor in Inner Mongolia, China. Cells of the two strains were pleomorphic, non-motile and strictly aerobic. They required at least 2.5 M NaCl for growth, with optimum growth at 3.4 M NaCl. They grew at pH 8.0-11.0, with optimum growth at pH 9.0. Hypotonic treatment with less than 1.5 M NaCl caused cell lysis. The two strains had similar polar lipid compositions, possessing C20C20 and C20C25 derivatives of phosphatidylglycerol and phosphatidylglycerol phosphate methyl ester. No glycolipids were detected. Comparison of 16S rRNA gene sequences and morphological features placed them in the genus Natronorubrum. 16S rRNA gene sequence similarities to strains of recognized species of the genus Natronorubrum were 96.2-93.8%. Detailed phenotypic characterization and DNA-DNA hybridization studies revealed that the two strains belong to a novel species in the genus Natronorubrum, for which the name Natronorubrum sediminis sp. nov. is proposed; the type strain is CG-6T (=CECT 7487T =CGMCC 1.8981T =JCM 15982T).

Diversity of bacteria and glycosyl hydrolase family 48 genes in cellulolytic consortia enriched from thermophilic biocompost.

PubMed

Izquierdo, Javier A; Sizova, Maria V; Lynd, Lee R

2010-06-01

The enrichment from nature of novel microbial communities with high cellulolytic activity is useful in the identification of novel organisms and novel functions that enhance the fundamental understanding of microbial cellulose degradation. In this work we identify predominant organisms in three cellulolytic enrichment cultures with thermophilic compost as an inoculum. Community structure based on 16S rRNA gene clone libraries featured extensive representation of clostridia from cluster III, with minor representation of clostridial clusters I and XIV and a novel Lutispora species cluster. Our studies reveal different levels of 16S rRNA gene diversity, ranging from 3 to 18 operational taxonomic units (OTUs), as well as variability in community membership across the three enrichment cultures. By comparison, glycosyl hydrolase family 48 (GHF48) diversity analyses revealed a narrower breadth of novel clostridial genes associated with cultured and uncultured cellulose degraders. The novel GHF48 genes identified in this study were related to the novel clostridia Clostridium straminisolvens and Clostridium clariflavum, with one cluster sharing as little as 73% sequence similarity with the closest known relative. In all, 14 new GHF48 gene sequences were added to the known diversity of 35 genes from cultured species.

Complete mitochondrial genome of Taharana fasciana (Insecta, Hemiptera: Cicadellidae) and comparison with other Cicadellidae insects.

PubMed

Wang, Jiajia; Li, Hu; Dai, Renhuai

2017-12-01

Here, we describe the first complete mitochondrial genome (mitogenome) sequence of the leafhopper Taharana fasciana (Coelidiinae). The mitogenome sequence contains 15,161 bp with an A + T content of 77.9%. It includes 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one non-coding (A + T-rich) region; in addition, a repeat region is also present (GenBank accession no. KY886913). These genes/regions are in the same order as in the inferred insect ancestral mitogenome. All protein-coding genes have ATN as the start codon, and TAA or single T as the stop codons, except the gene ND3, which ends with TAG. Furthermore, we predicted the secondary structures of the rRNAs in T. fasciana. Six domains (domain III is absent in arthropods) and 41 helices were predicted for 16S rRNA, and 12S rRNA comprised three structural domains and 24 helices. Phylogenetic tree analysis confirmed that T. fasciana and other members of the Cicadellidae are clustered into a clade, and it identified the relationships among the subfamilies Deltocephalinae, Coelidiinae, Idiocerinae, Cicadellinae, and Typhlocybinae.

Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

NASA Technical Reports Server (NTRS)

Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

1992-01-01

Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

PubMed

Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2016-01-01

In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

Genome sequence and description of Corynebacterium ihumii sp. nov.

PubMed Central

Padmanabhan, Roshan; Dubourg, Grégory; Lagier, Jean-Christophe; Couderc, Carine; Michelle, Caroline; Raoult, Didier; Fournier, Pierre-Edouard

2014-01-01

Corynebacterium ihumii strain GD7T sp. nov. is proposed as the type strain of a new species, which belongs to the family Corynebacteriaceae of the class Actinobacteria. This strain was isolated from the fecal flora of a 62 year-old male patient, as a part of the culturomics study. Corynebacterium ihumii is a Gram positive, facultativly anaerobic, nonsporulating bacillus. Here, we describe the features of this organism, together with the high quality draft genome sequence, annotation and the comparison with other member of the genus Corynebacteria. C. ihumii genome is 2,232,265 bp long (one chromosome but no plasmid) containing 2,125 protein-coding and 53 RNA genes, including 4 rRNA genes. The whole-genome shotgun sequence of Corynebacterium ihumii strain GD7T sp. nov has been deposited in EMBL under accession number GCA_000403725. PMID:25197488

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Taxonomic differences of gut microbiomes drive cellulolytic enzymatic potential within hind-gut fermenting mammals.

PubMed

Finlayson-Trick, Emma C L; Getz, Landon J; Slaine, Patrick D; Thornbury, Mackenzie; Lamoureux, Emily; Cook, Jamie; Langille, Morgan G I; Murray, Lois E; McCormick, Craig; Rohde, John R; Cheng, Zhenyu

2017-01-01

Host diet influences the diversity and metabolic activities of the gut microbiome. Previous studies have shown that the gut microbiome provides a wide array of enzymes that enable processing of diverse dietary components. Because the primary diet of the porcupine, Erethizon dorsatum, is lignified plant material, we reasoned that the porcupine microbiome would be replete with enzymes required to degrade lignocellulose. Here, we report on the bacterial composition in the porcupine microbiome using 16S rRNA sequencing and bioinformatics analysis. We extended this analysis to the microbiomes of 20 additional mammals located in Shubenacadie Wildlife Park (Nova Scotia, Canada), enabling the comparison of bacterial diversity amongst three mammalian taxonomic orders (Rodentia, Carnivora, and Artiodactyla). 16S rRNA sequencing was validated using metagenomic shotgun sequencing on selected herbivores (porcupine, beaver) and carnivores (coyote, Arctic wolf). In the microbiome, functionality is more conserved than bacterial composition, thus we mined microbiome data sets to identify conserved microbial functions across species in each order. We measured the relative gene abundances for cellobiose phosphorylase, endoglucanase, and beta-glucosidase to evaluate the cellulose-degrading potential of select mammals. The porcupine and beaver had higher proportions of genes encoding cellulose-degrading enzymes than the Artic wolf and coyote. These findings provide further evidence that gut microbiome diversity and metabolic capacity are influenced by host diet.

Taxonomic differences of gut microbiomes drive cellulolytic enzymatic potential within hind-gut fermenting mammals

PubMed Central

Thornbury, Mackenzie; Lamoureux, Emily; Cook, Jamie; Langille, Morgan G. I.; Murray, Lois E.; McCormick, Craig; Rohde, John R.

2017-01-01

Host diet influences the diversity and metabolic activities of the gut microbiome. Previous studies have shown that the gut microbiome provides a wide array of enzymes that enable processing of diverse dietary components. Because the primary diet of the porcupine, Erethizon dorsatum, is lignified plant material, we reasoned that the porcupine microbiome would be replete with enzymes required to degrade lignocellulose. Here, we report on the bacterial composition in the porcupine microbiome using 16S rRNA sequencing and bioinformatics analysis. We extended this analysis to the microbiomes of 20 additional mammals located in Shubenacadie Wildlife Park (Nova Scotia, Canada), enabling the comparison of bacterial diversity amongst three mammalian taxonomic orders (Rodentia, Carnivora, and Artiodactyla). 16S rRNA sequencing was validated using metagenomic shotgun sequencing on selected herbivores (porcupine, beaver) and carnivores (coyote, Arctic wolf). In the microbiome, functionality is more conserved than bacterial composition, thus we mined microbiome data sets to identify conserved microbial functions across species in each order. We measured the relative gene abundances for cellobiose phosphorylase, endoglucanase, and beta-glucosidase to evaluate the cellulose-degrading potential of select mammals. The porcupine and beaver had higher proportions of genes encoding cellulose-degrading enzymes than the Artic wolf and coyote. These findings provide further evidence that gut microbiome diversity and metabolic capacity are influenced by host diet. PMID:29281673

Comparison of the gut microbial community between obese and lean peoples using 16S gene sequencing in a Japanese population.

PubMed

Andoh, Akira; Nishida, Atsushi; Takahashi, Kenichiro; Inatomi, Osamu; Imaeda, Hirotsugu; Bamba, Shigeki; Kito, Katsuyuki; Sugimoto, Mitsushige; Kobayashi, Toshio

2016-07-01

Altered gut microbial ecology contributes to the development of metabolic diseases including obesity. In this study, we performed 16S rRNA sequence analysis of the gut microbiota profiles of obese and lean Japanese populations. The V3-V4 hypervariable regions of 16S rRNA of fecal samples from 10 obese and 10 lean volunteers were sequenced using the Illumina MiSeq(TM)II system. The average body mass index of the obese and lean group were 38.1 and 16.6 kg/m(2), respectively (p<0.01). The Shannon diversity index was significantly higher in the lean group than in the obese group (p<0.01). The phyla Firmicutes and Fusobacteria were significantly more abundant in obese people than in lean people. The abundance of the phylum Bacteroidetes and the Bacteroidetes/Firmicutes ratio were not different between the obese and lean groups. The genera Alistipes, Anaerococcus, Corpococcus, Fusobacterium and Parvimonas increased significantly in obese people, and the genera Bacteroides, Desulfovibrio, Faecalibacterium, Lachnoanaerobaculum and Olsenella increased significantly in lean people. Bacteria species possessing anti-inflammatory properties, such as Faecalibacterium prausnitzii, increased significantly in lean people, but bacteria species possessing pro-inflammatory properties increased in obese people. Obesity-associated gut microbiota in the Japanese population was different from that in Western people.

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

2013-01-16

The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Diversity of cultured photosynthetic flagellates in the North East Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-06-01

During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Diversity of cultured photosynthetic flagellates in the northeast Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-11-01

During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

PubMed

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-12-31

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

PubMed Central

Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

2010-01-01

Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

PubMed

He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

2012-06-01

The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

EPA Science Inventory

The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

Root-knot nematodes in golf course greens of the western United States

USDA-ARS?s Scientific Manuscript database

A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...

Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

PubMed

Flynn, A N; Lyndon, C A; Church, D L

2013-08-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

New progress in snake mitochondrial gene rearrangement.

PubMed

Chen, Nian; Zhao, Shujin

2009-08-01

To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.

Phylogeny of Theileria buffeli genotypes identified in the South African buffalo (Syncerus caffer) population.

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C

2014-08-29

Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.

A new montane species of Philautus (Amphibia: Anura: Rhacophoridae) from western Sarawak, Malaysia, Borneo.

PubMed

Dehling, J Maximilian; Dehling, Matthias

2013-01-01

A new species of Philautus is described from western Sarawak. The new species was collected in lower montane forest in two national parks in Sarawak and recorded from another park. It differs from its congeners by a unique combination of morphological characters, including a long, acuminate snout, long legs, and comparatively extensive toe webbing. The advertisement call of the new species differs from all calls of other species that have been analyzed so far. Comparison of the mitochondrial 16S rRNA gene sequence corroborates its distinct specific status.

Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.

PubMed

Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu

2004-02-18

By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.

Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

PubMed

Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

2017-02-28

High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions

PubMed Central

Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake

2015-01-01

Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756

[Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].

PubMed

Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu

2002-12-01

Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.

Phaeobacterium nitratireducens gen. nov., sp. nov., a phototrophic gammaproteobacterium isolated from a mangrove forest sediment sample.

PubMed

Nupur; Tanuku, Naga Radha Srinivas; Shinichi, Takaichi; Pinnaka, Anil Kumar

2015-08-01

A novel brown-coloured, Gram-negative-staining, rod-shaped, motile, phototrophic, purple sulfur bacterium, designated strain AK40T, was isolated in pure culture from a sediment sample collected from Coringa mangrove forest, India. Strain AK40T contained bacteriochlorophyll a and carotenoids of the rhodopin series as major photosynthetic pigments. Strain AK40T was able to grow photoheterotrophically and could utilize a number of organic substrates. It was unable to grow photoautotrophically and did not utilize sulfide or thiosulfate as electron donors. Thiamine and riboflavin were required for growth. The dominant fatty acids were C12 : 0, C16 : 0, C18 : 1ω7c and summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH). The polar lipid profile of strain AK40T was found to contain diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol and eight unidentified lipids. Q-10 was the predominant respiratory quinone. The DNA G+C content of strain AK40T was 65.5 mol%. 16S rRNA gene sequence comparisons indicated that the isolate represented a member of the family Chromatiaceae within the class Gammaproteobacteria. 16S rRNA gene sequence analysis indicated that strain AK40T was closely related to Phaeochromatium fluminis, with 95.2% pairwise sequence similarity to the type strain; sequence similarity to strains of other species of the family was 90.8-94.8%. Based on the sequence comparison data, strain AK40T was positioned distinctly outside the group formed by the genera Phaeochromatium, Marichromatium, Halochromatium, Thiohalocapsa, Rhabdochromatium and Thiorhodovibrio. Distinct morphological, physiological and genotypic differences from previously described taxa supported the classification of this isolate as a representative of a novel species in a new genus, for which the name Phaeobacterium nitratireducens gen. nov., sp. nov. is proposed. The type strain of Phaeobacterium nitratireducens is AK40T ( = JCM 19219T = MTCC 11824T).

Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

PubMed

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

PubMed

Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

2015-03-01

Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

Comparing K-mer based methods for improved classification of 16S sequences.

PubMed

Vinje, Hilde; Liland, Kristian Hovde; Almøy, Trygve; Snipen, Lars

2015-07-01

The need for precise and stable taxonomic classification is highly relevant in modern microbiology. Parallel to the explosion in the amount of sequence data accessible, there has also been a shift in focus for classification methods. Previously, alignment-based methods were the most applicable tools. Now, methods based on counting K-mers by sliding windows are the most interesting classification approach with respect to both speed and accuracy. Here, we present a systematic comparison on five different K-mer based classification methods for the 16S rRNA gene. The methods differ from each other both in data usage and modelling strategies. We have based our study on the commonly known and well-used naïve Bayes classifier from the RDP project, and four other methods were implemented and tested on two different data sets, on full-length sequences as well as fragments of typical read-length. The difference in classification error obtained by the methods seemed to be small, but they were stable and for both data sets tested. The Preprocessed nearest-neighbour (PLSNN) method performed best for full-length 16S rRNA sequences, significantly better than the naïve Bayes RDP method. On fragmented sequences the naïve Bayes Multinomial method performed best, significantly better than all other methods. For both data sets explored, and on both full-length and fragmented sequences, all the five methods reached an error-plateau. We conclude that no K-mer based method is universally best for classifying both full-length sequences and fragments (reads). All methods approach an error plateau indicating improved training data is needed to improve classification from here. Classification errors occur most frequent for genera with few sequences present. For improving the taxonomy and testing new classification methods, the need for a better and more universal and robust training data set is crucial.

Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

PubMed

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

PCR detection of uncultured rumen bacteria.

PubMed

Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

2012-07-01

16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

NASA Astrophysics Data System (ADS)

Chen, K.

2017-01-01

With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

Genetic differences in internal transcribed spacer 1 between Dermanyssus gallinae from wild birds and domestic chickens.

PubMed

Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J

2008-06-01

We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.

Phylogenetic comparisons of a coastal bacterioplankton community with its counterparts in open ocean and freshwater systems.

PubMed

Rappé; Vergin; Giovannoni

2000-09-01

In order to extend previous comparisons between coastal marine bacterioplankton communities and their open ocean and freshwater counterparts, here we summarize and provide new data on a clone library of 105 SSU rRNA genes recovered from seawater collected over the western continental shelf of the USA in the Pacific Ocean. Comparisons to previously published data revealed that this coastal bacterioplankton clone library was dominated by SSU rRNA gene phylotypes originally described from surface waters of the open ocean, but also revealed unique SSU rRNA gene lineages of beta Proteobacteria related to those found in clone libraries from freshwater habitats. beta Proteobacteria lineages common to coastal and freshwater samples included members of a clade of obligately methylotrophic bacteria, SSU rRNA genes affiliated with Xylophilus ampelinus, and a clade related to the genus Duganella. In addition, SSU rRNA genes were recovered from such previously recognized marine bacterioplankton SSU rRNA gene clone clusters as the SAR86, SAR11, and SAR116 clusters within the class Proteobacteria, the Roseobacter clade of the alpha subclass of the Proteobacteria, the marine group A/SAR406 cluster, and the marine Actinobacteria clade. Overall, these results support and extend previous observations concerning the global distribution of several marine planktonic prokaryote SSU rRNA gene phylotypes, but also show that coastal bacterioplankton communities contain SSU rRNA gene lineages (and presumably bacterioplankton) shown previously to be prevalent in freshwater habitats.

Sulfur-inhibited Thermosphaera aggregans sp. nov., a new genus of hyperthermophilic archaea isolated after its prediction from environmentally derived 16S rRNA sequences.

PubMed

Huber, R; Dyba, D; Huber, H; Burggraf, S; Rachel, R

1998-01-01

Recently, a new procedure was developed which allowed for the first time the isolation of a hyperthermophilic archaeum tracked by 165 rRNA analysis from a terrestrial hot solfataric spring ('Obsidian Pool', Yellowstone National Park, WY, USA). This novel isolate is characterized here. Cells are round cocci with a diameter of 0.2-0.8 micron, occurring singly, in pairs, short chains and in grape-like aggregates. The aggregates exhibit a weak bluish-green fluorescence under UV radiation at 420 nm. The new isolate is an anaerobic obligate heterotroph, using preferentially yeast extract for growth. The metabolic products include CO2, H2, acetate and isovalerate. Growth is observed between 65 and 90 degrees C (optimum: 85 degrees C), from pH 5.0 to 7.0 (optimum: 6.5) and up to 0.7% NaCl. The apparent activation energy for growth is about 149 kJ mol-1. Elemental sulfur or hydrogen inhibits growth. The core lipids consist mainly of acyclic and cyclic glycerol diphytanyl tetraethers. The cell envelope contains a cytoplasmic membrane covered by an amorphous layer of unknown composition; there is no evidence for a regularly arrayed surface-layer protein. The G + C content is 46 mol%. On the basis of 165 rRNA sequence comparisons in combination with morphological, physiological and biochemical properties, the isolate represents a new genus within the Desulfurococcaceae, which has been named Thermosphaera. The type species is Thermosphaera aggregans, the type strain is isolate M11TLT (= DSM 11486T).

Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

PubMed

Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

2018-05-29

Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Application of MLST and Pilus Gene Sequence Comparisons to Investigate the Population Structures of Actinomyces naeslundii and Actinomyces oris

PubMed Central

Henssge, Uta; Do, Thuy; Gilbert, Steven C.; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A. J. M.; Radford, David R.; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established. PMID:21738661

Application of MLST and pilus gene sequence comparisons to investigate the population structures of Actinomyces naeslundii and Actinomyces oris.

PubMed

Henssge, Uta; Do, Thuy; Gilbert, Steven C; Cox, Steven; Clark, Douglas; Wickström, Claes; Ligtenberg, A J M; Radford, David R; Beighton, David

2011-01-01

Actinomyces naeslundii and Actinomyces oris are members of the oral biofilm. Their identification using 16S rRNA sequencing is problematic and better achieved by comparison of metG partial sequences. A. oris is more abundant and more frequently isolated than A. naeslundii. We used a multi-locus sequence typing approach to investigate the genotypic diversity of these species and assigned A. naeslundii (n = 37) and A. oris (n = 68) isolates to 32 and 68 sequence types (ST), respectively. Neighbor-joining and ClonalFrame dendrograms derived from the concatenated partial sequences of 7 house-keeping genes identified at least 4 significant subclusters within A. oris and 3 within A. naeslundii. The strain collection we had investigated was an under-representation of the total population since at least 3 STs composed of single strains may represent discrete clusters of strains not well represented in the collection. The integrity of these sub-clusters was supported by the sequence analysis of fimP and fimA, genes coding for the type 1 and 2 fimbriae, respectively. An A. naeslundii subcluster was identified with both fimA and fimP genes and these strains were able to bind to MUC7 and statherin while all other A. naeslundii strains possessed only fimA and did not bind to statherin. An A. oris subcluster harboured a fimA gene similar to that of Actinomyces odontolyticus but no detectable fimP failed to bind significantly to either MUC7 or statherin. These data are evidence of extensive genotypic and phenotypic diversity within the species A. oris and A. naeslundii but the status of the subclusters identified here will require genome comparisons before their phylogenic position can be unequivocally established.

16S rRNA Gene Sequencing for Deciphering the Colorectal Cancer Gut Microbiome: Current Protocols and Workflows.

PubMed

Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman

2018-01-01

The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags.

PubMed

Wu, Gary D; Lewis, James D; Hoffmann, Christian; Chen, Ying-Yu; Knight, Rob; Bittinger, Kyle; Hwang, Jennifer; Chen, Jun; Berkowsky, Ronald; Nessel, Lisa; Li, Hongzhe; Bushman, Frederic D

2010-07-30

Intense interest centers on the role of the human gut microbiome in health and disease, but optimal methods for analysis are still under development. Here we present a study of methods for surveying bacterial communities in human feces using 454/Roche pyrosequencing of 16S rRNA gene tags. We analyzed fecal samples from 10 individuals and compared methods for storage, DNA purification and sequence acquisition. To assess reproducibility, we compared samples one cm apart on a single stool specimen for each individual. To analyze storage methods, we compared 1) immediate freezing at -80 degrees C, 2) storage on ice for 24 or 3) 48 hours. For DNA purification methods, we tested three commercial kits and bead beating in hot phenol. Variations due to the different methodologies were compared to variation among individuals using two approaches--one based on presence-absence information for bacterial taxa (unweighted UniFrac) and the other taking into account their relative abundance (weighted UniFrac). In the unweighted analysis relatively little variation was associated with the different analytical procedures, and variation between individuals predominated. In the weighted analysis considerable variation was associated with the purification methods. Particularly notable was improved recovery of Firmicutes sequences using the hot phenol method. We also carried out surveys of the effects of different 454 sequencing methods (FLX versus Titanium) and amplification of different 16S rRNA variable gene segments. Based on our findings we present recommendations for protocols to collect, process and sequence bacterial 16S rDNA from fecal samples--some major points are 1) if feasible, bead-beating in hot phenol or use of the PSP kit improves recovery; 2) storage methods can be adjusted based on experimental convenience; 3) unweighted (presence-absence) comparisons are less affected by lysis method.

Serratia aquatilis sp. nov., isolated from drinking water systems.

PubMed

Kämpfer, Peter; Glaeser, Stefanie P

2016-01-01

A cream-white-pigmented, oxidase-negative bacterium (strain 2015-2462-01T), isolated from a drinking water system, was investigated in detail to determine its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain 2015-2462-01T with sequences of the type strains of closely related species of the genus Serratia revealed highest similarity to Serratia fonticola (98.4 %), Serratia proteamaculans (97.8 %), Serratia liquefaciens and Serratia grimesii (both 97.7 %). 16S rRNA gene sequence similarities to all other Serratia species were below 97.4 %. Multilocus sequence analysis (MLSA) on the basis of concatenated partial gyrB, rpoB, infB and atpD gene sequences showed a clear distinction of strain 2015-2462-01T from the type strains of the closest related Serratia species. The fatty acid profile of the strain consisted of C16 : 1 ω7c, C16 : 0; C14 : 0 and C14 : 0 3-OH/iso-C16 : 1 I as major components. DNA-DNA hybridizations between 2015-2462-01T and S. fonticola ATCC 29844T resulted in a relatedness value of 27 % (reciprocal 20 %). This DNA-DNA hybridization result in combination with the MLSA results and the differential biochemical properties indicated that strain 2015-2462-01T represents a novel species of the genus Serratia, for which the name Serratia aquatilis sp. nov. is proposed. The type strain is 2015-2462-01T ( = LMG 29119T = CCM 8626T).

Lactobacillus cerevisiae sp. nov., isolated from a spoiled brewery sample.

PubMed

Koob, Jennifer; Jacob, Fritz; Wenning, Mareike; Hutzler, Mathias

2017-09-01

A Gram-stain-positive, non-motile, rod-shaped bacterium, designated TUM BP 140423000-2250T (=DSM 100836T=LMG 29073T), was isolated from spoiled beer. This bacterium did not form spores, and was catalase-negative and facultatively anaerobic. Its taxonomic position was determined in a polyphasic study. The 16S rRNA gene sequence similarity data showed that the strain belonged to the Lactobacillus genus with the nearest neighbours being Lactobacillus koreensis DCY50T (sequence similarity 99.5 %), Lactobacillus yonginensis THK-V8T (99.2 %) and Lactobacillus parabrevis LMG 11984T (98.7 %). Sequence comparisons of additional phylogenetic markers, pheS and rpoA, confirmed the 16S rRNA gene sequence tree topology. The maximum rpoA sequence similarity was 92.3 % with L. yonginensis THK-V8T. The DNA G+C content of the isolate was 50.0 mol%. The DNA-DNA relatedness showed that strain TUM BP 140423000-2250T could be clearly distinguished from L. koreensis DCY 50T (30.8±0.4 %) and L. yonginensis THK-V8T (23.6±5.9 %). The major fatty acids were C18 : 1ω9c, summed feature 7 (comprised of C19 : 0 cyclo ω10c/C19 : 1ω6c) and C16 : 0. Based on phenotypic and genotypic studies, the authors propose classifying the new isolate as a representative of a novel species of the genus Lactobacillus, Lactobacillus cerevisiae sp. nov. The type strain is deposited at the Research Centre Weihenstephan for Brewing and Food Quality as TUM BP 140423000-2250T (=DSM 100836T=LMG 29073T).

Isolation of Propionibacterium acnes among the microbiota of primary endodontic infections with and without intraoral communication.

PubMed

Niazi, Sadia Ambreen; Al Kharusi, Hana Suleiman; Patel, Shanon; Bruce, Kenneth; Beighton, David; Foschi, Federico; Mannocci, Francesco

2016-11-01

The presence of opportunistic pathogens such as Propionibacterium acnes (P. acnes) may contribute to the endodontic pathology. The presence of P. acnes may be influenced by different endodontic conditions. The aims of the study were firstly, to identify P. acnes within the whole cultivable microbiota of primary endodontic infections, to investigate which P. acnes phylotypes predominate in such infections and secondly to determine if the presence of an "open" communication (e.g. a sinus) can be associated with the isolation of P. acnes from the root canal. The predominant cultivable microbiota of 15 primary endodontic lesions (7 without communication with the oral environment and 8 with an open communication) were identified using partial 16S ribosomal RNA (rRNA) gene sequence analysis. The identification of the organism was determined by interrogating the Human Oral Microbiome Database. The P. acnes isolates were typed on the basis of the recA gene sequence comparison. A neighbor-joining tree was constructed using MEGA 4.1 with the inclusion of known recA sequences. There was no difference in the number of species identified from lesions without communication (5.86 ± 3.7) and those with communication (5.37 ± 3.6) (P > 0.05). PCR-based 16S rRNA gene sequencing revealed P. acnes as the most prevalent isolate recovered from lesions with communication. recA gene sequencing revealed two phylogenetic lineages present in lesion with communication, with mainly type I (further split into type IA and type IB) and type II. The presence of P. acnes as opportunistic pathogens has been confirmed and may sustain the traits observed in specific clinical presentations. Clinical management of open lesions may require further disinfection to eliminate opportunistic bacteria.

Identification by 16S rRNA Gene Sequencing of an Actinomyces hongkongensis Isolate Recovered from a Patient with Pelvic Actinomycosis

PubMed Central

Flynn, A. N.; Lyndon, C. A.

2013-01-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532

Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

PubMed

Panosyan, Hovik; Birkeland, Nils-Kåre

2014-11-01

The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The diversity of eukaryotic microbiota in the traditional Slovak sheep cheese--bryndza.

PubMed

Laurencík, M; Sulo, P; Sláviková, E; Piecková, E; Seman, M; Ebringer, L

2008-09-30

We investigated the occurrence and diversity of yeasts and filamentous fungi in bryndza an artisanal Slovak soft spreadable cheese prepared from raw sheep milk or from a mixture of sheep and cow milk. Samples collected during four months of the summer production period from two locations (northern and southern parts of central Slovakia) contained 10(5)-10(7) (cfu) yeasts and about 10(2) (cfu) of mold per gram of wet weight. Further characterization by conventional taxonomy and sequence comparison of D1/D2 region from 26S rRNA gene revealed Mucor circinelloides v. Tieghem as the predominant filamentous fungus. A novel Geotrichum sp. together with Kluyveromyces (K. lactis/K. marxianus) was identified as the most abundant yeast species. Occasionally other yeasts, such as Candida inconspicua, Candida silvae, Pichia fermentans and Trichosporon domesticum were found. Conventional taxonomy readily identified isolates to the genus level, but DNA sequence comparison was capable of discriminating them at the species level.

Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems.

PubMed

Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R

2014-06-15

The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective. Published by Elsevier Ltd.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Vibrio aphrogenes sp. nov., in the Rumoiensis clade isolated from a seaweed.

PubMed

Tanaka, Mami; Endo, Shoko; Kotake, Fumihito; Al-Saari, Nurhidayu; Amin, A K M Rohul; Feng, Gao; Mino, Sayaka; Doi, Hidetaka; Ogura, Yoshitoshi; Hayashi, Tetsuya; Suda, Wataru; Hattori, Masahira; Yumoto, Isao; Sawabe, Toko; Sawabe, Tomoo; Araki, Toshiyoshi

2017-01-01

A novel strain Vibrio aphrogenes sp. nov. strain CA-1004T isolated from the surface of seaweed collected on the coast of Mie Prefecture in 1994 [1] was characterized using polyphasic taxonomy including multilocus sequence analysis (MLSA) and a genome based comparison. Both phylogenetic analyses on the basis of 16S rRNA gene sequences and MLSA based on eight protein-coding genes (gapA, gyrB, ftsZ, mreB, pyrH, recA, rpoA, and topA) showed the strain could be placed in the Rumoiensis clade in the genus Vibrio. Sequence similarities of the 16S rRNA gene and the multilocus genes against the Rumoiensis clade members, V. rumoiensis, V. algivorus, V. casei, and V. litoralis, were low enough to propose V. aphrogenes sp. nov. strain CA-1004T as a separate species. The experimental DNA-DNA hybridization data also revealed that the strain CA-1004T was separate from four known Rumoiensis clade species. The G+C content of the V. aphrogenes strain was determined as 42.1% based on the genome sequence. Major traits of the strain were non-motile, halophilic, fermentative, alginolytic, and gas production. A total of 27 traits (motility, growth temperature range, amylase, alginase and lipase productions, and assimilation of 19 carbon compounds) distinguished the strain from the other species in the Rumoiensis clade. The name V. aphrogenes sp. nov. is proposed for this species in the Rumoiensis clade, with CA-1004T as the type strain (JCM 31643T = DSM 103759T).

Comamonas aquatilis sp. nov., isolated from a garden pond.

PubMed

Kämpfer, Peter; Busse, Hans-Jürgen; Baars, Sophie; Wilharm, Gottfried; Glaeser, Stefanie P

2018-04-01

A beige-pigmented bacterial strain, SB30-Chr27-3 T , isolated from a garden pond, was studied for its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence with the sequences of the type strains of the most closely related species showed that the strain belongs to the genus Comamonas and showed highest sequence similarities to the type strains of Comamonas jiangduensis (97.5 %), Comamonas aquatica (97.4 %) and Comamonas phosphati (97.3 %). The 16S rRNA gene sequence similarities to all other Comamonas species were below 97.0 %. The fatty acid profile of strain SB30-Chr27-3 T consisted of the major fatty acids C16 : 0, C15 : 0iso 2-OH/ C16 : 1ω7c, C18 : 1ω7c/C18 : 1ω9c and, in a minor amount, C10 : 0 3-OH. Major compounds in the polar lipid profile were phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine and diphosphatidylglycerol. The quinone system was exclusively composed of ubiquinone Q-8. The polyamine pattern contained the major compounds putrescine, cadaverine and 2-hydroxyputrescine. These data and the differentiating biochemical properties indicated that isolate SB30-CHR27-3 T represents a novel species of the genus Comamonas, for which we propose the name >Comamonas aquatilis sp. nov. with the type strain SB30-Chr27-3 T (=CIP 111491 T =CCM 8815 T ).

'Candidatus Phytoplasma solani', a novel taxon associated with stolbur- and bois noir-related diseases of plants.

PubMed

Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward

2013-08-01

Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

2004-11-15

Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

NASA Technical Reports Server (NTRS)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

NASA Technical Reports Server (NTRS)

Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

1993-01-01

The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

Microbial Diversity of Acidic Hot Spring (Kawah Hujan B) in Geothermal Field of Kamojang Area, West Java-Indonesia

PubMed Central

Aditiawati, Pingkan; Yohandini, Heni; Madayanti, Fida; Akhmaloka

2009-01-01

Microbial communities in an acidic hot spring, namely Kawah Hujan B, at Kamojang geothermal field, West Java-Indonesia was examined using culture dependent and culture independent strategies. Chemical analysis of the hot spring water showed a characteristic of acidic-sulfate geothermal activity that contained high sulfate concentrations and low pH values (pH 1.8 to 1.9). Microbial community present in the spring was characterized by 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) analysis. The majority of the sequences recovered from culture-independent method were closely related to Crenarchaeota and Proteobacteria phyla. However, detail comparison among the member of Crenarchaeota showing some sequences variation compared to that the published data especially on the hypervariable and variable regions. In addition, the sequences did not belong to certain genus. Meanwhile, the 16S Rdna sequences from culture-dependent samples revealed mostly close to Firmicute and gamma Proteobacteria. PMID:19440252

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Microbial diversity of acidic hot spring (kawah hujan B) in geothermal field of kamojang area, west java-indonesia.

PubMed

Aditiawati, Pingkan; Yohandini, Heni; Madayanti, Fida; Akhmaloka

2009-01-01

Microbial communities in an acidic hot spring, namely Kawah Hujan B, at Kamojang geothermal field, West Java-Indonesia was examined using culture dependent and culture independent strategies. Chemical analysis of the hot spring water showed a characteristic of acidic-sulfate geothermal activity that contained high sulfate concentrations and low pH values (pH 1.8 to 1.9). Microbial community present in the spring was characterized by 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) analysis. The majority of the sequences recovered from culture-independent method were closely related to Crenarchaeota and Proteobacteria phyla. However, detail comparison among the member of Crenarchaeota showing some sequences variation compared to that the published data especially on the hypervariable and variable regions. In addition, the sequences did not belong to certain genus. Meanwhile, the 16S Rdna sequences from culture-dependent samples revealed mostly close to Firmicute and gamma Proteobacteria.

Caryotricha minuta (Xu et al., 2008) nov. comb., a unique marine ciliate (Protista, Ciliophora, Spirotrichea), with phylogenetic analysis of the ambiguous genus Caryotricha inferred from the small-subunit rRNA gene sequence.

PubMed

Miao, Miao; Shao, Chen; Jiang, Jiamei; Li, Liqiong; Stoeck, Thorsten; Song, Weibo

2009-02-01

A population of Kiitricha minuta Xu et al., 2008, a small kiitrichid ciliate, was isolated from a brackish water sample in Jiaozhou Bay, Qingdao, northern China. After comparison of its morphology and infraciliature, it is believed that this morphotype should be assigned to the genus Caryotricha; hence, a new combination is suggested, Caryotricha minuta (Xu et al., 2008) nov. comb. The small-subunit (SSU) rRNA gene sequence was determined in order to elucidate the phylogenetic position of this poorly known, ambiguous genus. The organism can be clearly separated from its congener, Caryotricha convexa Kahl, 1932, by the extremely shortened ventral cirral rows in the posterior ends. Based on the data available, an improved diagnosis is given for the genus: marine Kiitrichidae with prominent buccal field; two highly developed undulating membranes; non-grouped, uniform cirral rows on both ventral and dorsal sides; enlarged transverse cirri present, which are the only differentiated cirri; marginal cirri not present; one short migratory row located posterior to buccal field; structure of dorsal kineties generally in Kiitricha pattern. The sequence of the SSU rRNA gene of C. minuta differs by 13 % from that of Kiitricha marina. Molecular phylogenetic analyses (Bayesian inference, least squares, neighbour joining, maximum parsimony) indicate that Caryotricha, together with Kiitricha, diverges at a deep level from all other spirotrichs. Its branching position is between Phacodiniidia and Licnophoridia. The results strongly support the distinct separation of the Kiitricha-Caryotricha clade, which always branches basal to the Stichotrichia-Hypotrichia-Oligotrichia-Choreotrichia assemblage. These results also confirm the previous hypothesis that the Kiitricha-Caryotricha group, long assumed to be a close relation to the euplotids, represents a taxon at subclass level within the spirotrichs.

Paenibacillus nebraskensis sp. nov., isolated from the root surface of field-grown maize.

PubMed

Kämpfer, Peter; Busse, Hans-Jürgen; McInroy, John A; Hu, Chia-Hui; Kloepper, Joseph W; Glaeser, Stefanie P

2017-12-01

A Gram-positive-staining, aerobic, non-endospore-forming bacterial strain (JJ-59 T ), isolated from a field-grown maize plant in Dunbar, Nebraska in 2014 was studied by a polyphasic approach. Based on 16S rRNA gene sequence similarity comparisons, strain JJ-59 T was shown to be a member of the genus Paenibacillus, most closely related to the type strains of Paenibacillus aceris (98.6 % 16S rRNA gene sequence similarity) and Paenibacillus chondroitinus (97.8 %). For all other type strains of species of the genus Paenibacillus lower 16S rRNA gene sequence similarities were obtained. DNA-DNA hybridization values of strain JJ-59 T to the type strains of P. aceris and P. chondroitinus were 26 % (reciprocal, 59 %) and 52 % (reciprocal, 59 %), respectively. Chemotaxonomic characteristics such as the presence of meso-diaminopimelic acid in the peptidoglycan, the major quinone MK-7 and spermidine as the major polyamine were in agreement with the characteristics of the genus Paenibacillus. Strain JJ-59 T shared with its next related species P. aceris the major lipids diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified aminophospholipid, but the presence/absence of certain lipids was clearly distinguishable. Major fatty acids of strain JJ-59 T were anteiso-C15 : 0, iso-C15 : 0 and iso-C16 : 0, and the genomic G+C content is 47.2 mol%. Physiological and biochemical characteristics of strain JJ-59 T were clearly different from the most closely related species of the genus Paenibacillus. Thus, strain JJ-59 T represents a novel species of the genus Paenibacillus, for which the name Paenibacillus nebraskensis sp. nov. is proposed, with JJ-59 T (=DSM 103623 T =CIP 111179 T =LMG 29764 T ) as the type strain.

Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing

PubMed Central

Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.

2018-01-01

ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615

Identification of culturable stream water bacteria from urban, agricultural, and forested watersheds using 16S rRNA gene sequencing

Treesearch

Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins

2007-01-01

Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekov, Andrei D.

2007-10-30

The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

PubMed Central

Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

2013-01-01

There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

Characterization of Isolates of Streptococcus agalactiae from Diseased Farmed and Wild Marine Fish from the U.S. Gulf Coast, Latin America, and Thailand.

PubMed

Soto, Esteban; Wang, Rui; Wiles, Judy; Baumgartner, Wes; Green, Christopher; Plumb, John; Hawke, John

2015-06-01

We examined Lancefield serogroup B Streptococcus isolates recovered from diseased, cultured hybrid Striped Bass (Striped Bass Morone saxatilis × White Bass M. chrysops) and wild and cultured Gulf Killifish Fundulus grandis from coastal waters of the U.S. Gulf of Mexico (Gulf coast) and compared those isolates to strains from tilapias Oreochromis spp. reared in Mississippi, Thailand, Ecuador, and Honduras and to the original Gulf coast strain identified by Plumb et al. ( 1974 ). The isolates were subjected to phylogenetic, biochemical, and antibiotic susceptibility analyses. Genetic analysis was performed using partial sequence comparison of (1) the 16S ribosomal RNA (rRNA) gene; (2) the sipA gene, which encodes a surface immunogenic protein; (3) the cspA gene, which encodes a cell surface-associated protein; and (4) the secY gene, which encodes components of a general protein secretion pathway. Phylogenies inferred from sipA, secY, and cspA gene sequence comparisons were more discriminating than that inferred from the 16S rRNA gene sequence comparison. The U.S. Gulf coast strains showed a high degree of similarity to strains from South America and Central America and belonged to a unique group that can be distinguished from other group B streptococci. In agreement with the molecular findings, biochemical and antimicrobial resistance analyses demonstrated that the isolates recovered from the U.S. Gulf coast and Latin America were more similar to each other than to isolates from Thailand. Three laboratory challenge methods for inducing streptococcosis in Gulf Killifish were evaluated-intraperitoneal (IP) injection, immersion (IMM), and immersion plus abrasion (IMMA)-using serial dilutions of S. agalactiae isolate LADL 97-151, a representative U.S. Gulf coast strain. The dose that was lethal to 50% of test fish by 14 d postchallenge was approximately 2 CFU/fish via IP injection. In contrast, the fish that were challenged via IMM or IMMA presented cumulative mortality less than 40% by 14 d postchallenge.

Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

PubMed Central

Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

1992-01-01

Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving strains (indicated by differing numbers of base changes incorporated into the 16S rRNA sequence relative to outgroup organisms). While the results presented a clear picture of the phylogenetic relationships, the complexity of the branching will make division of the family into genera a difficult and somewhat subjective task. We do not suggest any taxonomic changes at this time. PMID:1548238

Reads2Type: a web application for rapid microbial taxonomy identification.

PubMed

Saputra, Dhany; Rasmussen, Simon; Larsen, Mette V; Haddad, Nizar; Sperotto, Maria Maddalena; Aarestrup, Frank M; Lund, Ole; Sicheritz-Pontén, Thomas

2015-11-25

Identification of bacteria may be based on sequencing and molecular analysis of a specific locus such as 16S rRNA, or a set of loci such as in multilocus sequence typing. In the near future, healthcare institutions and routine diagnostic microbiology laboratories may need to sequence the entire genome of microbial isolates. Therefore we have developed Reads2Type, a web-based tool for taxonomy identification based on whole bacterial genome sequence data. Raw sequencing data provided by the user are mapped against a set of marker probes that are derived from currently available bacteria complete genomes. Using a dataset of 1003 whole genome sequenced bacteria from various sequencing platforms, Reads2Type was able to identify the species with 99.5 % accuracy and on the minutes time scale. In comparison with other tools, Reads2Type offers the advantage of not needing to transfer sequencing files, as the entire computational analysis is done on the computer of whom utilizes the web application. This also prevents data privacy issues to arise. The Reads2Type tool is available at http://www.cbs.dtu.dk/~dhany/reads2type.html.

Identification of an anaerobic bacterium which reduces perchlorate and chlorate as Wolinella succinogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallace, W.; Attaway, H.

1995-12-31

Perchlorate and chlorate salts are widely used by the chemical, aerospace and defense industries as oxidizers in propellant, explosives and pyrotechnics. The authors have isolated a anaerobic bacterium which is capable of the dissimilatory reduction of both perchlorate and chlorate for energy and growth. Strain HAP-1 is a gram negative, thin rod, non-sporeforming, highly motile strict anaerobe. Antibiotic resistance profiles, utilization of carbon substrates and electron acceptors demonstrated similar physiological characteristics to Wolinella succinogenes. Pairwise comparisons of 16S RNA sequences showed only a 0.75% divergence between strain HAP-1 and W. succinogenes. Physiological, morphological and 16S RRNA sequence data indicate strainmore » HAP-1 is a subspecies of W. succinogenes that can utilize perchlorate and chlorate as terminal electron acceptors.« less

Selection of the internal control gene for real-time quantitative rt-PCR assays in temperature treated Leptospira.

PubMed

Carrillo-Casas, Erika Margarita; Hernández-Castro, Rigoberto; Suárez-Güemes, Francisco; de la Peña-Moctezuma, Alejandro

2008-06-01

Analysis of gene expression requires sensitive, precise, and reproducible measurements for specific mRNA sequences. To avoid bias, real-time RT-PCR is referred to one or several internal control genes. Here, we sought to identify a gene to be used as normalizer by analyzing three functional distinct housekeeping genes (lipL41, flaB, and 16S rRNA) for their expression level and stability in temperature treated Leptospira cultures. Leptospira interrogans serovar Hardjo subtype Hardjoprajitno was cultured at 30 degrees C for 7 days until a density of 10(6) cells/ml was reached and then shifted to physiological temperatures (37 degrees C and 42 degrees C) and to environmental temperatures (25 degrees C and 30 degrees C) during a 24 h period. cDNA was amplified by quantitative PCR using SYBR Green I technology and gene-specific primers for lipL41, flaB, and 16S rRNA. Expression stability (M) was assessed by geNorm and Normfinder v.18. 16S rRNA registered an average expression stability of M = 1.1816, followed by flaB (M = 1.682) and lipL41 (M = 1.763). 16S rRNA was identified as the most stable gene and can be used as a normalizer, as it showed greater expression stability than lipL41 and flaB in the four temperature treatments. Hence, comparisons of gene expression will have a higher sensitivity and specificity.

Bacterial diversity of the Colombian fermented milk "Suero Costeño" assessed by culturing and high-throughput sequencing and DGGE analysis of 16S rRNA gene amplicons.

PubMed

Motato, Karina Edith; Milani, Christian; Ventura, Marco; Valencia, Francia Elena; Ruas-Madiedo, Patricia; Delgado, Susana

2017-12-01

"Suero Costeño" (SC) is a traditional soured cream elaborated from raw milk in the Northern-Caribbean coast of Colombia. The natural microbiota that characterizes this popular Colombian fermented milk is unknown, although several culturing studies have previously been attempted. In this work, the microbiota associated with SC from three manufacturers in two regions, "Planeta Rica" (Córdoba) and "Caucasia" (Antioquia), was analysed by means of culturing methods in combination with high-throughput sequencing and DGGE analysis of 16S rRNA gene amplicons. The bacterial ecosystem of SC samples was revealed to be composed of lactic acid bacteria belonging to the Streptococcaceae and Lactobacillaceae families; the proportions and genera varying among manufacturers and region of elaboration. Members of the Lactobacillus acidophilus group, Lactocococcus lactis, Streptococcus infantarius and Streptococcus salivarius characterized this artisanal product. In comparison with culturing, the use of molecular in deep culture-independent techniques provides a more realistic picture of the overall bacterial communities residing in SC. Besides the descriptive purpose, these approaches will facilitate a rational strategy to follow (culture media and growing conditions) for the isolation of indigenous strains that allow standardization in the manufacture of SC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Kribbella albertanoniae sp. nov., isolated from a Roman catacomb, and emended description of the genus Kribbella.

PubMed

Everest, Gareth J; Curtis, Sarah M; De Leo, Filomena; Urzì, Clara; Meyers, Paul R

2013-10-01

A novel actinobacterium, strain BC640(T), was isolated from a biofilm sample collected in 2009 in the Saint Callistus Roman catacombs. Analysis of the 16S rRNA gene sequence showed that the strain belonged to the genus Kribbella. Phylogenetic analysis using the 16S rRNA gene and concatenated gyrB, rpoB, relA, recA and atpD gene sequences showed that strain BC640(T) was most closely related to the type strains of Kribbella yunnanensis and Kribbella sandramycini. Based on gyrB genetic distance analysis, strain BC640(T) was shown to be distinct from all Kribbella type strains. DNA-DNA hybridization experiments confirmed that strain BC640(T) represents a genomic species distinct from its closest phylogenetic relatives, K. yunnanensis DSM 15499(T) (53.5±7.8 % DNA relatedness) and K. sandramycini DSM 15626(T) (33.5±5.0 %). Physiological comparisons further showed that strain BC640(T) is phenotypically distinct from the type strains of K. yunnanensis and K. sandramycini. Strain BC640(T) ( = DSM 26744(T) = NRRL B-24917(T)) is thus presented as the type strain of a novel species, for which the name Kribbella albertanoniae sp. nov. is proposed.

Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags.

PubMed

Peng, Xin; Yu, Ke-Qiang; Deng, Guan-Hua; Jiang, Yun-Xia; Wang, Yu; Zhang, Guo-Xia; Zhou, Hong-Wei

2013-12-01

Low cost and high throughput capacity are major advantages of using next generation sequencing (NGS) techniques to determine metagenomic 16S rRNA tag sequences. These methods have significantly changed our view of microorganisms in the fields of human health and environmental science. However, DNA extraction using commercial kits has shortcomings of high cost and time constraint. In the present study, we evaluated the determination of fecal microbiomes using a direct boiling method compared with 5 different commercial extraction methods, e.g., Qiagen and MO BIO kits. Principal coordinate analysis (PCoA) using UniFrac distances and clustering showed that direct boiling of a wide range of feces concentrations gave a similar pattern of bacterial communities as those obtained from most of the commercial kits, with the exception of the MO BIO method. Fecal concentration by boiling method affected the estimation of α-diversity indices, otherwise results were generally comparable between boiling and commercial methods. The operational taxonomic units (OTUs) determined through direct boiling showed highly consistent frequencies with those determined through most of the commercial methods. Even those for the MO BIO kit were also obtained by the direct boiling method with high confidence. The present study suggested that direct boiling could be used to determine the fecal microbiome and using this method would significantly reduce the cost and improve the efficiency of the sample preparation for studying gut microbiome diversity. © 2013 Elsevier B.V. All rights reserved.

Methylobacterium platani sp. nov., isolated from a leaf of the tree Platanus orientalis.

PubMed

Kang, Yoon-Suk; Kim, Juhyun; Shin, Hyeon-Dong; Nam, Young-Do; Bae, Jin-Woo; Jeon, Che Ok; Park, Woojun

2007-12-01

A novel bacterial strain, designated PMB02(T), was isolated from a leaf of the tree Platanus orientalis. Colonies grown on TYG agar plates were circular, pink-pigmented and slow-growing, being 0.2-1.5 mm in diameter after 3 days growth. The cells of strain PMB02(T) were Gram-negative, aerobic, motile rods that possessed oxidase and catalase activities and grew at 20-30 degrees C, pH 6-8 and in media containing less than 1 % NaCl. The major respiratory quinone was identified as Q-10. A phylogenetic analysis based on 16S rRNA gene sequence comparisons indicated that strain PMB02(T) was related to members of the genus Methylobacterium. A comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium aquaticum and Methylobacterium variabile, with which it showed sequence similarities of 97.7 and 97.4 %, respectively. The values for DNA-DNA hybridization between strain PMB02(T) and M. aquaticum CCM 7218(T) and M. variabile GR3(T) were less than 32 %. On the basis of the phenotypic characterization, the phylogenetic analysis and the DNA-DNA relatedness data, strain PMB02(T) is considered to represent a novel species of the genus Methylobacterium, for which the name Methylobacterium platani sp. nov. is proposed. The type strain is PMB02(T) (=KCTC 12901(T)=JCM 14648(T)).

Assessing Cat Flea Microbiomes in Northern and Southern California by 16S rRNA Next-Generation Sequencing.

PubMed

Vasconcelos, Elton J R; Billeter, Sarah A; Jett, Lindsey A; Meinersmann, Richard J; Barr, Margaret C; Diniz, Pedro P V P; Oakley, Brian B

2018-06-12

Flea-borne diseases (FBDs) impact both human and animal health worldwide. Because adult fleas are obligately hematophagous and can harbor potential pathogens, fleas act as ectoparasites of vertebrates, as well as zoonotic disease vectors. Cat fleas (Ctenocephalides felis) are important vectors of two zoonotic bacterial genera listed as priority pathogens by the National Institute of Allergy and Infectious Diseases (NIAID-USA): Bartonella spp. and Rickettsia spp., causative agents of bartonelloses and rickettsioses, respectively. In this study, we introduce the first microbiome analysis of C. felis samples from California, determining the presence and abundance of relevant pathogenic genera by characterizing the cat flea microbiome through 16S rRNA next-generation sequencing (16S-NGS). Samples from both northern (NoCal) and southern (SoCal) California were assessed to expand current knowledge regarding FBDs in the state. We identified Rickettsia and Bartonella, as well as the endosymbiont Wolbachia, as the most abundant genera, followed by less abundant taxa. In comparison to our previous study screening Californian cat fleas for rickettsiae using PCR/digestion/sequencing of the ompB gene, the 16S-NGS approach applied herein showed a 95% level of agreement in detecting Rickettsia spp. There was no overall difference in microbiome diversity between NoCal and SoCal samples. Bacterial taxa identified by 16S-NGS in this study may help to improve epidemiological investigations, pathogen surveillance efforts, and clinical diagnostics of FBDs in California and elsewhere.

Evaluation of sampling and storage procedures on preserving the community structure of stool microbiota: A simple at-home toilet-paper collection method.

PubMed

Al, Kait F; Bisanz, Jordan E; Gloor, Gregory B; Reid, Gregor; Burton, Jeremy P

2018-01-01

The increasing interest on the impact of the gut microbiota on health and disease has resulted in multiple human microbiome-related studies emerging. However, multiple sampling methods are being used, making cross-comparison of results difficult. To avoid additional clinic visits and increase patient recruitment to these studies, there is the potential to utilize at-home stool sampling. The aim of this pilot study was to compare simple self-sampling collection and storage methods. To simulate storage conditions, stool samples from three volunteers were freshly collected, placed on toilet tissue, and stored at four temperatures (-80, 7, 22 and 37°C), either dry or in the presence of a stabilization agent (RNAlater®) for 3 or 7days. Using 16S rRNA gene sequencing by Illumina, the effect of storage variations for each sample was compared to a reference community from fresh, unstored counterparts. Fastq files may be accessed in the NCBI Sequence Read Archive: Bioproject ID PRJNA418287. Microbial diversity and composition were not significantly altered by any storage method. Samples were always separable based on participant, regardless of storage method suggesting there was no need for sample preservation by a stabilization agent. In summary, if immediate sample processing is not feasible, short term storage of unpreserved stool samples on toilet paper offers a reliable way to assess the microbiota composition by 16S rRNA gene sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

NASA Technical Reports Server (NTRS)

Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

1991-01-01

Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.

2004-05-01

We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha withinmore » the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.« less

Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

PubMed

Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

2018-05-01

Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

PubMed

Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

2015-04-01

Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite scaffolds occurring more likely in taxonomically distant producers but suggest that the antibiotic selection of gene pools is also influenced by site conditions.

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

PubMed Central

Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

2016-01-01

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

Aerobic and Anaerobic Transformation of cis-Dichloroethene (cis-DCE) and Vinyl Chloride (VC): Steps for Reliable Remediation

DTIC Science & Technology

2003-12-01

populations. (ii) Characterization of Dehalococeoides sp . strain FL2. The isolate, designate d Dehalococcoides sp . strain FL2, reductively...Pinellas group of the Dehalococcoides cluster, and demonstrated that strain FL2 shared an identical 165 rRNA gene sequence with Dehalococcoides sp ...strain CBDBI, a chlorobenzene-dechlorinating strain. The 165 rRNA gene sequence of Dehalococcoides sp . strain FL2 was submitted to GenBank (AF357918.2

Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing.

PubMed

Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan

2018-05-17

Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.

New Erwinia-Like Organism Causing Cervical Lymphadenitis▿

PubMed Central

Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo

2008-01-01

The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665

Bacterial flora analysis of coliforms in sewage, river water, and ground water using MALDI-TOF mass spectrometry.

PubMed

Suzuki, Yoshihiro; Niina, Kouki; Matsuwaki, Tomonori; Nukazawa, Kei; Iguchi, Atsushi

2018-01-28

The aim of this study was to rapidly and effectively analyze coliforms, which are the most fundamental indicators of water quality for fecal pollution, using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Coliform bacteria were isolated from municipal sewage, river water, and groundwater. For each sample, 100 isolates were determined by MALDI-TOF MS. In addition, these same 100 isolates were also identified via 16S rRNA gene sequence analysis. Obtained MALDI-TOF MS data were compared with the 16S rRNA sequencing analysis, and the validity of MALDI-TOF MS for classification of coliform bacteria was examined. The concordance rate of bacterial identification for the 100 isolates obtained by MALDI-TOF MS analysis and 16S rRNA gene sequence analysis for sewage, river water, and ground water were 96%, 74%, and 62% at the genus level, respectively. Among the sewage, river water, and ground water samples, the coliform bacterial flora were distinct. The dominant genus of coliforms in sewage, river water, and groundwater were Klebsiella spp., Enterobacter spp., and Serratia spp., respectively. We determined that MALDI-TOF MS is a rapid and accurate tool that can be used to identify coliforms. Therefore, without using conventional 16S rRNA sequencing, it is possible to rapidly and effectively classify coliforms in water using MALDI-TOF MS.

Microbial Characterization of Qatari Barchan Sand Dunes

PubMed Central

Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.

2016-01-01

This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399

16S-23S rRNA gene internal transcribed spacer sequences for analysis of the phylogenetic relationships among species of the genus Porphyromonas.

PubMed

Conrads, Georg; Citron, Diane M; Tyrrell, Kerin L; Horz, Hans-Peter; Goldstein, Ellie J C

2005-03-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of 11 reference strains of Porphyromonas species, together with Bacteroides distasonis and Tannerella forsythensis, were analysed to examine interspecies relationships. Compared with the phylogenetic tree generated using 16S rRNA gene sequences, the resolution of the ITS sequence-based tree was higher, but species positioning and clustering were similar with both approaches. The recent separation of Porphyromonas gulae and Porphyromonas gingivalis into distinct species was confirmed by the ITS data. In addition, analysis of the ITS sequences of 24 clinical isolates of Porphyromonas asaccharolytica plus the type strain ATCC 25260(T) divided the sequences into two clusters, of which one was alpha-fucosidase-positive (like the type strain) while the other was alpha-fucosidase-negative. The latter resembled the previously studied unusual extra-oral isolates of 'Porphyromonas endodontalis-like organisms' (PELOs) which could therefore be called 'Porphyromonas asaccharolytica-like organisms' (PALOs), based on the genetic identification. Moreover, the proposal of alpha-fucosidase-negative P. asaccharolytica strains as a new species should also be considered.

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Mycoplasma insons sp. nov., a twisted mycoplasma from green iguanas (Iguana iguana)

PubMed Central

May, Meghan; Ortiz, G. Javier; Wendland, Lori D.; Rotstein, David S.; Relich, Ryan F.; Balish, Mitchell F.; Brown, Daniel R.

2008-01-01

Mycoplasma insons sp. nov., first cultured from the choanae and tracheae of healthy green iguanas (Iguana iguana) from El Salvador, was readily distinguished from all previously described mollicutes and assigned to the Mycoplasma fastidiosum phylogenetic cluster by 16S rRNA gene sequence comparisons. Growth inhibition assays distinguished the isolates serologically from the other two members of that cluster. Many M. insons cells exhibit a remarkable twisted rod morphology despite lacking a cell wall. The organism is nonmotile, produces acid from glucose, but does not hydrolyze arginine, esculin, or urea. Mycoplasma insons 16S rRNA gene was also detected by PCR in packed blood cells from culture-negative iguanas. The type strain I17P1T has been deposited with the Mollicutes Collection at Purdue University and with the American Type Culture Collection (ATCC BAA-1435) in the USA. A limited number of cultures generated by the authors have also been deposited with the Culture Collection, University of Göteborg, in Sweden (CCUG 53461). PMID:17697083

Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

PubMed

Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

2006-07-01

The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

The complete mitochondrial genome of the Anabas testudineus (Perciformes, Anabantidae) and its comparison with other related fish species.

PubMed

Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kumari, Kavita; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Rao, A R; Rai, Anil

2017-03-01

In the present study, the complete mitochondrial genome sequence of Anabas testudineusis reported using PGM sequencer (Ion Torrent, Life Technologies, La Jolla, CA). The complete mitogenome of climbing perch, A. testudineusis obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP), which is 16 603 bp in length. The mitogenome of A. testudineus composed of 13 protein- coding genes, two rRNA, and 22 tRNAs. Here, 20 tRNAs genes showed typical clover leaf model, and D-Loop as the control region along with gene order and organization, being closely similar to Osphronemidae and most of other Perciformes fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of earlier reported A. testudineus. The phylogenetic analysis of Anabantidae depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of A. testudineus would be helpful in understanding the population genetics, phylogenetics, and evolution of Anabantidae.

Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture

PubMed Central

Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy

2007-01-01

It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones analysed. In all, 28 phylotypes were identified: Lysobacter enzymogenes was the most abundant phylotype (31.4%), followed by Lysobacter sp. C3 (28.3%), gamma proteobacterium N4-7 (6.6%), Methylobacterium SM4 (4.7%) and Staphylococcus epidermidis (4.7%); 36 clones (7.0%) represented uncultivable phylotypes. We conclude that a diverse range of bacterial species are found within biofilms on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties. PMID:17501992

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

PubMed Central

Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

2015-01-01

In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

PubMed

Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

2016-03-30

The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status.

First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea.

PubMed

Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi

2016-07-01

In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.

Evaluating digestion efficiency in full-scale anaerobic digesters by identifying active microbial populations through the lens of microbial activity

NASA Astrophysics Data System (ADS)

Mei, Ran; Narihiro, Takashi; Nobu, Masaru K.; Kuroda, Kyohei; Liu, Wen-Tso

2016-09-01

Anaerobic digestion is a common technology to biologically stabilize wasted solids produced in municipal wastewater treatment. Its efficiency is usually evaluated by calculating the reduction in volatile solids, which assumes no biomass growth associated with digestion. To determine whether this assumption is valid and further evaluate digestion efficiency, this study sampled 35 digester sludge from different reactors at multiple time points together with the feed biomass in a full-scale water reclamation plant at Chicago, Illinois. The microbial communities were characterized using Illumina sequencing technology based on 16S rRNA and 16S rRNA gene (rDNA). 74 core microbial populations were identified and represented 58.7% of the entire digester community. Among them, active populations were first identified using the ratio of 16S rRNA and 16S rDNA (rRNA/rDNA) for individual populations, but this approach failed to generate consistent results. Subsequently, a recently proposed mass balance model was applied to calculate the specific growth rate (μ), and this approach successfully identified active microbial populations in digester (positive μ) that could play important roles than those with negative μ. It was further estimated that 82% of microbial populations in the feed sludge were digested in comparison with less than 50% calculated using current equations.

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

NASA Technical Reports Server (NTRS)

Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

1992-01-01

A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

Archaeon and archaeal virus diversity classification via sequence entropy and fractal dimension

NASA Astrophysics Data System (ADS)

Tremberger, George, Jr.; Gallardo, Victor; Espinoza, Carola; Holden, Todd; Gadura, N.; Cheung, E.; Schneider, P.; Lieberman, D.; Cheung, T.

2010-09-01

Archaea are important potential candidates in astrobiology as their metabolism includes solar, inorganic and organic energy sources. Archaeal viruses would also be expected to be present in a sustainable archaeal exobiological community. Genetic sequence Shannon entropy and fractal dimension can be used to establish a two-dimensional measure for classification and phylogenetic study of these organisms. A sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. Archaeal 16S and 23S ribosomal RNA sequences were studied. Outliers in the 16S rRNA fractal dimension and entropy plot were found to be halophilic archaea. Positive correlation (R-square ~ 0.75, N = 18) was observed between fractal dimension and entropy across the studied species. The 16S ribosomal RNA sequence entropy correlates with the 23S ribosomal RNA sequence entropy across species with R-square 0.93, N = 18. Entropy values correspond positively with branch lengths of a published phylogeny. The studied archaeal virus sequences have high fractal dimensions of 2.02 or more. A comparison of selected extremophile sequences with archaeal sequences from the Humboldt Marine Ecosystem database (Wood-Hull Oceanography Institute, MIT) suggests the presence of continuous sequence expression as inferred from distributions of entropy and fractal dimension, consistent with the diversity expected in an exobiological archaeal community.

A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria.

PubMed

Gaby, John Christian; Buckley, Daniel H

2014-01-01

We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm.

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria

PubMed Central

Gaby, John Christian; Buckley, Daniel H.

2014-01-01

We describe a nitrogenase gene sequence database that facilitates analysis of the evolution and ecology of nitrogen-fixing organisms. The database contains 32 954 aligned nitrogenase nifH sequences linked to phylogenetic trees and associated sequence metadata. The database includes 185 linked multigene entries including full-length nifH, nifD, nifK and 16S ribosomal RNA (rRNA) gene sequences. Evolutionary analyses enabled by the multigene entries support an ancient horizontal transfer of nitrogenase genes between Archaea and Bacteria and provide evidence that nifH has a different history of horizontal gene transfer from the nifDK enzyme core. Further analyses show that lineages in nitrogenase cluster I and cluster III have different rates of substitution within nifD, suggesting that nifD is under different selection pressure in these two lineages. Finally, we find that that the genetic divergence of nifH and 16S rRNA genes does not correlate well at sequence dissimilarity values used commonly to define microbial species, as stains having <3% sequence dissimilarity in their 16S rRNA genes can have up to 23% dissimilarity in nifH. The nifH database has a number of uses including phylogenetic and evolutionary analyses, the design and assessment of primers/probes and the evaluation of nitrogenase sequence diversity. Database URL: http://www.css.cornell.edu/faculty/buckley/nifh.htm PMID:24501396

Molecular characterization of sulfate-reducing bacteria in the Guaymas Basin

NASA Technical Reports Server (NTRS)

Dhillon, Ashita; Teske, Andreas; Dillon, Jesse; Stahl, David A.; Sogin, Mitchell L.

2003-01-01

The Guaymas Basin (Gulf of California) is a hydrothermal vent site where thermal alteration of deposited planktonic and terrestrial organic matter forms petroliferous material which supports diverse sulfate-reducing bacteria. We explored the phylogenetic and functional diversity of the sulfate-reducing bacteria by characterizing PCR-amplified dissimilatory sulfite reductase (dsrAB) and 16S rRNA genes from the upper 4 cm of the Guaymas sediment. The dsrAB sequences revealed that there was a major clade closely related to the acetate-oxidizing delta-proteobacterial genus Desulfobacter and a clade of novel, deeply branching dsr sequences related to environmental dsr sequences from marine sediments in Aarhus Bay and Kysing Fjord (Denmark). Other dsr clones were affiliated with gram-positive thermophilic sulfate reducers (genus Desulfotomaculum) and the delta-proteobacterial species Desulforhabdus amnigena and Thermodesulforhabdus norvegica. Phylogenetic analysis of 16S rRNAs from the same environmental samples resulted in identification of four clones affiliated with Desulfobacterium niacini, a member of the acetate-oxidizing, nutritionally versatile genus Desulfobacterium, and one clone related to Desulfobacula toluolica and Desulfotignum balticum. Other bacterial 16S rRNA bacterial phylotypes were represented by non-sulfate reducers and uncultured lineages with unknown physiology, like OP9, OP8, as well as a group with no clear affiliation. In summary, analyses of both 16S rRNA and dsrAB clone libraries resulted in identification of members of the Desulfobacteriales in the Guaymas sediments. In addition, the dsrAB sequencing approach revealed a novel group of sulfate-reducing prokaryotes that could not be identified by 16S rRNA sequencing.

Whole transcriptome analysis of the poultry red mite Dermanyssus gallinae (De Geer, 1778).

PubMed

Schicht, Sabine; Qi, Weihong; Poveda, Lucy; Strube, Christina

2014-03-01

SUMMARY Although the poultry red mite Dermanyssus gallinae (De Geer, 1778) is the major parasitic pest in poultry farming causing substantial economic losses every year, nucleotide data are rare in the public databases. Therefore, de novo sequencing covering the transcriptome of D. gallinae was carried out resulting in a dataset of 232 097 singletons and 42 130 contiguous sequences (contigs) which were subsequently clustered into 24 140 isogroups consisting of 35 788 isotigs. After removal of sequences possibly originating from bacteria or the chicken host, 267 464 sequences (231 657 singletons, 56 contigs and 35 751 isotigs) remained, of which 10·3% showed homology to proteins derived from other organisms. The most significant Blast top-hit species was the mite Metaseiulus occidentalis followed by the tick Ixodes scapularis. To gain functional knowledge of D. gallinae transcripts, sequences were mapped to Gene Ontology terms, Kyoto Encyclopedia of Gene and Genomes (KEGG) pathways and parsed to InterProScan. The transcriptome dataset provides new insights in general mite genetics and lays a foundation for future studies on stage-specific transcriptomics as well as genomic, proteomic, and metabolomic explorations and might provide new perspectives to control this parasitic mite by identifying possible drug targets or vaccine candidates. It is also worth noting that in different tested species of the class Arachnida no 28S rRNA was detectable in the rRNA profile, indicating that 28S rRNA might consists of two separate, hydrogen-bonded fragments, whose (heat-induced) disruption may led to co-migration with 18S rRNA.

Ribosomal RNA and ribosomal proteins in corynebacteria.

PubMed

Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

2003-09-04

Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

PubMed Central

Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

2002-01-01

Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

Sequence data for two large-subunit rRNA genes from an Asian strain of Alexandrium catenella.

PubMed Central

Yeung, P K; Kong, K F; Wong, F T; Wong, J T

1996-01-01

PCR generated two distinct products from a toxic isolate of Alexandrium catenella, which had been taken from Dai Ya Bay (southern China), by using primers for large-subunit rRNA. This pattern is distinct from published data for North American Alexandrium species. Sequences of the two products suggest that the smaller was generated by a deletion event. Single-cell PCR generated the same pattern, confirming that the two products were not the results from different individuals. PMID:8900010

Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

PubMed

Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

2016-02-25

Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

Prevalence of Theileria equi and Babesia caballi as well as the identification of associated ticks in sympatric Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya.

PubMed

Hawkins, Elaine; Kock, Richard; McKeever, Declan; Gakuya, Francis; Musyoki, Charles; Chege, Stephen M; Mutinda, Mathew; Kariuki, Edward; Davidson, Zeke; Low, Belinda; Skilton, Robert A; Njahira, Moses N; Wamalwa, Mark; Maina, Elsie

2015-01-01

The role of equine piroplasmosis as a factor in the population decline of the Grevy's zebra is not known. We determined the prevalence of Babesia caballi and Theileria equi in cograzing Grevy's zebras (Equus grevyi) and donkeys (Equus africanus asinus) in northern Kenya and identified the associated tick vectors. Blood samples were taken from 71 donkeys and 16 Grevy's zebras from March to May 2011. A nested PCR reaction using 18s ribosomal (r)RNA primers on 87 blood spots showed 72% (51/71; 95% confidence interval [CI] 60.4-81.0%) of donkeys and 100% (16/16; 95% CI, 77.3-100%) of Grevy's zebras were T. equi positive. No samples were positive for B. caballi. Sequence comparison using the National Center for Biotechnology Information's basic local alignment search tool identified homologous 18s rRNA sequences with a global geographic spread. The T. equi-derived sequences were evaluated using Bayesian approaches with independent Metropolis-coupled Markov chain Monte Carlo runs. The sequences clustered with those found in Sudan, Croatia, Mongolia, and the US, with statistical support greater than 80% for the two main clades. Hyalomma tick species were found on both donkeys and Grevy's zebras, whereas Rhipicephalus pulchellus was found exclusively on Grevy's zebras and Hyalomma marginatum rupfipes on donkeys. The prevalence of T. equi was 100% in Grevy's zebras and 72% in donkeys with common tick vectors identified. Our results suggest that donkeys and Grevy's zebras can be asymptomatic carriers and that piroplasmosis is endemic in the study area.

Salinispirillum marinum gen. nov., sp. nov., a haloalkaliphilic bacterium in the family 'Saccharospirillaceae'.

PubMed

Shahinpei, Azadeh; Amoozegar, Mohammad Ali; Fazeli, Seyed Abolhassan Shahzadeh; Schumann, Peter; Ventosa, Antonio

2014-11-01

A novel Gram-staining-negative, motile, non-pigmented, facultatively anaerobic, spirillum-shaped, halophilic and alkaliphilic bacterium, designated strain GCWy1(T), was isolated from water of the coastal-marine wetland Gomishan in Iran. The strain was able to grow at NaCl concentrations of 1-10% (w/v) and optimal growth was achieved at 3% (w/v). The optimum pH and temperature for growth were pH 8.5 and 30 °C, while the strain was able to grow at pH 7.5-10 and 4-40 °C. Phylogenetic analysis based on the comparison of the 16S rRNA gene sequence placed the isolate within the class Gammaproteobacteria as a separate deep branch, with 92.1% or lower sequence similarity to representatives of the genera Saccharospirillum and Reinekea and less than 91.0% sequence similarity with other remotely related genera. The major cellular fatty acids of the isolate were C(18 : 1)ω7c, C(16:0) and C(17 : 0), and the major components of its polar lipid profile were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cells of strain GCWy1(T) contained the isoprenoid quinones Q-9 and Q-8 (81% and 2%, respectively). The G+C content of the genomic DNA of this strain was 52.3 mol%. On the basis of 16S rRNA gene sequence analysis in combination with chemotaxonomic and phenotypic data, strain GCWy1(T) represents a novel species in a new genus in the family 'Saccharospirillaceae', order Oceanospirillales, for which the name Salinispirillum marinum gen. nov., sp. nov. is proposed. The type strain of the type species is GCWy1(T) ( = IBRC-M 10765(T) =CECT 8342(T)). © 2014 IUMS.

Spatio-temporal variations and genetic diversity of Anaplasma spp. in cattle from the North of Tunisia.

PubMed

Belkahia, Hanène; Ben Said, Mourad; El Mabrouk, Narjesse; Saidani, Mariem; Cherni, Chayma; Ben Hassen, Mariem; Bouattour, Ali; Messadi, Lilia

2017-09-01

In cattle, anaplasmosis is a tick-borne rickettsial disease caused by Anaplasma marginale, A. centrale, A. phagocytophilum, and A. bovis. To date, no information concerning the seasonal dynamics of single and/or mixed infections by different Anaplasma species in bovines are available in Tunisia. In this work, a total of 1035 blood bovine samples were collected in spring (n=367), summer (n=248), autumn (n=244) and winter (n=176) from five different governorates belonging to three bioclimatic zones from the North of Tunisia. Molecular survey of A. marginale, A. centrale and A. bovis in cattle showed that average prevalence rates were 4.7% (minimum 4.1% in autumn and maximum 5.6% in summer), 7% (minimum 3.9% in winter and maximum 10.7% in autumn) and 4.9% (minimum 2.7% in spring and maximum 7.3% in summer), respectively. A. phagocytophilum was not detected in all investigated cattle. Seasonal variations of Anaplasma spp. infection and co-infection rates in overall and/or according to each bioclimatic area were recorded. Molecular characterization of A. marginale msp4 gene indicated a high sequence homology of revealed strains with A. marginale sequences from African countries. Alignment of 16S rRNA A. centrale sequences showed that Tunisian strains were identical to the vaccine strain from several sub-Saharan African and European countries. The comparison of the 16S rRNA sequences of A. bovis variants showed a perfect homology between Tunisian variants isolated from cattle, goats and sheep. These present data are essential to estimate the risk of bovine anaplasmosis in order to develop integrated control policies against multi-species pathogen communities, infecting humans and different animal species, in the country. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Microbial Culturomics Application for Global Health: Noncontiguous Finished Genome Sequence and Description of Pseudomonas massiliensis Strain CB-1T sp. nov. in Brazil.

PubMed

Bardet, Lucie; Cimmino, Teresa; Buffet, Clémence; Michelle, Caroline; Rathored, Jaishriram; Tandina, Fatalmoudou; Lagier, Jean-Christophe; Khelaifia, Saber; Abrahão, Jônatas; Raoult, Didier; Rolain, Jean-Marc

2018-02-01

Culturomics is a new postgenomics field that explores the microbial diversity of the human gut coupled with taxono-genomic strategy. Culturomics, and the microbiome science more generally, are anticipated to transform global health diagnostics and inform the ways in which gut microbial diversity contributes to human health and disease, and by extension, to personalized medicine. Using culturomics, we report in this study the description of strain CB1 T ( = CSUR P1334 = DSM 29075), a new species isolated from a stool specimen from a 37-year-old Brazilian woman. This description includes phenotypic characteristics and complete genome sequence and annotation. Strain CB1 T is a gram-negative aerobic and motile bacillus, exhibits neither catalase nor oxidase activities, and presents a 98.3% 16S rRNA sequence similarity with Pseudomonas putida. The 4,723,534 bp long genome contains 4239 protein-coding genes and 74 RNA genes, including 15 rRNA genes (5 16S rRNA, 4 23S rRNA, and 6 5S rRNA) and 59 tRNA genes. Strain CB1 T was named Pseudomonas massiliensis sp. nov. and classified into the family Pseudomonadaceae. This study demonstrates the usefulness of microbial culturomics in exploration of human microbiota in diverse geographies and offers new promise for incorporating new omics technologies for innovation in diagnostic medicine and global health.

Isolation and distribution of a novel iron-oxidizing crenarchaeon from acidic geothermal springs in Yellowstone National Park.

PubMed

Kozubal, M; Macur, R E; Korf, S; Taylor, W P; Ackerman, G G; Nagy, A; Inskeep, W P

2008-02-01

Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75 degrees C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65 degrees C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80 degrees C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP.

The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

PubMed

Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2015-01-01

In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

PubMed

Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

2013-08-01

Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

PanFP: Pangenome-based functional profiles for microbial communities

DOE PAGES

Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren; ...

2015-09-26

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less

PanFP: pangenome-based functional profiles for microbial communities.

PubMed

Jun, Se-Ran; Robeson, Michael S; Hauser, Loren J; Schadt, Christopher W; Gorin, Andrey A

2015-09-26

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost-effective way to screen samples of interest for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. We present a computational method called pangenome-based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU's taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome's functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8-0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed-reference OTU picking strategies against specific reference sequence databases. We developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub ( https://github.com/srjun/PanFP ).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jun, Se -Ran; Hauser, Loren John; Schadt, Christopher Warren

For decades there has been increasing interest in understanding the relationships between microbial communities and ecosystem functions. Current DNA sequencing technologies allows for the exploration of microbial communities in two principle ways: targeted rRNA gene surveys and shotgun metagenomics. For large study designs, it is often still prohibitively expensive to sequence metagenomes at both the breadth and depth necessary to statistically capture the true functional diversity of a community. Although rRNA gene surveys provide no direct evidence of function, they do provide a reasonable estimation of microbial diversity, while being a very cost effective way to screen samples of interestmore » for later shotgun metagenomic analyses. However, there is a great deal of 16S rRNA gene survey data currently available from diverse environments, and thus a need for tools to infer functional composition of environmental samples based on 16S rRNA gene survey data. As a result, we present a computational method called pangenome based functional profiles (PanFP), which infers functional profiles of microbial communities from 16S rRNA gene survey data for Bacteria and Archaea. PanFP is based on pangenome reconstruction of a 16S rRNA gene operational taxonomic unit (OTU) from known genes and genomes pooled from the OTU s taxonomic lineage. From this lineage, we derive an OTU functional profile by weighting a pangenome s functional profile with the OTUs abundance observed in a given sample. We validated our method by comparing PanFP to the functional profiles obtained from the direct shotgun metagenomic measurement of 65 diverse communities via Spearman correlation coefficients. These correlations improved with increasing sequencing depth, within the range of 0.8 0.9 for the most deeply sequenced Human Microbiome Project mock community samples. PanFP is very similar in performance to another recently released tool, PICRUSt, for almost all of survey data analysed here. But, our method is unique in that any OTU building method can be used, as opposed to being limited to closed reference OTU picking strategies against specific reference sequence databases. In conclusion, we developed an automated computational method, which derives an inferred functional profile based on the 16S rRNA gene surveys of microbial communities. The inferred functional profile provides a cost effective way to study complex ecosystems through predicted comparative functional metagenomes and metadata analysis. All PanFP source code and additional documentation are freely available online at GitHub.« less

Blastocystis phylogeny among various isolates from humans to insects.

PubMed

Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

2016-12-01

Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

Structure and variation of the mitochondrial genome of fishes.

PubMed

Satoh, Takashi P; Miya, Masaki; Mabuchi, Kohji; Nishida, Mutsumi

2016-09-07

The mitochondrial (mt) genome has been used as an effective tool for phylogenetic and population genetic analyses in vertebrates. However, the structure and variability of the vertebrate mt genome are not well understood. A potential strategy for improving our understanding is to conduct a comprehensive comparative study of large mt genome data. The aim of this study was to characterize the structure and variability of the fish mt genome through comparative analysis of large datasets. An analysis of the secondary structure of proteins for 250 fish species (248 ray-finned and 2 cartilaginous fishes) illustrated that cytochrome c oxidase subunits (COI, COII, and COIII) and a cytochrome bc1 complex subunit (Cyt b) had substantial amino acid conservation. Among the four proteins, COI was the most conserved, as more than half of all amino acid sites were invariable among the 250 species. Our models identified 43 and 58 stems within 12S rRNA and 16S rRNA, respectively, with larger numbers than proposed previously for vertebrates. The models also identified 149 and 319 invariable sites in 12S rRNA and 16S rRNA, respectively, in all fishes. In particular, the present result verified that a region corresponding to the peptidyl transferase center in prokaryotic 23S rRNA, which is homologous to mt 16S rRNA, is also conserved in fish mt 16S rRNA. Concerning the gene order, we found 35 variations (in 32 families) that deviated from the common gene order in vertebrates. These gene rearrangements were mostly observed in the area spanning the ND5 gene to the control region as well as two tRNA gene cluster regions (IQM and WANCY regions). Although many of such gene rearrangements were unique to a specific taxon, some were shared polyphyletically between distantly related species. Through a large-scale comparative analysis of 250 fish species mt genomes, we elucidated various structural aspects of the fish mt genome and the encoded genes. The present results will be important for understanding functions of the mt genome and developing programs for nucleotide sequence analysis. This study demonstrated the significance of extensive comparisons for understanding the structure of the mt genome.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Intestinal microbiota composition in fishes is influenced by host ecology and environment.

PubMed

Wong, Sandi; Rawls, John F

2012-07-01

The digestive tracts of vertebrates are colonized by complex assemblages of micro-organisms, collectively called the gut microbiota. Recent studies have revealed important contributions of gut microbiota to vertebrate health and disease, stimulating intense interest in understanding how gut microbial communities are assembled and how they impact host fitness (Sekirov et al. 2010). Although all vertebrates harbour a gut microbiota, current information on microbiota composition and function has been derived primarily from mammals. Comparisons of different mammalian species have revealed intriguing associations between gut microbiota composition and host diet, anatomy and phylogeny (Ley et al. 2008b). However, mammals constitute <10% of all vertebrate species, and it remains unclear whether similar associations exist in more diverse and ancient vertebrate lineages such as fish. In this issue, Sullam et al. (2012) make an important contribution toward identifying factors determining gut microbiota composition in fishes. The authors conducted a detailed meta-analysis of 25 bacterial 16S rRNA gene sequence libraries derived from the intestines of different fish species. To provide a broader context for their analysis, they compared these data sets to a large collection of 16S rRNA gene sequence data sets from diverse free-living and host-associated bacterial communities. Their results suggest that variation in gut microbiota composition in fishes is strongly correlated with species habitat salinity, trophic level and possibly taxonomy. Comparison of data sets from fish intestines and other environments revealed that fish gut microbiota compositions are often similar to those of other animals and contain relatively few free-living environmental bacteria. These results suggest that the gut microbiota composition of fishes is not a simple reflection of the micro-organisms in their local habitat but may result from host-specific selective pressures within the gut (Bevins & Salzman 2011).

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

PubMed

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression

PubMed Central

Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.

2018-01-01

The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865

Weissella ghanensis sp. nov., isolated from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; Lefebvre, Karen; De Vuyst, Luc; Vandamme, Peter

2008-12-01

During a study on lactic acid bacteria (and their species diversity) in spontaneous heap fermentations of Ghanaian cocoa beans, two strains, designated 215(T) and 194B, were isolated. A phylogenetic analysis based on 16S rRNA gene sequences demonstrated that these strains represented a distinct lineage close to the genus Weissella and showing only 92.1 % 16S rRNA gene sequence similarity with respect to their closest neighbour, Weissella soli LMG 20113(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and physiological and biochemical tests confirmed the unique taxonomic position of the two novel isolates. On the basis of the results of the morphological and biochemical tests and 16S rRNA gene sequence analysis, strains 215(T) and 194B represent the most peripheral lineage of the genus Weissella, for which we propose the name Weissella ghanensis sp. nov. The type strain is 215(T) (=LMG 24286(T)=DSM 19935(T)).

Microbial community structure in the gut of the New Zealand insect Auckland tree weta (Hemideina thoracica).

PubMed

Waite, David W; Dsouza, Melissa; Biswas, Kristi; Ward, Darren F; Deines, Peter; Taylor, Michael W

2015-05-01

The endemic New Zealand weta is an enigmatic insect. Although the insect is well known by its distinctive name, considerable size, and morphology, many basic aspects of weta biology remain unknown. Here, we employed cultivation-independent enumeration techniques and rRNA gene sequencing to investigate the gut microbiota of the Auckland tree weta (Hemideina thoracica). Fluorescence in situ hybridisation performed on different sections of the gut revealed a bacterial community of fluctuating density, while rRNA gene-targeted amplicon pyrosequencing revealed the presence of a microbial community containing high bacterial diversity, but an apparent absence of archaea. Bacteria were further studied using full-length 16S rRNA gene sequences, with statistical testing of bacterial community membership against publicly available termite- and cockroach-derived sequences, revealing that the weta gut microbiota is similar to that of cockroaches. These data represent the first analysis of the weta microbiota and provide initial insights into the potential function of these microorganisms.

Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

PubMed

Jiang, Xuexia; Jiao, Nianzhi

2016-09-01

Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

Phylogeny and evolution of the auks (subfamily Alcinae) based on mitochondrial DNA sequences

USGS Publications Warehouse

Moum, Truls; Johansen, Steinar; Erikstad, Kjell Einar; Piatt, John F.

1994-01-01

The genetic divergence and phylogeny of the auks was assessed by mitochondrial DNA sequence comparisons in a study using 19 of the 22 auk species and two outgroup representatives. We compared more than 500 nucleotides from each of two mitochondrial genes encoding 12S rRNA and the NADH dehydrogenase subunit 6. Divergence times were estimated from transversional substitutions. The dovekie (Alle alle) is related to the razorbill (Alca torda) and the murres (Uria spp). Furthermore, the Xantus's murrelet (Synthliboramphus hypoleucus) and the ancient (Synthliboramphus antiquus) and Japanese murrelets (Synthliboramphus wumizusume) are genetically distinct members of the same main lineage, whereas brachyramphine and synthliboramphine murrelets are not closely related. An early adaptive radiation of six main species groups of auks seems to trace back to Middle Miocene. Later speciation probably involved ecological differentiations and geographical isolations.

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Comparison of single-molecule sequencing and hybrid approaches for finishing the genome of Clostridium autoethanogenum and analysis of CRISPR systems in industrial relevant Clostridia

PubMed Central

2014-01-01

Background Clostridium autoethanogenum strain JA1-1 (DSM 10061) is an acetogen capable of fermenting CO, CO2 and H2 (e.g. from syngas or waste gases) into biofuel ethanol and commodity chemicals such as 2,3-butanediol. A draft genome sequence consisting of 100 contigs has been published. Results A closed, high-quality genome sequence for C. autoethanogenum DSM10061 was generated using only the latest single-molecule DNA sequencing technology and without the need for manual finishing. It is assigned to the most complex genome classification based upon genome features such as repeats, prophage, nine copies of the rRNA gene operons. It has a low G + C content of 31.1%. Illumina, 454, Illumina/454 hybrid assemblies were generated and then compared to the draft and PacBio assemblies using summary statistics, CGAL, QUAST and REAPR bioinformatics tools and comparative genomic approaches. Assemblies based upon shorter read DNA technologies were confounded by the large number repeats and their size, which in the case of the rRNA gene operons were ~5 kb. CRISPR (Clustered Regularly Interspaced Short Paloindromic Repeats) systems among biotechnologically relevant Clostridia were classified and related to plasmid content and prophages. Potential associations between plasmid content and CRISPR systems may have implications for historical industrial scale Acetone-Butanol-Ethanol (ABE) fermentation failures and future large scale bacterial fermentations. While C. autoethanogenum contains an active CRISPR system, no such system is present in the closely related Clostridium ljungdahlii DSM 13528. A common prophage inserted into the Arg-tRNA shared between the strains suggests a common ancestor. However, C. ljungdahlii contains several additional putative prophages and it has more than double the amount of prophage DNA compared to C. autoethanogenum. Other differences include important metabolic genes for central metabolism (as an additional hydrogenase and the absence of a phophoenolpyruvate synthase) and substrate utilization pathway (mannose and aromatics utilization) that might explain phenotypic differences between C. autoethanogenum and C. ljungdahlii. Conclusions Single molecule sequencing will be increasingly used to produce finished microbial genomes. The complete genome will facilitate comparative genomics and functional genomics and support future comparisons between Clostridia and studies that examine the evolution of plasmids, bacteriophage and CRISPR systems. PMID:24655715

Metagenomics uncovers gaps in amplicon-based detection of microbial diversity

DOE PAGES

Eloe-Fadrosh, Emiley A.; Ivanova, Natalia N.; Woyke, Tanja; ...

2016-02-01

Our view of microbial diversity has expanded greatly over the past 40 years, primarily through the wide application of PCR-based surveys of the small-subunit ribosomal RNA (SSU rRNA) gene. Yet significant gaps in knowledge remain due to well-recognized limitations of this method. Here in this paper, we systematically survey primer fidelity in SSU rRNA gene sequences recovered from over 6,000 assembled metagenomes sampled globally. Our findings show that approximately 10% of environmental microbial sequences might be missed from classical PCR-based SSU rRNA gene surveys, mostly members of the Candidate Phyla Radiation (CPR) and as yet uncharacterized Archaea. In conclusion, thesemore » results underscore the extent of uncharacterized microbial diversity and provide fruitful avenues for describing additional phylogenetic lineages.« less

Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

PubMed Central

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.

PubMed

Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K

2016-02-01

A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.

Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

PubMed

Martins, C; Galetti, P M

2001-10-01

To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia

PubMed Central

Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen

2016-01-01

Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821

Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing

PubMed Central

de Gier, Camilla; Kirkham, Lea-Ann S.

2015-01-01

Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279

16S rRNA Gene Sequencing, Multilocus Sequence Analysis, and Mass Spectrometry Identification of the Proposed New Species “Clostridium neonatale”

PubMed Central

Bouvet, Philippe; Ferraris, Laurent; Dauphin, Brunhilde; Popoff, Michel-Robert; Butel, Marie Jose

2014-01-01

In 2002, an outbreak of necrotizing enterocolitis in a Canadian neonatal intensive care unit was associated with a proposed novel species of Clostridium, “Clostridium neonatale.” To date, there are no data about the isolation, identification, or clinical significance of this species. Additionally, C. neonatale has not been formally classified as a new species, rendering its identification challenging. Indeed, the C. neonatale 16S rRNA gene sequence shows high similarity to another Clostridium species involved in neonatal necrotizing enterocolitis, Clostridium butyricum. By performing a polyphasic study combining phylogenetic analysis (16S rRNA gene sequencing and multilocus sequence analysis) and phenotypic characterization with mass spectrometry, we demonstrated that C. neonatale is a new species within the Clostridium genus sensu stricto, for which we propose the name Clostridium neonatale sp. nov. Now that the status of C. neonatale has been clarified, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) can be used for better differential identification of C. neonatale and C. butyricum clinical isolates. This is necessary to precisely define the role and clinical significance of C. neonatale, a species that may have been misidentified and underrepresented during previous neonatal necrotizing enterocolitis studies. PMID:25232167

AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

EPA Science Inventory

This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.

PubMed

Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H

2014-05-01

Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).

Molecular Evidence of Chlamydia-Like Organisms in the Feces of Myotis daubentonii Bats.

PubMed

Hokynar, K; Vesterinen, E J; Lilley, T M; Pulliainen, A T; Korhonen, S J; Paavonen, J; Puolakkainen, M

2017-01-15

Chlamydia-like organisms (CLOs) are recently identified members of the Chlamydiales order. CLOs share intracellular lifestyles and biphasic developmental cycles, and they have been detected in environmental samples as well as in various hosts such as amoebae and arthropods. In this study, we screened bat feces for the presence of CLOs by molecular analysis. Using pan-Chlamydiales PCR targeting the 16S rRNA gene, Chlamydiales DNA was detected in 54% of the specimens. PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA and 23S rRNA genes were used to classify positive specimens and infer their phylogenetic relationships. Most sequences matched best with Rhabdochlamydia species or uncultured Chlamydia sequences identified in ticks. Another set of sequences matched best with sequences of the Chlamydia genus or uncultured Chlamydiales from snakes. To gain evidence of whether CLOs in bat feces are merely diet borne, we analyzed insects trapped from the same location where the bats foraged. Interestingly, the CLO sequences resembling Rhabdochlamydia spp. were detected in insect material as well, but the other set of CLO sequences was not, suggesting that this set might not originate from prey. Thus, bats represent another potential host for Chlamydiales and could harbor novel, previously unidentified members of this order. Several pathogenic viruses are known to colonize bats, and recent analyses indicate that bats are also reservoir hosts for bacterial genera. Chlamydia-like organisms (CLOs) have been detected in several animal species. CLOs have high 16S rRNA sequence similarity to Chlamydiaceae and exhibit similar intracellular lifestyles and biphasic developmental cycles. Our study describes the frequent occurrence of CLO DNA in bat feces, suggesting an expanding host species spectrum for the Chlamydiales As bats can acquire various infectious agents through their diet, prey insects were also studied. We identified CLO sequences in bats that matched best with sequences in prey insects but also CLO sequences not detected in prey insects. This suggests that a portion of CLO DNA present in bat feces is not prey borne. Furthermore, some sequences from bat droppings not originating from their diet might well represent novel, previously unidentified members of the Chlamydiales order. Copyright © 2016 American Society for Microbiology.

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana

PubMed Central

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe

2018-01-01

Abstract Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization. PMID:29518237

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

PubMed

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

PubMed

Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

2014-01-01

The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

Microbial Communities on Seafloor Basalts at Dorado Outcrop Reflect Level of Alteration and Highlight Global Lithic Clades

PubMed Central

Lee, Michael D.; Walworth, Nathan G.; Sylvan, Jason B.; Edwards, Katrina J.; Orcutt, Beth N.

2015-01-01

Areas of exposed basalt along mid-ocean ridges and at seafloor outcrops serve as conduits of fluid flux into and out of a subsurface ocean, and microbe–mineral interactions can influence alteration reactions at the rock–water interface. Located on the eastern flank of the East Pacific Rise, Dorado Outcrop is a site of low-temperature (<20°C) hydrothermal venting and represents a new end-member in the current survey of seafloor basalt biomes. Consistent with prior studies, a survey of 16S rRNA gene sequence diversity using universal primers targeting the V4 hypervariable region revealed much greater richness and diversity on the seafloor rocks than in surrounding seawater. Overall, Gamma-, Alpha-, and Deltaproteobacteria, and Thaumarchaeota dominated the sequenced communities, together making up over half of the observed diversity, though bacterial sequences were more abundant than archaeal in all samples. The most abundant bacterial reads were closely related to the obligate chemolithoautotrophic, sulfur-oxidizing Thioprofundum lithotrophicum, suggesting carbon and sulfur cycling as dominant metabolic pathways in this system. Representatives of Thaumarchaeota were detected in relatively high abundance on the basalts in comparison to bottom water, possibly indicating ammonia oxidation. In comparison to other sequence datasets from globally distributed seafloor basalts, this study reveals many overlapping and cosmopolitan phylogenetic groups and also suggests that substrate age correlates with community structure. PMID:26779122

Mitochondrial DNA Sequence Divergence among Meloidogyne incognita, Romanomermis culicivorax, Ascaris suum, and Caenorhabditis elegans

PubMed Central

Powers, T. O.; Harris, T. S.; Hyman, B. C.

1993-01-01

Mitochondrial DNA sequences were obtained from the NADH dehydrogenase subunit 3 (ND3), large rRNA, and cytochrome b genes from Meloidogyne incognita and Romanomermis culicivorax. Both species show considerable genetic distance within these same genes when compared with Caenorhabditis elegans or Ascaris suum, two species previously analyzed. Caenorhabditis, Ascaris, and Meloidogyne were selected as representatives of three subclasses in the nematode class Secernentea: Rhabditia, Spiruria, and Diplogasteria, respectively. Romanomermis served as a representative out-group of the class Adenophorea. The divergence between the phytoparasitic lineage (represented by Meloidogyne) and the three other species is so great that virtually every variable position in these genes appears to have accumulated multiple mutations, obscuring the phylogenetic information obtainable from these comparisons. The 39 and 42% amino acid similarity between the M. incognita and C. elegans ND3 and cytochrome b coding sequences, respectively, are approximately the same as those of C. elegans-mouse comparisons for the same genes (26 and 44%). This discovery calls into question the feasibility of employing cloned C. elegans probes as reagents to isolate phytoparasitic nematode genes. The genetic distance between the phytoparasitic nematode lineage and C. elegans markedly contrasts with the 79% amino acid similarity between C. elegans and A. suum for the same sequences. The molecular data suggest that Caenorhabditis and Ascaris belong to the same subclass. PMID:19279810

Complete Genome Sequence of Paenibacillus strain Y4.12MC10, a Novel Paenibacillus lautus strain Isolated from Obsidian Hot Spring in Yellowstone National Park

PubMed Central

Mead, David A.; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Cheng, Jan-Feng; Bruce, David C.; Goodwin, Lynne A.; Pitluck, Sam; Chertkov, Olga; Zhang, Xiaojing; Detter, John C.; Han, Cliff S.; Tapia, Roxanne; Land, Miriam; Hauser, Loren J.; Chang, Yun-juan; Kyrpides, Nikos C.; Ivanova, Natalia N.; Ovchinnikova, Galina; Woyke, Tanja; Brumm, Catherine; Hochstein, Rebecca; Schoenfeld, Thomas; Brumm, Phillip

2012-01-01

Paenibacillus sp.Y412MC10 was one of a number of organisms isolated from Obsidian Hot Spring, Yellowstone National Park, Montana, USA under permit from the National Park Service. The isolate was initially classified as a Geobacillus sp. Y412MC10 based on its isolation conditions and similarity to other organisms isolated from hot springs at Yellowstone National Park. Comparison of 16 S rRNA sequences within the Bacillales indicated that Geobacillus sp.Y412MC10 clustered with Paenibacillus species, and the organism was most closely related to Paenibacillus lautus. Lucigen Corp. prepared genomic DNA and the genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute. The genome sequence was deposited at the NCBI in October 2009 (NC_013406). The genome of Paenibacillus sp. Y412MC10 consists of one circular chromosome of 7,121,665 bp with an average G+C content of 51.2%. Comparison to other Paenibacillus species shows the organism lacks nitrogen fixation, antibiotic production and social interaction genes reported in other paenibacilli. The Y412MC10 genome shows a high level of synteny and homology to the draft sequence of Paenibacillus sp. HGF5, an organism from the Human Microbiome Project (HMP) Reference Genomes. This, combined with genomic CAZyme analysis, suggests an intestinal, rather than environmental origin for Y412MC10. PMID:23408395

Complete Genome Sequence of Paenibacillus strain Y4.12MC10, a Novel Paenibacillus lautus strain Isolated from Obsidian Hot Spring in Yellowstone National Park.

PubMed

Mead, David A; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Cheng, Jan-Feng; Bruce, David C; Goodwin, Lynne A; Pitluck, Sam; Chertkov, Olga; Zhang, Xiaojing; Detter, John C; Han, Cliff S; Tapia, Roxanne; Land, Miriam; Hauser, Loren J; Chang, Yun-Juan; Kyrpides, Nikos C; Ivanova, Natalia N; Ovchinnikova, Galina; Woyke, Tanja; Brumm, Catherine; Hochstein, Rebecca; Schoenfeld, Thomas; Brumm, Phillip

2012-07-30

Paenibacillus sp.Y412MC10 was one of a number of organisms isolated from Obsidian Hot Spring, Yellowstone National Park, Montana, USA under permit from the National Park Service. The isolate was initially classified as a Geobacillus sp. Y412MC10 based on its isolation conditions and similarity to other organisms isolated from hot springs at Yellowstone National Park. Comparison of 16 S rRNA sequences within the Bacillales indicated that Geobacillus sp.Y412MC10 clustered with Paenibacillus species, and the organism was most closely related to Paenibacillus lautus. Lucigen Corp. prepared genomic DNA and the genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute. The genome sequence was deposited at the NCBI in October 2009 (NC_013406). The genome of Paenibacillus sp. Y412MC10 consists of one circular chromosome of 7,121,665 bp with an average G+C content of 51.2%. Comparison to other Paenibacillus species shows the organism lacks nitrogen fixation, antibiotic production and social interaction genes reported in other paenibacilli. The Y412MC10 genome shows a high level of synteny and homology to the draft sequence of Paenibacillus sp. HGF5, an organism from the Human Microbiome Project (HMP) Reference Genomes. This, combined with genomic CAZyme analysis, suggests an intestinal, rather than environmental origin for Y412MC10.

Yeast diversity during the fermentation of Andean chicha: A comparison of high-throughput sequencing and culture-dependent approaches.

PubMed

Mendoza, Lucía M; Neef, Alexander; Vignolo, Graciela; Belloch, Carmela

2017-10-01

Diversity and dynamics of yeasts associated with the fermentation of Argentinian maize-based beverage chicha was investigated. Samples taken at different stages from two chicha productions were analyzed by culture-dependent and culture-independent methods. Five hundred and ninety six yeasts were isolated by classical microbiological methods and 16 species identified by RFLPs and sequencing of D1/D2 26S rRNA gene. Genetic typing of isolates from the dominant species, Saccharomyces cerevisiae, by PCR of delta elements revealed up to 42 different patterns. High-throughput sequencing (HTS) of D1/D2 26S rRNA gene amplicons from chicha samples detected more than one hundred yeast species and almost fifty filamentous fungi taxa. Analysis of the data revealed that yeasts dominated the fermentation, although, a significant percentage of filamentous fungi appeared in the first step of the process. Statistical analysis of results showed that very few taxa were represented by more than 1% of the reads per sample at any step of the process. S. cerevisiae represented more than 90% of the reads in the fermentative samples. Other yeast species dominated the pre-fermentative steps and abounded in fermented samples when S. cerevisiae was in percentages below 90%. Most yeasts species detected by pyrosequencing were not recovered by cultivation. In contrast, the cultivation-based methodology detected very few yeast taxa, and most of them corresponded with very few reads in the pyrosequencing analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lactobacillus brantae sp. nov., isolated from faeces of Canada geese (Branta canadensis).

PubMed

Volokhov, Dmitriy V; Amselle, Megan; Beck, Brian J; Popham, David L; Whittaker, Paul; Wang, Hua; Kerrigan, Elizabeth; Chizhikov, Vladimir E

2012-09-01

Three strains of lactic acid bacteria (LAB) were isolated from the faeces of apparently healthy wild Canada geese (Branta canadensis) in 2010 by cultivating faecal LAB on Rogosa SL agar under aerobic conditions. These three isolates were found to share 99.9 % gene sequence similarity of their 16S rRNA, their 16S-23S intergenic transcribed spacer region (ITS), partial 23S rRNA, rpoB, rpoC, rpoA and pheS gene sequences. However, the three strains exhibited lower levels of sequence similarity of these genetic targets to all known LAB, and the phylogenetically closest species to the geese strains were Lactobacillus casei, Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus saniviri. In comparison to L. casei ATCC 393(T), L. paracasei ATCC 25302(T), L. rhamnosus ATCC 7469(T) and L. saniviri DSM 24301(T), the novel isolates reacted uniquely in tests for cellobiose, galactose, mannitol, citric acid, aesculin and dextrin, and gave negative results in tests for l-proline arylamidase and l-pyrrolydonyl-arylamidase, and in the Voges-Proskauer test. Biochemical tests for cellobiose, aesculin, galactose, gentiobiose, mannitol, melezitose, ribose, salicin, sucrose, trehalose, raffinose, turanose, amygdalin and arbutin could be used for differentiation between L. saniviri and the novel strains. On the basis of phenotypic and genotypic characteristics, and phylogenetic data, the three isolates represent a novel species of the genus Lactobacillus, for which the name Lactobacillus brantae sp. nov. is proposed. The type strain is SL1108(T) (= ATCC BAA-2142(T) = LMG 26001(T) = DSM 23927(T)) and two additional strains are SL1170 and SL60106.

Sellimonas intestinalis gen. nov., sp. nov., isolated from human faeces.

PubMed

Seo, Boram; Yoo, Ju Eun; Lee, Yung Mi; Ko, GwangPyo

2016-02-01

A Gram-stain-positive and obligately anaerobic bacterial strain, BR72 T , forming ivory yellow colonies was isolated from a faecal sample of a healthy Korean woman. 16S rRNA gene sequence analysis indicated that strain BR72 T belongs to Clostridium cluster XIVa and represents a distinct phyletic line within the family Lachnospiraceae . The most closely related strains were Clostridium nexile DSM 1787 T (94.1 % 16S rRNA gene sequence similarity), Coprococcus comes ATCC 27758 T (93.5 %), Ruminococcus torques ATCC 27756 T (93.5 %), Ruminococcus lactaris ATCC 29176 T (93.5 %), Clostridium aerotolerans DSM 5434 T (93.1 %) and Eubacterium fissicatena DSM 3598 T (92.9 %). The DNA G+C content of strain BR72 T based on its genome sequence was 45.3 mol%. The major cellular fatty acids were C 16 : 0 , C 14 : 0 , and iso-C 17 : 1 I and/or anteiso-C 17 : 1 B. Acetic acid was produced from glucose fermentation. Other physiological and biochemical comparisons allowed the phenotypic differentiation of strain BR72 T from the members of the family Lachnospiraceae . Based on the phylogenetic and phenotypic findings, this strain is considered to represent a novel species of a new genus belonging to the family Lachnospiraceae and the name Sellimonas intestinalis gen. nov., sp. nov. is proposed. The type strain of Sellimonas intestinalis is BR72 T ( = KCTC 15479 T  = JCM 30749 T ).

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome

PubMed Central

Durham, Bryndan P.; Grote, Jana; Whittaker, Kerry A.; Bender, Sara J.; Luo, Haiwei; Grim, Sharon L.; Brown, Julia M.; Casey, John R.; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M.; Mine, Aric H.; Nigro, Olivia D.; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K.; Weber, Thomas S.; Wilson, Jesse M.; Church, Matthew J.; DeLong, Edward F.; Karl, David M.; Steward, Grieg F.; Eppley, John M.; Kyrpides, Nikos C.; Schuster, Stephan; Rappé, Michael S.

2014-01-01

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters. PMID:25197450

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome.

PubMed

Durham, Bryndan P; Grote, Jana; Whittaker, Kerry A; Bender, Sara J; Luo, Haiwei; Grim, Sharon L; Brown, Julia M; Casey, John R; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M; Mine, Aric H; Nigro, Olivia D; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K; Weber, Thomas S; Wilson, Jesse M; Church, Matthew J; DeLong, Edward F; Karl, David M; Steward, Grieg F; Eppley, John M; Kyrpides, Nikos C; Schuster, Stephan; Rappé, Michael S

2014-06-15

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters.

Complete mitochondrial genome of the frillneck lizard (Chlamydosaurus kingii, Reptilia; Agamidae), another squamate with two control regions.

PubMed

Ujvari, Beata; Madsen, Thomas

2008-10-01

Using PCR, the complete mitochondrial genome was sequenced in three frillneck lizards (Chlamydosaurus kingii). The mitochondria spanned over 16,761bp. As in other vertebrates, two rRNA genes, 22 tRNA genes and 13 protein coding genes were identified. However, similar to some other squamate reptiles, two control regions (CRI and CRII) were identified, spanning 801 and 812 bp, respectively. Our results were compared with another Australian member of the family Agamidae, the bearded dragon (Pogana vitticeps). The overall base composition of the light-strand sequence largely mirrored that observed in P vitticeps. Furthermore, similar to P. vitticeps, we observed an insertion 801 bp long between the ND5 and ND6 genes. However, in contrast to P vitticeps we did not observe a conserved sequence block III region. Based on a comparison among the three frillneck lizards, we also present data on the proportion of variable sites within the major mitochondrial regions.

Detection and quantification of Plasmodium falciparum in blood samples using quantitative nucleic acid sequence-based amplification.

PubMed

Schoone, G J; Oskam, L; Kroon, N C; Schallig, H D; Omar, S A

2000-11-01

A quantitative nucleic acid sequence-based amplification (QT-NASBA) assay for the detection of Plasmodium parasites has been developed. Primers and probes were selected on the basis of the sequence of the small-subunit rRNA gene. Quantification was achieved by coamplification of the RNA in the sample with one modified in vitro RNA as a competitor in a single-tube NASBA reaction. Parasite densities ranging from 10 to 10(8) Plasmodium falciparum parasites per ml could be demonstrated and quantified in whole blood. This is approximately 1,000 times more sensitive than conventional microscopy analysis of thick blood smears. Comparison of the parasite densities obtained by microscopy and QT-NASBA with 120 blood samples from Kenyan patients with clinical malaria revealed that for 112 of 120 (93%) of the samples results were within a 1-log difference. QT-NASBA may be especially useful for the detection of low parasite levels in patients with early-stage malaria and for the monitoring of the efficacy of drug treatment.

Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria.

PubMed

Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A

2002-11-01

Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).

Detection and molecular status of Isospora sp. from the domestic pigeon (Columba livia domestica).

PubMed

Matsubara, Ryuma; Fukuda, Yasuhiro; Murakoshi, Fumi; Nomura, Osamu; Suzuki, Toru; Tada, Chika; Nakai, Yutaka

2017-10-01

The domestic pigeon, Columba livia domestica, is reared for meat production, as a pet, or for racing. Few reports have characterized the parasitic protists from the genus Isospora isolated from Columbiformes. We detected Isospora-like oocysts from C. livia reared for racing. The oocyst contained two sporocysts, and each sporocyst included four sporozoites. The sporulated oocysts (n=4) were spherical; their mean diameters were 25.6 (24.0-27.2)×24.7 (23.4-26.0) μm. Micropyles, polar granules, and oocyst residuum were absent. The mean length and width of the sporocysts (n=8) were 19.5 (18.5-20.5) and 11.2 (10.2-12.1) μm, respectively. Stieda and sub-Stieda bodies were observed. Single-oocyst PCR revealed two different 18S rRNA gene sequences and one 28S rRNA gene sequence in a single oocyst of Isospora sp. Based on a phylogenetic analysis of the 18S rRNA gene, the two sequences made a group which fell within a cluster of known avian Isospora species. A tree based on the 28S rRNA gene sequence indicated that sequences from the pigeon Isospora sp. fell within a cluster of avian Isospora species. Both trees failed to clarify the phylogenetic relationships among the avian Isospora species due to limited resolution. Because the morphological description of Isospora sp. is based on only four oocysts, Isospora sp. is not proposed as a novel species here. This is the first description of Isospora sp. isolated from the domestic pigeon C. livia. Copyright © 2017 Elsevier B.V. All rights reserved.

Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

PubMed Central

Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

2012-01-01

Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

Group 16SrXI phytoplasma strains, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D, are associated with sugar cane white leaf.

PubMed

Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong

2016-01-01

Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Occurrence and characterization of hitherto unknown Streptomyces species in semi-arid soils.

PubMed

Kumar, Surendra; Priya, E; Singh Solanki, Dilip; Sharma, Ruchika; Gehlot, Praveen; Pathak, Rakesh; Singh, S K

2016-09-01

Streptomyces the predominant genus of Actinobacteria and plays an important role in the recycling of soil organic matter and production of important secondary metabolites. The occurrence and diversity assessment of Streptomyces species revealed alkaline and poor nutrient status of soils of semi-arid region of Jodhpur, Rajasthan. The morphological and biochemical characterization of 21 Streptomyces isolates facilitated Genus level identification but were insufficient to designate species. Species designation based on 16S rRNA gene delineated 21 isolates into 14 Streptomyces species. Upon BLAST search, the test isolates exhibited 98 to 100% identities with that of the best aligned sequences of the NCBI database. The GC content of 16S rRNA gene sequences of all the Streptomyces isolates tested ranged from 59.03% to 60.94%. The multiple sequence alignment of all the 21 Streptomyces isolates generated a phylogram with high bootstrap values indicating reliable grouping of isolates based on nucleotide sequence variations by way of insertion, deletion and substitutions and 16S rRNA length polymorphism. Some of the Streptomyces species molecularly identified under present study are reported for the first time from semi-arid region of Jodhpur.

Protistan diversity and activity inferred from RNA and DNA at a coastal ocean site in the eastern North Pacific.

PubMed

Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A

2016-04-01

Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

PubMed

Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

2007-01-01

In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE PAGES

Brumm, Phillip; Land, Miriam L.; Mead, David

2016-04-27

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

Evolutionary relationships of a plant-pathogenic mycoplasmalike organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences.

PubMed Central

Lim, P O; Sears, B B

1992-01-01

The families within the class Mollicutes are distinguished by their morphologies, nutritional requirements, and abilities to metabolize certain compounds. Biosystematic classification of the plant-pathogenic mycoplasmalike organisms (MLOs) has been difficult because these organisms have not been cultured in vitro, and hence their nutritional requirements have not been determined nor have physiological characterizations been possible. To investigate the evolutionary relationship of the MLOs to other members of the class Mollicutes, a segment of a ribosomal protein operon was cloned and sequenced from an aster yellows-type MLO which is pathogenic for members of the genus Oenothera and from Acholeplasma laidlawii. The deduced amino acid sequence data from the rpl22 and rps3 genes indicate that the MLOs are more closely related to A. laidlawii than to animal mycoplasmas, confirming previous results from 16S rRNA sequence comparisons. This conclusion is also supported by the finding that the UGA codon is not read as a tryptophan codon in the MLO and A. laidlawii, in contrast to its usage in Mycoplasma capricolum. PMID:1556079

Complete genome sequence of "Thiodictyon syntrophicum" sp. nov. strain Cad16T, a photolithoautotrophic purple sulfur bacterium isolated from the alpine meromictic Lake Cadagno.

PubMed

Luedin, Samuel M; Pothier, Joël F; Danza, Francesco; Storelli, Nicola; Frigaard, Niels-Ulrik; Wittwer, Matthias; Tonolla, Mauro

2018-01-01

" Thiodictyon syntrophicum" sp. nov. strain Cad16 T is a photoautotrophic purple sulfur bacterium belonging to the family of Chromatiaceae in the class of Gammaproteobacteria . The type strain Cad16 T was isolated from the chemocline of the alpine meromictic Lake Cadagno in Switzerland. Strain Cad16 T represents a key species within this sulfur-driven bacterial ecosystem with respect to carbon fixation. The 7.74-Mbp genome of strain Cad16 T has been sequenced and annotated. It encodes 6237 predicted protein sequences and 59 RNA sequences. Phylogenetic comparison based on 16S rRNA revealed that Thiodictyon elegans strain DSM 232 T the most closely related species. Genes involved in sulfur oxidation, central carbon metabolism and transmembrane transport were found. Noteworthy, clusters of genes encoding the photosynthetic machinery and pigment biosynthesis are found on the 0.48 Mb plasmid pTs485. We provide a detailed insight into the Cad16 T genome and analyze it in the context of the microbial ecosystem of Lake Cadagno.

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brumm, Phillip; Land, Miriam L.; Mead, David

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

The structural analysis of the mitochondrial SSUrRNA implies a close phylogenetic relationship between mitochondria from plants and from the heterotrophic alga Prototheca wickerhamii.

PubMed

Wolff, G; Kück, U

1990-04-01

The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.

Molecular detection of feline hemoplasmas in feral cats in Korea.

PubMed

Yu, Do-Hyeon; Kim, Hyun-Wook; Desai, Atul R; Han, In-Ae; Li, Ying-Hua; Lee, Mi-Jin; Kim, In-Shik; Chae, Joon-Seok; Park, Jinho

2007-12-01

The purpose of this study was to determine if Mycoplasma haemofelis, 'Candidatus Mycoplasma haemominutum' exist in Korea. Three hundreds and thirty one feral cats were evaluated by using PCR assay targeting 16S rRNA gene sequence. Fourteen cats (4.2%) were positive for M. haemofelis, 34 cats (10.3%) were positive for 'Candidatus M. haemominutum' and 18 cats (5.4%) were positive for both species. Partial 16S rRNA gene sequences were closely (>98%) related to those from other countries. This is the first molecular detection of feline hemoplasmas in Korea.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

Purpura fulminans mimicking toxic epidermal necrolysis - additional value of 16S rRNA sequencing and skin biopsy.

PubMed

Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M

2017-05-01

Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.

18S rRNA data indicate that Aschelminthes are polyphyletic in origin and consist of at least three distinct clades.

PubMed

Winnepenninckx, B; Backeljau, T; Mackey, L Y; Brooks, J M; De Wachter, R; Kumar, S; Garey, J R

1995-11-01

The Aschelminthes is a collection of at least eight animal phyla, historically grouped together because the absence of a true body cavity was perceived as a pseudocoelom. Analyses of 18S rRNA sequences from six Aschelminth phyla (including four previously unpublished sequences) support polyphyly for the Aschelminthes. At least three distinct groups of Aschelminthes were detected: the Priapulida among the protostomes, the Rotifera-Acanthocephala as a sister group to the protostomes, and the Nematoda as a basal group to the triploblastic Eumetazoa.

Actinomyces gaoshouyii sp. nov., isolated from plateau pika (Ochotona curzoniae).

PubMed

Meng, Xiangli; Wang, Yiting; Lu, Shan; Lai, Xin-He; Jin, Dong; Yang, Jing; Xu, Jianguo

2017-09-01

Two strains (pika_113T and pika_114) of a previously undescribed Actinomyces-like bacterium were recovered from the intestinal contents of plateau pika (Ochotona curzoniae) on the Tibet-Qinghai Plateau, China. Results from biochemical characterization indicated that the two strains were phenotypically homogeneous and distinct from other previously described species of the genus Actinomyces. Based on the comparison of 16S rRNA gene sequences and genome analysis, the bacteria were determined to be a hitherto unknown subline within the genus Actinomyces, being most closely related to type strains of Actinomyces denticolens and Actinomyces timonensis with a respective 97.2 and 97.1 % similarity in their 16S rRNA gene sequences. Phylogenetic analyses confirmed that pika_113T was well separated from any other recognized species of the genus Actinomyces and within the cluster with A. denticolens and A. timonensis. The genome of strain pika_113T displayed less than 42 % relatedness in DNA-DNA hybridization with all the available genomes of existing species of the genus Actinomyces in the NCBI database. Collectively, based on the phenotypic characteristics and phylogenetic analyses results, we propose the novel isolates as representatives of Actinomyces gaoshouyii sp. nov. The type strain of Actinomyces gaoshouyii is pika_113T (=CGMCC 4.7372T=DSM 104049T), with a genomic DNA G+C content of 71 mol%.

Natronolimnobius baerhuensis gen. nov., sp. nov. and Natronolimnobius innermongolicus sp. nov., novel haloalkaliphilic archaea isolated from soda lakes in Inner Mongolia, China.

PubMed

Itoh, Takashi; Yamaguchi, Takashi; Zhou, Peijin; Takashina, Tomonori

2005-04-01

Three novel isolates of haloalkaliphilic archaea, strains IHC-005T, IHC-010, and N-1311T, from soda lakes in Inner Mongolia, China, were characterized to elucidate their taxonomic positions. The three strains were aerobic, Gram-negative chemoorganotrophs growing optimally at 37-45 degrees C, pH 9.0-9.5, and 15-20% NaCl. Cells of strains IHC-005T/IHC-010 were motile rods, while those of strain N-1311T were non-motile pleomorphic flats or cocci. The three strains contained diphytanyl and phytanyl-sesterterpanyl diether derivatives of phosphatidylglycerol and phosphatidylglycerophosphate methyl ester. No glycolipids were detected. On phylogenetic analysis of 16S rRNA gene sequences, they formed an independent cluster in the Natro group of the family Halobacteriaceae. Comparison of their morphological, physiological, and biochemical properties, DNA G + C content and 16S rRNA gene sequences, and DNA-DNA hybridization study support the view that strains IHC-005T/IHC-010 and strain N-1311T represent separate species. Therefore, we propose Natronolimnobius baerhuensis gen. nov., sp. nov. for strains IHC-005T (=CGMCC 1.3597T =JCM 12253T)/IHC-010 (=CGMCC 1.3598 = JCM 12254) and Natronolimnobius innermongolicus sp. nov. for N-1311T (=CGMCC 1.2124T =JCM 12255T).

Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

PubMed

Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

2015-10-29

Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

PubMed

Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

2015-01-01

DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

hsp65 PCR-restriction analysis (PRA) with capillary electrophoresis in comparison to three other methods for identification of Mycobacterium species.

PubMed

Sajduda, Anna; Martin, Anandi; Portaels, Françoise; Palomino, Juan Carlos

2010-02-01

We developed a scheme for rapid identification of Mycobacterium species using an automated fluorescence capillary electrophoresis instrument. A 441-bp region of the hsp65 gene was examined using PCR-restriction analysis (PRA). The assay was initially evaluated on 38 reference strains. The observed sizes of restriction fragments were consistently smaller than the real sizes for each of the species as deduced from the sequence analysis (mean variance=7bp). Nevertheless, the obtained PRA patterns were highly reproducible and resulted in correct species identifications. A blind test was then successfully performed on 64 test isolates previously characterized by conventional biochemical methods, a commercial INNO-LiPA Mycobacteria assay and/or sequence determination of the 5' end of 16S rRNA gene. A total of 14 of 64 isolates were erroneously identified by conventional methods (78% accuracy). In contrast, PRA performed very well in comparison with the LiPA (89% concordance) and especially with DNA sequencing (93.3% of concordant results). Also, PRA identified seven isolates representing five previously unreported hsp65 alleles. We conclude that hsp65 PRA based on automated capillary electrophoresis is a rapid, simple and reliable method for identification of mycobacteria. Copyright 2010 Elsevier B.V. All rights reserved.

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags

PubMed Central

2010-01-01

Intense interest centers on the role of the human gut microbiome in health and disease, but optimal methods for analysis are still under development. Here we present a study of methods for surveying bacterial communities in human feces using 454/Roche pyrosequencing of 16S rRNA gene tags. We analyzed fecal samples from 10 individuals and compared methods for storage, DNA purification and sequence acquisition. To assess reproducibility, we compared samples one cm apart on a single stool specimen for each individual. To analyze storage methods, we compared 1) immediate freezing at -80°C, 2) storage on ice for 24 or 3) 48 hours. For DNA purification methods, we tested three commercial kits and bead beating in hot phenol. Variations due to the different methodologies were compared to variation among individuals using two approaches--one based on presence-absence information for bacterial taxa (unweighted UniFrac) and the other taking into account their relative abundance (weighted UniFrac). In the unweighted analysis relatively little variation was associated with the different analytical procedures, and variation between individuals predominated. In the weighted analysis considerable variation was associated with the purification methods. Particularly notable was improved recovery of Firmicutes sequences using the hot phenol method. We also carried out surveys of the effects of different 454 sequencing methods (FLX versus Titanium) and amplification of different 16S rRNA variable gene segments. Based on our findings we present recommendations for protocols to collect, process and sequence bacterial 16S rDNA from fecal samples--some major points are 1) if feasible, bead-beating in hot phenol or use of the PSP kit improves recovery; 2) storage methods can be adjusted based on experimental convenience; 3) unweighted (presence-absence) comparisons are less affected by lysis method. PMID:20673359

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Evaluation of the Bacterial Diversity in the Human Tongue Coating Based on Genus-Specific Primers for 16S rRNA Sequencing.

PubMed

Sun, Beili; Zhou, Dongrui; Tu, Jing; Lu, Zuhong

2017-01-01

The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis.

Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

PubMed Central

2012-01-01

Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

PubMed

Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J

2016-01-01

There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a clinical protocol.

How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys

PubMed Central

Berney, Cédric; Fahrni, José; Pawlowski, Jan

2004-01-01

Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

Thermanaeromonas burensis sp. nov., a thermophilic anaerobe isolated from a subterranean clay environment.

PubMed

Gam, Zouhaier Ben Ali; Daumas, Sylvie; Casalot, Laurence; Bartoli-Joseph, Manon; Necib, Sophia; Linard, Yannick; Labat, Marc

2016-01-01

A strictly anaerobic, thermophilic and halotolerant strain, designated IA106T, was isolated from the seepage water collected in a metal biocorrosion test at a depth of 490 m, in a 130-160 m thick, subterranean Callovo-Oxfordian clay formation (158-152 million years old) in northern France. This geological formation has been selected as the potential host rock for the French high-level nuclear waste repository. Cells of strain IA106T stained Gram-positive and were non-motile, spore-forming, straight rods (0.5 × 2-6 μm). The five major fatty acids were C16 : 0 (15.9 %), C18 : 0 (15.4 %), iso-C17 : 1 I and/or anteiso-C17 : 1 B(14.8 %), iso-C17 : 0 (14.7 %) and iso-C15 : 0 (13.0 %). Growth was observed at temperatures ranging from 55 to 70 °C and at pH 5.5-9. The salinity range for growth was 0-20 g NaCl 1- 1. Yeast extract was required for growth. Strain IA106T was able to grow on lactate and various sugars in the presence of thiosulfate as electron acceptor. Sulfate, sulfite, elemental sulfur, fumarate, nitrate and nitrite were not reduced. The DNA G+C content was 60.2 mol%. 16S rRNA gene sequence analysis indicated that strain IA106T belonged to the family Thermoanaerobacteraceae, class Clostridia, phylum Firmicutes, and was most closely related to Thermanaeromonas toyohensis DSM 14490T (95.16 % 16S rRNA gene sequence similarity). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain IA106T represents a novel species of the genus Thermanaeromonas, for which the name Thermanaeromonas burensis sp. nov. is proposed. The type strain is IA106T ( = DSM 26576T = JCM 18718T).

Meta-analysis To Define a Core Microbiota in the Swine Gut

PubMed Central

Holman, Devin B.; Brunelle, Brian W.; Trachsel, Julian

2017-01-01

ABSTRACT The swine gut microbiota encompasses a large and diverse population of bacteria that play a significant role in pig health. As such, a number of recent studies have utilized high-throughput sequencing of the 16S rRNA gene to characterize the composition and structure of the swine gut microbiota, often in response to dietary feed additives. It is important to determine which factors shape the composition of the gut microbiota among multiple studies and if certain bacteria are always present in the gut microbiota of swine, independently of study variables such as country of origin and experimental design. Therefore, we performed a meta-analysis using 20 publically available data sets from high-throughput 16S rRNA gene sequence studies of the swine gut microbiota. Next to the “study” itself, the gastrointestinal (GI) tract section that was sampled had the greatest effect on the composition and structure of the swine gut microbiota (P = 0.0001). Technical variation among studies, particularly the 16S rRNA gene hypervariable region sequenced, also significantly affected the composition of the swine gut microbiota (P = 0.0001). Despite this, numerous commonalities were discovered. Among fecal samples, the genera Prevotella, Clostridium, Alloprevotella, and Ruminococcus and the RC9 gut group were found in 99% of all fecal samples. Additionally, Clostridium, Blautia, Lactobacillus, Prevotella, Ruminococcus, Roseburia, the RC9 gut group, and Subdoligranulum were shared by >90% of all GI samples, suggesting a so-called “core” microbiota for commercial swine worldwide. IMPORTANCE The results of this meta-analysis demonstrate that “study” and GI sample location are the most significant factors in shaping the swine gut microbiota. However, in comparisons of results from different studies, some biological factors may be obscured by technical variation among studies. Nonetheless, there are some bacterial taxa that appear to form a core microbiota within the swine GI tract regardless of country of origin, diet, age, or breed. Thus, these results provide the framework for future studies to manipulate the swine gut microbiota for potential health benefits. PMID:28567446

Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

PubMed

Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

2013-03-01

Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639

Isolation and Distribution of a Novel Iron-Oxidizing Crenarchaeon from Acidic Geothermal Springs in Yellowstone National Park▿ †

PubMed Central

Kozubal, M.; Macur, R. E.; Korf, S.; Taylor, W. P.; Ackerman, G. G.; Nagy, A.; Inskeep, W. P.

2008-01-01

Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75°C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65°C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80°C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP. PMID:18083851

Cactodera chenopodiae (Nematoda: Heteroderidae), a new species of cyst nematode parasitizing common lambsquarter (Chenopodium album) in Liaoning, China.

PubMed

Feng, Yaxing; Wang, Dong; Xiao, Dongxue; Pereira, Tiago josÉ; Xuan, Yuanhu; Wang, Yuanyuan; Liu, Xiaoyu; Chen, Lijie; Duan, Yuxi; Zhu, Xiaofeng

2018-04-11

A new species of cyst nematode, Cactodera chenopodiae n. sp., parasitizing common lambsquarter, Chenopodium album L., is described from native vegetation in Liaoning, China. Cactodera chenopodiae n. sp. has a circumfenestrate pattern typical of the genus and is morphologically similar to C. cacti Krall Krall, 1978. However, in the new species, females and cysts show a larger L/W ratio whereas second-stage juveniles (J2s) have a longer hyaline region. The new species is also morphologically similar to C. milleri Graney Bird, 1990, but the J2s differ by a larger b ratio and longer tail. Based on DNA sequences of the 28S and ITS rRNA, C. chenopodiae n. sp. comes close to C. estonica Krall Krall, 1978, although it is distinct from the latter with respect to the presence of a punctate eggshell and larger b ratio in the J2s. Although morphometric comparisons with additional Cactodera species show the overlapping of diagnostic morphological characters, our phylogenetic analyses based on both rRNA genes support C. chenopodiae n. sp. as a unique lineage.

Description of Kribbella italica sp. nov., isolated from a Roman catacomb.

PubMed

Everest, Gareth J; Curtis, Sarah M; De Leo, Filomena; Urzì, Clara; Meyers, Paul R

2015-02-01

A novel actinobacterium, strain BC637(T), was isolated from a biodeteriogenic biofilm sample collected in 2009 in the Saint Callixstus Roman catacomb. The strain was found to belong to the genus Kribbella by analysis of the 16S rRNA gene. Phylogenetic analysis using the 16S rRNA gene and the gyrB, rpoB, relA, recA and atpD concatenated gene sequences showed that strain BC637(T) was most closely related to the type strains of Kribbella lupini and Kribbella endophytica. DNA-DNA hybridization experiments confirmed that strain BC637(T) is a genomic species that is distinct from its closest phylogenetic relatives, K. endophytica DSM 23718(T) (63 % DNA relatedness) and K. lupini LU14(T) (63 % DNA relatedness). Physiological comparisons showed that strain BC637(T) is phenotypically distinct from the type strains of K. endophytica and K. lupini. Thus, strain BC637(T) represents the type strain of a novel species, for which the name Kribella italica sp. nov. is proposed ( = DSM 28967(T) = NRRL B-59155(T)). © 2015 IUMS.

A meta-analysis of bacterial diversity in the feces of cattle

USDA-ARS?s Scientific Manuscript database

In this study, we conducted a meta-analysis on 16S rRNA gene sequences of bovine fecal origin that are publicly available in the RDP database. A total of 13663 sequences including 603 isolate sequences were identified in the RDP database (Release 11, Update 1), where 13447 sequences were assigned t...

Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

PubMed

Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

2016-09-01

Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

Post-transcriptional modifications in the small subunit ribosomal RNA from Thermotoga maritima, including presence of a novel modified cytidine

PubMed Central

Guymon, Rebecca; Pomerantz, Steven C.; Ison, J. Nicholas; Crain, Pamela F.; McCloskey, James A.

2007-01-01

Post-transcriptional modifications of RNA are nearly ubiquitous in the principal RNAs involved in translation. However, in the case of rRNA the functional roles of modification are far less established than for tRNA, and are subject to less knowledge in terms of specific nucleoside identities and their sequence locations. Post-transcriptional modifications have been studied in the SSU rRNA from Thermotoga maritima (optimal growth 80°C), one of the most deeply branched organisms in the Eubacterial phylogenetic tree. A total of 10 different modified nucleosides were found, the greatest number reported for bacterial SSU rRNA, occupying a net of ∼14 sequence sites, compared with a similar number of sites recently reported for Thermus thermophilus and 11 for Escherichia coli. The relatively large number of modifications in Thermotoga offers modest support for the notion that thermophile rRNAs are more extensively modified than those from mesophiles. Seven of the Thermotoga modified sites are identical (location and identity) to those in E. coli. An unusual derivative of cytidine was found, designated N-330 (M r 330.117), and was sequenced to position 1404 in the decoding region of the rRNA. It was unexpectedly found to be identical to an earlier reported nucleoside of unknown structure at the same location in the SSU RNA of the archaeal mesophile Haloferax volcanii. PMID:17255199

A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

PubMed

Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

2010-05-01

To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples

PubMed Central

de Vries, Michel; Deijs, Martin; Canuti, Marta; van Schaik, Barbera D. C.; Faria, Nuno R.; van de Garde, Martijn D. B.; Jachimowski, Loes C. M.; Jebbink, Maarten F.; Jakobs, Marja; Luyf, Angela C. M.; Coenjaerts, Frank E. J.; Claas, Eric C. J.; Molenkamp, Richard; Koekkoek, Sylvie M.; Lammens, Christine; Leus, Frank; Goossens, Herman; Ieven, Margareta; Baas, Frank; van der Hoek, Lia

2011-01-01

In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material. PMID:21283679

[Methods, challenges and opportunities for big data analyses of microbiome].

PubMed

Sheng, Hua-Fang; Zhou, Hong-Wei

2015-07-01

Microbiome is a novel research field related with a variety of chronic inflamatory diseases. Technically, there are two major approaches to analysis of microbiome: metataxonome by sequencing the 16S rRNA variable tags, and metagenome by shot-gun sequencing of the total microbial (mainly bacterial) genome mixture. The 16S rRNA sequencing analyses pipeline includes sequence quality control, diversity analyses, taxonomy and statistics; metagenome analyses further includes gene annotation and functional analyses. With the development of the sequencing techniques, the cost of sequencing will decrease, and big data analyses will become the central task. Data standardization, accumulation, modeling and disease prediction are crucial for future exploit of these data. Meanwhile, the information property in these data, and the functional verification with culture-dependent and culture-independent experiments remain the focus in future research. Studies of human microbiome will bring a better understanding of the relations between the human body and the microbiome, especially in the context of disease diagnosis and therapy, which promise rich research opportunities.

Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines.

PubMed

Mapalo, Marc A; Stec, Daniel; Mirano-Bascos, Denise; Michalczyk, Łukasz

2016-06-20

The limnoterrestrial tardigrade fauna of the Philippines is completely unknown. In this paper, we describe the first ever limnoterrestrial water bear species from this southeast Asian country, Mesobiotus philippinicus sp. nov., found in a moss sample collected in Quezon City. Apart from morphometrics and imaging in light microscopy, we also analysed the new species under scanning electron microscope and sequenced four DNA markers differing in mutation rates, three nuclear (18S rRNA, 28S rRNA, and ITS-2) and one mitochondrial (COI). This allowed not only a detailed description but also provided barcodes to aid future species identification. The new species belongs to the harmsworthi group and is most similar to M. diffusus (Binda & Pilato, 1987), M. pseudocoronatus (Pilato et al., 2006), M. montanus (Murray, 1910) and M. mottai (Binda & Pilato, 1994), but differs from these species by whorled egg processes and dimensions of some morphometric traits. The 28S rRNA, ITS-2 and COI sequences presented in this paper are the first published DNA sequences for the genus Mesobiotus.

Pseudopropionibacterium sp. nov., a novel red-pigmented species isolated from human gingival sulcus.

PubMed

Saito, Masanori; Shinozaki-Kuwahara, Noriko; Tsudukibashi, Osamu; Hashizume-Takizawa, Tomomi; Kobayashi, Ryoki; Kurita-Ochiai, Tomoko

2018-04-24

Strain SK-1 T is a novel Gram stain-positive, pleomorphic, rod-shaped, non-spore forming, and non-motile organism, designated SK-1 T , isolated from human gingival sulcus that produces acetic acid, propionic acid, lactic acid, and succinic acid as end products of glucose fermentation. Strain SK-1 T had the closest relatedness to Pseudopropionibacterium (Propionibacterium) propionicum with sequence homologies of the 16S rRNA and RNA polymerase β subunit (rpoB) genes of 96.6% and 93.1%, respectively. The genomic DNA G + C content of the isolate was 61.8 mol%. Based on the sequence data of the 16S rRNA and housekeeping (rpoB) genes, we propose a novel taxon, Pseudopropionibacterium rubrum sp. nov. (type strain SK-1 T = JCM 31317T= DSM 100122T). The 16S rRNA and rpoB gene sequences of strain SK-1 T were deposited to the DNA Data Bank of Japan under the accession numbers LC002971 and LC102236, respectively. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

High abundance of JS-1- and Chloroflexi-related Bacteria in deeply buried marine sediments revealed by quantitative, real-time PCR.

PubMed

Blazejak, Anna; Schippers, Axel

2010-05-01

Sequences of members of the bacterial candidate division JS-1 and the classes Anaerolineae and Caldilineae of the phylum Chloroflexi are frequently found in 16S rRNA gene clone libraries obtained from marine sediments. Using a newly designed quantitative, real-time PCR assay, these bacterial groups were jointly quantified in samples from near-surface and deeply buried marine sediments from the Peru margin, the Black Sea, and a forearc basin off the island of Sumatra. In near-surface sediments, sequences of the JS-1 as well as Anaerolineae- and Caldilineae-related Bacteria were quantified with significantly lower 16S rRNA gene copy numbers than the sequences of total Bacteria. In contrast, in deeply buried sediments below approximately 1 m depth, similar quantities of the 16S rRNA gene copies of these specific groups and Bacteria were found. This finding indicates that JS-1 and Anaerolineae- and Caldilineae-related Bacteria might dominate the bacterial community in deeply buried marine sediments and thus seem to play an important ecological role in the deep biosphere.

Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos) Shown with 16S rRNA Gene-Based Microbial Community Analysis

PubMed Central

Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

2013-01-01

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms. PMID:24058905

Population abundance of potentially pathogenic organisms in intestinal microbiome of jungle crow (Corvus macrorhynchos) shown with 16S rRNA gene-based microbial community analysis.

PubMed

Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

2013-01-01

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

PubMed

Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

2017-05-01

Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

Characterization and Screening of Native Scenedesmus sp. Isolates Suitable for Biofuel Feedstock.

PubMed

Gour, Rakesh Singh; Chawla, Aseem; Singh, Harvinder; Chauhan, Rajinder Singh; Kant, Anil

2016-01-01

In current study isolates of two native microalgae species were screened on the basis of growth kinetics and lipid accumulation potential. On the basis of data obtained on growth parameters and lipid accumulation, it is concluded that Scenedesmus dimorphus has better potential as biofuel feedstock. Two of the isolates of Scenedesmus dimorphus performed better than other isolates with respect to important growth parameters with lipid content of ~30% of dry biomass. Scenedesmus dimorphus was found to be more suitable as biodiesel feedstock candidate on the basis of cumulative occurrence of five important biodiesel fatty acids, relative occurrence of SFA (53.04%), MUFA (23.81%) and PUFA (19.69%), and more importantly that of oleic acid in its total lipids. The morphological observations using light and Scanning Electron Microscope and molecular characterization using amplified 18S rRNA gene sequences of microalgae species under study were also performed. Amplified 18S rRNA gene fragments of the microalgae species were sequenced, annotated at the NCBI website and phylogenetic analysis was done. We have published eight 18S rRNA gene sequences of microalgae species in NCBI GenBank.