Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

PubMed

Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

2013-12-01

Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

Phylogenetic Diversity of Bacteria Associated with the Marine Sponge Rhopaloeides odorabile†

PubMed Central

Webster, Nicole S.; Wilson, Kate J.; Blackall, Linda L.; Hill, Russell T.

2001-01-01

Molecular techniques were employed to document the microbial diversity associated with the marine sponge Rhopaloeides odorabile. The phylogenetic affiliation of sponge-associated bacteria was assessed by 16S rRNA sequencing of cloned DNA fragments. Fluorescence in situ hybridization (FISH) was used to confirm the presence of the predominant groups indicated by 16S rDNA analysis. The community structure was extremely diverse with representatives of the Actinobacteria, low-G+C gram-positive bacteria, the β- and γ-subdivisions of the Proteobacteria, Cytophaga/Flavobacterium, green sulfur bacteria, green nonsulfur bacteria, planctomycetes, and other sequence types with no known close relatives. FISH probes revealed the spatial location of these bacteria within the sponge tissue, in some cases suggesting possible symbiotic functions. The high proportion of 16S rRNA sequences derived from novel actinomycetes is good evidence for the presence of an indigenous marine actinomycete assemblage in R. odorabile. High microbial diversity was inferred from low duplication of clones in a library with 70 representatives. Determining the phylogenetic affiliation of sponge-associated microorganisms by 16S rRNA analysis facilitated the rational selection of culture media and isolation conditions to target specific groups of well-represented bacteria for laboratory culture. Novel media incorporating sponge extracts were used to isolate bacteria not previously recovered from this sponge. PMID:11133476

Ribosomal RNA gene detection and targeted culture of novel nitrogen-responsive fungal taxa from temperate pine forest soil.

PubMed

Hesse, Cedar N; Torres-Cruz, Terry J; Tobias, Terri Billingsley; Al-Matruk, Maryam; Porras-Alfaro, Andrea; Kuske, Cheryl R

Soil fungal communities are responsible for carbon and nitrogen (N) cycling. The high complexity of the soil fungal community and the high proportion of taxonomically unidentifiable sequences confound ecological interpretations in field studies because physiological information is lacking for many organisms known only by their rRNA sequences. This situation forces experimental comparisons to be made at broader taxonomic racks where functions become difficult to infer. The objective of this study was to determine OTU (operational taxonomic units) level responses of the soil fungal community to N enrichment in a temperate pine forest experiment and to use the sequencing data to guide culture efforts of novel N-responsive fungal taxa. Replicate samples from four soil horizons (up to 10 cm depth) were obtained from ambient, enriched CO 2 and N-fertilization plots. Through a fungal large subunit rRNA gene (LSU) sequencing survey, we identified two novel fungal clades that were abundant in our soil sampling (representing up to 27% of the sequences in some samples) and responsive to changes in soil N. The two N-responsive taxa with no predicted taxonomic association were targeted for isolation and culturing from specific soil samples where their sequences were abundant. Representatives of both OTUs were successfully cultured using a filtration approach. One taxon (OTU6) was most closely related to Saccharomycotina; the second taxon (OTU69) was most closely related to Mucoromycotina. Both taxa likely represent novel species. This study shows how observation of specific OTUs level responses to altered N status in a large rRNA gene field survey provided the impetus to design targeted culture approaches for isolation of novel N-responsive fungal taxa.

The sponge microbiome project.

PubMed

Moitinho-Silva, Lucas; Nielsen, Shaun; Amir, Amnon; Gonzalez, Antonio; Ackermann, Gail L; Cerrano, Carlo; Astudillo-Garcia, Carmen; Easson, Cole; Sipkema, Detmer; Liu, Fang; Steinert, Georg; Kotoulas, Giorgos; McCormack, Grace P; Feng, Guofang; Bell, James J; Vicente, Jan; Björk, Johannes R; Montoya, Jose M; Olson, Julie B; Reveillaud, Julie; Steindler, Laura; Pineda, Mari-Carmen; Marra, Maria V; Ilan, Micha; Taylor, Michael W; Polymenakou, Paraskevi; Erwin, Patrick M; Schupp, Peter J; Simister, Rachel L; Knight, Rob; Thacker, Robert W; Costa, Rodrigo; Hill, Russell T; Lopez-Legentil, Susanna; Dailianis, Thanos; Ravasi, Timothy; Hentschel, Ute; Li, Zhiyong; Webster, Nicole S; Thomas, Torsten

2017-10-01

Marine sponges (phylum Porifera) are a diverse, phylogenetically deep-branching clade known for forming intimate partnerships with complex communities of microorganisms. To date, 16S rRNA gene sequencing studies have largely utilised different extraction and amplification methodologies to target the microbial communities of a limited number of sponge species, severely limiting comparative analyses of sponge microbial diversity and structure. Here, we provide an extensive and standardised dataset that will facilitate sponge microbiome comparisons across large spatial, temporal, and environmental scales. Samples from marine sponges (n = 3569 specimens), seawater (n = 370), marine sediments (n = 65) and other environments (n = 29) were collected from different locations across the globe. This dataset incorporates at least 268 different sponge species, including several yet unidentified taxa. The V4 region of the 16S rRNA gene was amplified and sequenced from extracted DNA using standardised procedures. Raw sequences (total of 1.1 billion sequences) were processed and clustered with (i) a standard protocol using QIIME closed-reference picking resulting in 39 543 operational taxonomic units (OTU) at 97% sequence identity, (ii) a de novo clustering using Mothur resulting in 518 246 OTUs, and (iii) a new high-resolution Deblur protocol resulting in 83 908 unique bacterial sequences. Abundance tables, representative sequences, taxonomic classifications, and metadata are provided. This dataset represents a comprehensive resource of sponge-associated microbial communities based on 16S rRNA gene sequences that can be used to address overarching hypotheses regarding host-associated prokaryotes, including host specificity, convergent evolution, environmental drivers of microbiome structure, and the sponge-associated rare biosphere. © The Authors 2017. Published by Oxford University Press.

Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

NASA Technical Reports Server (NTRS)

Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

1995-01-01

Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries.

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2010-04-01

An arbitrary primed community PCR fingerprinting technique based on capillary electrophoresis was developed to study maple sap microbial community characteristics among 19 production sites in Québec over the tapping season. Presumptive fragment identification was made with corresponding fingerprint profiles of bacterial isolate cultures. Maple sap microbial communities were subsequently compared using a representative subset of 13 16S rRNA gene clone libraries followed by gene sequence analysis. Results from both methods indicated that all maple sap production sites and flow periods shared common microbiota members, but distinctive features also existed. Changes over the season in relative abundance of predominant populations showed evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most abundantly and frequently represented genera of the 2239 sequences analyzed. Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilithonimonas and Sphingomonas were revealed as occasional contaminants in maple sap. Maple sap microbiota showed a low level of deep diversity along with a high variation of similar 16S rRNA gene sequences within the Pseudomonas genus. Predominance of Pseudomonas is suggested as a typical feature of maple sap microbiota across geographical regions, production sites, and sap flow periods.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

PubMed Central

Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

2011-01-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

PubMed

Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

2011-09-01

Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

PubMed

Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

2015-01-01

The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination thus shaped the evolution of 16S rRNA genes in the genus Enterobacter. PMID:29180992

Paralogues of nuclear ribosomal genes conceal phylogenetic signals within the invasive Asian fish tapeworm lineage: evidence from next generation sequencing data.

PubMed

Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D Timothy J

2016-08-01

Complete mitochondrial genomes and nuclear rRNA operons of eight geographically distinct isolates of the Asian fish tapeworm Schyzocotyle acheilognathi (syn. Bothriocephalus acheilognathi), representing the parasite's global diversity spanning four continents, were fully characterised using an Illumina sequencing platform. This cestode species represents an extreme example of a highly invasive, globally distributed pathogen of veterinary importance with exceptionally low host specificity unseen elsewhere within the parasitic flatworms. In addition to eight specimens of S. acheilognathi, we fully characterised its closest known relative and the only congeneric species, Schyzocotyle nayarensis, from cyprinids in the Indian subcontinent. Since previous nucleotide sequence data on the Asian fish tapeworm were restricted to a single molecular locus of questionable phylogenetic utility-the nuclear rRNA genes-separating internal transcribed spacers-the mitogenomic data presented here offer a unique opportunity to gain the first detailed insights into both the intraspecific phylogenetic relationships and population genetic structure of the parasite, providing key baseline information for future research in the field. Additionally, we identify a previously unnoticed source of error and demonstrate the limited utility of the nuclear rRNA sequences, including the internal transcribed spacers that has likely misled most of the previous molecular phylogenetic and population genetic estimates on the Asian fish tapeworm. Copyright © 2016 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys

PubMed Central

Berney, Cédric; Fahrni, José; Pawlowski, Jan

2004-01-01

Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic taxa, two of which comprise several phylotypes that were found independently in different studies. To ascertain their taxonomic status, however, the organisms themselves have now to be identified. PMID:15176975

Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

PubMed

Panosyan, Hovik; Birkeland, Nils-Kåre

2014-11-01

The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden

PubMed Central

Lührig, Katharina; Canbäck, Björn; Paul, Catherine J.; Johansson, Tomas; Persson, Kenneth M.; Rådström, Peter

2015-01-01

Next-generation sequencing of the V1–V2 and V3 variable regions of the 16S rRNA gene generated a total of 674,116 reads that described six distinct bacterial biofilm communities from both water meters and pipes. A high degree of reproducibility was demonstrated for the experimental and analytical work-flow by analyzing the communities present in parallel water meters, the rare occurrence of biological replicates within a working drinking water distribution system. The communities observed in water meters from households that did not complain about their drinking water were defined by sequences representing Proteobacteria (82–87%), with 22–40% of all sequences being classified as Sphingomonadaceae. However, a water meter biofilm community from a household with consumer reports of red water and flowing water containing elevated levels of iron and manganese had fewer sequences representing Proteobacteria (44%); only 0.6% of all sequences were classified as Sphingomonadaceae; and, in contrast to the other water meter communities, markedly more sequences represented Nitrospira and Pedomicrobium. The biofilm communities in pipes were distinct from those in water meters, and contained sequences that were identified as Mycobacterium, Nocardia, Desulfovibrio, and Sulfuricurvum. The approach employed in the present study resolved the bacterial diversity present in these biofilm communities as well as the differences that occurred in biofilms within a single distribution system, and suggests that next-generation sequencing of 16S rRNA amplicons can show changes in bacterial biofilm communities associated with different water qualities. PMID:25739379

Bacterial community analysis of drinking water biofilms in southern Sweden.

PubMed

Lührig, Katharina; Canbäck, Björn; Paul, Catherine J; Johansson, Tomas; Persson, Kenneth M; Rådström, Peter

2015-01-01

Next-generation sequencing of the V1-V2 and V3 variable regions of the 16S rRNA gene generated a total of 674,116 reads that described six distinct bacterial biofilm communities from both water meters and pipes. A high degree of reproducibility was demonstrated for the experimental and analytical work-flow by analyzing the communities present in parallel water meters, the rare occurrence of biological replicates within a working drinking water distribution system. The communities observed in water meters from households that did not complain about their drinking water were defined by sequences representing Proteobacteria (82-87%), with 22-40% of all sequences being classified as Sphingomonadaceae. However, a water meter biofilm community from a household with consumer reports of red water and flowing water containing elevated levels of iron and manganese had fewer sequences representing Proteobacteria (44%); only 0.6% of all sequences were classified as Sphingomonadaceae; and, in contrast to the other water meter communities, markedly more sequences represented Nitrospira and Pedomicrobium. The biofilm communities in pipes were distinct from those in water meters, and contained sequences that were identified as Mycobacterium, Nocardia, Desulfovibrio, and Sulfuricurvum. The approach employed in the present study resolved the bacterial diversity present in these biofilm communities as well as the differences that occurred in biofilms within a single distribution system, and suggests that next-generation sequencing of 16S rRNA amplicons can show changes in bacterial biofilm communities associated with different water qualities.

Molecular Evidence of Chlamydia-Like Organisms in the Feces of Myotis daubentonii Bats.

PubMed

Hokynar, K; Vesterinen, E J; Lilley, T M; Pulliainen, A T; Korhonen, S J; Paavonen, J; Puolakkainen, M

2017-01-15

Chlamydia-like organisms (CLOs) are recently identified members of the Chlamydiales order. CLOs share intracellular lifestyles and biphasic developmental cycles, and they have been detected in environmental samples as well as in various hosts such as amoebae and arthropods. In this study, we screened bat feces for the presence of CLOs by molecular analysis. Using pan-Chlamydiales PCR targeting the 16S rRNA gene, Chlamydiales DNA was detected in 54% of the specimens. PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA and 23S rRNA genes were used to classify positive specimens and infer their phylogenetic relationships. Most sequences matched best with Rhabdochlamydia species or uncultured Chlamydia sequences identified in ticks. Another set of sequences matched best with sequences of the Chlamydia genus or uncultured Chlamydiales from snakes. To gain evidence of whether CLOs in bat feces are merely diet borne, we analyzed insects trapped from the same location where the bats foraged. Interestingly, the CLO sequences resembling Rhabdochlamydia spp. were detected in insect material as well, but the other set of CLO sequences was not, suggesting that this set might not originate from prey. Thus, bats represent another potential host for Chlamydiales and could harbor novel, previously unidentified members of this order. Several pathogenic viruses are known to colonize bats, and recent analyses indicate that bats are also reservoir hosts for bacterial genera. Chlamydia-like organisms (CLOs) have been detected in several animal species. CLOs have high 16S rRNA sequence similarity to Chlamydiaceae and exhibit similar intracellular lifestyles and biphasic developmental cycles. Our study describes the frequent occurrence of CLO DNA in bat feces, suggesting an expanding host species spectrum for the Chlamydiales As bats can acquire various infectious agents through their diet, prey insects were also studied. We identified CLO sequences in bats that matched best with sequences in prey insects but also CLO sequences not detected in prey insects. This suggests that a portion of CLO DNA present in bat feces is not prey borne. Furthermore, some sequences from bat droppings not originating from their diet might well represent novel, previously unidentified members of the Chlamydiales order. Copyright © 2016 American Society for Microbiology.

Microbial community structure in the gut of the New Zealand insect Auckland tree weta (Hemideina thoracica).

PubMed

Waite, David W; Dsouza, Melissa; Biswas, Kristi; Ward, Darren F; Deines, Peter; Taylor, Michael W

2015-05-01

The endemic New Zealand weta is an enigmatic insect. Although the insect is well known by its distinctive name, considerable size, and morphology, many basic aspects of weta biology remain unknown. Here, we employed cultivation-independent enumeration techniques and rRNA gene sequencing to investigate the gut microbiota of the Auckland tree weta (Hemideina thoracica). Fluorescence in situ hybridisation performed on different sections of the gut revealed a bacterial community of fluctuating density, while rRNA gene-targeted amplicon pyrosequencing revealed the presence of a microbial community containing high bacterial diversity, but an apparent absence of archaea. Bacteria were further studied using full-length 16S rRNA gene sequences, with statistical testing of bacterial community membership against publicly available termite- and cockroach-derived sequences, revealing that the weta gut microbiota is similar to that of cockroaches. These data represent the first analysis of the weta microbiota and provide initial insights into the potential function of these microorganisms.

Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

PubMed

Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

2017-09-18

Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B.V. All rights reserved.

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Prevotella timonensis sp. nov., isolated from a human breast abscess.

PubMed

Glazunova, Olga O; Launay, Thierry; Raoult, Didier; Roux, Véronique

2007-04-01

Gram-negative anaerobic rods were isolated from a human breast abscess. Based on genotypic and phenotypic characteristics, the novel strain belonged to the genus Prevotella. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that it was closely related to Prevotella buccalis (94 % 16S rRNA gene sequence similarity), Prevotella salivae (90 %) and Prevotella oris (89.1 %). The major cellular fatty acid was C(14 : 0) (19.5 %). The new isolate represents a novel species in the genus Prevotella, for which the name Prevotella timonensis sp. nov. is proposed. The type strain is strain 4401737(T) (=CIP 108522(T)=CCUG 50105(T)).

Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

PubMed

Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

2014-02-01

Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2010-09-01

Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.

[Isolation and phylogenetic analysis of one actinomycete strain YIM 90022 exhibiting anticancer activity].

PubMed

Chen, Yi-Guang; Li, Wen-Jun; Cui, Xiao-Long; Jiang, Cheng-Lin; Xu, Li-Hua

2006-10-01

One facultative alkaliphilic actinomycete strain YIM 90022 was isolated from hypersaline alkaline soil in Qinghai province, China. An almost-complete 16S rRNA gene sequence (1500 bp) for strain YIM 90022 was obtained. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 90022 was closely related to four members of the genus Nocardiopsis with 16S rRNA gene sequence similarity values of 98.8% (N. exhalans DSM 44407T), 98.5% (N. prasina DSM 43845T), 98.4% (N. metallicus DSM 44598T) and 97.8% (N. listeri DSM 40297T), but represented a distinct phylogenetic lineage. Repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting was evaluated on strain YIM 90022 and its closest relatives to investigate their genetic relatedness. The analysis of the rep-PCR genomic fingerprints showed that strain YIM 90022 was distinguishable from its closest relatives. The polyphasic taxonomic data presented in this study, including its morphology, physiological and biochemical characteristics, chemotaxonomy, 16S rRNA gene sequence-based phylogenetic analysis and rep-PCR genomic fingerprinting, supported the view that strain YIM 90022 represented a potential new species of the genus Nocardiopsis. The fermentation broth of strain YIM 90022 strongly inhibited growth of cell series of gastric cancer, lung cancer, mammary cancer, melanoma cancer, renal cancer and uterus cancer. Strain YIM 90022 grew well on most tested media, producing exuberant vegetative hyphae and aerial hyphae. The vegetative hyphae are long and fragmented. Light yellow to deep brown diffusible pigments were produced on ISP 2, ISP 3 and ISP 6. Growth of the strain occurred in the pH range 6.0-12.0, with optimal pH8.5. The NaCl tolerate range was 0-15% (W/V). Cell walls contain meso-diaminopimelic acid and have no diagnostic sugars. Polar lipids are phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethylethanolamine. Major menaquinones are MK-10 (H4, H6). The DNA G + C content is 71.5 mol %.

Widespread and Persistent Populations of a Major New Marine Actinomycete Taxon in Ocean Sediments

PubMed Central

Mincer, Tracy J.; Jensen, Paul R.; Kauffman, Christopher A.; Fenical, William

2002-01-01

A major taxon of obligate marine bacteria within the order Actinomycetales has been discovered from ocean sediments. Populations of these bacteria (designated MAR 1) are persistent and widespread, spanning at least three distinct ocean systems. In this study, 212 actinomycete isolates possessing MAR 1 morphologies were examined and all but two displayed an obligate requirement of seawater for growth. Forty-five of these isolates, representing all observed seawater-requiring morphotypes, were partially sequenced and found to share characteristic small-subunit rRNA signature nucleotides between positions 207 and 468 (Escherichia coli numbering). Phylogenetic characterization of seven representative isolates based on almost complete sequences of genes encoding 16S rRNA (16S ribosomal DNA) yielded a monophyletic clade within the family Micromonosporaceae and suggests novelty at the genus level. This is the first evidence for the existence of widespread populations of obligate marine actinomycetes. Organic extracts from cultured members of this new group exhibit remarkable biological activity, suggesting that they represent a prolific resource for biotechnological applications. PMID:12324350

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

PubMed Central

Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

2015-01-01

The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

Diversity, Biogeography, and Biodegradation Potential of Actinobacteria in the Deep-Sea Sediments along the Southwest Indian Ridge

PubMed Central

Chen, Ping; Zhang, Limin; Guo, Xiaoxuan; Dai, Xin; Liu, Li; Xi, Lijun; Wang, Jian; Song, Lei; Wang, Yuezhu; Zhu, Yaxin; Huang, Li; Huang, Ying

2016-01-01

The phylum Actinobacteria has been reported to be common or even abundant in deep marine sediments, however, knowledge about the diversity, distribution, and function of actinobacteria is limited. In this study, actinobacterial diversity in the deep sea along the Southwest Indian Ridge (SWIR) was investigated using both 16S rRNA gene pyrosequencing and culture-based methods. The samples were collected at depths of 1662–4000 m below water surface. Actinobacterial sequences represented 1.2–9.1% of all microbial 16S rRNA gene amplicon sequences in each sample. A total of 5 actinobacterial classes, 17 orders, 28 families, and 52 genera were detected by pyrosequencing, dominated by the classes Acidimicrobiia and Actinobacteria. Differences in actinobacterial community compositions were found among the samples. The community structure showed significant correlations to geochemical factors, notably pH, calcium, total organic carbon, total phosphorus, and total nitrogen, rather than to spatial distance at the scale of the investigation. In addition, 176 strains of the Actinobacteria class, belonging to 9 known orders, 18 families, and 29 genera, were isolated. Among these cultivated taxa, 8 orders, 13 families, and 15 genera were also recovered by pyrosequencing. At a 97% 16S rRNA gene sequence similarity, the pyrosequencing data encompassed 77.3% of the isolates but the isolates represented only 10.3% of the actinobacterial reads. Phylogenetic analysis of all the representative actinobacterial sequences and isolates indicated that at least four new orders within the phylum Actinobacteria were detected by pyrosequencing. More than half of the isolates spanning 23 genera and all samples demonstrated activity in the degradation of refractory organics, including polycyclic aromatic hydrocarbons and polysaccharides, suggesting their potential ecological functions and biotechnological applications for carbon recycling. PMID:27621725

Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

PubMed

Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

2016-10-01

The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Partial 16S rRNA primary structure of five Actinomyces species: phylogenetic implications and development of an Actinomyces israelii-specific oligonucleotide probe.

PubMed

Stackebrandt, E; Charfreitag, O

1990-01-01

The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.

Lactobacillus pobuzihii sp. nov., isolated from pobuzihi (fermented cummingcordia).

PubMed

Chen, Yi-Sheng; Miyashita, Mika; Suzuki, Ken-ichiro; Sato, Hajime; Hsu, Jar-Sheng; Yanagida, Fujitoshi

2010-08-01

Twenty-one homofermentative lactic acid bacteria were isolated from fermented cummingcordia (pobuzihi), a traditional food in Taiwan. The isolates had identical 16S rRNA gene sequences that were distinct from those of other lactobacilli, and their closest neighbours in the 16S rRNA gene sequence phylogenetic tree were strains of Lactobacillus acidipiscis. Levels of DNA-DNA relatedness between representative pobuzihi isolates and strains of L. acidipiscis were 17% and below. Furthermore, the new isolates could be differentiated clearly from L. acidipiscis NBRC 102163T and NBRC 102164 in terms of acid production from L-arabinose, rhamnose, mannitol, lactose and 5-ketogluconate. It was concluded that the new isolates represent a single novel species of the genus Lactobacillus, for which the name Lactobacillus pobuzihii sp. nov. is proposed. The type strain is E100301T (=RIFY 6501T =NBRC 103219T =KCTC 13174T).

Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

PubMed Central

2018-01-01

Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

Burkholderia cordobensis sp. nov., from agricultural soils.

PubMed

Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

2014-06-01

Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

PubMed

Root-Bernstein, Robert; Root-Bernstein, Meredith

2016-05-21

We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

PubMed

Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

1995-04-01

Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

Organization of 5S rDNA in species of the fish Leporinus: two different genomic locations are characterized by distinct nontranscribed spacers.

PubMed

Martins, C; Galetti, P M

2001-10-01

To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

Coxiella Detection in Ticks from Wildlife and Livestock in Malaysia

PubMed Central

Khoo, Jing-Jing; Lim, Fang-Shiang; Chen, Fezshin; Phoon, Wai-Hong; Khor, Chee-Sieng; Pike, Brian L.; Chang, Li-Yen

2016-01-01

Abstract Recent studies have shown that ticks harbor Coxiella-like bacteria, which are potentially tick-specific endosymbionts. We recently described the detection of Coxiella-like bacteria and possibly Coxiella burnetii in ticks found from rural areas in Malaysia. In the present study, we collected ticks, including Haemaphysalis bispinosa, Haemaphysalis hystricis, Dermacentor compactus, Dermacentor steini, and Amblyomma sp. from wildlife and domesticated goats from four different locations in Malaysia. Coxiella 16s rRNA genomic sequences were detected by PCR in 89% of ticks tested. Similarity analysis and phylogenetic analyses of the 16s rRNA and rpoB partial sequences were performed for 10 representative samples selected based on the tick species, sex, and location. The findings here suggested the presence of C. burnetii in two samples, each from D. steini and H. hystricis. The sequences of both samples clustered with published C. burnetii sequences. The remaining eight tick samples were shown to harbor 16s rRNA sequences of Coxiella-like bacteria, which clustered phylogenetically according to the respective tick host species. The findings presented here added to the growing evidence of the association between Coxiella-like bacteria and ticks across species and geographical boundaries. The importance of C. burnetii found in ticks in Malaysia warrants further investigation. PMID:27763821

Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

PubMed

Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

2017-05-01

Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

Cladistic biogeography of Juglans (Juglandaceae) based on chloroplast DNA intergenic spacer sequences

USDA-ARS?s Scientific Manuscript database

The phylogenetic utility of sequence variation from five chloroplast DNA intergenic spacer (IGS) regions: trnT-trnF, psbA-trnH, atpB-rbcL, trnV-16S rRNA, and trnS-trnfM was examined in the genus Juglans. A total of seventeen taxa representing the four sections within Juglans and an outgroup taxon, ...

Characterization of a novel variant of Mycobacterium chimaera.

PubMed

van Ingen, J; Hoefsloot, W; Buijtels, P C A M; Tortoli, E; Supply, P; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

2012-09-01

In this study, nonchromogenic mycobacteria were isolated from pulmonary samples of three patients in the Netherlands. All isolates had identical, unique 16S rRNA gene and 16S-23S ITS sequences, which were closely related to those of Mycobacterium chimaera and Mycobacterium marseillense. The biochemical features of the isolates differed slightly from those of M. chimaera, suggesting that the isolates may represent a possible separate species within the Mycobacterium avium complex (MAC). However, the cell-wall mycolic acid pattern, analysed by HPLC, and the partial sequences of the hsp65 and rpoB genes were identical to those of M. chimaera. We concluded that the isolates represent a novel variant of M. chimaera. The results of this analysis have led us to question the currently used methods of species definition for members of the genus Mycobacterium, which are based largely on 16S rRNA or rpoB gene sequencing. Definitions based on a single genetic target are likely to be insufficient. Genetic divergence, especially in the MAC, yields strains that cannot be confidently assigned to a specific species based on the analysis of a single genetic target.

Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.

PubMed

Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H

2014-05-01

Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).

Phylogenetic position of the enigmatic clawless eutardigrade genus Apodibius Dastych, 1983 (Tardigrada), based on 18S and 28S rRNA sequence data from its type species A. confusus.

PubMed

Dabert, Miroslawa; Dastych, Hieronymus; Hohberg, Karin; Dabert, Jacek

2014-01-01

The systematics of Eutardigrada, the largest lineage among the three classes of the phylum Tardigrada, is based mainly on the morphology of the leg claws and of the buccal apparatus. However, three members of the rarely recorded and poorly known limno-terrestrial eutardigrade genus Apodibius have no claws on their strongly reduced legs, a unique character among all tardigrades. This absence of all claws makes the systematic position of Apodibius one of the most enigmatic among the whole class. Until now all known associates of the genus Apodibius have been located in the incertae sedis species group or, quite recently, included into the Necopinatidae family. In the present study, phylogenetic analyses of 18S and 28S rRNA sequence data from 31 tardigrade species representing four parachelan superfamilies (Isohypsibioidea, Hypsibioidea, Macrobiotoidea, Eohypsibioidea), the apochelan Milnesium tardigradum, and the type species of the genus Apodibius, A. confusus, indicated close relationship of the Apodibius with tardigrade species recently included in the superfamily Isohypsibioidea. This result was well-supported and consistent across all markers (separate 18S rRNA, 28S rRNA, and combined 18S rRNA+28S rRNA datasets) and methods (MP, ML) applied. Copyright © 2013 Elsevier Inc. All rights reserved.

Molecular characterization of sulfate-reducing bacteria in the Guaymas Basin

NASA Technical Reports Server (NTRS)

Dhillon, Ashita; Teske, Andreas; Dillon, Jesse; Stahl, David A.; Sogin, Mitchell L.

2003-01-01

The Guaymas Basin (Gulf of California) is a hydrothermal vent site where thermal alteration of deposited planktonic and terrestrial organic matter forms petroliferous material which supports diverse sulfate-reducing bacteria. We explored the phylogenetic and functional diversity of the sulfate-reducing bacteria by characterizing PCR-amplified dissimilatory sulfite reductase (dsrAB) and 16S rRNA genes from the upper 4 cm of the Guaymas sediment. The dsrAB sequences revealed that there was a major clade closely related to the acetate-oxidizing delta-proteobacterial genus Desulfobacter and a clade of novel, deeply branching dsr sequences related to environmental dsr sequences from marine sediments in Aarhus Bay and Kysing Fjord (Denmark). Other dsr clones were affiliated with gram-positive thermophilic sulfate reducers (genus Desulfotomaculum) and the delta-proteobacterial species Desulforhabdus amnigena and Thermodesulforhabdus norvegica. Phylogenetic analysis of 16S rRNAs from the same environmental samples resulted in identification of four clones affiliated with Desulfobacterium niacini, a member of the acetate-oxidizing, nutritionally versatile genus Desulfobacterium, and one clone related to Desulfobacula toluolica and Desulfotignum balticum. Other bacterial 16S rRNA bacterial phylotypes were represented by non-sulfate reducers and uncultured lineages with unknown physiology, like OP9, OP8, as well as a group with no clear affiliation. In summary, analyses of both 16S rRNA and dsrAB clone libraries resulted in identification of members of the Desulfobacteriales in the Guaymas sediments. In addition, the dsrAB sequencing approach revealed a novel group of sulfate-reducing prokaryotes that could not be identified by 16S rRNA sequencing.

Phylogeny of culturable cyanobacteria from Brazilian mangroves.

PubMed

Silva, Caroline Souza Pamplona; Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Fiore, Marli Fátima

2014-03-01

The cyanobacterial community from Brazilian mangrove ecosystems was examined using a culture-dependent method. Fifty cyanobacterial strains were isolated from soil, water and periphytic samples collected from Cardoso Island and Bertioga mangroves using specific cyanobacterial culture media. Unicellular, homocytous and heterocytous morphotypes were recovered, representing five orders, seven families and eight genera (Synechococcus, Cyanobium, Cyanobacterium, Chlorogloea, Leptolyngbya, Phormidium, Nostoc and Microchaete). All of these novel mangrove strains had their 16S rRNA gene sequenced and BLAST analysis revealed sequence identities ranging from 92.5 to 99.7% when they were compared with other strains available in GenBank. The results showed a high variability of the 16S rRNA gene sequences among the genotypes that was not associated with the morphologies observed. Phylogenetic analyses showed several branches formed exclusively by some of these novel 16S rRNA gene sequences. BLAST and phylogeny analyses allowed for the identification of Nodosilinea and Oxynema strains, genera already known to exhibit poor morphological diacritic traits. In addition, several Nostoc and Leptolyngbya morphotypes of the mangrove strains may represent new generic entities, as they were distantly affiliated with true genera clades. The presence of non-ribosomal peptide synthetase, polyketide synthase, microcystin and saxitoxin genes were detected in 20.5%, 100%, 37.5% and 33.3%, respectively, of the 44 tested isolates. A total of 134 organic extracts obtained from 44 strains were tested against microorganisms, and 26% of the extracts showed some antimicrobial activity. This is the first polyphasic study of cultured cyanobacteria from Brazilian mangrove ecosystems using morphological, genetic and biological approaches. Copyright © 2014 Elsevier GmbH. All rights reserved.

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

PubMed Central

Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

1981-01-01

We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

PubMed

Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

2005-12-01

Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria.

PubMed

Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A

2002-11-01

Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex

PubMed Central

Weber, Carolyn F.; King, Gary M.

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796

Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex.

PubMed

Weber, Carolyn F; King, Gary M

2017-01-01

Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).

Lactobacillus hayakitensis sp. nov., isolated from intestines of healthy thoroughbreds

PubMed Central

Morita, Hidetoshi; Shiratori, Chiharu; Murakami, Masaru; Takami, Hideto; Kato, Yukio; Endo, Akihito; Nakajima, Fumihiko; Takagi, Misako; Akita, Hiroaki; Okada, Sanae; Masaoka, Toshio

2007-01-01

Two strains, KBL13T and GBL13, were isolated as one of intestinal lactobacilli from the faecal specimens from different thoroughbreds of the same farm where they were born in Hokkaido, Japan. They were Gram-positive, facultatively anaerobic, catalase-negative, non-spore-forming and non-motile rods. KBL13T and GBL13 homofermentatively metabolize glucose, and produce lactate as the sole final product from glucose. The 16S rRNA gene sequence, DNA–DNA hybridization, DNA G+C content and biochemical characterization indicated that these two strains, KBL13T and GBL13, belong to the same species. In the representative strain, KBL13T, the DNA G+C content was 34.3 mol%. Lactobacillus salivarius JCM 1231T (=ATCC 11741T; AF089108) is the type strain most closely related to the strain KBL13T as shown in the phylogenetic tree, and the 16S rRNA gene sequence identity showed 96.0 % (1425/1484 bp). Comparative 16S rRNA gene sequence analysis of this strain indicated that the two isolated strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives, L. salivarius, Lactobacillus aviarius, Lactobacillus saerimneri and Lactobacillus acidipiscis. DNA–DNA reassociation experiments with L. salivarius and L. aviarius confirmed that KBL13T represents a novel species, for which the name Lactobacillus hayakitensis sp. nov. is proposed. The type strain is KBL13T (=JCM 14209T=DSM 18933T). PMID:18048734

Lactobacillus hayakitensis sp. nov., isolated from intestines of healthy thoroughbreds.

PubMed

Morita, Hidetoshi; Shiratori, Chiharu; Murakami, Masaru; Takami, Hideto; Kato, Yukio; Endo, Akihito; Nakajima, Fumihiko; Takagi, Misako; Akita, Hiroaki; Okada, Sanae; Masaoka, Toshio

2007-12-01

Two strains, KBL13(T) and GBL13, were isolated as one of intestinal lactobacilli from the faecal specimens from different thoroughbreds of the same farm where they were born in Hokkaido, Japan. They were Gram-positive, facultatively anaerobic, catalase-negative, non-spore-forming and non-motile rods. KBL13(T) and GBL13 homofermentatively metabolize glucose, and produce lactate as the sole final product from glucose. The 16S rRNA gene sequence, DNA-DNA hybridization, DNA G+C content and biochemical characterization indicated that these two strains, KBL13(T) and GBL13, belong to the same species. In the representative strain, KBL13(T), the DNA G+C content was 34.3 mol%. Lactobacillus salivarius JCM 1231(T) (=ATCC 11741(T); AF089108) is the type strain most closely related to the strain KBL13(T) as shown in the phylogenetic tree, and the 16S rRNA gene sequence identity showed 96.0 % (1425/1484 bp). Comparative 16S rRNA gene sequence analysis of this strain indicated that the two isolated strains belong to the genus Lactobacillus and that they formed a branch distinct from their closest relatives, L. salivarius, Lactobacillus aviarius, Lactobacillus saerimneri and Lactobacillus acidipiscis. DNA-DNA reassociation experiments with L. salivarius and L. aviarius confirmed that KBL13(T) represents a novel species, for which the name Lactobacillus hayakitensis sp. nov. is proposed. The type strain is KBL13(T) (=JCM 14209(T)=DSM 18933(T)).

Phylogenetic diversity of Flavobacteria isolated from the North Sea on solid media.

PubMed

Hahnke, Richard L; Harder, Jens

2013-10-01

Flavobacteria are abundant in the North Sea, an epeiric sea on the continental shelf of Europe. However, this abundance has so far not been reflected by the number of strains in culture collections. In this study, Flavobacteria were isolated from pelagic and benthic samples, such as seawater, phytoplankton, sediment and its porewater, and from surfaces of animals and seaweeds on agar plates with a variety of carbon sources. Dilution cultivation with a new medium, incubation at low temperatures and with long incubation times, and colony screening by a Flavobacteria-Cytophagia-specific PCR detecting 16S rRNA gene sequences led to a collection of phylogenetically diverse strains. Two strains affiliated with Flammeovirgaceae and seven strains affiliated with Cyclobacteriaceae, whereas within the Flavobacteriaceae 20 isolated strains presumably represented seven novel candidate genera and 355 strains affiliated with 26 of 80 validly described marine Flavobacteriaceae genera, based on a genus boundary of 95.0% 16S rRNA gene sequence identity. The majority of strains (276) affiliated with 37 known species in 16 genera (based on a boundary of 98.7% 16S rRNA gene sequence identity), whereas 79 strains likely represented 42 novel species in 22 established Flavobacteriaceae genera. Pigmentation, iridescence, gliding motility, agar lysis, and flexirubin as a chemical marker supported the taxonomy at the species level. This study demonstrated the culturability on solid medium of phylogenetically diverse Flavobacteria originating from the North Sea. Copyright © 2013 Elsevier GmbH. All rights reserved.

Molecular phylogeny of mitochondrial cytochrome b and 12S rRNA sequences in the Felidae: ocelot and domestic cat lineages.

PubMed

Masuda, R; Lopez, J V; Slattery, J P; Yuhki, N; O'Brien, S J

1996-12-01

Molecular phylogeny of the cat family Felidae is derived using two mitochondrial genes, cytochrome b and 12S rRNA. Phylogenetic methods of weighted maximum parsimony and minimum evolution estimated by neighbor-joining are employed to reconstruct topologies among 20 extant felid species. Sequence analyses of 363 bp of cytochrome b and 376 bp of the 12S rRNA genes yielded average pair-wise similarity values between felids ranging from 94 to 99% and from 85 to 99%, respectively. Phylogenetic reconstruction supports more recent, intralineage associations but fails to completely resolve interlineage relationships. Both genes produce a monophyletic group of Felis species but vary in the placement of the pallas cat. The ocelot lineage represents an early divergence within the Felidae, with strong associations between ocelot and margay, Geoffroy's cat and kodkod, and pampas cat and tigrina. Implications of the relative recency of felid evolution, presence of ancestral polymorphisms, and influence of outgroups in placement of the topological root are discussed.

High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

PubMed Central

Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

2014-01-01

In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

CloVR-ITS: Automated internal transcribed spacer amplicon sequence analysis pipeline for the characterization of fungal microbiota

PubMed Central

2013-01-01

Background Besides the development of comprehensive tools for high-throughput 16S ribosomal RNA amplicon sequence analysis, there exists a growing need for protocols emphasizing alternative phylogenetic markers such as those representing eukaryotic organisms. Results Here we introduce CloVR-ITS, an automated pipeline for comparative analysis of internal transcribed spacer (ITS) pyrosequences amplified from metagenomic DNA isolates and representing fungal species. This pipeline performs a variety of steps similar to those commonly used for 16S rRNA amplicon sequence analysis, including preprocessing for quality, chimera detection, clustering of sequences into operational taxonomic units (OTUs), taxonomic assignment (at class, order, family, genus, and species levels) and statistical analysis of sample groups of interest based on user-provided information. Using ITS amplicon pyrosequencing data from a previous human gastric fluid study, we demonstrate the utility of CloVR-ITS for fungal microbiota analysis and provide runtime and cost examples, including analysis of extremely large datasets on the cloud. We show that the largest fractions of reads from the stomach fluid samples were assigned to Dothideomycetes, Saccharomycetes, Agaricomycetes and Sordariomycetes but that all samples were dominated by sequences that could not be taxonomically classified. Representatives of the Candida genus were identified in all samples, most notably C. quercitrusa, while sequence reads assigned to the Aspergillus genus were only identified in a subset of samples. CloVR-ITS is made available as a pre-installed, automated, and portable software pipeline for cloud-friendly execution as part of the CloVR virtual machine package (http://clovr.org). Conclusion The CloVR-ITS pipeline provides fungal microbiota analysis that can be complementary to bacterial 16S rRNA and total metagenome sequence analysis allowing for more comprehensive studies of environmental and host-associated microbial communities. PMID:24451270

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

PubMed

Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

2013-08-01

[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

The role of pH in determining the species composition of the human colonic microbiota.

PubMed

Duncan, Sylvia H; Louis, Petra; Thomson, John M; Flint, Harry J

2009-08-01

The pH of the colonic lumen varies with anatomical site and microbial fermentation of dietary residue. We have investigated the impact of mildly acidic pH, which occurs in the proximal colon, on the growth of different species of human colonic bacteria in pure culture and in the complete microbial community. Growth was determined for 33 representative human colonic bacteria at three initial pH values (approximately 5.5, 6.2 and 6.7) in anaerobic YCFA medium, which includes a mixture of short-chain fatty acids (SCFA) with 0.2% glucose as energy source. Representatives of all eight Bacteroides species tested grew poorly at pH 5.5, as did Escherichia coli, whereas 19 of the 23 gram-positive anaerobes tested gave growth rates at pH 5.5 that were at least 50% of those at pH 6.7. Growth inhibition of B. thetaiotaomicron at pH 5.5 was increased by the presence of the SCFA mix (33 mM acetate, 9 mM propionate and 1 mM each of iso-valerate, valerate and iso-butyrate). Analysis of amplified 16S rRNA sequences demonstrated a major pH-driven shift within a human faecal bacterial community in a continuous flow fermentor. Bacteroides spp. accounted for 27% of 16S rRNA sequences detected at pH 5.5, but 86% of sequences at pH 6.7. Conversely, butyrate-producing gram-positive bacteria related to Eubacterium rectale represented 50% of all 16S rRNA sequences at pH 5.5, but were not detected at pH 6.7. Inhibition of the growth of a major group of gram-negative bacteria at mildly acidic pH apparently creates niches that can be exploited by more low pH-tolerant microorganisms.

Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

PubMed Central

Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

2012-01-01

Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

Group 16SrXI phytoplasma strains, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D, are associated with sugar cane white leaf.

PubMed

Zhang, Rong-Yue; Li, Wen-Feng; Huang, Ying-Kun; Wang, Xiao-Yan; Shan, Hong-Li; Luo, Zhi-Ming; Yin, Jiong

2016-01-01

Sugar cane white leaf (SCWL) is a serious disease caused by phytoplasmas. In this study, we performed nested PCR with phytoplasma universal primer pairs (P1/P7 and R16F2n/R16R2) for the 16S rRNA gene to detect SCWL phytoplasmas in 31 SCWL samples collected from Baoshan and Lincang, Yunnan, China. We cloned and sequenced the nested PCR products, revealing that the 16S rRNA gene sequences from 31 SCWL samples were all 1247 bp in length and shared more than 99 % nucleotide sequence similarity with the 16S rRNA gene sequences of SCWL phytoplasmas from various countries. Based on the reported 16S rRNA gene sequence data from SCWL isolates of various countries, we conducted phylogenetic and virtual RFLP analysis. In the resulting phylogenetic tree, all SCWL isolates clustered into two branches, with the Lincang and Baoshan SCWL phytoplasma isolates belonging to different branches. The virtual RFLP patterns show that phytoplasmas of the Lincang branch belong to subgroup 16SrXI-B. However, the virtual RFLP patterns revealed by HaeIII digestion of phytoplasmas of the Baoshan branch differed from those of subgroup 16SrXI-B. According to the results of phylogenetic and virtual RFLP analysis, we propose that the phytoplasmas of the Baoshan branch represent a new subgroup, 16SrXI-D. These findings suggest that SCWL is caused by phytoplasmas from group 16SrXI, including subgroup 16SrXI-B and a new subgroup, 16SrXI-D.

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

PubMed

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

A new species of Drepanocephalus Dietz, 1909 (Digenea: Echinostomatidae) from the double-crested cormorant Phalacrocorax auritus (Lesson) (Aves: Phalacrocoracidae) in North America.

PubMed

Kudlai, Olena; Kostadinova, Aneta; Pulis, Eric E; Tkach, Vasyl V

2015-03-01

Drepanocephalus auritus n. sp. is described based on specimens from the double-crested cormorant Phalacrocorax auritus (Lesson) in North America. The new species differs from its congeners in its very narrow, elongate body, long uterine field and widely separated testes. Sequences of the nuclear rRNA gene cluster, spanning the 3' end of the nuclear ribosomal 18S rRNA gene, internal transcribed spacer region (ITS1+5.8S gene+ITS2) and partial 28S gene (2,345 bp), were identical in specimens collected from North Dakota, Minnesota and Mississippi, USA. Sequences of the 651 bp long fragment of the mitochondrial cox1 gene exhibited very low intraspecific variability (< 1%). Comparisons of the newly-generated sequences with those available in the GenBank indicate that the sequences from North America published under the name D. spathans Dietz, 1909 in fact represent D. auritus n. sp.

Isolation and molecular identification of planctomycete bacteria from postlarvae of the giant tiger prawn, Penaeus monodon.

PubMed Central

Fuerst, J A; Gwilliam, H G; Lindsay, M; Lichanska, A; Belcher, C; Vickers, J E; Hugenholtz, P

1997-01-01

Bacteria phenotypically resembling members of the phylogenetically distinct planctomycete group of the domain Bacteria were isolated from postlarvae of the giant tiger prawn, Penaeus monodon. A selective medium designed in the light of planctomycete antibiotic resistance characteristics was used for this isolation. Planctomycetes were isolated from both healthy and monodon baculovirus-infected prawn postlarvae. The predominant colony type recovered from postlarvae regardless of viral infection status was nonpigmented. Other, less commonly observed types were pink or orange pigmented. A planctomycete-specific 16S rRNA-directed probe was designed and used to screen the isolates for their identity as planctomycetes prior to molecular phylogenetic characterization. 16S rRNA genes from nine prawn isolates together with two planctomycete reference strains (Planctomyces brasiliensis and Gemmata obscuriglobus) were sequenced and compared with reference sequences from the planctomycetes and other members of the domain Bacteria. Phylogenetic analyses and sequence signatures of the 16S rRNA genes demonstrated that the prawn isolates were members of the planctomycete group. Five representatives of the predominant nonpigmented colony type were members of the Pirellula group within the planctomycetes, as were three pink-pigmented colony type representatives. Homology values and tree topology indicated that representatives of the nonpigmented and pink-pigmented colony types formed two discrete clusters within the Pirellula group, not identical to any known Pirellula species. A sole representative of the orange colony type was a member of the Planctomyces group, virtually identical in 16S rDNA sequence to P. brasiliensis, and exhibited distinctive morphology. PMID:8979353

Natural communities of novel archaea and bacteria growing in cold sulfurous springs with a string-of-pearls-like morphology.

PubMed

Rudolph, C; Wanner, G; Huber, R

2001-05-01

We report the identification of novel archaea living in close association with bacteria in the cold (approximately 10 degrees C) sulfurous marsh water of the Sippenauer Moor near Regensburg, Bavaria, Germany. These microorganisms form a characteristic, macroscopically visible structure, morphologically comparable to a string of pearls. Tiny, whitish globules (the pearls; diameter, about 0.5 to 3.0 mm) are connected to each other by thin, white-colored threads. Fluorescent in situ hybridization (FISH) studies have revealed that the outer part of the pearls is mainly composed of bacteria, with a filamentous bacterium predominating. Internally, archaeal cocci are the predominant microorganisms, with up to 10(7) cells estimated to be present in a single pearl. The archaea appear to be embedded in a polymer of unknown chemical composition. According to FISH and 16S rRNA gene sequence analysis, the archaea are affiliated with the euryarchaeal kingdom. The new euryarchaeal sequence represents a deep phylogenetic branch within the 16S rRNA tree and does not show extensive similarity to any cultivated archaea or to 16S rRNA gene sequences from environmental samples.

Streptomyces tritici sp. nov., a novel actinomycete isolated from rhizosphere soil of wheat (Triticum aestivum L.).

PubMed

Zhao, Junwei; Shi, Linlin; Li, Wenchao; Wang, Jiabin; Wang, Han; Tian, Yuanyuan; Xiang, Wensheng; Wang, Xiangjing

2018-02-01

Two novel actinomycete isolates, designated strains NEAU-A4 T and NEAU-A3, were isolated from rhizosphere soil of wheat (Triticumaestivum L.) and characterized using a polyphasic approach. Morphological and chemotaxonomic characteristics of the two strains coincided with those of the genus Streptomyces. The 16S rRNA gene sequence analysis showed that the two isolates exhibited 99.6 % 16S rRNA gene sequence similarity with each other and that they were most closely related to Streptomyces violaceorectus DSM 40279 T (98.8, 99.0 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that the two strains clustered together and formed a separate subclade. Furthermore, a combination of DNA-DNA hybridization results and some physiological and biochemical properties demonstrated that the two strains could be distinguished from its closest relative. Therefore, it is proposed that strains NEAU-A4 T and NEAU-A3 should be classified as representatives of a novel species of the genus Streptomyces, for which the name Streptomycestritici sp. nov. is proposed. The type strain is NEAU-A4 T (=CGMCC 4.7393 T =DSM 104540 T ).

Mixed heterolobosean and novel gregarine lineage genes from culture ATCC 50646: Long-branch artefacts, not lateral gene transfer, distort α-tubulin phylogeny.

PubMed

Cavalier-Smith, Thomas

2015-04-01

Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.

Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

PubMed

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced, but the relationships between Artiodactyla, Cetacea, and Perissodactyla remained unresolved. Nevertheless, we found no support for a Perissodactyla + Hyracoidea clade, neither with distance approach, nor with parsimony reconstruction. The 12S rRNA was useful to solve intraordinal relationships among Ungulata, but it seemed to harbor too few informative positions to decipher the bushlike radiation of some Ungulata orders, an event which has most probably occurred in a short span of time between 55 and 70 MYA.

Bacteraemia caused by Sciscionella marina in a lymphoma patient: phenotypically mimicking Nocardia.

PubMed

Sinha, M; Shivaprakash, M R; Chakrabarti, A; Shafiulla, M; Babu, K G; Jayshree, R S

2013-06-01

A 55-year-old female patient with malignant lymphoma after induction chemotherapy developed fever. Blood culture yielded an organism biochemically identified as representing Nocardia spp., but molecular identification (16S rRNA gene sequencing) later identified it as representing Sciscionella marina. This is the first report, to the best of our knowledge, of Sciscionella being isolated from a human sample.

Genome Sequence of the Novel Marine Member of the Gammaproteobacteria Strain HTCC5015▿

PubMed Central

Thrash, J. Cameron; Stingl, Ulrich; Cho, Jang-Cheon; Ferriera, Steve; Johnson, Justin; Vergin, Kevin L.; Giovannoni, Stephen J.

2010-01-01

HTCC5015 is a novel, highly divergent marine member of the Gammaproteobacteria, currently without a cultured representative with greater than 89% 16S rRNA gene identity to itself. The organism was isolated from water collected from Hydrostation S south of Bermuda using high-throughput dilution-to-extinction culturing techniques. Here we present the genome sequence of the unique Gammaproteobacterium strain HTCC5015. PMID:20472792

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

PubMed

Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

2018-03-19

To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

High-Throughput Identification and Screening of Novel Methylobacterium Species Using Whole-Cell MALDI-TOF/MS Analysis

PubMed Central

Tani, Akio; Sahin, Nurettin; Matsuyama, Yumiko; Enomoto, Takashi; Nishimura, Naoki; Yokota, Akira; Kimbara, Kazuhide

2012-01-01

Methylobacterium species are ubiquitous α-proteobacteria that reside in the phyllosphere and are fed by methanol that is emitted from plants. In this study, we applied whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (WC-MS) to evaluate the diversity of Methylobacterium species collected from a variety of plants. The WC-MS spectrum was reproducible through two weeks of cultivation on different media. WC-MS spectrum peaks of M. extorquens strain AM1 cells were attributed to ribosomal proteins, but those were not were also found. We developed a simple method for rapid identification based on spectra similarity. Using all available type strains of Methylobacterium species, the method provided a certain threshold similarity value for species-level discrimination, although the genus contains some type strains that could not be easily discriminated solely by 16S rRNA gene sequence similarity. Next, we evaluated the WC-MS data of approximately 200 methylotrophs isolated from various plants with MALDI Biotyper software (Bruker Daltonics). Isolates representing each cluster were further identified by 16S rRNA gene sequencing. In most cases, the identification by WC-MS matched that by sequencing, and isolates with unique spectra represented possible novel species. The strains belonging to M. extorquens, M. adhaesivum, M. marchantiae, M. komagatae, M. brachiatum, M. radiotolerans, and novel lineages close to M. adhaesivum, many of which were isolated from bryophytes, were found to be the most frequent phyllospheric colonizers. The WC-MS technique provides emerging high-throughputness in the identification of known/novel species of bacteria, enabling the selection of novel species in a library and identification without 16S rRNA gene sequencing. PMID:22808262

Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

PubMed

Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

2007-03-01

In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

NASA Technical Reports Server (NTRS)

Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

1987-01-01

A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

PubMed

Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

2014-08-01

We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

Identification of the bacterial endosymbionts of the marine ciliate Euplotes magnicirratus (Ciliophora, Hypotrichia) and proposal of 'Candidatus Devosia euplotis'.

PubMed

Vannini, Claudia; Rosati, Giovanna; Verni, Franco; Petroni, Giulio

2004-07-01

This paper reports the identification of bacterial endosymbionts that inhabit the cytoplasm of the marine ciliated protozoon Euplotes magnicirratus. Ultrastructural and full-cycle rRNA approaches were used to reveal the identity of these bacteria. Based on analysis of 16S rRNA gene sequences, evolutionary trees were constructed; these placed the endosymbiont in the genus Devosia in the alpha-Proteobacteria. The validity of this finding was also shown by fluorescence in situ hybridization with a Devosia-specific oligonucleotide probe. Differences at the 16S rRNA gene level (which allowed the construction of a species-specific oligonucleotide probe) and the peculiar habitat indicate that the endosymbiont represents a novel species. As its cultivation has not been successful to date, the provisional name 'Candidatus Devosia euplotis' is proposed. The species- and group-specific probes designed in this study could represent convenient tools for the detection of 'Candidatus Devosia euplotis' and Devosia-like bacteria in the environment.

Description of Groenewaldozyma gen. nov. for placement of Candida auringiensis, Candida salmanticensis and Candida tartarivorans.

PubMed

Kurtzman, Cletus P

2016-07-01

DNA sequence analyses have demonstrated that species of the polyphyletic anamorphic ascomycete genus Candida may be members of described teleomorphic genera, members of the Candida tropicalis clade upon which the genus Candida is circumscribed, or members of isolated clades that represent undescribed genera. From phylogenetic analysis of gene sequences from nuclear large subunit rRNA, mitochondrial small subunit rRNA and cytochrome oxidase II, Candida auringiensis (NRRL Y-17674(T), CBS 6913(T)), Candida salmanticensis (NRRL Y-17090(T), CBS 5121(T)), and Candida tartarivorans (NRRL Y-27291(T), CBS 7955(T)) were shown to be members of an isolated clade and are proposed for reclassification in the genus Groenewaldozyma gen. nov. (MycoBank MB 815817). Neighbouring taxa include species of the Wickerhamiella clade and Candida blankii.

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Rapid Detection & Identification of Bacillus Species using MALDI-TOF/TOF and Biomarker Database

DTIC Science & Technology

2006-06-01

rRNA sequence analysis. Multilocus enzyme electrophoresis ( MEE ) and comparative DNA sequence analysis suggest that they may represent a single species...adaptation of the MEE method [63] but with greater discrimination [64]. All of these new PCR-based subtyping methods are certainly superior and more...Demirev, P.A., Lin, J.S., Pineda , F.J., and Fenselau, C. (2001). Bioinformatics and mass spectrometry for microorganism identification: proteome-wide

Exploration of the Genomic Diversity and Core Genome of the Bifidobacterium adolescentis Phylogenetic Group by Means of a Polyphasic Approach

PubMed Central

Duranti, Sabrina; Turroni, Francesca; Milani, Christian; Foroni, Elena; Bottacini, Francesca; Dal Bello, Fabio; Ferrarini, Alberto; Delledonne, Massimo; van Sinderen, Douwe

2013-01-01

In the current work, we describe genome diversity and core genome sequences among representatives of three bifidobacterial species, i.e., Bifidobacterium adolescentis, Bifidobacterium catenulatum, and Bifidobacterium pseudocatenulatum, by employing a polyphasic approach involving analysis of 16S rRNA gene and 16S-23S internal transcribed spacer (ITS) sequences, pulsed-field gel electrophoresis (PFGE), and comparative genomic hybridization (CGH) assays. PMID:23064340

Classification of Culturable Bifidobacterial Population from Colonic Samples of Wild Pigs (Sus scrofa) Based on Three Molecular Genetic Methods.

PubMed

Pechar, Radko; Killer, Jiří; Mekadim, Chahrazed; Geigerová, Martina; Rada, Vojtěch

2017-11-01

Occurrence of bifidobacteria, known as health-promoting probiotic microorganisms, in the digestive tract of wild pigs (Sus scrofa) has not been examined yet. One hundred forty-nine fructose-6-phosphate phosphoketolase positive bacterial strains were isolated from colonic content of twenty-two individuals of wild pigs originated from four localities in the Czechia. Based on PCR-DGGE technique targeting the variable V3 region of the 16S rRNA genes, strains were initially differentiated into four groups represented by: (i) probably a new Bifidobacterium species (89 strains), (ii) B. boum/B. thermophilum/B. thermacidophilum subsp. porcinum/B. thermacidophilum subsp. thermacidophilum (sub)species (49 strains), (iii) Pseudoscardovia suis (7 strains), and (iv) B. pseudolongum subsp. globosum/B. pseudolongum subsp. pseudolongum (4 strains), respectively. Given the fact that DGGE technique did not allow to differentiate the representatives of thermophilic bifidobacteria and B. pseudolongum subspecies, strains were further classified by the 16S rRNA and thrS gene sequences. Primers targeting the variable regions of the latter gene were designed to be applicable in identification and phylogeny of Bifidobacteriaceae family. The 16S rRNA-derived phylogenetic study classified members of the first group into five subgroups in a separated cluster of thermophilic bifidobacteria. Comparable results were obtained by the thrS-derived phylogenetic analysis. Remarkably, variability among thrS sequences was higher compared with 16S rRNA gene sequences. Overall, molecular genetic techniques application allowed to identify a new Bifidobacterium phylotype which is predominant in the digestive tract of examined wild pigs.

Geodermatophilus tzadiensis sp. nov., a UV radiation-resistant bacterium isolated from sand of the Saharan desert.

PubMed

Montero-Calasanz, Maria del Carmen; Göker, Markus; Broughton, William J; Cattaneo, Arlette; Favet, Jocelyne; Pötter, Gabriele; Rohde, Manfred; Spröer, Cathrin; Schumann, Peter; Klenk, Hans-Peter; Gorbushina, Anna A

2013-05-01

Three novel Gram-positive, aerobic, actinobacterial strains, CF5/2(T), CF5/1 and CF7/1, were isolated in 2007 during environmental screening of arid desert soil in the Sahara desert, Chad. Results from riboprinting, MALDI-TOF protein spectra and 16S rRNA sequence analysis confirmed that all three strains belonged to the same species. Phylogenetic analysis of 16S rRNA sequences with the strains' closest relatives indicated that they represented a distinct species. The three novel strains also shared a number of physiological and biochemical characteristics distinct from previously named Geodermatophilus species. The novel strains' peptidoglycan contained meso-diaminopimelic acid; their main phospholipids were phosphatidylcholine, phosphatidylethanolamine, diphosphatidylglycerol, phosphatidylinositol and a small amount of phosphatidylglycerol; MK-9(H4) was the dominant menaquinone. The major cellular fatty acids were the branched-chain saturated acids iso-C16:0 and iso-C15:0. Galactose was detected as diagnostic sugar. Based on these chemotaxonomic results, 16S rRNA gene sequence analysis and DNA-DNA hybridization between strain CF5/2(T) and the type strains of Geodermatophilus saharensis, Geodermatophilus arenarius, Geodermatophilus nigrescens, Geodermatophilus telluris and Geodermatophilus siccatus, the isolates CF5/2(T), CF5/1 and CF7/1 are proposed to represent a novel species, Geodermatophilus tzadiensis, with type strain CF5/2(T)=DSM 45416=MTCC 11411 and two reference strains, CF5/1 (DSM 45415) and CF7/1 (DSM 45420). Copyright © 2013 Elsevier GmbH. All rights reserved.

Evidence for Context-Dependent Complementarity of Non-Shine-Dalgarno Ribosome Binding Sites to Escherichia coli rRNA

PubMed Central

Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.

2013-01-01

While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812

Veillonella infantium sp. nov., an anaerobic, Gram-stain-negative coccus isolated from tongue biofilm of a Thai child.

PubMed

Mashima, Izumi; Liao, Yu-Chieh; Miyakawa, Hiroshi; Theodorea, Citra F; Thawboon, Boonyanit; Thaweboon, Sroisiri; Scannapieco, Frank A; Nakazawa, Futoshi

2018-04-01

A strain of a novel anaerobic, Gram-stain-negative coccus was isolated from the tongue biofilm of a Thai child. This strain was shown, at the phenotypic level and based on 16S rRNA gene sequencing, to be a member of the genus Veillonella. Comparative analysis of the 16S rRNA, dnaK and rpoB gene sequences indicated that phylogenetically the strain comprised a distinct novel branch within the genus Veillonella. The novel strain showed 99.8, 95.1 and 95.9 % similarity to partial 16S rRNA, dnaK and rpoB gene sequences, respectively, to the type strains of the two most closely related species, Veillonelladispar ATCC 17748 T and Veillonellatobetsuensis ATCC BAA-2400 T . The novel strain could be discriminated from previously reported species of the genus Veillonella based on partial dnaK and rpoB gene sequencing and average nucleotide identity values. The major acid end-product produced by this strain was acetic acid under anaerobic conditions in trypticase-yeast extract-haemin with 1 % (w/v) glucose or fructose medium. Lactate was fermented to acetic acid and propionic acid. Based on these observations, this strain represents a novel species, for which the name Veillonella infantium sp. nov. is proposed. The type strain is T11011-4 T (=JCM 31738 T =TSD-88 T ).

Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

PubMed Central

Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank; Al-Soud, Waleed Abu; Brejnrod, Asker; Sørensen, Søren Johannes; Lassen, Jan; Løvendahl, Peter; Højberg, Ole

2017-01-01

Dairy cows experience dramatic changes in host physiology from gestation to lactation period and dietary switch from high-forage prepartum diet to high-concentrate postpartum diet over the transition period (parturition +/- three weeks). Understanding the community structure and activity of the rumen microbiota and its associative patterns over the transition period may provide insight for e.g. improving animal health and production. In the present study, rumen samples from ten primiparous Holstein dairy cows were collected over seven weeks spanning the transition period. Total RNA was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community was dominated by three phyla, showing significant changes in relative abundance range over the transition period: Firmicutes (from prepartum 57% to postpartum 35%), Bacteroidetes (from prepartum 22% to postpartum 18%) and Proteobacteria (from prepartum 7% to postpartum 32%). For the archaea, qPCR analysis of 16S rRNA transcript number, revealed a significant prepartum to postpartum increase in Methanobacteriales, in accordance with an observed increase (from prepartum 80% to postpartum 89%) in relative abundance of 16S rRNA transcript amplicons allocated to this order. On the other hand, a significant prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over the transition period. According to T-RFLP analysis of the mcrA transcripts, two Methanobacteriales genera, Methanobrevibacter and Methanosphaera (represented by the T-RFs 39 and 267 bp), represented more than 70% of the metabolically active methanogens, showing no significant changes over the transition period; minor T-RFs, likely to represent members of the order Methanomassiliicoccales and with a relative abundance below 5% in total, decreased significantly over the transition period. In accordance with the T-RFLP analysis, the mcrA transcript amplicon sequencing revealed Methanobacteriales to cover 99% of the total reads, dominated by the genera Methanobrevibacter (75%) and Methanosphaera (24%), whereas the Methanomassiliicoccales order covered only 0.2% of the total reads. In conclusion, the present study showed that the structure of the metabolically active bacterial and archaeal rumen communities changed over the transition period, likely in response to the dramatic changes in physiology and nutritional factors like dry matter intake and feed composition. It should be noted however that for the methanogens, the observed community changes were influenced by the analyzed gene (mcrA or 16S rRNA). PMID:29117259

Novel Molecular Method for Identification of Streptococcus pneumoniae Applicable to Clinical Microbiology and 16S rRNA Sequence-Based Microbiome Studies

PubMed Central

Scholz, Christian F. P.; Poulsen, Knud

2012-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered specific for S. pneumoniae hamper the exact identification of S. pneumoniae. Based on sequence analysis of 16S rRNA genes of a collection of 634 streptococcal strains, identified by multilocus sequence analysis, we detected a cytosine at position 203 present in all 440 strains of S. pneumoniae but replaced by an adenosine residue in all strains representing other species of mitis group streptococci. The S. pneumoniae-specific sequence signature could be demonstrated by sequence analysis or indirectly by restriction endonuclease digestion of a PCR amplicon covering the site. The S. pneumoniae-specific signature offers an inexpensive means for validation of the identity of clinical isolates and should be used as an integrated marker in the annotation procedure employed in 16S rRNA-based molecular studies of complex human microbiotas. This may avoid frequent misidentifications such as those we demonstrate to have occurred in previous reports and in reference sequence databases. PMID:22442329

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

Systematics of Cladophora spp. (Chlorophyta) from North Carolina, USA, based upon morphology and DNA sequence data with a description of Cladophora subtilissima sp. nov.

PubMed

Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson

2017-06-01

Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.

Isolation of novel bacteria within the Chloroflexi capable of reductive dechlorination of 1,2,3-trichloropropane.

PubMed

Yan, J; Rash, B A; Rainey, F A; Moe, W M

2009-04-01

Two strictly anaerobic bacterial strains were isolated from contaminated groundwater at a Superfund site located near Baton Rouge, LA, USA. These strains represent the first isolates reported to reductively dehalogenate 1,2,3-trichloropropane. Allyl chloride (3-chloro-1-propene), which is chemically unstable, was produced from 1,2,3-trichloropropane, and it was hydrolysed abiotically to allyl alcohol and also reacted with the sulfide- and cysteine-reducing agents in the medium to form various allyl sulfides. Both isolates also dehalogenated a variety of other vicinally chlorinated alkanes (1,2-dichloropropane, 1,2-dichloroethane, 1,1,2-trichloroethane, 1,1,2,2- tetrachloroethane) via dichloroelimination reactions. A quantitative real-time PCR (qPCR) approach targeting 16S rRNA genes indicated that both strains couple reductive dechlorination to cell growth. Growth was not observed in the absence of hydrogen (H2) as an electron donor and a polychlorinated alkane as an electron acceptor. Alkanes containing only a single chlorine substituent (1-chloropropane, 2-chloropropane), chlorinated alkenes (tetrachlorothene, trichlorothene, cisdichloroethene, trans-dichloroethene, vinyl chloride) and chlorinated benzenes (1-chlorobenzene and 1,2- dichlorobenzene) were not dechlorinated. Phylogenetic analysis based on 16S rRNA gene sequence data showed these isolates to represent a new lineage within the Chloroflexi. Their closest previously cultured relatives are 'Dehalococcoides' strains, with 16S rRNA gene sequence similarities of only 90%.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

PubMed

Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

2013-07-01

Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Isolation and molecular identification of endophytic diazotrophs from seeds and stems of three cereal crops.

PubMed

Liu, Huawei; Zhang, Lei; Meng, Aihua; Zhang, Junbiao; Xie, Miaomiao; Qin, Yaohong; Faulk, Dylan Chase; Zhang, Baohong; Yang, Shushen; Qiu, Li

2017-01-01

Ten strains of endophytic diazotroph were isolated and identified from the plants collected from three different agricultural crop species, wheat, rice and maize, using the nitrogen-free selective isolation conditions. The nitrogen-fixing ability of endophytic diazotroph was verified by the nifH-PCR assay that showed positive nitrogen fixation ability. These identified strains were classified by 879F-RAPD and 16S rRNA sequence analysis. RAPD analyses revealed that the 10 strains were clustered into seven 879F-RAPD groups, suggesting a clonal origin. 16S rRNA sequencing analyses allowed the assignment of the 10 strains to known groups of nitrogen-fixing bacteria, including organisms from the genera Paenibacillus, Enterobacter, Klebsiella and Pantoea. These representative genus are not endophytic diazotrophs in the conventional sense. They may have obtained nitrogen fixation ability through lateral gene transfer, however, the evolutionary forces of lateral gene transfer are not well known. Molecular identification results from 16S rRNA analyses were also confirmed by morphological and biochemical data. The test strains SH6A and MZB showed positive effect on the growth of plants.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

The chaperonin-60 universal target is a barcode for bacteria that enables de novo assembly of metagenomic sequence data.

PubMed

Links, Matthew G; Dumonceaux, Tim J; Hemmingsen, Sean M; Hill, Janet E

2012-01-01

Barcoding with molecular sequences is widely used to catalogue eukaryotic biodiversity. Studies investigating the community dynamics of microbes have relied heavily on gene-centric metagenomic profiling using two genes (16S rRNA and cpn60) to identify and track Bacteria. While there have been criteria formalized for barcoding of eukaryotes, these criteria have not been used to evaluate gene targets for other domains of life. Using the framework of the International Barcode of Life we evaluated DNA barcodes for Bacteria. Candidates from the 16S rRNA gene and the protein coding cpn60 gene were evaluated. Within complete bacterial genomes in the public domain representing 983 species from 21 phyla, the largest difference between median pairwise inter- and intra-specific distances ("barcode gap") was found from cpn60. Distribution of sequence diversity along the ∼555 bp cpn60 target region was remarkably uniform. The barcode gap of the cpn60 universal target facilitated the faithful de novo assembly of full-length operational taxonomic units from pyrosequencing data from a synthetic microbial community. Analysis supported the recognition of both 16S rRNA and cpn60 as DNA barcodes for Bacteria. The cpn60 universal target was found to have a much larger barcode gap than 16S rRNA suggesting cpn60 as a preferred barcode for Bacteria. A large barcode gap for cpn60 provided a robust target for species-level characterization of data. The assembly of consensus sequences for barcodes was shown to be a reliable method for the identification and tracking of novel microbes in metagenomic studies.

'Candidatus Phytoplasma noviguineense', a novel taxon associated with Bogia coconut syndrome and banana wilt disease on the island of New Guinea.

PubMed

Miyazaki, Akio; Shigaki, Toshiro; Koinuma, Hiroaki; Iwabuchi, Nozomu; Rauka, Gou Bue; Kembu, Alfred; Saul, Josephine; Watanabe, Kiyoto; Nijo, Takamichi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2018-01-01

Bogia coconut syndrome (BCS) is one of the lethal yellowing (LY)-type diseases associated with phytoplasma presence that are seriously threatening coconut cultivation worldwide. It has recently emerged, and is rapidly spreading in northern parts of the island of New Guinea. BCS-associated phytoplasmas collected in different regions were compared in terms of 16S rRNA gene sequences, revealing high identity among them represented by strain BCS-Bo R . Comparative analysis of the 16S rRNA gene sequences revealed that BCS-Bo R shared less than a 97.5 % similarity with other species of 'Candidatus Phytoplasma', with a maximum value of 96.08 % (with strain LY; GenBank accession no. U18747). This result indicates the necessity and propriety of a novel taxon for BCS phytoplasmas according to the recommendations of the IRPCM. Phylogenetic analysis was also conducted on 16S rRNA gene sequences, resulting in a monophyletic cluster composed of BCS-Bo R and other LY-associated phytoplasmas. Other phytoplasmas on the island of New Guinea associated with banana wilt and arecanut yellow leaf diseases showed high similarities to BCS-Bo R and were closely related to BCS phytoplasmas. Based on the uniqueness of their 16S rRNA gene sequences, a novel taxon 'Ca.Phytoplasma noviguineense' is proposed for these phytoplasmas found on the island of New Guinea, with strain BCS-Bo R (GenBank accession no. LC228755) as the reference strain. The novel taxon is described in detail, including information on the symptoms of associated diseases and additional genetic features of the secY gene and rp operon.

Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

USDA-ARS?s Scientific Manuscript database

This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene

PubMed Central

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze

2013-01-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775

Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.

PubMed

Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun

2013-10-01

Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.

Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

PubMed

van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

1995-06-01

Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

Diversity of lactic acid bacteria in suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.

PubMed

Chao, Shiou-Huei; Wu, Ruei-Jie; Watanabe, Koichi; Tsai, Ying-Chieh

2009-11-15

Fu-tsai and suan-tsai are spontaneously fermented mustard products traditionally prepared by the Hakka tribe of Taiwan. We chose 5 different processing stages of these products for analysis of the microbial community of lactic acid bacteria (LAB) by 16S rRNA gene sequencing. From 500 LAB isolates we identified 119 representative strains belonging to 5 genera and 18 species, including Enterococcus (1 species), Lactobacillus (11 species), Leuconostoc (3 species), Pediococcus (1 species), and Weissella (2 species). The LAB composition of mustard fermented for 3 days, known as the Mu sample, was the most diverse, with 11 different LAB species being isolated. We used sequence analysis of the 16S rRNA gene to identify the LAB strains and analysis of the dnaA, pheS, and rpoA genes to identify 13 LAB strains for which identification by 16S rRNA gene sequences was not possible. These 13 strains were found to belong to 5 validated known species: Lactobacillus farciminis, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Weissella cibaria, and Weissella paramesenteroides, and 5 possibly novel Lactobacillus species. These results revealed that there is a high level of diversity in LAB at the different stages of fermentation in the production of suan-tsai and fu-tsai.

Characterization of strains of Weissella fabalis sp. nov. and Fructobacillus tropaeoli from spontaneous cocoa bean fermentations.

PubMed

Snauwaert, Isabel; Papalexandratou, Zoi; De Vuyst, Luc; Vandamme, Peter

2013-05-01

Six facultatively anaerobic, non-motile lactic acid bacteria were isolated from spontaneous cocoa bean fermentations carried out in Brazil, Ecuador and Malaysia. Phylogenetic analysis revealed that one of these strains, designated M75(T), isolated from a Brazilian cocoa bean fermentation, had the highest 16S rRNA gene sequence similarity towards Weissella fabaria LMG 24289(T) (97.7%), W. ghanensis LMG 24286(T) (93.3%) and W. beninensis LMG 25373(T) (93.4%). The remaining lactic acid bacteria isolates, represented by strain M622, showed the highest 16S rRNA gene sequence similarity towards the type strain of Fructobacillus tropaeoli (99.9%), a recently described species isolated from a flower in South Africa. pheS gene sequence analysis indicated that the former strain represented a novel species, whereas pheS, rpoA and atpA gene sequence analysis indicated that the remaining five strains belonged to F. tropaeoli; these results were confirmed by DNA-DNA hybridization experiments towards their respective nearest phylogenetic neighbours. Additionally, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry proved successful for the identification of species of the genera Weissella and Fructobacillus and for the recognition of the novel species. We propose to classify strain M75(T) ( = LMG 26217(T)  = CCUG 61472(T)) as the type strain of the novel species Weissella fabalis sp. nov.

Lactobacillus futsaii sp. nov., isolated from fu-tsai and suan-tsai, traditional Taiwanese fermented mustard products.

PubMed

Chao, Shiou-Huei; Kudo, Yuko; Tsai, Ying-Chieh; Watanabe, Koichi

2012-03-01

Three Gram-stain-positive strains were isolated from fermented mustard and were rod-shaped, non-motile, asporogenous, facultatively anaerobic, homofermentative and did not exhibit catalase activity. Comparative analyses of 16S rRNA, pheS and rpoA gene sequences demonstrated that the novel strains were members of the genus Lactobacillus. On the basis of 16S rRNA gene sequence analysis, the type strains of Lactobacillus crustorum (98.7% similarity), Lactobacillus farciminis (98.9%) and Lactobacillus mindensis (97.9%) were the closest neighbours. However, DNA-DNA reassociation values with these strains were less than 50%. Phenotypic and genotypic features demonstrated that these isolates represent a novel species of the genus Lactobacillus, for which the name Lactobacillus futsaii sp. nov. is proposed; the type strain is YM 0097(T) (=JCM 17355(T)=BCRC 80278(T)).

Lactobacillus hammesii sp. nov., isolated from French sourdough.

PubMed

Valcheva, Rosica; Korakli, Maher; Onno, Bernard; Prévost, Hervé; Ivanova, Iskra; Ehrmann, Matthias A; Dousset, Xavier; Gänzle, Michael G; Vogel, Rudi F

2005-03-01

Twenty morphologically different strains were chosen from French wheat sourdough isolates. Cells were Gram-positive, non-spore-forming, non-motile rods. The isolates were identified using amplified-fragment length polymorphism, randomly amplified polymorphic DNA and 16S rRNA gene sequence analysis. All isolates were members of the genus Lactobacillus. They were identified as representing Lactobacillus plantarum, Lactobacillus paralimentarius, Lactobacillus sanfranciscensis, Lactobacillus spicheri and Lactobacillus sakei. However, two isolates (LP38(T) and LP39) could be clearly discriminated from recognized Lactobacillus species on the basis of genotyping methods. 16S rRNA gene sequence similarity and DNA-DNA relatedness data indicate that the two strains belong to a novel Lactobacillus species, for which the name Lactobacillus hammesii is proposed. The type strain is LP38(T) (=DSM 16381(T)=CIP 108387(T)=TMW 1.1236(T)).

Characterization of Microbial Communities Associated With Deep-Sea Hydrothermal Vent Animals of the East Pacific Rise and the Galápagos Rift

NASA Astrophysics Data System (ADS)

Ward, N.; Page, S.; Heidelberg, J.; Eisen, J. A.; Fraser, C. M.

2002-12-01

The composition of microbial communities associated with deep-sea hydrothermal vent animals is of interest because of the key role of bacterial symbionts in driving the chemosynthetic food chain of the vent system, and also because bacterial biofilms attached to animal exterior surfaces may play a part in settlement of larval forms. Sequence analysis of 16S ribosomal RNA (rRNA) genes from such communities provides a snapshot of community structure, as this gene is present in all Bacteria and Archaea, and a useful phylogenetic marker for both cultivated microbial species, and uncultivated species such as many of those found in the deep-sea environment. Specimens of giant tube worms (Riftia pachyptila), mussels (Bathymodiolus thermophilus), and clams (Calyptogena magnifica) were collected during the 2002 R/V Atlantis research cruises to the East Pacific Rise (9N) and Galápagos Rift. Microbial biofilms attached to the exterior surfaces of individual animals were sampled, as were tissues known to harbor chemosynthetic bacterial endosymbionts. Genomic DNA was extracted from the samples using a commercially available kit, and 16S rRNA genes amplified from the mixed bacterial communities using the polymerase chain reaction (PCR) and oligonucleotide primers targeting conserved terminal regions of the 16S rRNA gene. The PCR products obtained were cloned into a plasmid vector and the recombinant plasmids transformed into cells of Escherichia coli. Individual cloned 16S rRNA genes were sequenced at the 5' end of the gene (the most phylogenetically informative region in most taxa) and the sequence data compared to publicly available gene sequence databases, to allow a preliminary assignment of clones to taxonomic groups within the Bacteria and Archaea, and to determine the overall composition and phylogenetic diversity of the animal-associated microbial communities. Analysis of Riftia pachyptila exterior biofilm samples revealed the presence of members of the delta and epsilon proteobacteria, low GC Gram positive bacteria (firmicutes), spirochetes, CFB (Cytophaga-Flavobacterium-Bacteroides) group, green nonsulfur bacteria, acidobacteria, verrucomicrobia, and planctomycetes. The presence of the latter three taxonomic groups is of special interest, as they represent phylogenetically distinct groups within the Bacteria for which specific ecological functions have not yet been identified, but which have been found to be widely distributed and often numerically significant in diverse terrestrial and aquatic habitats. Although further sequencing is required to demonstrate the presence of a Riftia-associated microbial population distinct from that of the surrounding seawater, results available from three Riftia individuals from the East Pacific Rise suggest this to be the case. Analysis of microbial communities associated with the gill tissue of the mussel Bathymodiolus thermophilus shows a population dominated by gamma-Proteobacterial chemoautotrophic symbionts, although lower frequency novel phylotypes have been detected. Representatives of specific taxonomic groups have been selected for sequencing of the complete 16S rRNA gene, and the sequences used to reconstruct phylogenetic trees to more accurately determine the evolutionary relationships between the novel sequences, and available sequences for both cultured and non-cultured bacteria.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A unique Mycobacterium species isolated from an epizootic of striped bass (Morone saxatilis).

PubMed Central

Rhodes, M. W.; Kator, H.; Kotob, S.; van Berkum, P.; Kaattari, I.; Vogelbein, W.; Floyd, M. M.; Butler, W. R.; Quinn, F. D.; Ottinger, C.; Shotts, E.

2001-01-01

We isolated a Mycobacterium sp. resembling Mycobacterium marinum and M. ulcerans from diseased striped bass (Morone saxatilis) during an epizootic of mycobacteriosis in the Chesapeake Bay. This isolate may represent an undescribed Mycobacterium species, based on phenotypic characteristics and comparative 16S rRNA gene sequence. PMID:11747708

Integrating metagenomic and amplicon databases to resolve the phylogenetic and ecological diversity of the Chlamydiae

PubMed Central

Lagkouvardos, Ilias; Weinmaier, Thomas; Lauro, Federico M; Cavicchioli, Ricardo; Rattei, Thomas; Horn, Matthias

2014-01-01

In the era of metagenomics and amplicon sequencing, comprehensive analyses of available sequence data remain a challenge. Here we describe an approach exploiting metagenomic and amplicon data sets from public databases to elucidate phylogenetic diversity of defined microbial taxa. We investigated the phylum Chlamydiae whose known members are obligate intracellular bacteria that represent important pathogens of humans and animals, as well as symbionts of protists. Despite their medical relevance, our knowledge about chlamydial diversity is still scarce. Most of the nine known families are represented by only a few isolates, while previous clone library-based surveys suggested the existence of yet uncharacterized members of this phylum. Here we identified more than 22 000 high quality, non-redundant chlamydial 16S rRNA gene sequences in diverse databases, as well as 1900 putative chlamydial protein-encoding genes. Even when applying the most conservative approach, clustering of chlamydial 16S rRNA gene sequences into operational taxonomic units revealed an unexpectedly high species, genus and family-level diversity within the Chlamydiae, including 181 putative families. These in silico findings were verified experimentally in one Antarctic sample, which contained a high diversity of novel Chlamydiae. In our analysis, the Rhabdochlamydiaceae, whose known members infect arthropods, represents the most diverse and species-rich chlamydial family, followed by the protist-associated Parachlamydiaceae, and a putative new family (PCF8) with unknown host specificity. Available information on the origin of metagenomic samples indicated that marine environments contain the majority of the newly discovered chlamydial lineages, highlighting this environment as an important chlamydial reservoir. PMID:23949660

Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

NASA Technical Reports Server (NTRS)

Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

1995-01-01

Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

PubMed Central

Pan, W J; Blackburn, E H

1995-01-01

The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

[Community structure and phylogenetic analysis of cyanobacteria in cryoconite from surface of the Glacier No. 1 in the Tianshan Mountains].

PubMed

Ni, Xuejiao; Qi, Xing'e; Gu, Yanling; Zheng, Xiaoji; Dong, Juan; Ni, Yongqing; Cheng, Guodong

2014-11-04

The purpose of this study is to characterize the community composition and phylogenetic analysis of cyanobacteria from supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains, China. We amplified 16S rRNA genes from the extracted cryoconite DNA by PCR with 2 pairs of cyanobacteria-specific primers. Amplificon was used to construct 16S rRNA genes clone library. The estimation of species richness, diversity indices, and rarefaction curve of the 16S rRNA genes library were determined based on representative phylotypes (OTUs). Analysis of 16S rRNA gene sequences allowed grouping of 101 clones into 12 phylotypes (OTUs) using a cut-off of 97% identity. The phylogenetic analysis revealed that most of sequences affiliated to the order Oscillatoriales and Chroococcales except that three were unclassified. The clone library was dominated by representatives of the order Oscillatoriales (81% of the total clones), and the most abundant organisms within this order were in the genus Phormidium (68 clones) including clones grouping into four phylotypes. The only clone of Chroococcales was closely related to the genus Chamaesiphon with 97% similarity. In addition, comparison of soil chemical properties between different habitats indicated that supraglacial cryoconite supported significantly higher the content of available phosphorus and potassium, nitrate nitrogen and organic matter compared with the forefield of the Glacier No. 1. The diversity index of cyanobacteria were relatively high in supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains. The community structure was dominated by members of the genus Phormidium. This study may enrich our knowledge on biogeochemical processes and ecological distribution of cyanobacterial populations in glacial ecosystem.

Characterization of Melioribacter roseus gen. nov., sp. nov., a novel facultatively anaerobic thermophilic cellulolytic bacterium from the class Ignavibacteria, and a proposal of a novel bacterial phylum Ignavibacteriae.

PubMed

Podosokorskaya, Olga A; Kadnikov, Vitaly V; Gavrilov, Sergey N; Mardanov, Andrey V; Merkel, Alexander Y; Karnachuk, Olga V; Ravin, Nikolay V; Bonch-Osmolovskaya, Elizaveta A; Kublanov, Ilya V

2013-06-01

A novel moderately thermophilic, facultatively anaerobic chemoorganotrophic bacterium strain P3M-2(T) was isolated from a microbial mat developing on the wooden surface of a chute under the flow of hot water (46°C) coming out of a 2775-m-deep oil exploration well (Tomsk region, Russia). Strain P3M-2(T) is a moderate thermophile and facultative anaerobe growing on mono-, di- or polysaccharides by aerobic respiration, fermentation or by reducing diverse electron acceptors [nitrite, Fe(III), As(V)]. Its closest cultivated relative (90.8% rRNA gene sequence identity) is Ignavibacterium album, the only chemoorganotrophic member of the phylum Chlorobi. New genus and species Melioribacter roseus are proposed for isolate P3M-2(T) . Together with I. album, the new organism represents the class Ignavibacteria assigned to the phylum Chlorobi. The revealed group includes a variety of uncultured environmental clones, the 16S rRNA gene sequences of some of which have been previously attributed to the candidate division ZB1. Phylogenetic analysis of M. roseus and I. album based on their 23S rRNA and RecA sequences confirmed that these two organisms could represent an even deeper, phylum-level lineage. Hence, we propose a new phylum Ignavibacteriae within the Bacteroidetes-Chlorobi group with a sole class Ignavibacteria, two families Ignavibacteriaceae and Melioribacteraceae and two species I. album and M. roseus. This proposal correlates with chemotaxonomic data and phenotypic differences of both organisms from other cultured representatives of Chlorobi. The most essential differences, supported by the analyses of complete genomes of both organisms, are motility, facultatively anaerobic and obligately organotrophic mode of life, the absence of chlorosomes and the apparent inability to grow phototrophically. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Identification of Opportunistic Pathogenic Bacteria in Drinking Water Samples of Different Rural Health Centers and Their Clinical Impacts on Humans

PubMed Central

Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.

2013-01-01

International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144

Campylobacter iguaniorum sp. nov., isolated from reptiles.

PubMed

Gilbert, Maarten J; Kik, Marja; Miller, William G; Duim, Birgitta; Wagenaar, Jaap A

2015-03-01

During sampling of reptiles for members of the class Epsilonproteobacteria, strains representing a member of the genus Campylobacter not belonging to any of the established taxa were isolated from lizards and chelonians. Initial amplified fragment length polymorphism, PCR and 16S rRNA sequence analysis showed that these strains were most closely related to Campylobacter fetus and Campylobacter hyointestinalis. A polyphasic study was undertaken to determine the taxonomic position of five strains. The strains were characterized by 16S rRNA and atpA sequence analysis, matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and conventional phenotypic testing. Whole-genome sequences were determined for strains 1485E(T) and 2463D, and the average nucleotide and amino acid identities were determined for these strains. The strains formed a robust phylogenetic clade, divergent from all other species of the genus Campylobacter. In contrast to most currently known members of the genus Campylobacter, the strains showed growth at ambient temperatures, which might be an adaptation to their reptilian hosts. The results of this study clearly show that these strains isolated from reptiles represent a novel species within the genus Campylobacter, for which the name Campylobacter iguaniorum sp. nov. is proposed. The type strain is 1485E(T) ( = LMG 28143(T) = CCUG 66346(T)). © 2015 IUMS.

Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification.

PubMed Central

Gundersen, D E; Lee, I M; Rehner, S A; Davis, R E; Kingsbury, D T

1994-01-01

A global phylogenetic analysis using parsimony of 16S rRNA gene sequences from 46 mollicutes, 19 mycoplasmalike organisms (MLOs) (new trivial name, phytoplasmas), and several related bacteria placed the MLOs definitively among the members of the class Mollicutes and revealed that MLOs form a large discrete monophyletic clade, paraphyletic to the Acholeplasma species, within the Anaeroplasma clade. Within the MLO clade resolved in the global mollicutes phylogeny and a comprehensive MLO phylogeny derived by parsimony analyses of 16S rRNA gene sequences from 30 diverse MLOs representative of nearly all known distinct MLO groups, five major phylogenetic groups with a total of 11 distinct subclades (monophyletic groups or taxa) could be recognized. These MLO subclades (roman numerals) and designated type strains were as follows: i, Maryland aster yellows AY1; ii, apple proliferation AP-A; iii, peanut witches'-broom PnWB; iv, Canada peach X CX; v, rice yellow dwarf RYD; vi, pigeon pea witches'-broom PPWB; vii, palm lethal yellowing LY; viii, ash yellows AshY; ix, clover proliferation CP; x, elm yellows EY; and xi, loofah witches'-broom LfWB. The designations of subclades and their phylogenetic positions within the MLO clade were supported by a congruent phylogeny derived by parsimony analyses of ribosomal protein L22 gene sequences from most representative MLOs. On the basis of the phylogenies inferred in the present study, we propose that MLOs should be represented taxonomically at the minimal level of genus and that each phylogenetically distinct MLO subclade identified should represent at least a distinct species under this new genus. Images PMID:8071198

Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

PubMed

Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

2017-09-01

Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

Candida halmiae sp. nov., Geotrichum ghanense sp. nov. and Candida awuaii sp. nov., isolated from Ghanaian cocoa fermentations.

PubMed

Nielsen, Dennis S; Jakobsen, Mogens; Jespersen, Lene

2010-06-01

During an investigation of the microbiology of Ghanaian cocoa fermentations, a number of yeast isolates with unusual pheno- and genotypic properties representing three possible novel species were isolated. Members of Group A divided by multilateral budding and ascospores were not produced. Group B strains produced true hyphae and ascospores were not produced. Group C representatives divided by budding and formed chains and star-like aggregates. Ascospores were not produced. Sequence analysis of the 26S rRNA gene (D1/D2 region) revealed that the Group A isolates were phylogenetically most closely related to Saturnispora mendoncae (gene sequence similarity 92.4 %), Saturnispora besseyi (88.8 %), Saturnispora saitoi (88.8 %) and Saturnispora ahearnii (88.3 %). Members of Group B were most closely related to representatives of the genera Dipodascus and Galactomyces and the asporogenous genus Geotrichum, but in all cases with 26S rRNA gene (D1/D2 region) similarities below 87 %. For Group C, the most closely related species were Candida rugopelliculosa (92.4 %), Pichia occidentalis (91.6 %) and Pichia exigua (91.9 %). The very low gene sequence similarities obtained for the three groups of isolates clearly indicated that they represented novel species. Repetitive Palindromic PCR (Rep-PCR) of the isolates and their closest phylogenetic relatives confirmed that the new isolates belonged to previously undescribed species. In conclusion, based on the genetic and phenotypic results, the new isolates were considered to represent three novel species, for which the names Candida halmiae (group A, type strain G3(T)=CBS 11009(T)=CCUG 56721(T)); Geotrichum ghanense (group B, type strain G6(T)=CBS 11010(T)=CCUG 56722(T)) and Candida awuaii (group C, type strain G15(T)=CBS 11011(T)=CCUG 56723(T)) are proposed.

Proposal of Vespertiliibacter pulmonis gen. nov., sp. nov. and two genomospecies as new members of the family Pasteurellaceae isolated from European bats.

PubMed

Mühldorfer, Kristin; Speck, Stephanie; Wibbelt, Gudrun

2014-07-01

Five bacterial strains isolated from bats of the family Vespertilionidae were characterized by phenotypic tests and multilocus sequence analysis (MLSA) using the 16S rRNA gene and four housekeeping genes (rpoA, rpoB, infB, recN). Phylogenetic analyses of individual and combined datasets indicated that the five strains represent a monophyletic cluster within the family Pasteurellaceae. Comparison of 16S rRNA gene sequences demonstrated a high degree of similarity (98.3-99.9%) among the group of bat-derived strains, while searches in nucleotide databases indicated less than 96% sequence similarity to known members of the Pasteurellaceae. The housekeeping genes rpoA, rpoB, infB and recN provided higher resolution compared with the 16S rRNA gene and subdivided the group according to the bat species from which the strains were isolated. Three strains derived from noctule bats shared 98.6-100% sequence similarity in all four genes investigated, whereas, based on rpoB, infB and recN gene sequences, 91.8-96% similarity was observed with and between the remaining two strains isolated from a serotine bat and a pipistrelle bat, respectively. Genome relatedness as deduced from recN gene sequences correlated well with the results of MLSA and indicated that the five strains represent a new genus. Based on these results, it is proposed to classify the five strains derived from bats within Vespertiliibacter pulmonis gen. nov., sp. nov. (the type species), Vespertiliibacter genomospecies 1 and Vespertiliibacter genomospecies 2. The genus can be distinguished phenotypically from recognized genera of the Pasteurellaceae by at least three characteristics. All strains are nutritionally fastidious and require a chemically defined supplement with NAD for growth. The DNA G+C content of strain E127/08(T) is 38.2 mol%. The type strain of Vespertiliibacter pulmonis gen. nov., sp. nov. is E127/08(T) ( = CCUG 64585(T) = DSM 27238(T)). The reference strains of Vespertiliibacter genomospecies 1 and 2 are E145/08 and E157/08, respectively. © 2014 IUMS.

Brain Microbial Populations in HIV/AIDS: α-Proteobacteria Predominate Independent of Host Immune Status

PubMed Central

Branton, William G.; Ellestad, Kristofor K.; Maingat, Ferdinand; Wheatley, B. Matt; Rud, Erling; Warren, René L.; Holt, Robert A.; Surette, Michael G.; Power, Christopher

2013-01-01

The brain is assumed to be a sterile organ in the absence of disease although the impact of immune disruption is uncertain in terms of brain microbial diversity or quantity. To investigate microbial diversity and quantity in the brain, the profile of infectious agents was examined in pathologically normal and abnormal brains from persons with HIV/AIDS [HIV] (n = 12), other disease controls [ODC] (n = 14) and in cerebral surgical resections for epilepsy [SURG] (n = 6). Deep sequencing of cerebral white matter-derived RNA from the HIV (n = 4) and ODC (n = 4) patients and SURG (n = 2) groups revealed bacterially-encoded 16 s RNA sequences in all brain specimens with α-proteobacteria representing over 70% of bacterial sequences while the other 30% of bacterial classes varied widely. Bacterial rRNA was detected in white matter glial cells by in situ hybridization and peptidoglycan immunoreactivity was also localized principally in glia in human brains. Analyses of amplified bacterial 16 s rRNA sequences disclosed that Proteobacteria was the principal bacterial phylum in all human brain samples with similar bacterial rRNA quantities in HIV and ODC groups despite increased host neuroimmune responses in the HIV group. Exogenous viruses including bacteriophage and human herpes viruses-4, -5 and -6 were detected variably in autopsied brains from both clinical groups. Brains from SIV- and SHIV-infected macaques displayed a profile of bacterial phyla also dominated by Proteobacteria but bacterial sequences were not detected in experimentally FIV-infected cat or RAG1−/− mouse brains. Intracerebral implantation of human brain homogenates into RAG1−/− mice revealed a preponderance of α-proteobacteria 16 s RNA sequences in the brains of recipient mice at 7 weeks post-implantation, which was abrogated by prior heat-treatment of the brain homogenate. Thus, α-proteobacteria represented the major bacterial component of the primate brain’s microbiome regardless of underlying immune status, which could be transferred into naïve hosts leading to microbial persistence in the brain. PMID:23355888

New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain.

PubMed

Criado-Fornelio, A; Rey-Valeiron, C; Buling, A; Barba-Carretero, J C; Jefferies, R; Irwin, P

2007-03-31

The prevalence of hematozoan infections (Hepatozoon canis and Babesia sp., particularly Babesia canis vogeli) in canids from Venezuela, Thailand and Spain was studied by amplification and sequencing of the 18S rRNA gene. H. canis infections caused simultaneously by two different isolates were confirmed by RFLP analysis in samples from all the geographic regions studied. In Venezuela, blood samples from 134 dogs were surveyed. Babesia infections were found in 2.24% of the dogs. Comparison of sequences of the 18S rRNA gene indicated that protozoan isolates were genetically identical to B. canis vogeli from Japan and Brazil. H. canis infected 44.77 per cent of the dogs. A representative sample of Venezuelan H. canis isolates (21.6% of PCR-positives) was sequenced. Many of them showed 18S rRNA gene sequences identical to H. canis Spain 2, albeit two less frequent genotypes were found in the sample studied. In Thailand, 20 dogs were analyzed. No infections caused by Babesia were diagnosed, whereas 30 per cent of the dogs were positive to hematozoan infection. Two protozoa isolates showing 99.7-100% identity to H. canis Spain 2 were found. In Spain, 250 dogs were studied. B. canis vogeli infected 0.01% of the animals. The sequence of the 18S rRNA gene in Spanish isolates of this protozoa was closely related to those previously deposited in GenBank (> 99% identity). Finally, 20 red foxes were screened for hematozoans employing semi-nested PCR and primers designed to detect Babesia/Theileria. Fifty percent of the foxes were positive to Theileria annae. In addition, it was found that the PCR assay was able as well to detect Hepatozoon infections. Thirty five percent of the foxes were infected with two different H. canis isolates showing 99.8-100% identity to Curupira 1 from Brazil.

Leucobacter salsicius sp. nov., from a salt-fermented food.

PubMed

Yun, Ji-Hyun; Roh, Seong Woon; Kim, Min-Soo; Jung, Mi-Ja; Park, Eun-Jin; Shin, Kee-Sun; Nam, Young-Do; Bae, Jin-Woo

2011-03-01

Strain M1-8(T) was isolated from jeotgal, a Korean salt-fermented food. Cells were aerobic, non-motile, Gram-reaction-positive and rod-shaped. Colonies were cream-coloured and circular with entire margins. Strain M1-8(T) exhibited optimal growth at 25-30 °C and pH 7.0-8.0 and in 0-4  % (w/v) NaCl. The strain tolerated up to 10.0 mM Cr(VI). Phylogenetic analyses of 16S rRNA gene sequences indicated that strain M1-8(T) represents a novel species in the genus Leucobacter. The 16S rRNA gene sequence of M1-8(T) exhibited 98.1  % similarity to that of Leucobacter chromiireducens subsp. chromiireducens L-1(T). The new isolate was clustered with Leucobacter species on a 16S rRNA gene sequence-based phylogenetic tree. The chromosomal DNA G+C content of strain M1-8(T) was 62.8 %. Its cell-wall peptidoglycan contained 2,4-diaminobutyric acid, glutamic acid, alanine, glycine and γ-aminobutyric acid. The major menaquinone was MK-11 and the predominant fatty acids were anteiso-C₁₅:₀ (63.6 %), anteiso-C₁₇:₀ (16.7 %) and iso-C₁₆:₀ (14.2  %). The polar lipid profile of strain M1-8(T) contained diphosphatidylglycerol and one unknown glycolipid. Significant genotypic and phenotypic differences were found between strain M1-8(T) and other Leucobacter species. These differentiating characteristics indicate that strain M1-8(T) represents a novel species of the genus Leucobacter, for which the name Leucobacter salsicius sp. nov. is proposed. The type strain is M1-8(T) (=KACC 21127(T) =JCM 16362(T)).

Evaluation of composition and individual variability of rumen microbiota in yaks by 16S rRNA high-throughput sequencing technology.

PubMed

Guo, Wei; Li, Ying; Wang, Lizhi; Wang, Jiwen; Xu, Qin; Yan, Tianhai; Xue, Bai

2015-08-01

The Yak (Bos grunniens) is a unique species of ruminant animals that is important to agriculture of the Tibetan plateau, and has a complex intestinal microbial community. The objective of the present study was to characterize the composition and individual variability of microbiota in the rumen of yaks using 16S rRNA gene high-throughput sequencing technique. Rumen samples used in the present study were obtained from grazing adult male yaks (n = 6) in a commercial farm in Ganzi Autonomous Prefecture of Sichuan Province, China. Universal prokaryote primers were used to target the V4-V5 hypervariable region of 16S rRNA gene. A total of 7200 operational taxonomic units (OTUs) were obtained after sequence filtering and chimera removal. Within these OTUs, 0.56% belonged to Archaea (40 OTUs), 7.19% to unassigned species (518 OTUs), and the remaining OTUs (6642) in all samples were of bacterial origin. When examining the community structure of bacteria, we identified 23 phyla within 159 families after taxonomic summarization. Bacteroidetes and Firmicutes were the predominant phyla accounting for 39.68% (SD = 0.05) and 45.90% (SD = 0.06), respectively. Moreover, 3764 OTUs were identified as shared OTUs (i.e. represented in all yaks) and belonged to 35 genera, exhibiting highly variable abundance across individual samples. Phylogenetic placement of these genera across individual samples was examined. In addition, we evaluated the distance among the 6 rumen samples by adding taxon phylogeny using UniFrac, representing 24.1% of average distance. In summary, the current study reveals a shared rumen microbiome and phylogenetic lineage and presents novel information on composition and individual variability of the bacterial community in the rumen of yaks. Copyright © 2015. Published by Elsevier Ltd.

Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

DOE PAGES

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

2015-02-06

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

PubMed Central

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

2015-01-01

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

Characterization and Evolution of Cell Division and Cell Wall Synthesis Genes in the Bacterial Phyla Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes and Phylogenetic Comparison with rRNA Genes▿ †

PubMed Central

Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio

2008-01-01

In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order—this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia. PMID:18310338

Nodeomics: Pathogen Detection in Vertebrate Lymph Nodes Using Meta-Transcriptomics

USGS Publications Warehouse

Wittekindt, Nicola E.; Padhi, Abinash; Schuster, Stephan C.; Qi, Ji; Zhao, Fangqing; Tomsho, Lynn P.; Kasson, Lindsay R.; Packard, Michael; Cross, Paul C.; Poss, Mary

2010-01-01

The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

[Phylogenetic and diversity analysis of Acidithiobacillus spp. based on 16S rRNA and RubisCO genes homologues].

PubMed

Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing

2016-04-14

The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

PubMed Central

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-01-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Distribution and diversity of Verrucomicrobia methanotrophs in geothermal and acidic environments.

PubMed

Sharp, Christine E; Smirnova, Angela V; Graham, Jaime M; Stott, Matthew B; Khadka, Roshan; Moore, Tim R; Grasby, Stephen E; Strack, Maria; Dunfield, Peter F

2014-06-01

Recently, methanotrophic members of the phylum Verrucomicrobia have been described, but little is known about their distribution in nature. We surveyed methanotrophic bacteria in geothermal springs and acidic wetlands via pyrosequencing of 16S rRNA gene amplicons. Putative methanotrophic Verrucomicrobia were found in samples covering a broad temperature range (22.5-81.6°C), but only in acidic conditions (pH 1.8-5.0) and only in geothermal environments, not in acidic bogs or fens. Phylogenetically, three 16S rRNA gene sequence clusters of putative methanotrophic Verrucomicrobia were observed. Those detected in high-temperature geothermal samples (44.1-81.6°C) grouped with known thermoacidiphilic 'Methylacidiphilum' isolates. A second group dominated in moderate-temperature geothermal samples (22.5-40.1°C) and a representative mesophilic methanotroph from this group was isolated (strain LP2A). Genome sequencing verified that strain LP2A possessed particulate methane monooxygenase, but its 16S rRNA gene sequence identity to 'Methylacidiphilum infernorum' strain V4 was only 90.6%. A third group clustered distantly with known methanotrophic Verrucomicrobia. Using pmoA-gene targeted quantitative polymerase chain reaction, two geothermal soil profiles showed a dominance of LP2A-like pmoA sequences in the cooler surface layers and 'Methylacidiphilum'-like pmoA sequences in deeper, hotter layers. Based on these results, there appears to be a thermophilic group and a mesophilic group of methanotrophic Verrucomicrobia. However, both were detected only in acidic geothermal environments. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Genetic characterization of Strongyloides spp. from captive, semi-captive and wild Bornean orangutans (Pongo pygmaeus) in Central and East Kalimantan, Borneo, Indonesia.

PubMed

Labes, E M; Nurcahyo, W; Wijayanti, N; Deplazes, P; Mathis, A

2011-09-01

Orangutans (Pongo spp.), Asia's only great apes, are threatened in their survival due to habitat loss, hunting and infections. Nematodes of the genus Strongyloides may represent a severe cause of death in wild and captive individuals. In order to better understand which Strongyloides species/subspecies infect orangutans under different conditions, larvae were isolated from fecal material collected in Indonesia from 9 captive, 2 semi-captive and 9 wild individuals, 18 captive groups of Bornean orangutans and from 1 human working with wild orangutans. Genotyping was done at the genomic rDNA locus (part of the 18S rRNA gene and internal transcribed spacer 1, ITS1) by sequencing amplicons. Thirty isolates, including the one from the human, could be identified as S. fuelleborni fuelleborni with 18S rRNA gene identities of 98·5-100%, with a corresponding published sequence. The ITS1 sequences could be determined for 17 of these isolates revealing a huge variability and 2 main clusters without obvious pattern with regard to attributes of the hosts. The ITS1 amplicons of 2 isolates were cloned and sequenced, revealing considerable variability indicative of mixed infections. One isolate from a captive individual was identified as S. stercoralis (18S rRNA) and showed 99% identity (ITS1) with S. stercoralis sequences from geographically distinct locations and host species. The findings are significant with regard to the zoonotic nature of these parasites and might contribute to the conservation of remaining orangutan populations.

Actinobacterial diversity across a marine transgression in the deep subsurface off Shimokita Peninsula, Japan

NASA Astrophysics Data System (ADS)

Harrison, B. K.; Bailey, J. V.

2013-12-01

Sediment horizons represent a significant - but not permanent - barrier to microbial transport. Cells commonly attach to mineral surfaces in unconsolidated sediments. However, by taxis, growth, or passive migration under advecting fluids, some portion of the microbial community may transgress sedimentary boundaries. Few studies have attempted to constrain such transport of community signatures in the marine subsurface and its potential impact on biogeography. Integrated Ocean Drilling Program (IODP) Expedition 337 off the Shimokita Peninsula recovered sediments over a greater than 1km interval representing a gradual decrease of terrestrial influence, from tidal to continental shelf depositional settings. This sequence represents a key opportunity to link subsurface microbial communities to lithological variability and investigate the permanence of community signatures characteristic of distinct depositional regimes. The phylogenetic connectivity between marine and terrestrially-influenced deposits may demonstrate to what degree sediments offer a substantial barrier to cell transport in the subsurface. Previous work has demonstrated that the Actinobacterial phylum is broadly distributed in marine sediments (Maldonado et al., 2005), present and active in the deep subsurface (Orsi et al., 2013), and that marine and terrestrial lineages may potentially be distinguished by 16S rRNA gene sequencing (e.g. Prieto-Davó et al., 2013). We report on Actinobacteria-specific 16S rRNA gene diversity recovered between 1370 and 2642 mbsf with high-throughput sequencing using the Illumina MiSeq platform, as well as selective assembly and analysis of environmental clone libraries.

[Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

PubMed

Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

2013-07-04

Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

Common 5S rRNA variants are likely to be accepted in many sequence contexts

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The results demonstrate that changes that occur multiple times in a local region of RNA sequence space in fact usually will be accepted in any sequence context in that same local region.

Analysis of the Gull Fecal Microbial Community Reveals the Dominance of Catellicoccus marimammalium in Relation to Culturable Enterococci

PubMed Central

Koskey, Amber M.; Fisher, Jenny C.; Traudt, Mary F.; Newton, Ryan J.

2014-01-01

Gulls are prevalent in beach environments and can be a major source of fecal contamination. Gulls have been shown to harbor a high abundance of fecal indicator bacteria (FIB), such as Escherichia coli and enterococci, which can be readily detected as part of routine beach monitoring. Despite the ubiquitous presence of gull fecal material in beach environments, the associated microbial community is relatively poorly characterized. We generated comprehensive microbial community profiles of gull fecal samples using Roche 454 and Illumina MiSeq platforms to investigate the composition and variability of the gull fecal microbial community and to measure the proportion of FIB. Enterococcaceae and Enterobacteriaceae were the two most abundant families in our gull samples. Sequence comparisons between short-read data and nearly full-length 16S rRNA gene clones generated from the same samples revealed Catellicoccus marimammalium as the most numerous taxon among all samples. The identification of bacteria from gull fecal pellets cultured on membrane-Enterococcus indoxyl-β-d-glucoside (mEI) plates showed that the dominant sequences recovered in our sequence libraries did not represent organisms culturable on mEI. Based on 16S rRNA gene sequencing of gull fecal isolates cultured on mEI plates, 98.8% were identified as Enterococcus spp., 1.2% were identified as Streptococcus spp., and none were identified as C. marimammalium. Illumina deep sequencing indicated that gull fecal samples harbor significantly higher proportions of C. marimammalium 16S rRNA gene sequences (>50-fold) relative to typical mEI culturable Enterococcus spp. C. marimammalium therefore can be confidently utilized as a genetic marker to identify gull fecal pollution in the beach environment. PMID:24242244

New data on epizootiology and genetics of piroplasms based on sequences of small ribosomal subunit and cytochrome b genes.

PubMed

Criado, A; Martinez, J; Buling, A; Barba, J C; Merino, S; Jefferies, R; Irwin, P J

2006-12-20

As a continuation of our studies on molecular epizootiology of piroplasmosis in Spain and other countries, we present in this contribution the finding of new hosts for some piroplasms, as well as information on their 18S rRNA gene sequences. Genetic data were complemented with sequences of apocytochrome b gene (whenever possible). The following conclusions were drawn from these molecular studies: Theileria annulata is capable of infecting dogs, since it was diagnosed in a symptomatic animal. According to cytochrome b sequences, isolates from cows and dog present slight differences. The same isolates showed, however, identical sequence in the 18S rRNA gene. This exemplifies well the usefulness of the mitochondrial gene for examining infra-specific variation. Babesia bovis is an occasional parasite of equines, since it was detected in two symptomatic horses. We found evidence of genetic polymorphism occurring in the 18S rRNA gene of Spanish T. equi-like and B. ovis isolates. B. bennetti from Spanish seagull is loosely related to B. ovis, and might represent a genetically distinct branch of babesids. A partial sequence of a cytochrome b pseudogene was obtained for the first time in Babesia canis rossi from South Africa. The pseudogene is distantly related to B. bigemina cytochrome b gene. These new findings confirm the ability of some piroplasms to infect multiple hosts, as well as the existence of a relatively wide genetic polymorphisms with respect to the cytochrome b gene. On the other hand, the existence of mtDNA-like pseudogenes of possible nuclear location in piroplasms is interesting due to their possible impact on molecular phylogeny studies.

Anticancer property of sediment actinomycetes against MCF-7 and MDA-MB-231 cell lines.

PubMed

Ravikumar, S; Fredimoses, M; Gnanadesigan, M

2012-02-01

To investigate the anticancer property of marine sediment actinomycetes against two different breast cancer cell lines. In vitro anticancer activity was carried out against breast (MCF-7 and MDA-MB-231) cancer cell lines. Partial sequences of the 16s rRNA gene, phylogenetic tree construction, multiple sequence analysis and secondary structure analysis were also carried out with the actinomycetes isolates. Of the selected five actinomycete isolates, ACT01 and ACT02 showed the IC50 value with (10.13±0.92) and (22.34±5.82) µg/mL concentrations, respectively for MCF-7 cell line at 48 h, but ACT01 showed the minimum (18.54±2.49 µg/mL) level of IC50 value with MDA-MB-231 cell line. Further, the 16s rRNA partial sequences of ACT01, ACT02, ACT03, ACT04 and ACT05 isolates were also deposited in NCBI data bank with the accession numbers of GQ478246, GQ478247, GQ478248, GQ478249 and GQ478250, respectively. The phylogenetic tree analysis showed that, the isolates of ACT02 and ACT03 were represented in group I and III, respectively, but ACT01 and ACT02 were represented in group II. The multiple sequence alignment of the actinomycete isolates showed that, the maximum identical conserved regions were identified with the nucleotide regions of 125 to 221st base pairs, 65 to 119th base pairs and 55, 48 and 31st base pairs. Secondary structure prediction of the 16s rRNA showed that, the maximum free energy was consumed with ACT03 isolate (-45.4 kkal/mol) and the minimum free energy was consumed with ACT04 isolate (-57.6 kkal/mol). The actinomycete isolates of ACT01 and ACT02 (GQ478246 and GQ478247) which are isolated from sediment sample can be further used as anticancer agents against breast cancer cell lines.

Lactobacillus apodemi sp. nov., a tannase-producing species isolated from wild mouse faeces.

PubMed

Osawa, Ro; Fujisawa, Tomohiko; Pukall, Rüdiger

2006-07-01

A Gram-positive, rod-shaped, non-endospore-forming bacterium, strain ASB1(T), able to degrade tannin, was isolated from faeces of the Japanese large wood mouse, Apodemus speciosus. Comparative analysis of the 16S rRNA gene sequence revealed that the strain could be assigned as a member of the genus Lactobacillus. The nearest phylogenetic neighbours were determined as Lactobacillus animalis DSM 20602(T) (98.9 % 16S rRNA gene sequence similarity) and Lactobacillus murinus ASF 361 (98.9 %). Subsequent polyphasic analysis, including automated ribotyping and DNA-DNA hybridization experiments, confirmed that the isolate represents a novel species, for which the name Lactobacillus apodemi sp. nov. is proposed. The DNA G+C content of the novel strain is 38.5 mol%. The cell-wall peptidoglycan is of type A4alpha L-lys-D-asp. The type strain is ASB1(T) (=DSM 16634(T)=CIP 108913(T)).

Molecular analysis of microflora associated with dentoalveolar abscesses.

PubMed Central

Dymock, D; Weightman, A J; Scully, C; Wade, W G

1996-01-01

The microflora associated with three dentoalveolar abscesses was determined by cultural and molecular methods. 16S rRNA genes were randomly amplified by means of conserved eubacterial primers and cloned. Restriction fragment length polymorphism analysis of the clones and amplified genes encoding 16S rRNA from the cultured bacteria was used to detect putative unculturable bacteria. Clones representative of five predominant groups of uncultured organisms were sequenced. Two were identified as Porphyromonas gingivalis and Prevotella oris, and one was found to be closely related to Peptostreptococcus micros. The remaining two clones did not correspond to known, previously sequenced organisms. One was related to Zoogloea ramigera, a species of aerobic waterborne organisms, while the other was distantly related to the genus Prevotella. This study has demonstrated the possibility of the characterization of microflora associated with human infection by molecular methods without the inherent biases of culture. PMID:8904410

Wickerhamomyces mori sp. nov., an anamorphic yeast species found in the guts of wood-boring insect larvae.

PubMed

Hui, Feng-Li; Chen, Liang; Chu, Xue-Ying; Niu, Qiu-Hong; Ke, Tao

2013-03-01

A novel anamorphic yeast species is described to accommodate three isolates recovered from the guts of three different wood-boring insect larvae collected in Henan, central China. On the basis of sequence analyses of the D1/D2 domains of the large-subunit rRNA gene and the internal transcribed spacer regions, the three strains are assigned to a novel species of the genus Wickerhamomyces, although the formation of ascospores was not observed. These strains also exhibited a number of distinct morphological and physiological characteristics that clearly differentiated them from Wickerhamomyces mucosus, Candida odintsovae and Wickerhamomyces rabaulensis, the most closely related species. In view of the phenotypic differences and unique rRNA gene sequences, we consider that these three isolates represent a novel species of the genus Wickerhamomyces, Wickerhamomyces mori sp. nov. The type strain is NYNU 1216(T) ( = CICC 1983(T)  = CBS 12678(T)).

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Matrix-Assisted Laser Desorption Ionization (MALDI)-Time of Flight Mass Spectrometry- and MALDI Biotyper-Based Identification of Cultured Biphenyl-Metabolizing Bacteria from Contaminated Horseradish Rhizosphere Soil▿

PubMed Central

Uhlik, Ondrej; Strejcek, Michal; Junkova, Petra; Sanda, Miloslav; Hroudova, Miluse; Vlcek, Cestmir; Mackova, Martina; Macek, Tomas

2011-01-01

Bacteria that are able to utilize biphenyl as a sole source of carbon were extracted and isolated from polychlorinated biphenyl (PCB)-contaminated soil vegetated by horseradish. Isolates were identified using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The usage of MALDI Biotyper for the classification of isolates was evaluated and compared to 16S rRNA gene sequence analysis. A wide spectrum of bacteria was isolated, with Arthrobacter, Serratia, Rhodococcus, and Rhizobium being predominant. Arthrobacter isolates also represented the most diverse group. The use of MALDI Biotyper in many cases permitted the identification at the level of species, which was not achieved by 16S rRNA gene sequence analyses. However, some isolates had to be identified by 16S rRNA gene analyses if MALDI Biotyper-based identification was at the level of probable or not reliable identification, usually due to a lack of reference spectra included in the database. Overall, this study shows the possibility of using MALDI-TOF MS and MALDI Biotyper for the fast and relatively nonlaborious identification/classification of soil isolates. At the same time, it demonstrates the dominant role of employing 16S rRNA gene analyses for the identification of recently isolated strains that can later fill the gaps in the protein-based identification databases. PMID:21821747

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Comparative molecular cytogenetics of major repetitive sequence families of three Dendrobium species (Orchidaceae) from Bangladesh

PubMed Central

Begum, Rabeya; Alam, Sheikh Shamimul; Menzel, Gerhard; Schmidt, Thomas

2009-01-01

Background and Aims Dendrobium species show tremendous morphological diversity and have broad geographical distribution. As repetitive sequence analysis is a useful tool to investigate the evolution of chromosomes and genomes, the aim of the present study was the characterization of repetitive sequences from Dendrobium moschatum for comparative molecular and cytogenetic studies in the related species Dendrobium aphyllum, Dendrobium aggregatum and representatives from other orchid genera. Methods In order to isolate highly repetitive sequences, a c0t-1 DNA plasmid library was established. Repeats were sequenced and used as probes for Southern hybridization. Sequence divergence was analysed using bioinformatic tools. Repetitive sequences were localized along orchid chromosomes by fluorescence in situ hybridization (FISH). Key Results Characterization of the c0t-1 library resulted in the detection of repetitive sequences including the (GA)n dinucleotide DmoO11, numerous Arabidopsis-like telomeric repeats and the highly amplified dispersed repeat DmoF14. The DmoF14 repeat is conserved in six Dendrobium species but diversified in representative species of three other orchid genera. FISH analyses showed the genome-wide distribution of DmoF14 in D. moschatum, D. aphyllum and D. aggregatum. Hybridization with the telomeric repeats demonstrated Arabidopsis-like telomeres at the chromosome ends of Dendrobium species. However, FISH using the telomeric probe revealed two pairs of chromosomes with strong intercalary signals in D. aphyllum. FISH showed the terminal position of 5S and 18S–5·8S–25S rRNA genes and a characteristic number of rDNA sites in the three Dendrobium species. Conclusions The repeated sequences isolated from D. moschatum c0t-1 DNA constitute major DNA families of the D. moschatum, D. aphyllum and D. aggregatum genomes with DmoF14 representing an ancient component of orchid genomes. Large intercalary telomere-like arrays suggest chromosomal rearrangements in D. aphyllum while the number and localization of rRNA genes as well as the species-specific distribution pattern of an abundant microsatellite reflect the genomic diversity of the three Dendrobium species. PMID:19635741

Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

PubMed

Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

2013-10-01

According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

PubMed

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

FunGene: the functional gene pipeline and repository.

PubMed

Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

2013-01-01

Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Pedobacter tournemirensis sp. nov., isolated from a fault water sample of a deep Toarcian argillite layer.

PubMed

Urios, Laurent; Intertaglia, Laurent; Magot, Michel

2013-01-01

A Gram-negative bacterium, designated TF5-37.2-LB10(T), was isolated from subsurface water of the Toarcian geological layer of Tournemire, France. Cells were non-motile straight rods that formed cream to light pink colonies on 10-fold diluted LB agar. Strain TF5-37.2-LB10(T) contained menaquinone 7 and its major fatty acids were iso-C(15 : 0), summed feature 3 (iso-C(15 : 0) 2-OH and/or C(16 : 1)ω7c), iso-C(17 : 0) 3-OH and iso-C(17 : 1)ω9c. The G+C content of the genomic DNA was 46 mol%. Phylogenetic analysis of the 16S rRNA gene sequence placed strain TF5-37.2-LB10(T) within the genus Pedobacter, family Sphingobacteriaceae. Pedobacter composti TR6-06(T) and Pedobacter oryzae DSM 19973(T) were the closest phylogenetic relatives (93.5 and 93.3 % 16S rRNA gene sequence similarity, respectively). On the basis of 16S rRNA gene sequence comparison and physiological and biochemical characteristics, strain TF5-37.2-LB10(T) represents a novel species of the genus Pedobacter, for which the name Pedobacter tournemirensis sp. nov. is proposed. The type strain is TF5-37.2-LB10(T) (= DSM 23085(T) = CIP 110085(T) = MOLA 820(T)).

Gaetbulicola byunsanensis gen. nov., sp. nov., isolated from tidal flat sediment.

PubMed

Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang

2010-01-01

A Gram-negative, non-motile and pleomorphic bacterial strain, SMK-114(T), which belongs to the class Alphaproteobacteria, was isolated from a tidal flat sample collected in Byunsan, Korea. Strain SMK-114(T) grew optimally at pH 7.0-8.0 and 25-30 degrees C and in the presence of 2 % (w/v) NaCl. A neighbour-joining phylogenetic tree based on 16S rRNA gene sequences showed that strain SMK-114(T) formed a cluster with Octadecabacter species, with which it exhibited 16S rRNA gene sequence similarity values of 95.2-95.4 %. This cluster was part of the clade comprising Thalassobius species with a bootstrap resampling value of 76.3 %. Strain SMK-114(T) exhibited 16S rRNA gene sequence similarity values of 95.1-96.3 % to members of the genus Thalassobius. It contained Q-10 as the predominant ubiquinone and C(18 : 1)omega7c as the major fatty acid. The DNA G+C content was 60.0 mol%. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-114(T) is considered to represent a novel species in a new genus for which the name Gaetbulicola byunsanensis gen. nov., sp. nov. is proposed. The type strain of Gaetbulicola byunsanensis is SMK-114(T) (=KCTC 22632(T) =CCUG 57612(T)).

Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

PubMed

Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

2009-04-01

Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

Insight into the validity of Leptobrachium guangxiense (Anura: Megophryidae): evidence from mitochondrial DNA sequences and morphological characters.

PubMed

Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming

2013-01-01

Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.

Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.

PubMed

López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco

2002-07-01

A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.

Saccharothrix ghardaiensis sp. nov., an actinobacterium isolated from Saharan soil.

PubMed

Bouznada, Khaoula; Bouras, Noureddine; Mokrane, Salim; Chaabane Chaouch, Fawzia; Zitouni, Abdelghani; Pötter, Gabriele; Spröer, Cathrin; Klenk, Hans-Peter; Sabaou, Nasserdine

2017-03-01

The taxonomic position of a new Saccharothrix strain, designated MB46 T , isolated from a Saharan soil sample collected in Mzab region (Ghardaïa province, South Algeria) was established following a polyphasic approach. The novel microorganism has morphological and chemical characteristics typical of the members of the genus Saccharothrix and formed a phyletic line at the periphery of the Saccharothrix espanaensis subcluster in the 16S rRNA gene dendrograms. Results of the 16S rRNA gene sequence comparisons revealed that strain MB46 T shares high degrees of similarity with S. espanaensis DSM 44229 T (99.2%), Saccharothrix variisporea DSM 43911 T (98.7%) and Saccharothrix texasensis NRRL B-16134 T (98.6%). However, the new strain exhibited only 12.5-17.5% DNA relatedness to the neighbouring Saccharothrix spp. On the basis of phenotypic characteristics, 16S rRNA gene sequence comparisons and DNA-DNA hybridizations, strain MB46 T is concluded to represent a novel species of the genus Saccharothrix, for which the name Saccharothrix ghardaiensis sp. nov. (type strain MB46 T  = DSM 46886 T  = CECT 9046 T ) is proposed.

Isolation and identification of multidrug-resistant Staphylococcus haemolyticus from a laboratory-breeding mouse.

PubMed

Huang, Fengying; Meng, Qiuping; Tan, Guanghong; Huang, Yonghao; Wang, Hua; Mei, Wenli; Dai, Haofu

2011-06-01

To analysis and identify a bacterium strain isolated from laboratory breeding mouse far away from a hospital. Phenotype of the isolate was investigated by conventional microbiological methods, including Gram-staining, colony morphology, tests for haemolysis, catalase, coagulase, and antimicrobial susceptibility test. The mecA and 16S rRNA genes were amplified by the polymerase chain reaction (PCR) and sequenced. The base sequence of the PCR product was compared with known 16S rRNA gene sequences in the GenBank database by phylogenetic analysis and multiple sequence alignment. The isolate in this study was a gram positive, coagulase negative, and catalase positive coccus. The isolate was resistant to oxacillin, methicillin, penicillin, ampicillin, cefazolin, ciprofloxacin erythromycin, et al. PCR results indicated that the isolate was mecA gene positive and its 16S rRNA was 1 465 bp. Phylogenetic analysis of the resultant 16S rRNA indicated the isolate belonged to genus Saphylococcus, and multiple sequence alignment showed that the isolate was Saphylococcus haemolyticus with only one base difference from the corresponding 16S rRNA deposited in the GenBank. 16S rRNA gene sequencing is a suitable technique for non-specialist researchers. Laboratory animals are possible sources of lethal pathogens, and researchers must adapt protective measures when they manipulate animals. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Polynucleobacter meluiroseus sp. nov., a bacterium isolated from a lake located in the mountains of the Mediterranean island of Corsica.

PubMed

Pitt, Alexandra; Schmidt, Johanna; Lang, Elke; Whitman, William B; Woyke, Tanja; Hahn, Martin W

2018-06-01

Strain AP-Melu-1000-B4 was isolated from a lake located in the mountains of the Mediterranean island of Corsica (France). Phenotypic, chemotaxonomic and genomic traits were investigated. Phylogenetic analyses based on 16S rRNA gene sequencing referred the strain to the cryptic species complex PnecC within the genus Polynucleobacter. The strain encoded genes for biosynthesis of proteorhodopsin and retinal. When pelleted by centrifugation the strain showed an intense rose colouring. Major fatty acids were C16 : 1ω7c, C16 : 0, C18 : 1ω7c and summed feature 2 (C16 : 1 isoI and C14 : 0-3OH). The sequence of the 16S rRNA gene contained an indel which was not present in any previously described Polynucleobacter species. Genome sequencing revealed a genome size of 1.89 Mbp and a G+C content of 46.6 mol%. In order to resolve the phylogenetic position of the new strain within subcluster PnecC, its phylogeny was reconstructed from sequences of 319 shared genes. To represent all currently described Polynucleobacter species by whole genome sequences, three type strains were additionally sequenced. Our phylogenetic analysis revealed that strain AP-Melu-100-B4 occupied a basal position compared with previously described PnecC strains. Pairwise determined whole genome average nucleotide identity (gANI) values suggested that strain AP-Melu-1000-B4 represents a new species, for which we propose the name Polynucleobacter meluiroseus sp. nov. with the type strain AP-Melu-1000-B4 T (=DSM 103591 T =CIP 111329 T ).

The Complete Mitochondrial DNA Sequence of Scenedesmus obliquus Reflects an Intermediate Stage in the Evolution of the Green Algal Mitochondrial Genome

PubMed Central

Nedelcu, Aurora M.; Lee, Robert W.; Lemieux, Claude; Gray, Michael W.; Burger, Gertraud

2000-01-01

Two distinct mitochondrial genome types have been described among the green algal lineages investigated to date: a reduced–derived, Chlamydomonas-like type and an ancestral, Prototheca-like type. To determine if this unexpected dichotomy is real or is due to insufficient or biased sampling and to define trends in the evolution of the green algal mitochondrial genome, we sequenced and analyzed the mitochondrial DNA (mtDNA) of Scenedesmus obliquus. This genome is 42,919 bp in size and encodes 42 conserved genes (i.e., large and small subunit rRNA genes, 27 tRNA and 13 respiratory protein-coding genes), four additional free-standing open reading frames with no known homologs, and an intronic reading frame with endonuclease/maturase similarity. No 5S rRNA or ribosomal protein-coding genes have been identified in Scenedesmus mtDNA. The standard protein-coding genes feature a deviant genetic code characterized by the use of UAG (normally a stop codon) to specify leucine, and the unprecedented use of UCA (normally a serine codon) as a signal for termination of translation. The mitochondrial genome of Scenedesmus combines features of both green algal mitochondrial genome types: the presence of a more complex set of protein-coding and tRNA genes is shared with the ancestral type, whereas the lack of 5S rRNA and ribosomal protein-coding genes as well as the presence of fragmented and scrambled rRNA genes are shared with the reduced–derived type of mitochondrial genome organization. Furthermore, the gene content and the fragmentation pattern of the rRNA genes suggest that this genome represents an intermediate stage in the evolutionary process of mitochondrial genome streamlining in green algae. [The sequence data described in this paper have been submitted to the GenBank data library under accession no. AF204057.] PMID:10854413

Phylogenetically Structured Differences in rRNA Gene Sequence Variation among Species of Arbuscular Mycorrhizal Fungi and Their Implications for Sequence Clustering

PubMed Central

Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.

2016-01-01

ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found that the amount of sequence variation in an rRNA gene that is commonly used to identify AM fungal species varied significantly between evolutionary groups that correspond to different genera, with the exception of two genera that are genetically indistinguishable from each other. When we clustered groups of similar sequences into operational taxonomic units (OTUs) using five different clustering methods, these patterns of sequence variation caused the number of OTUs to either over- or underestimate the actual number of AM fungal species, depending on the genus. Our results indicate that OTU-based inferences about AM fungal species composition from environmental sequences can be improved if they take these taxonomically structured patterns of sequence variation into account. PMID:27260357

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Neisseria arctica sp. nov. isolated from nonviable eggs of greater white-fronted geese (Anser albifrons) in Arctic Alaska

USGS Publications Warehouse

Hansen, Cristina M.; Himschoot, Elizabeth; Hare, Rebekah F.; Meixell, Brandt W.; Van Hemert, Caroline R.; Hueffer, Karsten

2017-01-01

During the summers of 2013 and 2014, isolates of a novel Gram-negative coccus in the Neisseria genus were obtained from the contents of nonviable greater white-fronted goose (Anser albifrons) eggs on the Arctic Coastal Plain of Alaska. We used a polyphasic approach to determine whether these isolates represent a novel species. 16S rRNA gene sequences, 23S rRNA gene sequences, and chaperonin 60 gene sequences suggested that these Alaskan isolates are members of a distinct species that is most closely related to Neisseria canis, N. animaloris, and N. shayeganii. Analysis of the rplF gene additionally showed that our isolates are unique and most closely related to N. weaveri. Average nucleotide identity of the whole genome sequence of our type strain was between 71.5% and 74.6% compared to close relatives, further supporting designation as a novel species. Fatty acid methyl ester analysis showed a predominance of C14:0, C16:0, and C16:1ω7c fatty acids. Finally, biochemical characteristics distinguished our isolates from other Neisseria species. The name Neisseria arctica (type strain KH1503T = ATCC TSD-57T = DSM 103136T) is proposed.

Identification, characterization and description of Arcobacter faecis sp. nov., isolated from a human waste septic tank.

PubMed

Whiteduck-Léveillée, Kerri; Whiteduck-Léveillée, Jenni; Cloutier, Michel; Tambong, James T; Xu, Renlin; Topp, Edward; Arts, Michael T; Chao, Jerry; Adam, Zaky; Lévesque, C André; Lapen, David R; Villemur, Richard; Khan, Izhar U H

2016-03-01

A study on the taxonomic classification of Arcobacter species was performed on the cultures isolated from various fecal sources where an Arcobacter strain AF1078(T) from human waste septic tank near Ottawa, Ontario, Canada was characterized using a polyphasic approach. Genetic investigations including 16S rRNA, atpA, cpn60, gyrA, gyrB and rpoB gene sequences of strain AF1078(T) are unique in comparison with other arcobacters. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the strain is most closely related to Arcobacter lanthieri and Arcobacter cibarius. Analyses of atpA, cpn60, gyrA, gyrB and rpoB gene sequences suggested that strain AF1078(T) formed a phylogenetic lineage independent of other species in the genus. Whole-genome sequence, DNA-DNA hybridization, fatty acid profile and phenotypic analysis further supported the conclusion that strain AF1078(T) represents a novel Arcobacter species, for which the name Arcobacter faecis sp. nov. is proposed, with type strain AF1078(T) (=LMG 28519(T); CCUG 66484(T)). Crown Copyright © 2015. Published by Elsevier GmbH. All rights reserved.

A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari.

PubMed

Hirayama, Junichi; Tazumi, Akihiro; Hayashi, Kyohei; Tasaki, Erina; Kuribayashi, Takashi; Moore, John E; Millar, Beverley C; Matsuda, Motoo

2011-06-01

In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

PubMed

Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

2013-09-01

Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

Streptococcus caprae sp. nov., isolated from Iberian ibex (Capra pyrenaica hispanica).

PubMed

Vela, A I; Mentaberre, G; Lavín, S; Domínguez, L; Fernández-Garayzábal, J F

2016-01-01

Biochemical and molecular genetic studies were performed on a novel Gram-stain-positive, catalase-negative, coccus-shaped organism isolated from tonsil samples of two Iberian ibexes. The micro-organism was identified as a streptococcal species based on its cellular, morphological and biochemical characteristics. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus, but the organism did not correspond to any species of this genus. The nearest phylogenetic relative of the unknown coccus from ibex was Streptococcus porci 2923-03T (96.6 % 16S rRNA gene sequence similarity). Analysis based on rpoB and sodA gene sequences revealed sequence similarity values lower than 86.0 and 83.8 %, respectively, from the type strains of recognized Streptococcus species. The novel bacterial isolate was distinguished from Streptococcus porci and other Streptococcus species using biochemical tests. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as representing a novel species of the genus Streptococcus, for which the name Streptococcus caprae sp. nov. is proposed. The type strain is DICM07-02790-1CT ( = CECT 8872T = CCUG 67170T).

Tetrahymena australis (Protozoa, Ciliophora): A Well-Known But "Non-Existing" Taxon - Consideration of Its Identification, Definition and Systematic Position.

PubMed

Liu, Mingjian; Fan, Xinpeng; Gao, Feng; Gao, Shan; Yu, Yuhe; Warren, Alan; Huang, Jie

2016-11-01

A cryptic species of the Tetrahymena pyriformis complex, Tetrahymena australis, has been known for a long time but never properly diagnosed based on taxonomic methods. The species name is thus invalid according to the International Code of Zoological Nomenclature. Recently, a population isolated from a freshwater lake in Wuhan, China was investigated using live observations, silver staining methods and gene sequence data. This organism can be separated from other described species of the T. pyriformis complex by its relatively small body size, the number of somatic kineties and differences in sequences of two genes, namely the small subunit ribosomal RNA (SSU rRNA) and the mitochondrial cytochrome c oxidase subunit I (cox1). We compared the SSU rRNA gene sequences of all available Tetrahymena species to reveal the nucleotide differences within this genus. The sequence of the Wuhan population is identical to two sequences of a previously isolated strain of T. australis (ATCC #30831). Phylogenetic analyses indicate that these three sequences (X56167, M98015, KT334373) cluster with Tetrahymena shanghaiensis (EF070256) in a polytomy. However, sequence divergence of the cox1 gene between the Wuhan population and another strain of T. australis (ATCC #30271) is 1.4%, suggesting that these may represent different subspecies. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

USDA-ARS?s Scientific Manuscript database

Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

Chromosomal Organization of Rrna Operons in Bacillus Subtilis

PubMed Central

Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

1988-01-01

Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

Diversity, ecological distribution and biotechnological potential of Actinobacteria inhabiting seamounts and non-seamounts in the Tyrrhenian Sea.

PubMed

Ettoumi, Besma; Chouchane, Habib; Guesmi, Amel; Mahjoubi, Mouna; Brusetti, Lorenzo; Neifar, Mohamed; Borin, Sara; Daffonchio, Daniele; Cherif, Ameur

2016-01-01

In the present study, the ecological distribution of marine Actinobacteria isolated from seamount and non-seamount stations in the Tyrrhenian Sea was investigated. A collection of 110 isolates was analyzed by Automated Ribosomal Intergenic Spacer Analysis (ARISA) and 16S rRNA gene sequencing of representatives for each ARISA haplotype (n=49). Phylogenetic analysis of 16S rRNA sequences showed a wide diversity of marine isolates and clustered the strains into 11 different genera, Janibacter, Rhodococcus, Arthrobacter, Kocuria, Dietzia, Curtobacterium, Micrococcus, Citricoccus, Brevibacterium, Brachybacterium and Nocardioides. Interestingly, Janibacter limosus was the most encountered species particularly in seamounts stations, suggesting that it represents an endemic species of this particular ecosystem. The application of BOX-PCR fingerprinting on J. limosus sub-collection (n=22), allowed their separation into seven distinct BOX-genotypes suggesting a high intraspecific microdiversity among the collection. Furthermore, by screening the biotechnological potential of selected actinobacterial strains, J. limosus was shown to exhibit the most important biosurfactant activity. Our overall data indicates that Janibacter is a major and active component of seamounts in the Tyrrhenian Sea adapted to low nutrient ecological niche. Copyright © 2016 Elsevier GmbH. All rights reserved.

Bradyrhizobium sacchari sp. nov., a legume nodulating bacterium isolated from sugarcane roots.

PubMed

de Matos, Gustavo Feitosa; Zilli, Jerri Edson; de Araújo, Jean Luiz Simões; Parma, Marcia Maria; Melo, Itamar Soares; Radl, Viviane; Baldani, José Ivo; Rouws, Luc Felicianus Marie

2017-11-01

Members of the genus Bradyrhizobium are well-known as nitrogen-fixing microsymbionts of a wide variety of leguminous species, but they have also been found in different environments, notably as endophytes in non-legumes such as sugarcane. This study presents a detailed polyphasic characterization of four Bradyrhizobium strains (type strain BR 10280 T ), previously isolated from roots of sugarcane in Brazil. 16S rRNA sequence analysis, multilocus sequence analysis (MLSA) and analysis of the 16S-23S rRNA internal transcribed spacer showed that these strains form a novel clade close to, but different from B. huanghuaihaiense strain CCBAU 23303 T . Average nucleotide identity (ANI) analyses confirmed that BR 10280 T represents a novel species. Phylogenetic analysis based on nodC gene sequences also placed the strains close to CCBAU 23303 T , but different from this latter strain, the sugarcane strains did not nodulate soybean, although they effectively nodulated Vigna unguiculata, Cajanus cajan and Macroptilium atropurpureum. Physiological traits are in agreement with the placement of the strains in the genus Bradyrhizobium as a novel species for which the name Bradyrhizobium sacchari sp. nov. is proposed.

Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

PubMed

Chun, J; Huq, A; Colwell, R R

1999-05-01

Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.

PubMed

Broderick, Nichole A; Raffa, Kenneth F; Goodman, Robert M; Handelsman, Jo

2004-01-01

Little is known about bacteria associated with Lepidoptera, the large group of mostly phytophagous insects comprising the moths and butterflies. We inventoried the larval midgut bacteria of a polyphagous foliivore, the gypsy moth (Lymantria dispar L.), whose gut is highly alkaline, by using traditional culturing and culture-independent methods. We also examined the effects of diet on microbial composition. Analysis of individual third-instar larvae revealed a high degree of similarity of microbial composition among insects fed on the same diet. DNA sequence analysis indicated that most of the PCR-amplified 16S rRNA genes belong to the gamma-Proteobacteria and low G+C gram-positive divisions and that the cultured members represented more than half of the phylotypes identified. Less frequently detected taxa included members of the alpha-Proteobacterium, Actinobacterium, and Cytophaga/Flexibacter/Bacteroides divisions. The 16S rRNA gene sequences from 7 of the 15 cultured organisms and 8 of the 9 sequences identified by PCR amplification diverged from previously reported bacterial sequences. The microbial composition of midguts differed substantially among larvae feeding on a sterilized artificial diet, aspen, larch, white oak, or willow. 16S rRNA analysis of cultured isolates indicated that an Enterococcus species and culture-independent analysis indicated that an Entbacter sp. were both present in all larvae, regardless of the feeding substrate; the sequences of these two phylotypes varied less than 1% among individual insects. These results provide the first comprehensive description of the microbial diversity of a lepidopteran midgut and demonstrate that the plant species in the diet influences the composition of the gut bacterial community.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackrel, Sara L.; Owens, Sarah M.; Gilbert, Jack A.

Plants in terrestrial and aquatic environments contain a diverse microbiome. Yet, the chloroplast and mitochondria organelles of the plant eukaryotic cell originate from free-living cyanobacteria and Rickettsiales. This represents a challenge for sequencing the plant microbiome with universal primers, as ~99% of 16S rRNA sequences may consist of chloroplast and mitochondrial sequences. Peptide nucleic acid clamps offer a potential solution by blocking amplification of host-associated sequences. We assessed the efficacy of chloroplast and mitochondria-blocking clamps against a range of microbial taxa from soil, freshwater and marine environments. While we found that the mitochondrial blocking clamps appear to be a robustmore » method for assessing animal-associated microbiota, Proteobacterial 16S rRNA binds to the chloroplast-blocking clamp, resulting in a strong sequencing bias against this group. We attribute this bias to a conserved 14-bp sequence in the Proteobacteria that matches the 17-bp chloroplast-blocking clamp sequence. By scanning the Greengenes database, we provide a reference list of nearly 1500 taxa that contain this 14-bp sequence, including 48 families such as the Rhodobacteraceae, Phyllobacteriaceae, Rhizobiaceae, Kiloniellaceae and Caulobacteraceae. To determine where these taxa are found in nature, we mapped this taxa reference list against the Earth Microbiome Project database. These taxa are abundant in a variety of environments, particularly aquatic and semiaquatic freshwater and marine habitats. To facilitate informed decisions on effective use of organelle-blocking clamps, we provide a searchable database of microbial taxa in the Greengenes and Silva databases matching various n-mer oligonucleotides of each PNA sequence.« less

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Paenibacillus phoenicis sp. nov., isolated from the Phoenix Lander assembly facility and a subsurface molybdenum mine.

PubMed

Benardini, James N; Vaishampayan, Parag A; Schwendner, Petra; Swanner, Elizabeth; Fukui, Youhei; Osman, Sharif; Satomi, Masakata; Venkateswaran, Kasthuri

2011-06-01

A novel Gram-positive, motile, endospore-forming, aerobic bacterium was isolated from the NASA Phoenix Lander assembly clean room that exhibits 100 % 16S rRNA gene sequence similarity to two strains isolated from a deep subsurface environment. All strains are rod-shaped, endospore-forming bacteria, whose endospores are resistant to UV radiation up to 500 J m(-2). A polyphasic taxonomic study including traditional phenotypic tests, fatty acid analysis, 16S rRNA gene sequencing and DNA-DNA hybridization analysis was performed to characterize these novel strains. The 16S rRNA gene sequencing convincingly grouped these novel strains within the genus Paenibacillus as a separate cluster from previously described species. The similarity of 16S rRNA gene sequences among the novel strains was identical but only 98.1 to 98.5 % with their nearest neighbours Paenibacillus barengoltzii ATCC BAA-1209(T) and Paenibacillus timonensis CIP 108005(T). The menaquinone MK-7 was dominant in these novel strains as shown in other species of the genus Paenibacillus. The DNA-DNA hybridization dissociation value was <45 % with the closest related species. The novel strains had DNA G+C contents of 51.9 to 52.8 mol%. Phenotypically, the novel strains can be readily differentiated from closely related species by the absence of urease and gelatinase and the production of acids from a variety of sugars including l-arabinose. The major fatty acid was anteiso-C(15 : 0) as seen in P. barengoltzii and P. timonensis whereas the proportion of C(16 : 0) was significantly different from the closely related species. Based on phylogenetic and phenotypic results, it was concluded that these strains represent a novel species of the genus Paenibacillus, for which the name Paenibacillus phoenicis sp. nov. is proposed. The type strain is 3PO2SA(T) ( = NRRL B-59348(T)  = NBRC 106274(T)).

Genotypic variations in field isolates of Theileria species infecting giraffes (Giraffa camelopardalis tippelskirchi and Giraffa camelopardalis reticulata) in Kenya.

PubMed

Githaka, Naftaly; Konnai, Satoru; Skilton, Robert; Kariuki, Edward; Kanduma, Esther; Murata, Shiro; Ohashi, Kazuhiko

2013-10-01

Recently, mortalities among giraffes, attributed to infection with unique species of piroplasms were reported in South Africa. Although haemoparasites are known to occur in giraffes of Kenya, the prevalence, genetic diversity and pathogenicity of these parasites have not been investigated. In this study, blood samples from 13 giraffes in Kenya were investigated microscopically and genomic DNA extracted. PCR amplicons of the hyper-variable region 4 (V4) of Theileria spp. small subunit ribosomal RNA (18S rRNA) gene were hybridized to a panel of genus- and species-specific oligonucleotide probes by reverse line blot (RLB). Two newly designed oligonucleotide probes specific for previously identified Theileria spp. of giraffes found single infections in eight of the specimens and mixed infections in the remaining five samples. Partial 18S rRNA genes were successfully amplified from 9 samples and the PCR amplicons were cloned. A total of 28 plasmid clones representing the Kenyan isolates were analyzed in the present study and compared with those of closely-related organisms retrieved from GenBank. In agreement with RLB results, the nucleotide sequence alignment indicated the presence of mixed infections in the giraffes. In addition, sequence alignment with the obtained 18S rRNA gene sequences revealed extensive microheterogeneities within and between isolates, characterized by indels in the V4 regions and point mutations outside this region. Phylogeny with 18S rRNA gene sequences from the detected parasites and those of related organisms places Theileria of giraffes into two major groups, within which are numerous clades that include the isolates reported in South Africa. Collectively, these data suggest the existence of at least two distinct Theileria species among giraffes, and extensive genetic diversity within the two parasite groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Novel magnetite-producing magnetotactic bacteria belonging to the Gammaproteobacteria.

PubMed

Lefèvre, Christopher T; Viloria, Nathan; Schmidt, Marian L; Pósfai, Mihály; Frankel, Richard B; Bazylinski, Dennis A

2012-02-01

Two novel magnetotactic bacteria (MTB) were isolated from sediment and water collected from the Badwater Basin, Death Valley National Park and southeastern shore of the Salton Sea, respectively, and were designated as strains BW-2 and SS-5, respectively. Both organisms are rod-shaped, biomineralize magnetite, and are motile by means of flagella. The strains grow chemolithoautotrophically oxidizing thiosulfate and sulfide microaerobically as electron donors, with thiosulfate oxidized stoichiometrically to sulfate. They appear to utilize the Calvin-Benson-Bassham cycle for autotrophy based on ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) activity and the presence of partial sequences of RubisCO genes. Strains BW-2 and SS-5 biomineralize chains of octahedral magnetite crystals, although the crystals of SS-5 are elongated. Based on 16S rRNA gene sequences, both strains are phylogenetically affiliated with the Gammaproteobacteria class. Strain SS-5 belongs to the order Chromatiales; the cultured bacterium with the highest 16S rRNA gene sequence identity to SS-5 is Thiohalocapsa marina (93.0%). Strain BW-2 clearly belongs to the Thiotrichales; interestingly, the organism with the highest 16S rRNA gene sequence identity to this strain is Thiohalospira alkaliphila (90.2%), which belongs to the Chromatiales. Each strain represents a new genus. This is the first report of magnetite-producing MTB phylogenetically associated with the Gammaproteobacteria. This finding is important in that it significantly expands the phylogenetic diversity of the MTB. Physiology of these strains is similar to other MTB and continues to demonstrate their potential in nitrogen, iron, carbon and sulfur cycling in natural environments.

Cultivable Anaerobic Microbiota of Severe Early Childhood Caries▿¶

PubMed Central

Tanner, A. C. R.; Mathney, J. M. J.; Kent, R. L.; Chalmers, N. I.; Hughes, C. V.; Loo, C. Y.; Pradhan, N.; Kanasi, E.; Hwang, J.; Dahlan, M. A.; Papadopolou, E.; Dewhirst, F. E.

2011-01-01

Severe early childhood caries (ECC), while strongly associated with Streptococcus mutans using selective detection (culture, PCR), has also been associated with a widely diverse microbiota using molecular cloning approaches. The aim of this study was to evaluate the microbiota of severe ECC using anaerobic culture. The microbial composition of dental plaque from 42 severe ECC children was compared with that of 40 caries-free children. Bacterial samples were cultured anaerobically on blood and acid (pH 5) agars. Isolates were purified, and partial sequences for the 16S rRNA gene were obtained from 5,608 isolates. Sequence-based analysis of the 16S rRNA isolate libraries from blood and acid agars of severe ECC and caries-free children had >90% population coverage, with greater diversity occurring in the blood isolate library. Isolate sequences were compared with taxon sequences in the Human Oral Microbiome Database (HOMD), and 198 HOMD taxa were identified, including 45 previously uncultivated taxa, 29 extended HOMD taxa, and 45 potential novel groups. The major species associated with severe ECC included Streptococcus mutans, Scardovia wiggsiae, Veillonella parvula, Streptococcus cristatus, and Actinomyces gerensceriae. S. wiggsiae was significantly associated with severe ECC children in the presence and absence of S. mutans detection. We conclude that anaerobic culture detected as wide a diversity of species in ECC as that observed using cloning approaches. Culture coupled with 16S rRNA identification identified over 74 isolates for human oral taxa without previously cultivated representatives. The major caries-associated species were S. mutans and S. wiggsiae, the latter of which is a candidate as a newly recognized caries pathogen. PMID:21289150

Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

NASA Technical Reports Server (NTRS)

Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

1994-01-01

When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

Candida andamanensis sp. nov., Candida laemsonensis sp. nov. and Candida ranongensis sp. nov., anamorphic yeast species isolated from estuarine waters in a Thai mangrove forest.

PubMed

Am-In, Somjit; Limtong, Savitree; Yongmanitchai, Wichien; Jindamorakot, Sasitorn

2011-02-01

Five strains (RV5(T), RV140, R31(T), RS17 and RS28(T)) representing three novel anamorphic ascomycetous yeast species were isolated by membrane filtration from estuarine waters collected from a mangrove forest in Laem Son National Park, Ranong Province, Thailand, on different occasions. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and the internal transcribed spacer region and phylogenetic analysis, three strains were found to represent two novel Candida species. Two strains (RV5(T) and RV140) represented a single novel species, for which the name Candida laemsonensis sp. nov. is proposed. The type strain is RV5(T) (=BCC 35154(T) =NBRC 105873(T) =CBS 11419(T)). Strain R31(T) was assigned to a novel species that was named Candida andamanensis sp. nov. (type strain R31(T) =BCC 25965(T) =NBRC 103862(T) =CBS 10859(T)). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, sequence analysis of the D1/D2 domain of the large-subunit rRNA gene and phylogenetic analysis, strains RS17 and RS28(T) represented another novel species of Candida, for which the name Candida ranongensis sp. nov. is proposed. The type strain is RS28(T) (=BCC 25964(T) =NBRC 103861(T) =CBS 10861(T)).

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

PubMed Central

Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

2011-01-01

Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages, identified in diverse environments. PMID:22174774

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

Campylobacter geochelonis sp. nov. isolated from the western Hermann's tortoise (Testudo hermanni hermanni).

PubMed

Piccirillo, Alessandra; Niero, Giulia; Calleros, Lucía; Pérez, Ruben; Naya, Hugo; Iraola, Gregorio

2016-09-01

During a screening study to determine the presence of species of the genus Campylobacter in reptiles, three putative strains (RC7, RC11 and RC20T) were isolated from different individuals of the western Hermann's tortoise (Testudo hermanni hermanni). Initially, these isolates were characterized as representing Campylobacterfetus subsp. fetus by multiplex PCR and partial 16S rRNA gene sequence analysis. Further whole- genome characterization revealed considerable differences compared to other Campylobacter species. A polyphasic study was then undertaken to determine the exact taxonomic position of the isolates. The three strains were characterized by conventional phenotypic tests and whole genome sequencing. We generated robust phylogenies that showed a distinct clade containing only these strains using the 16S rRNA and atpA genes and a set of 40 universal proteins. Our phylogenetic analysis demonstrates their designation as representing a novel species and this was further confirmed using whole- genome average nucleotide identity within the genus Campylobacter (~80 %). Compared to most Campylobacter species, these strains hydrolysed hippurate, and grew well at 25 °C but not at 42 °C. Phenotypic and genetic analyses demonstrate that the three Campylobacter strains isolated from the western Hermann's tortoise represent a novel species within the genus Campylobacter, for which the name Campylobactergeochelonis sp. nov. is proposed, with RC20T (=DSM 102159T=LMG 29375T) as the type strain.

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

PubMed

Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

2016-03-01

Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

PubMed Central

Petti, C. A.; Polage, C. R.; Schreckenberger, P.

2005-01-01

Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

PubMed Central

Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

1999-01-01

The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

An endangered oasis of aquatic microbial biodiversity in the Chihuahuan desert

PubMed Central

Souza, Valeria; Espinosa-Asuar, Laura; Escalante, Ana E.; Eguiarte, Luis E.; Farmer, Jack; Forney, Larry; Lloret, Lourdes; Rodríguez-Martínez, Juan M.; Soberón, Xavier; Dirzo, Rodolfo; Elser, James J.

2006-01-01

The Cuatro Cienegas basin in the Chihuahuan desert is a system of springs, streams, and pools. These ecosystems support >70 endemic species and abundant living stromatolites and other microbial communities, representing a desert oasis of high biodiversity. Here, we combine data from molecular microbiology and geology to document the microbial biodiversity of this unique environment. Ten water samples from locations within the Cuatro Cienegas basin and two neighboring valleys as well as three samples of wet sediments were analyzed. The phylogeny of prokaryotic populations in the samples was determined by characterizing cultured organisms and by PCR amplification and sequencing of 16S rRNA genes from total community DNA. The composition of microbial communities was also assessed by determining profiles of terminal restriction site polymorphisms of 16S rRNA genes in total community DNA. There were 250 different phylotypes among the 350 cultivated strains. Ninety-eight partial 16S rRNA gene sequences were obtained and classified. The clones represented 38 unique phylotypes from ten major lineages of Bacteria and one of Archaea. Unexpectedly, 50% of the phylotypes were most closely related to marine taxa, even though these environments have not been in contact with the ocean for tens of millions of years. Furthermore, terminal restriction site polymorphism profiles and geological data suggest that the aquatic ecosystems of Cuatro Cienegas are hydrologically interconnected with adjacent valleys recently targeted for agricultural intensification. The findings underscore the conservation value of desert aquatic ecosystems and the urgent need for study and preservation of freshwater microbial communities. PMID:16618921

Influence of Molecular Resolution on Sequence-Based Discovery of Ecological Diversity among Synechococcus Populations in an Alkaline Siliceous Hot Spring Microbial Mat ▿ †

PubMed Central

Melendrez, Melanie C.; Lange, Rachel K.; Cohan, Frederick M.; Ward, David M.

2011-01-01

Previous research has shown that sequences of 16S rRNA genes and 16S-23S rRNA internal transcribed spacer regions may not have enough genetic resolution to define all ecologically distinct Synechococcus populations (ecotypes) inhabiting alkaline, siliceous hot spring microbial mats. To achieve higher molecular resolution, we studied sequence variation in three protein-encoding loci sampled by PCR from 60°C and 65°C sites in the Mushroom Spring mat (Yellowstone National Park, WY). Sequences were analyzed using the ecotype simulation (ES) and AdaptML algorithms to identify putative ecotypes. Between 4 and 14 times more putative ecotypes were predicted from variation in protein-encoding locus sequences than from variation in 16S rRNA and 16S-23S rRNA internal transcribed spacer sequences. The number of putative ecotypes predicted depended on the number of sequences sampled and the molecular resolution of the locus. Chao estimates of diversity indicated that few rare ecotypes were missed. Many ecotypes hypothesized by sequence analyses were different in their habitat specificities, suggesting different adaptations to temperature or other parameters that vary along the flow channel. PMID:21169433

Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

PubMed

Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

2016-05-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Skin microbiome surveys are strongly influenced by experimental design

PubMed Central

Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

2016-01-01

Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

Streptococcus bovimastitidis sp. nov., isolated from a dairy cow with mastitis.

PubMed

de Vries, Stefan P W; Hadjirin, Nazreen F; Lay, Elizabeth M; Zadoks, Ruth N; Peacock, Sharon J; Parkhill, Julian; Grant, Andrew J; McDougall, Scott; Holmes, Mark A

2018-01-01

Here we describe a new species of the genus Streptococcus that was isolated from a dairy cow with mastitis in New Zealand. Strain NZ1587 T was Gram-positive, coccus-shaped and arranged as chains, catalase and coagulase negative, γ-haemolytic and negative for Lancefield carbohydrates (A-D, F and G). The 16S rRNA sequence did not match sequences in the NCBI 16S rRNA or GreenGenes databases. Taxonomic classification of strain NZ1587 T was investigated using 16S rRNA and core genome phylogeny, genome-wide average nucleotide identity (ANI) and predicted DNA-DNA hybridisation (DDH) analyses. Phylogeny based on 16S rRNA was unable to resolve the taxonomic position of strain NZ1587 T , however NZ1587 T shared 99.4 % identity at the 16S rRNA level with a distinct branch of S. pseudoporcinus. Importantly, core genome phylogeny demonstrated that NZ1587 T grouped amongst the 'pyogenic' streptococcal species and formed a distinct branch supported by a 100 % bootstrap value. In addition, average nucleotide identity and inferred DNA-DNA hybridisation analyses showed that NZ1587 T represents a novel species. Biochemical profiling using the rapid ID 32 strep identification test enabled differentiation of strain NZ1587 T from closely related streptococcal species. In conclusion, strain NZ1587 T can be classified as a novel species, and we propose a novel taxon named Streptococcus bovimastitidis sp. nov.; the type strain is NZ1587 T . NZ1587 T has been deposited in the Culture Collection University of Gothenburg (CCUG 69277 T ) and the Belgian Co-ordinated Collections of Micro-organisms/LMG (LMG 29747).

Phylogenetic position and emended description of the genus Methylovorus.

PubMed

Doronina, Nina V; Ivanova, Ekaterina G; Trotsenko, Yuri A

2005-03-01

The genus Methylovorus, currently represented by the restricted facultative methylotroph Methylovorus glucosotrophus Govorukhina and Trotsenko 1991 and the obligate methylotroph Methylovorus mays Doronina et al. 2001, is here established by direct sequencing of amplified 16S rRNA genes and DNA-DNA hybridization to be clearly separated from the extant ribulose monophosphate (RuMP) pathway methylobacteria and to form a distinct branch within the beta-Proteobacteria.

Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

PubMed

Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

2016-12-15

Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

PubMed

Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

2005-04-11

We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger salamander complex species also produced robustly supported trees. The D-loop, used in previous molecular phylogenetic studies of the complex, was found to contain a relatively low level of variation and we identified mitochondrial regions with higher rates of molecular evolution that are more useful in resolving relationships among species. Our results show the benefit of using complete genome mitochondrial information in studies of recently and rapidly diverged taxa.

Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

2010-01-01

Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

Two new anamorphic yeasts species, Cyberlindnera samutprakarnensis sp. nov. and Candida thasaenensis sp. nov., isolated from industrial wastes in Thailand.

PubMed

Poomtien, Jamroonsri; Jindamorakot, Sasitorn; Limtong, Savitree; Pinphanichakarn, Pairoh; Thaniyavarn, Jiraporn

2013-01-01

Three yeast strains were isolated from industrial wastes in Thailand. Based on the phylogenetic sequence analysis of the D1/D2 region of the large subunit rRNA gene, the internal transcribed spacer (ITS1-5.8S rRNA gene-ITS2; ITS1-2) region, and their physiological characteristics, the three strains were found to represent two novel species of the ascomycetous anamorphic yeast. Strain JP52(T) represent a novel species which was named Cyberlindnera samutprakarnensis sp. nov. (type strain JP52(T); = BCC 46825(T) = JCM 17816(T) = CBS 12528(T), MycoBank no. MB800879), which was differentiated from the closely related species Cyberlindnera mengyuniae CBS 10845(T) by 2.9 % sequence divergence in the D1/D2 region and 4.4 % sequence divergence in the ITS1-2. Strain JP59(T) and JP60 were identical in their D1/D2 and ITS1-2 regions, which were closely related to those of Scheffersomyces spartinae CBS 6059(T) by 0.9 and 1.0 % sequence divergence, respectively. In addition, supportive evidence of actin gene and translational elongation factor gene by sequence divergence of 6.5 % each confirmed their distinct status. Furthermore, JP59(T) and JP60 differentiated from the closely related species in some biochemical and physiological characteristics. These two strains were assigned as a single novel species which was named Candida thasaenensis sp. nov. (type JP59(T) = BCC 46828(T) = JCM 17817(T) = CBS 12529(T), MycoBank no. MB800880).

DNA-based stable isotope probing coupled with cultivation methods implicates Methylophaga in hydrocarbon degradation

PubMed Central

Mishamandani, Sara; Gutierrez, Tony; Aitken, Michael D.

2014-01-01

Marine hydrocarbon-degrading bacteria perform a fundamental role in the oxidation and ultimate removal of crude oil and its petrochemical derivatives in coastal and open ocean environments. Those with an almost exclusive ability to utilize hydrocarbons as a sole carbon and energy source have been found confined to just a few genera. Here we used stable isotope probing (SIP), a valuable tool to link the phylogeny and function of targeted microbial groups, to investigate hydrocarbon-degrading bacteria in coastal North Carolina sea water (Beaufort Inlet, USA) with uniformly labeled [13C]n-hexadecane. The dominant sequences in clone libraries constructed from 13C-enriched bacterial DNA (from n-hexadecane enrichments) were identified to belong to the genus Alcanivorax, with ≤98% sequence identity to the closest type strain—thus representing a putative novel phylogenetic taxon within this genus. Unexpectedly, we also identified 13C-enriched sequences in heavy DNA fractions that were affiliated to the genus Methylophaga. This is a contentious group since, though some of its members have been proposed to degrade hydrocarbons, substantive evidence has not previously confirmed this. We used quantitative PCR primers targeting the 16S rRNA gene of the SIP-identified Alcanivorax and Methylophaga to determine their abundance in incubations amended with unlabeled n-hexadecane. Both showed substantial increases in gene copy number during the experiments. Subsequently, we isolated a strain representing the SIP-identified Methylophaga sequences (99.9% 16S rRNA gene sequence identity) and used it to show, for the first time, direct evidence of hydrocarbon degradation by a cultured Methylophaga sp. This study demonstrates the value of coupling SIP with cultivation methods to identify and expand on the known diversity of hydrocarbon-degrading bacteria in the marine environment. PMID:24578702

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Creation of a data base for sequences of ribosomal nucleic acids and detection of conserved restriction endonucleases sites through computerized processing.

PubMed Central

Patarca, R; Dorta, B; Ramirez, J L

1982-01-01

As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402

Diversity and community composition of methanogenic archaea in the rumen of Scottish upland sheep assessed by different methods.

PubMed

Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John

2014-01-01

Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Metataxonomics reveal vultures as a reservoir for Clostridium perfringens.

PubMed

Meng, Xiangli; Lu, Shan; Yang, Jing; Jin, Dong; Wang, Xiaohong; Bai, Xiangning; Wen, Yumeng; Wang, Yiting; Niu, Lina; Ye, Changyun; Rosselló-Móra, Ramon; Xu, Jianguo

2017-02-22

The Old World vulture may carry and spread pathogens for emerging infections since they feed on the carcasses of dead animals and participate in the sky burials of humans, some of whom have died from communicable diseases. Therefore, we studied the precise fecal microbiome of the Old World vulture with metataxonomics, integrating the high-throughput sequencing of almost full-length small subunit ribosomal RNA (16S rRNA) gene amplicons in tandem with the operational phylogenetic unit (OPU) analysis strategy. Nine vultures of three species were sampled using rectal swabs on the Qinghai-Tibet Plateau, China. Using the Pacific Biosciences sequencing platform, we obtained 54 135 high-quality reads of 16S rRNA amplicons with an average of 1442±6.9 bp in length and 6015±1058 reads per vulture. Those sequences were classified into 314 OPUs, including 102 known species, 50 yet to be described species and 161 unknown new lineages of uncultured representatives. Forty-five species have been reported to be responsible for human outbreaks or infections, and 23 yet to be described species belong to genera that include pathogenic species. Only six species were common to all vultures. Clostridium perfringens was the most abundant and present in all vultures, accounting for 30.8% of the total reads. Therefore, using the new technology, we found that vultures are an important reservoir for C. perfringens as evidenced by the isolation of 107 strains encoding for virulence genes, representing 45 sequence types. Our study suggests that the soil-related C. perfringens and other pathogens could have a reservoir in vultures and other animals.

Metataxonomics reveal vultures as a reservoir for Clostridium perfringens

PubMed Central

Meng, Xiangli; Lu, Shan; Yang, Jing; Jin, Dong; Wang, Xiaohong; Bai, Xiangning; Wen, Yumeng; Wang, Yiting; Niu, Lina; Ye, Changyun; Rosselló-Móra, Ramon; Xu, Jianguo

2017-01-01

The Old World vulture may carry and spread pathogens for emerging infections since they feed on the carcasses of dead animals and participate in the sky burials of humans, some of whom have died from communicable diseases. Therefore, we studied the precise fecal microbiome of the Old World vulture with metataxonomics, integrating the high-throughput sequencing of almost full-length small subunit ribosomal RNA (16S rRNA) gene amplicons in tandem with the operational phylogenetic unit (OPU) analysis strategy. Nine vultures of three species were sampled using rectal swabs on the Qinghai-Tibet Plateau, China. Using the Pacific Biosciences sequencing platform, we obtained 54 135 high-quality reads of 16S rRNA amplicons with an average of 1442±6.9 bp in length and 6015±1058 reads per vulture. Those sequences were classified into 314 OPUs, including 102 known species, 50 yet to be described species and 161 unknown new lineages of uncultured representatives. Forty-five species have been reported to be responsible for human outbreaks or infections, and 23 yet to be described species belong to genera that include pathogenic species. Only six species were common to all vultures. Clostridium perfringens was the most abundant and present in all vultures, accounting for 30.8% of the total reads. Therefore, using the new technology, we found that vultures are an important reservoir for C. perfringens as evidenced by the isolation of 107 strains encoding for virulence genes, representing 45 sequence types. Our study suggests that the soil-related C. perfringens and other pathogens could have a reservoir in vultures and other animals. PMID:28223683

Culturing Heterotrophic Protists from the Baltic Sea: Mostly the "Usual Suspects" but a Few Novelties as Well.

PubMed

Weber, Felix; Mylnikov, Alexander P; Jürgens, Klaus; Wylezich, Claudia

2017-03-01

The study of cultured strains has a long tradition in protistological research and has greatly contributed to establishing the morphology, taxonomy, and ecology of many protist species. However, cultivation-independent techniques, based on 18S rRNA gene sequences, have demonstrated that natural protistan assemblages mainly consist of hitherto uncultured protist lineages. This mismatch impedes the linkage of environmental diversity data with the biological features of cultured strains. Thus, novel taxa need to be obtained in culture to close this knowledge gap. In this study, traditional cultivation techniques were applied to samples from coastal surface waters and from deep oxygen-depleted waters of the Baltic Sea. Based on 18S rRNA gene sequencing, 126 monoclonal cultures of heterotrophic protists were identified. The majority of the isolated strains were affiliated with already cultured and described taxa, mainly chrysophytes and bodonids. This was likely due to "culturing bias" but also to the eutrophic nature of the Baltic Sea. Nonetheless, ~ 12% of the isolates in our culture collection showed highly divergent 18S rRNA gene sequences compared to those of known organisms and thus may represent novel taxa, either at the species level or at the genus level. Moreover, we also obtained evidence that some of the isolated taxa are ecologically relevant, under certain conditions, in the Baltic Sea. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

PubMed Central

Fischer, Sandra; Kumar, Neeraj

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056

Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

PubMed

Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

2017-01-01

The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

Aestuariicola saemankumensis gen. nov., sp. nov., a member of the family Flavobacteriaceae, isolated from tidal flat sediment.

PubMed

Yoon, Jung-Hoon; Kang, So-Jung; Jung, Yong-Taek; Oh, Tae-Kwang

2008-09-01

A Gram-negative, non-motile, pleomorphic bacterial strain, designated SMK-142(T), was isolated from a tidal flat of the Yellow Sea, Korea, and was subjected to a polyphasic taxonomic study. Strain SMK-142(T) grew optimally at pH 7.0-8.0, 25 degrees C and in the presence of 2% (w/v) NaCl. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain SMK-142(T) clustered with Lutibacter litoralis with which it exhibited a 16S rRNA gene sequence similarity value of 91.2%. This cluster joined the clade comprising the genera Tenacibaculum and Polaribacter at a high bootstrap resampling value. Strain SMK-142(T) contained MK-6 as the predominant menaquinone and iso-C(15:0), iso-C(15:1) and iso-C(17:0) 3-OH as the major fatty acids. The DNA G+C content was 37.2 mol%. Strain SMK-142(T) was differentiated from three phylogenetically related genera, Lutibacter, Tenacibaculum and Polaribacter, on the basis of low 16S rRNA gene sequence similarity values and differences in fatty acid profiles and in some phenotypic properties. On the basis of phenotypic, chemotaxonomic and phylogenetic data, strain SMK-142(T) represents a novel genus and species for which the name Aestuariicola saemankumensis gen. nov., sp. nov. is proposed (phylum Bacteroidetes, family Flavobacteriaceae). The type strain of the type species, Aestuariicola saemankumensis sp. nov., is SMK-142(T) (=KCTC 22171(T)=CCUG 55329(T)).

Serratia myotis sp. nov. and Serratia vespertilionis sp. nov., isolated from bats hibernating in caves.

PubMed

García-Fraile, P; Chudíčková, M; Benada, O; Pikula, J; Kolařík, M

2015-01-01

During the study of bacteria associated with bats affected by white-nose syndrome hibernating in caves in the Czech Republic, we isolated two facultatively anaerobic, Gram-stain-negative bacteria, designated strains 12(T) and 52(T). Strains 12(T) and 52(T) were motile, rod-like bacteria (0.5-0.6 µm in diameter; 1-1.3 µm long), with optimal growth at 20-35 °C and pH 6-8. On the basis of the almost complete sequence of their 16S rRNA genes they should be classified within the genus Serratia; the closest relatives to strains 12(T) and 52(T) were Serratia quinivorans DSM 4597(T) (99.5 % similarity in 16S rRNA gene sequences) and Serratia ficaria DSM 4569(T) (99.5% similarity in 16S rRNA gene sequences), respectively. DNA-DNA relatedness between strain 12(T) and S. quinivorans DSM 4597(T) was only 37.1% and between strain 52(T) and S. ficaria DSM 4569(T) was only 56.2%. Both values are far below the 70% threshold value for species delineation. In view of these data, we propose the inclusion of the two isolates in the genus Serratia as representatives of Serratia myotis sp. nov. (type strain 12(T) =CECT 8594(T) =DSM 28726(T)) and Serratia vespertilionis sp. nov. (type strain 52(T) =CECT 8595(T) =DSM 28727(T)). © 2015 IUMS.

Pseudoclavibacter caeni sp. nov., isolated from sludge of a sewage disposal plant.

PubMed

Srinivasan, Sathiyaraj; Kim, Hyun Sook; Kim, Myung Kyum; Lee, Myungjin

2012-04-01

A Gram-positive, strictly aerobic, rod-shaped, non-motile bacterial strain, designated MJ28T, was isolated from a sludge sample from the Daejeon sewage disposal plant in South Korea. A polyphasic approach was applied to study the taxonomic position of strain MJ28T. Strain MJ28T showed highest 16S rRNA gene sequence similarity to Pseudoclavibacter soli KP02T (95.2 %). Levels of 16S rRNA gene sequence similarity to the type strains of other Pseudoclavibacter species were less than 94.0 %. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain MJ28T belonged to the clade formed by members of the genus Pseudoclavibacter in the family Microbacteriaceae. The G+C content of the genomic DNA of strain MJ28T was 65.8 mol%. The chemotaxonomic characteristics of strain MJ28T showed features typical of the genus Pseudoclavibacter, with MK-9 as the predominant respiratory quinone, 2,4-diaminobutryic acid as the diamino acid in the peptidoglycan, and anteiso-C17:0 (44.6 %), anteiso-C15:0 (35.7 %) and C16:0 (9.5 %) as the major fatty acids. On the basis of phylogenetic inference, fatty acid profile and other phenotypic properties, strain MJ28T is considered to represent a novel species of the genus Pseudoclavibacter, for which the name Pseudoclavibacter caeni sp. nov. is proposed. The type strain is MJ28T (=KCTC 19773T=JCM 16921T).

[Molecular characterization of pathogenic bacteria of the respiratory tract in peruvian patients with cystic fibrosis].

PubMed

Aquino, Ruth; Gonzáles, Emely; Samaniego, Sol; Rivera, Juan; Cedeño, Virna; Urbina, Yrene; Diringer, Benoit

2017-01-01

To molecularly characterize the pathogenic bacteria of the respiratory tract isolated from patients with cystic fibrosis (CF) in Peru. Bacterial communities cultured from sputum samples of pediatric and adult patients with CF admitted to the Edgardo Rebagliati Martins National Hospital and the National Institute of Child Health were characterized. Standard microbiological techniques were used for bacterial culture, and gene sequencing of 16S rRNA and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry and tandem MALDI-TOF mass spectrometry (MALDI TOF/TOF) were used for molecular characterization. Seventeen bacterial strains were characterized by 16S rRNA sequencing, and the identified pathogenic bacteria were Pseudomonas aeruginosa (31.5%), Staphylococcus aureus (12.6%), Pseudomonas spp. (11.8%), and Klebsiella oxytoca (3.1%). MALDI-TOF analysis generated a series of spectra representative of each isolated bacterial species, whereas MALDI TOF/TOF analysis identified the peptides and proteins of the most common strains and provided data on pathogenicity and sensitivity to antibiotics. The primary pathogenic microorganisms found in the respiratory tract of patients with CF in Peru were the same as those found in other countries. This study is the first to perform 16S rRNA sequencing as well as MALDI-TOF and MALDI-TOF/TOF analysis of the bacterial pathogens circulating in Peru. The inclusion of proteomic analysis further allowed for the identification of native microorganisms involved in CF.

Comparison of ribosomal RNA removal methods for transcriptome sequencing workflows in teleost fish

USDA-ARS?s Scientific Manuscript database

RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. rRNAs are commonly removed from total RNA via either mRNA selection or rRNA depletion. These methods have...

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

PubMed

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

PubMed Central

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

Bifidobacterium mongoliense sp. nov., from airag, a traditional fermented mare's milk product from Mongolia.

PubMed

Watanabe, Koichi; Makino, Hiroshi; Sasamoto, Masae; Kudo, Yuko; Fujimoto, Junji; Demberel, Shirchin

2009-06-01

Two novel micro-organisms, designated strains YIT 10443(T) and YIT 10738, were isolated from airag, a traditional fermented mare's milk from Mongolia. The two strains were Gram-positive-staining, non-motile, asporogenous, catalase-negative, facultatively anaerobic rods of various shapes. Comparative analyses of 16S rRNA and ClpC ATPase (clpC) gene sequences and the presence of fructose-6-phosphate phosphoketolase (F6PPK) demonstrated that the novel strains were members of the genus Bifidobacterium. On the basis of 16S rRNA gene sequence similarity, the type strains of Bifidobacterium minimum (96.6 %) and Bifidobacterium psychraerophilum (95.7 %) were the closest neighbours of the novel strains, and DNA-DNA reassociation values with these strains were found to be lower than 15 %. The phenotypic and genotypic features demonstrated that the two strains represent a single, novel Bifidobacterium species, for which the name Bifidobacterium mongoliense sp. nov. is proposed. The type strain is YIT 10443(T) (=JCM 15461(T) =DSM 21395(T)).

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Multiple identification of most important waterborne protozoa in surface water used for irrigation purposes by 18S rRNA amplicon-based metagenomics.

PubMed

Moreno, Y; Moreno-Mesonero, L; Amorós, I; Pérez, R; Morillo, J A; Alonso, J L

2018-01-01

Understanding waterborne protozoan parasites (WPPs) diversity has important implications in public health. In this study, we evaluated a NGS-based method as a detection approach to identify simultaneously most important WPPs using 18S rRNA high-throughput sequencing. A set of primers to target the V4 18S rRNA region of WPPs such as Cryptosporidium spp., Giardia sp., Blastocystis sp., Entamoeba spp, Toxoplasma sp. and free-living amoebae (FLA) was designed. In order to optimize PCR conditions before sequencing, both a mock community with a defined composition of representative WPPs and a real water sample inoculated with specific WPPs DNA were prepared. Using the method proposed in this study, we have detected the presence of Giardia intestinalis, Acanthamoeba castellanii, Toxoplasma gondii, Entamoeba histolytica and Blastocystis sp. at species level in real irrigation water samples. Our results showed that untreated surface irrigation water in open fields can provide an important source of WPPs. Therefore, the methodology proposed in this study can establish a basis for an accurate and effective diagnostic of WPPs to provide a better understanding of the risk associated to irrigation water. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

Seasonal changes in bacterial communities associated with healthy and diseased Porites coral in southern Taiwan.

PubMed

Lin, Chorng-Horng; Chuang, Chih-Hsiang; Twan, Wen-Hung; Chiou, Shu-Fen; Wong, Tit-Yee; Liu, Jong-Kang; Kao, Chyuan-Yao; Kuo, Jimmy

2016-12-01

We compared the bacterial communities associated with healthy scleractinian coral Porites sp. with those associated with coral infected with pink spot syndrome harvested during summer and winter from waters off the coast of southern Taiwan. Members of the bacterial community associated with the coral were characterized by means of denaturing gradient gel electrophoresis (DGGE) of a short region of the 16S rRNA gene and clone library analysis. Of 5 different areas of the 16S rRNA gene, we demonstrated that the V3 hypervariable region is most suited to represent the coral-associated bacterial community. The DNA sequences of 26 distinct bands extracted from DGGE gels and 269 sequences of the 16S rRNA gene from clone libraries were determined. We found that the communities present in diseased coral were more heterogeneous than the bacterial communities of uninfected coral. In addition, bacterial communities associated with coral harvested in the summer were more diverse than those associated with coral collected in winter, regardless of the health status of the coral. Our study suggested that the compositions of coral-associated bacteria communities are complex, and the population of bacteria varies greatly between seasons and in coral of differing health status.

Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

PubMed Central

Sánchez, Maximo; Ramírez-Bahena, Martha-Helena; Peix, Alvaro; Lorite, María J.; Sanjuán, Juan; Monza, Jorge

2014-01-01

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium. The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium, for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T). PMID:24271211

Identification of Mycobacterium spp. of veterinary importance using rpoB gene sequencing

PubMed Central

2011-01-01

Background Studies conducted on Mycobacterium spp. isolated from human patients indicate that sequencing of a 711 bp portion of the rpoB gene can be useful in assigning a species identity, particularly for members of the Mycobacterium avium complex (MAC). Given that MAC are important pathogens in livestock, companion animals, and zoo/exotic animals, we were interested in evaluating the use of rpoB sequencing for identification of Mycobacterium isolates of veterinary origin. Results A total of 386 isolates, collected over 2008 - June 2011 from 378 animals (amphibians, reptiles, birds, and mammals) underwent PCR and sequencing of a ~ 711 bp portion of the rpoB gene; 310 isolates (80%) were identified to the species level based on similarity at ≥ 98% with a reference sequence. The remaining 76 isolates (20%) displayed < 98% similarity with reference sequences and were assigned to a clade based on their location in a neighbor-joining tree containing reference sequences. For a subset of 236 isolates that received both 16S rRNA and rpoB sequencing, 167 (70%) displayed a similar species/clade assignation for both sequencing methods. For the remaining 69 isolates, species/clade identities were different with each sequencing method. Mycobacterium avium subsp. hominissuis was the species most frequently isolated from specimens from pigs, cervids, companion animals, cattle, and exotic/zoo animals. Conclusions rpoB sequencing proved useful in identifying Mycobacterium isolates of veterinary origin to clade, species, or subspecies levels, particularly for assemblages (such as the MAC) where 16S rRNA sequencing alone is not adequate to demarcate these taxa. rpoB sequencing can represent a cost-effective identification tool suitable for routine use in the veterinary diagnostic laboratory. PMID:22118247

Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

PubMed

van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

1991-06-01

In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

Phylogeny of Kinorhyncha Based on Morphology and Two Molecular Loci

PubMed Central

Sørensen, Martin V.; Dal Zotto, Matteo; Rho, Hyun Soo; Herranz, Maria; Sánchez, Nuria; Pardos, Fernando; Yamasaki, Hiroshi

2015-01-01

The phylogeny of Kinorhyncha was analyzed using morphology and the molecular loci 18S rRNA and 28S rRNA. The different datasets were analyzed separately and in combination, using maximum likelihood and Bayesian Inference. Bayesian inference of molecular sequence data in combination with morphology supported the division of Kinorhyncha into two major clades: Cyclorhagida comb. nov. and Allomalorhagida nom. nov. The latter clade represents a new kinorhynch class, and accommodates Dracoderes, Franciscideres, a yet undescribed genus which is closely related with Franciscideres, and the traditional homalorhagid genera. Homalorhagid monophyly was not supported by any analyses with molecular sequence data included. Analysis of the combined molecular and morphological data furthermore supported a cyclorhagid clade which included all traditional cyclorhagid taxa, except Dracoderes that no longer should be considered a cyclorhagid genus. Accordingly, Cyclorhagida is divided into three main lineages: Echinoderidae, Campyloderidae, and a large clade, ‘Kentrorhagata’, which except for species of Campyloderes, includes all species with a midterminal spine present in adult individuals. Maximum likelihood analysis of the combined datasets produced a rather unresolved tree that was not regarded in the following discussion. Results of the analyses with only molecular sequence data included were incongruent at different points. However, common for all analyses was the support of several major clades, i.e., Campyloderidae, Kentrorhagata, Echinoderidae, Dracoderidae, Pycnophyidae, and a clade with Paracentrophyes + New Genus and Franciscideres (in those analyses where the latter was included). All molecular analyses including 18S rRNA sequence data furthermore supported monophyly of Allomalorhagida. Cyclorhagid monophyly was only supported in analyses of combined 18S rRNA and 28S rRNA (both ML and BI), and only in a restricted dataset where taxa with incomplete information from 28S rRNA had been omitted. Analysis of the morphological data produced results that were similar with those from the combined molecular and morphological analysis. E.g., the morphological data also supported exclusion of Dracoderes from Cyclorhagida. The main differences between the morphological analysis and analyses based on the combined datasets include: 1) Homalorhagida appears as monophyletic in the morphological tree only, 2) the morphological analyses position Franciscideres and the new genus within Cyclorhagida near Zelinkaderidae and Cateriidae, whereas analyses including molecular data place the two genera inside Allomalorhagida, and 3) species of Campyloderes appear in a basal trichotomy within Kentrorhagata in the morphological tree, whereas analysis of the combined datasets places species of Campyloderes as a sister clade to Echinoderidae and Kentrorhagata. PMID:26200115

Rhizobium favelukesii sp. nov., isolated from the root nodules of alfalfa (Medicago sativa L).

PubMed

Torres Tejerizo, Gonzalo; Rogel, Marco Antonio; Ormeño-Orrillo, Ernesto; Althabegoiti, María Julia; Nilsson, Juliet Fernanda; Niehaus, Karsten; Schlüter, Andreas; Pühler, Alfred; Del Papa, María Florencia; Lagares, Antonio; Martínez-Romero, Esperanza; Pistorio, Mariano

2016-11-01

Strains LPU83T and Or191 of the genus Rhizobium were isolated from the root nodules of alfalfa, grown in acid soils from Argentina and the USA. These two strains, which shared the same plasmid pattern, lipopolysaccharide profile, insertion-sequence fingerprint, 16S rRNA gene sequence and PCR-fingerprinting pattern, were different from reference strains representing species of the genus Rhizobium with validly published names. On the basis of previously reported data and from new DNA-DNA hybridization results, phenotypic characterization and phylogenetic analyses, strains LPU83T and Or191 can be considered to be representatives of a novel species of the genus Rhizobium, for which the name Rhizobium favelukesii sp. nov. is proposed. The type strain of this species is LPU83T (=CECT 9014T=LMG 29160T), for which an improved draft-genome sequence is available.

Clavibacter michiganensis subsp. phaseoli subsp. nov., pathogenic in bean.

PubMed

González, Ana J; Trapiello, Estefanía

2014-05-01

A yellow Gram-reaction-positive bacterium isolated from bean seeds (Phaseolus vulgaris L.) was identified as Clavibacter michiganensis by 16S rRNA gene sequencing. Molecular methods were employed in order to identify the subspecies. Such methods included the amplification of specific sequences by PCR, 16S amplified rDNA restriction analysis (ARDRA), RFLP and multilocus sequence analysis as well as the analysis of biochemical and phenotypic traits including API 50CH and API ZYM results. The results showed that strain LPPA 982T did not represent any known subspecies of C. michiganensis. Pathogenicity tests revealed that the strain is a bean pathogen causing a newly identified bacterial disease that we name bacterial bean leaf yellowing. On the basis of these results, strain LPPA 982T is regarded as representing a novel subspecies for which the name Clavibacter michiganensis subsp. phaseoli subsp. nov. is proposed. The type strain is LPPA 982T (=CECT 8144T=LMG 27667T).

Rapid identification of oral Actinomyces species cultivated from subgingival biofilm by MALDI-TOF-MS

PubMed Central

Stingu, Catalina S.; Borgmann, Toralf; Rodloff, Arne C.; Vielkind, Paul; Jentsch, Holger; Schellenberger, Wolfgang; Eschrich, Klaus

2015-01-01

Background Actinomyces are a common part of the residential flora of the human intestinal tract, genitourinary system and skin. Isolation and identification of Actinomyces by conventional methods is often difficult and time consuming. In recent years, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has become a rapid and simple method to identify bacteria. Objective The present study evaluated a new in-house algorithm using MALDI-TOF-MS for rapid identification of different species of oral Actinomyces cultivated from subgingival biofilm. Design Eleven reference strains and 674 clinical strains were used in this study. All the strains were preliminarily identified using biochemical methods and then subjected to MALDI-TOF-MS analysis using both similarity-based analysis and classification methods (support vector machine [SVM]). The genotype of the reference strains and of 232 clinical strains was identified by sequence analysis of the 16S ribosomal RNA (rRNA). Results The sequence analysis of the 16S rRNA gene of all references strains confirmed their previous identification. The MALDI-TOF-MS spectra obtained from the reference strains and the other clinical strains undoubtedly identified as Actinomyces by 16S rRNA sequencing were used to create the mass spectra reference database. Already a visual inspection of the mass spectra of different species reveals both similarities and differences. However, the differences between them are not large enough to allow a reliable differentiation by similarity analysis. Therefore, classification methods were applied as an alternative approach for differentiation and identification of Actinomyces at the species level. A cross-validation of the reference database representing 14 Actinomyces species yielded correct results for all species which were represented by more than two strains in the database. Conclusions Our results suggest that a combination of MALDI-TOF-MS with powerful classification algorithms, such as SVMs, provide a useful tool for the differentiation and identification of oral Actinomyces. PMID:25597306

Natrinema gari sp. nov., a halophilic archaeon isolated from fish sauce in Thailand.

PubMed

Tapingkae, Wanaporn; Tanasupawat, Somboon; Itoh, Takashi; Parkin, Kirk L; Benjakul, Soottawat; Visessanguan, Wonnop; Valyasevi, Ruud

2008-10-01

Two Gram-negative, rod-shaped, halophilic archaea, designated strains HIS40-3(T) and HDS3-1, were isolated from anchovy fish sauce (nam-pla) collected from two different locations in Thailand. The two strains were able to grow at 20-60 degrees C (optimum 37-40 degrees C), at 1.7-5.1 M NaCl (optimum 2.6-3.4 M NaCl) and at pH 5.5-8.5 (optimum pH 6.0-6.5). Hypotonic treatment with less than 1.7 M NaCl caused cell lysis. The major polar lipids of the isolates were C(20)C(20) and C(20)C(25) derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate, two glycolipids and one unidentified lipid. The DNA G+C contents were 64.0-65.4 mol%. In addition to phenotypic and chemotaxonomic characteristics, phylogenetic analysis based on 16S rRNA gene sequence similarities showed that strains HIS40-3(T) and HDS3-1 were related most closely to species of the genus Natrinema. Levels of 16S rRNA gene sequence similarity between strains HIS40-3(T) and HDS3-1 and the type strains of recognized Natrinema species were 99.1-96.6 %. The two novel strains could be distinguished from recognized Natrinema species on the basis of low levels of DNA-DNA relatedness and differences in whole-cell protein patterns and phenotypic properties. Levels of 16S rRNA gene sequence similarity and DNA-DNA relatedness between the two strains were 99.7 and 77.7 %, respectively, suggesting that they should be classified as representing a single species. Based on these taxonomic data, strains HIS40-3(T) and HDS3-1 are considered to represent a novel species of the genus Natrinema, for which the name Natrinema gari sp. nov. is proposed. The type strain is HIS40-3(T) (=BCC 24370(T) =JCM 14663(T) =PCU 303(T)).

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

PubMed

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

Phylogeny of 54 representative strains of species in the family Pasteurellaceae as determined by comparison of 16S rRNA sequences.

PubMed Central

Dewhirst, F E; Paster, B J; Olsen, I; Fraser, G J

1992-01-01

Virtually complete 16S rRNA sequences were determined for 54 representative strains of species in the family Pasteurellaceae. Of these strains, 15 were Pasteurella, 16 were Actinobacillus, and 23 were Haemophilus. A phylogenetic tree was constructed based on sequence similarity, using the Neighbor-Joining method. Fifty-three of the strains fell within four large clusters. The first cluster included the type strains of Haemophilus influenzae, H. aegyptius, H. aphrophilus, H. haemolyticus, H. paraphrophilus, H. segnis, and Actinobacillus actinomycetemcomitans. This cluster also contained A. actinomycetemcomitans FDC Y4, ATCC 29522, ATCC 29523, and ATCC 29524 and H. aphrophilus NCTC 7901. The second cluster included the type strains of A. seminis and Pasteurella aerogenes and H. somnus OVCG 43826. The third cluster was composed of the type strains of Pasteurella multocida, P. anatis, P. avium, P. canis, P. dagmatis, P. gallinarum, P. langaa, P. stomatis, P. volantium, H. haemoglobinophilus, H. parasuis, H. paracuniculus, H. paragallinarum, and A. capsulatus. This cluster also contained Pasteurella species A CCUG 18782, Pasteurella species B CCUG 19974, Haemophilus taxon C CAPM 5111, H. parasuis type 5 Nagasaki, P. volantium (H. parainfluenzae) NCTC 4101, and P. trehalosi NCTC 10624. The fourth cluster included the type strains of Actinobacillus lignieresii, A. equuli, A. pleuropneumoniae, A. suis, A. ureae, H. parahaemolyticus, H. parainfluenzae, H. paraphrohaemolyticus, H. ducreyi, and P. haemolytica. This cluster also contained Actinobacillus species strain CCUG 19799 (Bisgaard taxon 11), A. suis ATCC 15557, H. ducreyi ATCC 27722 and HD 35000, Haemophilus minor group strain 202, and H. parainfluenzae ATCC 29242. The type strain of P. pneumotropica branched alone to form a fifth group. The branching of the Pasteurellaceae family tree was quite complex. The four major clusters contained multiple subclusters. The clusters contained both rapidly and slowly evolving strains (indicated by differing numbers of base changes incorporated into the 16S rRNA sequence relative to outgroup organisms). While the results presented a clear picture of the phylogenetic relationships, the complexity of the branching will make division of the family into genera a difficult and somewhat subjective task. We do not suggest any taxonomic changes at this time. PMID:1548238

Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

PubMed Central

Ampe, Frédéric

2000-01-01

Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria. PMID:10788405

Phylogenetic relationships of Paradiclybothrium pacificum and Diclybothrium armatum (Monogenoidea: Diclybothriidae) inferred from 18S rDNA sequence data.

PubMed

Rozhkovan, Konstantin V; Shedko, Marina B

2015-10-01

The Diclybothriidae (Monogenoidea: Oligonchoinea) includes specific parasites of fishes assigned to the ancient order Acipenseriformes. Phylogeny of the Diclybothriidae is still unclear despite several systematic studies based on morphological characters. Together with the closely related Hexabothriidae represented by parasites of sharks and ray-fishes, the position of Diclybothriidae in different taxonomical systems has been matter of discussion. Here, we present the first molecular data on Diclybothriidae. The SSU rRNA gene was used to investigate the phylogenetic position of Paradiclybothrium pacificum and Diclybothrium armatum among the other Oligonchoinea. Complete nucleotide sequences of P. pacificum and D. armatum demonstrated high identity (98.53%) with no intraspecific sequence variability. Specimens of D. armatum were obtained from different hosts (Acipenser schrenckii and Huso dauricus); however, variation by host was not detected. The sequence divergence and phylogenetic trees data show that Diclybothriidae and Hexabothriidae are more closely related to each other than with other representatives of Oligonchoinea. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Variability of Actinobacteria, a minor component of rumen microflora.

PubMed

Suľák, M; Sikorová, L; Jankuvová, J; Javorský, P; Pristaš, P

2012-07-01

Actinobacteria (Actinomycetes) are a significant and interesting group of gram-positive bacteria. They are regular, though infrequent, members of the microbial life in the rumen and represent up to 3 % of total rumen bacteria; there is considerable lack of information about ecology and biology of rumen actinobacteria. During the characterization of variability of rumen treponemas using non-cultivation approach, we also noted the variability of rumen actinobacteria. By using Treponema-specific primers a specific 16S rRNA gene library was prepared from cow and sheep rumen total DNA. About 10 % of recombinant clones contained actinobacteria-like sequences. Phylogenetic analyses of 11 clones obtained showed the high variability of actinobacteria in the ruminant digestive system. While some sequences are nearly identical to known sequences of actinobacteria, we detected completely new clusters of actinobacteria-like sequences, representing probably new, as yet undiscovered, group of rumen Actinobacteria. Further research will be necessary for understanding their nature and functions in the rumen.

Legionella saoudiensis sp. nov., isolated from a sewage water sample.

PubMed

Bajrai, Leena Hussein; Azhar, Esam Ibraheem; Yasir, Muhammad; Jardot, Priscilla; Barrassi, Lina; Raoult, Didier; La Scola, Bernard; Pagnier, Isabelle

2016-11-01

A Gram-stain-negative, bacilli-shaped bacterial strain, LS-1T, was isolated from a sewage water sample collected in Jeddah, Saudi Arabia. The taxonomic position of strain LS-1T was investigated using a polyphasic taxonomic approach. Phylogenetic analysis based on 16S rRNA gene sequences and those of four other genes indicated that strain LS-1T belongs to the genus Legionella in the family Legionellaceae. Regarding the 16S rRNA gene, the most closely related species are Legionella rowbothamii LLAP-6T (98.6 %) and Legionella lytica L2T (98.5 %). The mip gene sequence of strain LS-1T showed 94 % sequence similarity with that of L. lytica L2T and 93 % similarity with that of L. rowbothamii LLAP-6T. Strain LS-1T grew optimally at a temperature of 32 °C on a buffered charcoal yeast extract (BCYE) agar plate in a 5 % CO2 atmosphere and had a flagellum. The combined phylogenetic, phenotypic and genomic sequence data suggest that strain LS-1T represents a novel species of the genus Legionella, for which the name Legionella saoudiensis sp. nov. is proposed. The type strain is LS-1T (=DSM 101682T=CSUR P2101T).

High-Throughput rRNA Gene Sequencing Reveals High
and Complex Bacterial Diversity Associated with
Brazilian Coffee Bean Fermentation

PubMed Central

Vinícius de Melo, Gilberto

2018-01-01

Summary Coffee bean fermentation is a spontaneous, on-farm process involving the action of different microbial groups, including bacteria and fungi. In this study, high-throughput sequencing approach was employed to study the diversity and dynamics of bacteria associated with Brazilian coffee bean fermentation. The total DNA from fermenting coffee samples was extracted at different time points, and the 16S rRNA gene with segments around the V4 variable region was sequenced by Illumina high-throughput platform. Using this approach, the presence of over eighty bacterial genera was determined, many of which have been detected for the first time during coffee bean fermentation, including Fructobacillus, Pseudonocardia, Pedobacter, Sphingomonas and Hymenobacter. The presence of Fructobacillus suggests an influence of these bacteria on fructose metabolism during coffee fermentation. Temporal analysis showed a strong dominance of lactic acid bacteria with over 97% of read sequences at the end of fermentation, mainly represented by the Leuconostoc and Lactococcus. Metabolism of lactic acid bacteria was associated with the high formation of lactic acid during fermentation, as determined by HPLC analysis. The results reported in this study confirm the underestimation of bacterial diversity associated with coffee fermentation. New microbial groups reported in this study may be explored as functional starter cultures for on-farm coffee processing.

Unexpected Importance of Potential Parasites in the Composition of the Freshwater Small-Eukaryote Community▿

PubMed Central

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2008-01-01

The diversity of small eukaryotes (0.2 to 5 μm) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types. PMID:18359836

Unexpected importance of potential parasites in the composition of the freshwater small-eukaryote community.

PubMed

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2008-05-01

The diversity of small eukaryotes (0.2 to 5 mum) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types.

Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

PubMed

Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

2014-03-01

16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

Genomic insights into the taxonomic status of the Bacillus cereus group

PubMed Central

Liu, Yang; Lai, Qiliang; Göker, Markus; Meier-Kolthoff, Jan P.; Wang, Meng; Sun, Yamin; Wang, Lei; Shao, Zongze

2015-01-01

The identification and phylogenetic relationships of bacteria within the Bacillus cereus group are controversial. This study aimed at determining the taxonomic affiliations of these strains using the whole-genome sequence-based Genome BLAST Distance Phylogeny (GBDP) approach. The GBDP analysis clearly separated 224 strains into 30 clusters, representing eleven known, partially merged species and accordingly 19–20 putative novel species. Additionally, 16S rRNA gene analysis, a novel variant of multi-locus sequence analysis (nMLSA) and screening of virulence genes were performed. The 16S rRNA gene sequence was not sufficient to differentiate the bacteria within this group due to its high conservation. The nMLSA results were consistent with GBDP. Moreover, a fast typing method was proposed using the pycA gene, and where necessary, the ccpA gene. The pXO plasmids and cry genes were widely distributed, suggesting little correlation with the phylogenetic positions of the host bacteria. This might explain why classifications based on virulence characteristics proved unsatisfactory in the past. In summary, this is the first large-scale and systematic study of the taxonomic status of the bacteria within the B. cereus group using whole-genome sequences, and is likely to contribute to further insights into their pathogenicity, phylogeny and adaptation to diverse environments. PMID:26373441

Pantoea allii sp. nov., isolated from onion plants and seed.

PubMed

Brady, Carrie L; Goszczynska, Teresa; Venter, Stephanus N; Cleenwerck, Ilse; De Vos, Paul; Gitaitis, Ronald D; Coutinho, Teresa A

2011-04-01

Eight yellow-pigmented, Gram-negative, rod-shaped, oxidase-negative, motile, facultatively anaerobic bacteria were isolated from onion seed in South Africa and from an onion plant exhibiting centre rot symptoms in the USA. The isolates were assigned to the genus Pantoea on the basis of phenotypic and biochemical tests. 16S rRNA gene sequence analysis and multilocus sequence analysis (MLSA), based on gyrB, rpoB, infB and atpD sequences, confirmed the allocation of the isolates to the genus Pantoea. MLSA further indicated that the isolates represented a novel species, which was phylogenetically most closely related to Pantoea ananatis and Pantoea stewartii. Amplified fragment length polymorphism analysis also placed the isolates into a cluster separate from P. ananatis and P. stewartii. Compared with type strains of species of the genus Pantoea that showed >97 % 16S rRNA gene sequence similarity with strain BD 390(T), the isolates exhibited 11-55 % whole-genome DNA-DNA relatedness, which confirmed the classification of the isolates in a novel species. The most useful phenotypic characteristics for the differentiation of the isolates from their closest phylogenetic neighbours are production of acid from amygdalin and utilization of adonitol and sorbitol. A novel species, Pantoea allii sp. nov., is proposed, with type strain BD 390(T) ( = LMG 24248(T)).

Phylogenetic diversity and position of the genus Campylobacter

NASA Technical Reports Server (NTRS)

Lau, P. P.; DeBrunner-Vossbrinck, B.; Dunn, B.; Miotto, K.; MacDonnell, M. T.; Rollins, D. M.; Pillidge, C. J.; Hespell, R. B.; Colwell, R. R.; Sogin, M. L.;

Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.

PubMed

Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel

2017-11-01

One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).

Pseudomonas aestus sp. nov., a plant growth-promoting bacterium isolated from mangrove sediments.

PubMed

Vasconcellos, Rafael L F; Santos, Suikinai Nobre; Zucchi, Tiago Domingues; Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Melo, Itamar Soares

2017-10-01

Strain CMAA 1215 T , a Gram-reaction-negative, aerobic, catalase positive, polarly flagellated, motile, rod-shaped (0.5-0.8 × 1.3-1.9 µm) bacterium, was isolated from mangrove sediments, Cananéia Island, Brazil. Analysis of the 16S rRNA gene sequences showed that strain CMAA 1215 T forms a distinct phyletic line within the Pseudomonas putida subclade, being closely related to P. plecoglossicida ATCC 700383 T , P. monteilii NBRC 103158 T , and P. taiwanensis BCRC 17751 T of sequence similarity of 98.86, 98.73, and 98.71%, respectively. Genomic comparisons of the strain CMAA 1215 T with its closest phylogenetic type strains using average nucleotide index (ANI) and DNA:DNA relatedness approaches revealed 84.3-85.3% and 56.0-63.0%, respectively. A multilocus sequence analysis (MLSA) performed concatenating 16S rRNA, gyrB and rpoB gene sequences from the novel species was related with Pseudomonas putida subcluster and formed a new phylogenetic lineage. The phenotypic, physiological, biochemical, and genetic characteristics support the assignment of CMAA 1215 T to the genus Pseudomonas, representing a novel species. The name Pseudomonas aestus sp.nov. is proposed, with CMAA 1215 T (=NRRL B-653100 T  = CBMAI 1962 T ) as the type strain.

Lactobacillus gorillae sp. nov., isolated from the faeces of captive and wild western lowland gorillas (Gorilla gorilla gorilla).

PubMed

Tsuchida, Sayaka; Kitahara, Maki; Nguema, Pierre Philippe Mbehang; Norimitsu, Saeko; Fujita, Shiho; Yamagiwa, Juichi; Ngomanda, Alfred; Ohkuma, Moriya; Ushida, Kazunari

2014-12-01

Four strains of Gram-staining-positive, anaerobic rods were isolated from the faeces of western lowland gorillas (Gorilla gorilla gorilla). Three strains, KZ01(T), KZ02 and KZ03, were isolated at the Kyoto City Zoo, Japan, and one strain, GG02, was isolated in the Moukalaba-Doudou National Park, Gabon. These strains were investigated taxonomically. These strains belonged to the Lactobacillus reuteri phylogenetic group according to phylogenetic analysis based on 16S rRNA gene sequences and specific phenotypic characteristics. Phylogenetic analysis of their 16S rRNA gene sequences revealed that strains KZ01(T), KZ02, KZ03 and GG02 formed a single monophyletic cluster and had a distinct line of descent. Based on sequence similarity of the 16S rRNA gene, Lactobacillus fermentum JCM 1173(T) (96.6 %) was the closest neighbour to these novel strains, although it was clear that these strains belonged to a different species. Partial pheS sequences also supported these relationships. DNA-DNA relatedness between strain KZ01(T) and L. fermentum JCM 1173(T) was less than 22 % and the DNA G+C content of strain KZ01(T) was 50.7 mol%. The cell-wall peptidoglycan type was A4β (l-Orn-d-Asp) and the major fatty acids were C16 : 0, C18 : 1ω9c and C19 : 1 cyclo 9,10. Therefore, based on phylogenetic, phenotypic and physiological evidence, these strains represent a novel species of the genus Lactobacillus, for which the name Lactobacillus gorillae sp. nov. is proposed. The type strain is KZ01(T) ( = JCM 19575(T) = DSM 28356(T)). © 2014 IUMS.

Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species.

PubMed

Pettersson, B; Kodjo, A; Ronaghi, M; Uhlén, M; Tønjum, T

1998-01-01

Thirty-three strains previously classified into 11 species in the bacterial family Moraxellaceae were subjected to phylogenetic analysis based on 16S rRNA sequences. The family Moraxellaceae formed a distinct clade consisting of four phylogenetic groups as judged from branch lengths, bootstrap values and signature nucleotides. Group I contained the classical moraxellae and strains of the coccal moraxellae, previously known as Branhamella, with 16S rRNA similarity of > or = 95%. A further division of group I into five tentative clusters is discussed. Group II consisted of two strains representing Moraxella atlantae and Moraxella osloensis. These strains were only distantly related to each other (93.4%) and also to the other members of the Moraxellaceae (< or = 93%). Therefore, reasons for reclassification of these species into separate and new genera are discussed. Group III harboured strains of the genus Psychrobacter and strain 752/52 of [Moraxella] phenylpyruvica. This strain of [M.] phenylpyruvica formed an early branch from the group III line of descent. Interestingly, a distant relationship was found between Psychrobacter phenylpyruvicus strain ATCC 23333T (formerly classified as [M.] phenylpyruvica) and [M.] phenylpyruvica strain 752/52, exhibiting less than 96% nucleotide similarity between their 16S rRNA sequences. The establishment of a new genus for [M.] phenylpyruvica strain 752/52 is therefore suggested. Group IV contained only two strains of the genus Acinetobacter. Strategies for the development of diagnostic probes and distinctive sequences for 16S rRNA-based species-specific assays within group I are suggested. Although these findings add to the classificatory placements within the Moraxellaceae, analysis of a more comprehensive selection of strains is still needed to obtain a complete classification system within this family.

MetaMetaDB: a database and analytic system for investigating microbial habitability.

PubMed

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes.

A novel approach for monitoring genetically engineered microorganisms by using artificial, stable RNAs

NASA Technical Reports Server (NTRS)

Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.

1995-01-01

Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.

Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

PubMed

Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

2010-04-01

This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny. (c) 2009 Elsevier Inc. All rights reserved.

Ursidibacter maritimus gen. nov., sp. nov. and Ursidibacter arcticus sp. nov., two new members of the family Pasteurellaceae isolated from the oral cavity of bears.

PubMed

Johanne Hansen, Mie; Strøm Braaten, Mira; Miki Bojesen, Anders; Christensen, Henrik; Sonne, Christian; Dietz, Rune; Frost Bertelsen, Mads

2015-10-01

Thirty-three suspected strains of the family Pasteurellaceae isolated from the oral cavity of polar and brown bears were characterized by genotypic and phenotypic tests. Phylogenetic analysis of partial 16S rRNA gene and rpoB sequences showed that the investigated isolates formed two closely related monophyletic groups, representing two novel species of a new genus. Based on 16S rRNA gene sequence comparison Bibersteinia trehalosi was the closest related species with a validly published name, with 95.4 % similarity to the polar bear group and 94.4 % similarity to the brown bear group. Otariodibacter oris was the closest related species based on rpoB sequence comparison with a similarity of 89.8 % with the polar bear group and 90 % with the brown bear group. The new genus could be separated from existing genera of the family Pasteurellaceae by three to ten phenotypic characters, and the two novel species could be separated from each other by two phenotypic characters. It is proposed that the strains should be classified as representatives of a new genus, Ursidibacter gen. nov., with two novel species: the type species Ursidibacter maritimus sp. nov., isolated from polar bears (type strain Pb43106T = CCUG 65144T = DSM 28137T, DNA G+C content 39.3 mol%), and Ursidibacter arcticus sp. nov., isolated from brown bears (type strain Bamse61T = CCUG 65145T = DSM 28138T).

Changes in bacterial and archaeal communities during the concentration of brine at the graduation towers in Ciechocinek spa (Poland).

PubMed

Kalwasińska, Agnieszka; Deja-Sikora, Edyta; Burkowska-But, Aleksandra; Szabó, Attila; Felföldi, Támas; Kosobucki, Przemysław; Krawiec, Arkadiusz; Walczak, Maciej

2018-03-01

This study evaluates the changes in bacterial and archaeal community structure during the gradual evaporation of water from the brine (extracted from subsurface Jurassic deposits) in the system of graduation towers located in Ciechocinek spa, Poland. The communities were assessed with 16S rRNA gene sequencing (MiSeq, Illumina) and microscopic methods. The microbial cell density determined by direct cell count was at the order of magnitude of 10 7 cells/mL. It was found that increasing salt concentration was positively correlated with both the cell counts, and species-level diversity of bacterial and archaeal communities. The archaeal community was mostly constituted by members of the phylum Euryarchaeota, class Halobacteria and was dominated by Halorubrum-related sequences. The bacterial community was more diverse, with representatives of the phyla Proteobacteria and Bacteroidetes as the most abundant. The proportion of Proteobacteria decreased with increasing salt concentration, while the proportion of Bacteroidetes increased significantly in the more concentrated samples. Representatives of the genera Idiomarina, Psychroflexus, Roseovarius, and Marinobacter appeared to be tolerant to changes of salinity. During the brine concentration, the relative abundances of Sphingobium and Sphingomonas were significantly decreased and the raised contributions of genera Fabibacter and Fodinibius were observed. The high proportion of novel (not identified at 97% similarity level) bacterial reads (up to 42%) in the 16S rRNA gene sequences indicated that potentially new bacterial taxa inhabit this unique environment.

Bacterial Diversity in Microbial Mats and Sediments from the Atacama Desert.

PubMed

Rasuk, Maria Cecilia; Fernández, Ana Beatriz; Kurth, Daniel; Contreras, Manuel; Novoa, Fernando; Poiré, Daniel; Farías, María Eugenia

2016-01-01

The Atacama Desert has extreme environmental conditions that allow the development of unique microbial communities. The present paper reports the bacterial diversity of microbial mats and sediments and its mineralogical components. Some physicochemical conditions of the water surrounding these ecosystems have also been studied trying to determine their influence on the diversity of these communities. In that way, mats and sediments distributed among different hypersaline lakes located in salt flats of the Atacama Desert were subjected to massive parallel sequencing of the V4 region of the 16S rRNA genes of Bacteria. A higher diversity in sediment than in mat samples have been found. Lakes that harbor microbial mats have higher salinity than lakes where mats are absent. Proteobacteria and/or Bacteroidetes are the major phyla represented in all samples. An interesting item is the finding of a low proportion or absence of Cyanobacteria sequences in the ecosystems studied, suggesting the possibility that other groups may be playing an essential role as primary producers in these extreme environments. Additionally, the large proportion of 16S rRNA gene sequences that could not be classified at the level of phylum indicates potential new phyla present in these ecosystems.

Reassessment of the taxonomic position of Burkholderia andropogonis and description of Robbsia andropogonis gen. nov., comb. nov.

PubMed

Lopes-Santos, Lucilene; Castro, Daniel Bedo Assumpção; Ferreira-Tonin, Mariana; Corrêa, Daniele Bussioli Alves; Weir, Bevan Simon; Park, Duckchul; Ottoboni, Laura Maria Mariscal; Neto, Júlio Rodrigues; Destéfano, Suzete Aparecida Lanza

2017-06-01

The phylogenetic classification of the species Burkholderia andropogonis within the Burkholderia genus was reassessed using 16S rRNA gene phylogenetic analysis and multilocus sequence analysis (MLSA). Both phylogenetic trees revealed two main groups, named A and B, strongly supported by high bootstrap values (100%). Group A encompassed all of the Burkholderia species complex, whi.le Group B only comprised B. andropogonis species, with low percentage similarities with other species of the genus, from 92 to 95% for 16S rRNA gene sequences and 83% for conserved gene sequences. Average nucleotide identity (ANI), tetranucleotide signature frequency, and percentage of conserved proteins POCP analyses were also carried out, and in the three analyses B. andropogonis showed lower values when compared to the other Burkholderia species complex, near 71% for ANI, from 0.484 to 0.724 for tetranucleotide signature frequency, and around 50% for POCP, reinforcing the distance observed in the phylogenetic analyses. Our findings provide an important insight into the taxonomy of B. andropogonis. It is clear from the results that this bacterial species exhibits genotypic differences and represents a new genus described herein as Robbsia andropogonis gen. nov., comb. nov.

Legionella cardiaca sp. nov., isolated from a case of native valve endocarditis in a human heart

PubMed Central

Pearce, Meghan M.; Theodoropoulos, Nicole; Mandel, Mark J.; Brown, Ellen; Reed, Kurt D.

2012-01-01

A Gram-negative, rod-shaped bacterium, designated H63T, was isolated from aortic valve tissue of a patient with native valve endocarditis. 16S rRNA gene sequencing revealed that H63T belongs to the genus Legionella, with its closest neighbours being the type strains of Legionella brunensis (98.8 % similarity), L. londiniensis (97.0 %), L. jordanis (96.8 %), L. erythra (96.2 %), L. dresdenensis (96.0 %) and L. rubrilucens, L. feeleii, L. pneumophila and L. birminghamensis (95.7 %). DNA–DNA hybridization studies yielded values of <70 % relatedness between strain H63T and its nearest neighbours in terms of 16S rRNA gene sequence similarity, indicating that the strain represents a novel species. Phylogenetic analysis of the 16S rRNA, macrophage infectivity potentiator (mip) and RNase P (rnpB) genes confirmed that H63T represents a distinct species, with L. brunensis being its closest sister taxon. Fatty acid composition and biochemical traits, such as the inability to ferment glucose and reduce nitrate, supported the affiliation of H63T to the genus Legionella. H63T was distinguishable from its neighbours based on it being positive for hippurate hydrolysis. H63T was further differentiated by its inability to grow on BCYE agar at 17 °C, its poor growth on low-iron medium and the absence of sliding motility. Also, H63T did not react with antisera generated from type strains of Legionella species. H63T replicated within macrophages. It also grew in mouse lungs, inducing histopathological evidence of pneumonia and dissemination to the spleen. Together, these results confirm that H63T represents a novel, pathogenic Legionella species, for which the name Legionella cardiaca sp. nov. is proposed. The type strain is H63T ( = ATCC BAA-2315T  = DSM 25049T  = JCM 17854T). PMID:22286905

Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

PubMed

Li, X; De Boer, S H

1995-10-01

Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information

PubMed Central

Chen, Tsute; Yu, Wen-Han; Izard, Jacques; Baranova, Oxana V.; Lakshmanan, Abirami; Dewhirst, Floyd E.

2010-01-01

The human oral microbiome is the most studied human microflora, but 53% of the species have not yet been validly named and 35% remain uncultivated. The uncultivated taxa are known primarily from 16S rRNA sequence information. Sequence information tied solely to obscure isolate or clone numbers, and usually lacking accurate phylogenetic placement, is a major impediment to working with human oral microbiome data. The goal of creating the Human Oral Microbiome Database (HOMD) is to provide the scientific community with a body site-specific comprehensive database for the more than 600 prokaryote species that are present in the human oral cavity based on a curated 16S rRNA gene-based provisional naming scheme. Currently, two primary types of information are provided in HOMD—taxonomic and genomic. Named oral species and taxa identified from 16S rRNA gene sequence analysis of oral isolates and cloning studies were placed into defined 16S rRNA phylotypes and each given unique Human Oral Taxon (HOT) number. The HOT interlinks phenotypic, phylogenetic, genomic, clinical and bibliographic information for each taxon. A BLAST search tool is provided to match user 16S rRNA gene sequences to a curated, full length, 16S rRNA gene reference data set. For genomic analysis, HOMD provides comprehensive set of analysis tools and maintains frequently updated annotations for all the human oral microbial genomes that have been sequenced and publicly released. Oral bacterial genome sequences, determined as part of the Human Microbiome Project, are being added to the HOMD as they become available. We provide HOMD as a conceptual model for the presentation of microbiome data for other human body sites. Database URL: http://www.homd.org PMID:20624719

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture

PubMed Central

Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy

2007-01-01

It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones analysed. In all, 28 phylotypes were identified: Lysobacter enzymogenes was the most abundant phylotype (31.4%), followed by Lysobacter sp. C3 (28.3%), gamma proteobacterium N4-7 (6.6%), Methylobacterium SM4 (4.7%) and Staphylococcus epidermidis (4.7%); 36 clones (7.0%) represented uncultivable phylotypes. We conclude that a diverse range of bacterial species are found within biofilms on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties. PMID:17501992

Equally parsimonious pathways through an RNA sequence space are not equally likely

NASA Technical Reports Server (NTRS)

Lee, Y. H.; DSouza, L. M.; Fox, G. E.

1997-01-01

An experimental system for determining the potential ability of sequences resembling 5S ribosomal RNA (rRNA) to perform as functional 5S rRNAs in vivo in the Escherichia coli cellular environment was devised previously. Presumably, the only 5S rRNA sequences that would have been fixed by ancestral populations are ones that were functionally valid, and hence the actual historical paths taken through RNA sequence space during 5S rRNA evolution would have most likely utilized valid sequences. Herein, we examine the potential validity of all sequence intermediates along alternative equally parsimonious trajectories through RNA sequence space which connect two pairs of sequences that had previously been shown to behave as valid 5S rRNAs in E. coli. The first trajectory requires a total of four changes. The 14 sequence intermediates provide 24 apparently equally parsimonious paths by which the transition could occur. The second trajectory involves three changes, six intermediate sequences, and six potentially equally parsimonious paths. In total, only eight of the 20 sequence intermediates were found to be clearly invalid. As a consequence of the position of these invalid intermediates in the sequence space, seven of the 30 possible paths consisted of exclusively valid sequences. In several cases, the apparent validity/invalidity of the intermediate sequences could not be anticipated on the basis of current knowledge of the 5S rRNA structure. This suggests that the interdependencies in RNA sequence space may be more complex than currently appreciated. If ancestral sequences predicted by parsimony are to be regarded as actual historical sequences, then the present results would suggest that they should also satisfy a validity requirement and that, in at least limited cases, this conjecture can be tested experimentally.

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

PubMed Central

Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

2017-01-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

PubMed Central

Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

2013-01-01

The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

Salinispirillum marinum gen. nov., sp. nov., a haloalkaliphilic bacterium in the family 'Saccharospirillaceae'.

PubMed

Shahinpei, Azadeh; Amoozegar, Mohammad Ali; Fazeli, Seyed Abolhassan Shahzadeh; Schumann, Peter; Ventosa, Antonio

2014-11-01

A novel Gram-staining-negative, motile, non-pigmented, facultatively anaerobic, spirillum-shaped, halophilic and alkaliphilic bacterium, designated strain GCWy1(T), was isolated from water of the coastal-marine wetland Gomishan in Iran. The strain was able to grow at NaCl concentrations of 1-10% (w/v) and optimal growth was achieved at 3% (w/v). The optimum pH and temperature for growth were pH 8.5 and 30 °C, while the strain was able to grow at pH 7.5-10 and 4-40 °C. Phylogenetic analysis based on the comparison of the 16S rRNA gene sequence placed the isolate within the class Gammaproteobacteria as a separate deep branch, with 92.1% or lower sequence similarity to representatives of the genera Saccharospirillum and Reinekea and less than 91.0% sequence similarity with other remotely related genera. The major cellular fatty acids of the isolate were C(18 : 1)ω7c, C(16:0) and C(17 : 0), and the major components of its polar lipid profile were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylethanolamine. The cells of strain GCWy1(T) contained the isoprenoid quinones Q-9 and Q-8 (81% and 2%, respectively). The G+C content of the genomic DNA of this strain was 52.3 mol%. On the basis of 16S rRNA gene sequence analysis in combination with chemotaxonomic and phenotypic data, strain GCWy1(T) represents a novel species in a new genus in the family 'Saccharospirillaceae', order Oceanospirillales, for which the name Salinispirillum marinum gen. nov., sp. nov. is proposed. The type strain of the type species is GCWy1(T) ( = IBRC-M 10765(T) =CECT 8342(T)). © 2014 IUMS.

Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

PubMed

Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

2005-11-01

Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

Common bacterial responses in six ecosystems exposed to 10 years of elevated atmospheric carbon dioxide.

PubMed

Dunbar, John; Eichorst, Stephanie A; Gallegos-Graves, La Verne; Silva, Shannon; Xie, Gary; Hengartner, N W; Evans, R David; Hungate, Bruce A; Jackson, Robert B; Megonigal, J Patrick; Schadt, Christopher W; Vilgalys, Rytas; Zak, Donald R; Kuske, Cheryl R

2012-05-01

Six terrestrial ecosystems in the USA were exposed to elevated atmospheric CO(2) in single or multifactorial experiments for more than a decade to assess potential impacts. We retrospectively assessed soil bacterial community responses in all six-field experiments and found ecosystem-specific and common patterns of soil bacterial community response to elevated CO(2) . Soil bacterial composition differed greatly across the six ecosystems. No common effect of elevated atmospheric CO(2) on bacterial biomass, richness and community composition across all of the ecosystems was identified, although significant responses were detected in individual ecosystems. The most striking common trend across the sites was a decrease of up to 3.5-fold in the relative abundance of Acidobacteria Group 1 bacteria in soils exposed to elevated CO(2) or other climate factors. The Acidobacteria Group 1 response observed in exploratory 16S rRNA gene clone library surveys was validated in one ecosystem by 100-fold deeper sequencing and semi-quantitative PCR assays. Collectively, the 16S rRNA gene sequencing approach revealed influences of elevated CO(2) on multiple ecosystems. Although few common trends across the ecosystems were detected in the small surveys, the trends may be harbingers of more substantive changes in less abundant, more sensitive taxa that can only be detected by deeper surveys. Representative bacterial 16S rRNA gene clone sequences were deposited in GenBank with Accession No. JQ366086–JQ387568. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Ideonella azotifigens sp. nov., an aerobic diazotroph of the Betaproteobacteria isolated from grass rhizosphere soil, and emended description of the genus Ideonella.

PubMed

Noar, Jesse D; Buckley, Daniel H

2009-08-01

Strain 1a22T, a nitrogen-fixing bacterium, was isolated from soil associated with the rhizosphere of a perennial grass growing in a fallow agricultural field in Ithaca, New York, USA. Analysis of the 16S rRNA gene sequence placed the strain in the Rubrivivax-Roseateles-Leptothrix-Azohydromonas-Aquincola-Ideonella branch of the Betaproteobacteria and the closest characterized relative was the type strain of Ideonella dechloratans (97.7% 16S rRNA sequence similarity). Cells of strain 1a22T were Gram-negative, motile, straight rods, which formed polyhydroxybutyrate-like granules and were positive for oxidase and weakly positive for catalase. Cells were chemo-organotrophic, unable to grow by reduction of chlorate or nitrate and grew exclusively through aerobic respiration. Growth with mannitol on N-free solid media caused the strain to produce copious amounts of slime. The G+C content of the genomic DNA was 67.4 mol%. The major cellular fatty acids were C16:1 cis-9 and C16:0 and cells contained significant amounts of the hydroxy fatty acids C10:0 3-OH, C12:0 2-OH and C12:0 3-OH. Based on DNA-DNA hybridization studies, 16S rRNA gene sequence analysis, fatty acid analysis, and morphological and physiological characteristics, strain 1a22T represents a novel species in the genus Ideonella, for which the name Ideonella azotifigens sp. nov. is proposed. The type strain of Ideonella azotifigens is 1a22T (=JCM 15503T=DSM 21438T).

Molecular gene organisation and secondary structure of the mitochondrial large subunit ribosomal RNA from the cultivated Basidiomycota Agrocybe aegerita: a 13 kb gene possessing six unusual nucleotide extensions and eight introns.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1999-04-01

The complete gene sequence and secondary structure of the mitochondrial LSU rRNA from the cultivated Basidiomycota Agrocybe aegerita was derived by chromosome walking. The A.aegerita LSU rRNA gene (13 526 nt) represents, to date, the longest described, due to the highest number of introns (eight) and the occurrence of six long nucleotidic extensions. Seven introns belong to group I, while the intronic sequence i5 constitutes the first typical group II intron reported in a fungal mitochondrial LSU rDNA. As with most fungal LSU rDNA introns reported to date, four introns (i5-i8) are distributed in domain V associated with the peptidyl-transferase activity. One intron (i1) is located in domain I, and three (i2-i4) in domain II. The introns i2-i8 possess homologies with other fungal, algal or protozoan introns located at the same position in LSU rDNAs. One of them (i6) is located at the same insertion site as most Ascomycota or algae LSU introns, suggesting a possible inheritance from a common ancestor. On the contrary, intron i1 is located at a so-far unreported insertion site. Among the six unusual nucleotide extensions, five are located in domain I and one in domain V. This is the first report of a mitochondrial LSU rRNA gene sequence and secondary structure for the whole Basidiomycota division.

Bacillus horneckiae sp. nov., isolated from a spacecraft-assembly clean room.

PubMed

Vaishampayan, Parag; Probst, Alexander; Krishnamurthi, Srinivasan; Ghosh, Sudeshna; Osman, Shariff; McDowall, Alasdair; Ruckmani, Arunachalam; Mayilraj, Shanmugam; Venkateswaran, Kasthuri

2010-05-01

Five Gram-stain-positive, motile, aerobic strains were isolated from a clean room of the Kennedy Space Center where the Phoenix spacecraft was assembled. All strains are rod-shaped, spore-forming bacteria, whose spores were resistant to UV radiation up to 1000 J m(-2). The spores were subterminally positioned and produced an external layer. A polyphasic taxonomic study including traditional biochemical tests, fatty acid analysis, cell-wall typing, lipid analyses, 16S rRNA gene sequencing and DNA-DNA hybridization studies was performed to characterize these novel strains. 16S rRNA gene sequencing and lipid analyses convincingly grouped these novel strains within the genus Bacillus as a cluster separate from already described species. The similarity of 16S rRNA gene sequences among the novel strains was >99 %, but the similarity was only about 97 % with their nearest neighbours Bacillus pocheonensis, Bacillus firmus and Bacillus bataviensis. DNA-DNA hybridization dissociation values were <24 % to the closest related type strains. The novel strains had a G+C content 35.6+/-0.5 mol% and could liquefy gelatin but did not utilize or produce acids from any of the carbon substrates tested. The major fatty acids were iso-C(15 : 0) and anteiso-C(15 : 0) and the cell-wall diamino acid was meso-diaminopimelic acid. Based on phylogenetic and phenotypic results, it is concluded that these strains represent a novel species of the genus Bacillus, for which the name Bacillus horneckiae sp. nov. is proposed. The type strain is 1P01SC(T) (=NRRL B-59162(T) =MTCC 9535(T)).

Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences.

PubMed

Cernotíková, Eva; Horák, Ales; Moravec, Frantisek

2011-06-01

Abstract: Small subunit rRNA sequences were obtained from 38 representatives mainly of the nematode orders Spirurida (Camallanidae, Cystidicolidae, Daniconematidae, Philometridae, Physalopteridae, Rhabdochonidae, Skrjabillanidae) and, in part, Ascaridida (Anisakidae, Cucullanidae, Quimperiidae). The examined nematodes are predominantly parasites of fishes. Their analyses provided well-supported trees allowing the study ofphylogenetic relationships among some spirurine nematodes. The present results support the placement of Cucullanidae at the base of the suborder Spirurina and, based on the position of the genus Philonema (subfamily Philoneminae) forming a sister group to Skrjabillanidae (thus Philoneminae should be elevated to Philonemidae), the paraphyly of the Philometridae. Comparison of a large number of sequences of representatives of the latter family supports the paraphyly of the genera Philometra, Philometroides and Dentiphilometra. The validity of the newly included genera Afrophilometra and Caranginema is not supported. These results indicate geographical isolation has not been the cause of speciation in this parasite group and no coevolution with fish hosts is apparent. On the contrary, the group of South-American species ofAlinema, Nilonema and Rumai is placed in an independent branch, thus markedly separated from other family members. Molecular data indicate that the skrjabillanid subfamily Esocineminae (represented by Esocinema bohemicum) should be either elevated to the rank of an independent family or Daniconematidae (Mexiconema africanum) should be decreased to Daniconematinae and transferred to the family Skrjabillanidae. Camallanid genera Camallanus and Procamallanus, as well as the subgenera Procamallanus and Spirocamallanus are confirmed to be paraphyletic. Paraphyly has also been found within Filarioidea, Habronematoidea and Thelazioidea and in Cystidicolidae, Physalopteridae and Thelaziidae. The results of the analyses also show that Neoascarophis, Spinitectus and Rhabdochona are monophyletic, in contrast to the paraphyletic genus Ascarophis. They further confirm the independence of two subgenera, Rhabdochona and Globochona, in the genus Rhabdochona. The necessity of further studies of fish-parasitizing representatives of additional nematode families not yet studied by molecular methods, such as Guyanemidae, Lucionematidae or Tetanonematidae, is underscored.

Characterization of Mycobacteria from a Major Brazilian Outbreak Suggests that Revision of the Taxonomic Status of Members of the Mycobacterium chelonae-M. abscessus Group Is Needed ▿

PubMed Central

Leao, Sylvia Cardoso; Tortoli, Enrico; Viana-Niero, Cristina; Ueki, Suely Yoko Mizuka; Lima, Karla Valeria Batista; Lopes, Maria Luiza; Yubero, Jesus; Menendez, Maria Carmen; Garcia, Maria Jesus

2009-01-01

An outbreak of postsurgical infections caused by rapidly growing mycobacteria has been ongoing in Brazil since 2004. The degrees of similarity of the rpoB and hsp65 sequences from the clinical isolates and the corresponding sequences from both the Mycobacterium massiliense and the M. bolletii type strains were above the accepted limit for interspecies variability, leading to conflicting identification results. Therefore, an extensive characterization of members of the M. chelonae-M. abscessus group was carried out. The M. abscessus, M. chelonae, M. immunogenum, M. massiliense, and M. bolletii type strains and a subset of clinical isolates were analyzed by biochemical tests, high-performance liquid chromatography, drug susceptibility testing, PCR-restriction enzyme analysis of hsp65 (PRA-hsp65), rpoB, and hsp65 gene sequencing and analysis of phylogenetic trees, DNA-DNA hybridization (DDH), and restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene (RFLP-16S rRNA). The clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains could not be separated by phenotypic tests and were grouped in the phylogenetic trees obtained. The results of DDH also confirmed the >70% relatedness of the clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains; and indistinguishable RFLP-16S rRNA patterns were obtained. On the contrary, the separation of clinical isolates and the M. abscessus, M. massiliense, and M. bolletii type strains from M. chelonae and M. immunogenum was supported by the results of PRA-hsp65, DDH, and RFLP-16S rRNA and by the rpoB and hsp65 phylogenetic trees. Taken together, these results led to the proposition that M. abscessus, M. massiliense, and M. bolletii represent a single species, that of M. abscessus. Two subspecies are also proposed, M. abscessus subsp. abscessus and M. abscessus subsp. massiliense, and these two subspecies can be distinguished by two different PRA-hsp65 patterns, which differ by a single HaeIII band, and by differences in their rpoB (3.4%) and hsp65 (1.3%) sequences. PMID:19571015

MetaMetaDB: A Database and Analytic System for Investigating Microbial Habitability

PubMed Central

Yang, Ching-chia; Iwasaki, Wataru

2014-01-01

MetaMetaDB (http://mmdb.aori.u-tokyo.ac.jp/) is a database and analytic system for investigating microbial habitability, i.e., how a prokaryotic group can inhabit different environments. The interaction between prokaryotes and the environment is a key issue in microbiology because distinct prokaryotic communities maintain distinct ecosystems. Because 16S ribosomal RNA (rRNA) sequences play pivotal roles in identifying prokaryotic species, a system that comprehensively links diverse environments to 16S rRNA sequences of the inhabitant prokaryotes is necessary for the systematic understanding of the microbial habitability. However, existing databases are biased to culturable prokaryotes and exhibit limitations in the comprehensiveness of the data because most prokaryotes are unculturable. Recently, metagenomic and 16S rRNA amplicon sequencing approaches have generated abundant 16S rRNA sequence data that encompass unculturable prokaryotes across diverse environments; however, these data are usually buried in large databases and are difficult to access. In this study, we developed MetaMetaDB (Meta-Metagenomic DataBase), which comprehensively and compactly covers 16S rRNA sequences retrieved from public datasets. Using MetaMetaDB, users can quickly generate hypotheses regarding the types of environments a prokaryotic group may be adapted to. We anticipate that MetaMetaDB will improve our understanding of the diversity and evolution of prokaryotes. PMID:24475242

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific micropollutants. This work is an important step towards developing tools to predict biotransformation rates in WWTPs based on taxonomic composition. Copyright © 2014 Elsevier Ltd. All rights reserved.

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

Phylogenetic analysis of anaerobic psychrophilic enrichment cultures obtained from a greenland glacier ice core

NASA Technical Reports Server (NTRS)

Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

2003-01-01

The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at -9 degrees C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 x 10(7) cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at -2 degrees C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years.

Phylogenetic Analysis of Anaerobic Psychrophilic Enrichment Cultures Obtained from a Greenland Glacier Ice Core

PubMed Central

Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

2003-01-01

The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at −9°C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 × 107 cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at −2°C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years. PMID:12676695

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Acidovorax anthurii sp. nov., a new phytopathogenic bacterium which causes bacterial leaf-spot of anthurium.

PubMed

Gardan, L; Dauga, C; Prior, P; Gillis, M; Saddler, G S

2000-01-01

The bacterial leaf-spot of anthurium emerged during the 1980s, in the French West Indies and Trinidad. This new bacterial disease is presently wide spread and constitutes a serious limiting factor for commercial anthurium production. Twenty-nine strains isolated from leaf-spots of naturally infected anthurium were characterized and compared with reference strains belonging to the Comamonadaceae family, the genera Ralstonia and Burkholderia, and representative fluorescent pseudomonads. From artificial inoculations 25 out of 29 strains were pathogenic on anthurium. Biochemical and physiological tests, fatty acid analysis, DNA-DNA hybridization, 16S rRNA gene sequence analysis, DNA-16S RNA hybridization were performed. The 25 pathogenic strains on anthurium were clustered in one phenon closely related to phytopathogenic strains of the genus Acidovorax. Anthurium strains were 79-99% (deltaTm range 0.2-1.6) related to the strain CFBP 3232 and constituted a discrete DNA homology group indicating that they belong to the same species. DNA-rRNA hybridization, 16S rRNA sequence and fatty acid analysis confirmed that this new species belongs to the beta-subclass of Proteobacteria and to rRNA superfamily III, to the family of Comamonadaceae and to the genus Acidovorax. The name Acidovorax anthurii is proposed for this new phytopathogenic bacterium. The type strain has been deposited in the Collection Française des Bactéries Phytopathogènes as CFBP 3232T.

Genetic relationships between blowflies (Calliphoridae) of forensic importance.

PubMed

Stevens, J; Wall, R

2001-08-15

Phylogenetic relationships among blowfly (Calliphoridae) species of forensic importance are explored using DNA sequence data from the large sub-unit (lsu, 28S) ribosomal RNA (rRNA) gene, the study includes representatives of a range of calliphorid species commonly encountered in forensic analysis in Britain and Europe. The data presented provide a basis to define molecular markers, including the identification of highly informative intra-sequence regions, which may be of use in the identification of larvae for forensic entomology. Phylogenetic analysis of the sequences also provides new insights into the different evolutionary patterns apparent within the family Calliphoridae which, additionally, can provide a measure of the degree of genetic variation likely to be encountered within taxonomic groups of differing forensic utility.

Molecular confirmation of Hepatozoon canis in Mauritius.

PubMed

Daskalaki, Aikaterini Alexandra; Ionică, Angela Monica; Jeetah, Keshav; Gherman, Călin Mircea; Mihalca, Andrei Daniel

2018-01-01

In this study, Hepatozoon species was molecularly identified and characterized for the first time on the Indian Ocean island of Mauritius. Partial sequences of the 18S rRNA gene of the Hepatozoon isolates were analysed from three naturally infected dogs. The sequences of H. canis were similar to the 18S rRNA partial sequences (JX112783, AB365071 99%) from dog blood samples from West Indies and Nigeria. Our sequences were deposited in the GenBank database. Copyright © 2017 Elsevier B.V. All rights reserved.

rpoB Gene Sequencing for Identification of Corynebacterium Species

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2004-01-01

The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970

Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

PubMed

Röder, Christoph; König, Helmut; Fröhlich, Jürgen

2007-09-01

Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

PubMed

Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

2014-01-01

Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

PubMed

Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

2017-10-06

Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

NASA Technical Reports Server (NTRS)

Winker, S.; Woese, C. R.

1991-01-01

The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

Steroidobacter denitrificans gen. nov., sp. nov., a steroidal hormone-degrading gammaproteobacterium.

PubMed

Fahrbach, Michael; Kuever, Jan; Remesch, Markko; Huber, Birgit E; Kämpfer, Peter; Dott, Wolfgang; Hollender, Juliane

2008-09-01

A denitrifying bacterium, designated strain FS(T), was isolated from anoxic digested sludge on oestradiol [17beta-oestra-1,3,5(10)-triene-3,17-diol] or testosterone (17beta-hydroxyandrost-4-en-3-one) as the sole source of carbon and energy with nitrate as the electron acceptor. Strain FS(T) represents the first known bacterium to grow anaerobically on both oestradiol (C-18) and testosterone (C-19). Steroidal hormones were degraded completely by nitrate reduction to dinitrogen monoxide, which was further reduced to dinitrogen in stationary-phase cultures. Gram-negative cells were slightly curved rods, 0.3-0.5 x 0.6-1.6 microm in size, motile, non-fermentative, non-spore-forming and catalase- and oxidase-positive, showing optimal growth at pH 7.0, 28 degrees C and 0.1% (w/v) NaCl. Beside steroidal hormones, the bacterium utilized only a narrow range of organic substrates with nitrate as the electron acceptor, including several fatty acids and glutamate. No aerobic or anaerobic growth occurred on liquid or solid complex media. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain FS(T) has no known close relatives and represents a distinct lineage within the Gammaproteobacteria. Together with the genera Nevskia, Hydrocarboniphaga, Solimonas and Sinobacter (less than 88% 16S rRNA gene sequence similarity to strain FS(T)), it forms a phylogenetic cluster separated from the families Chromatiaceae, Ectothiorhodospiraceae and Xanthomonadaceae. The quinone system of strain FS(T) consisted exclusively of ubiquinone Q-8. The dominant polar lipids were diphosphatidylglycerol and phosphatidylethanolamine. Spermidine in combination with putrescine and traces of sym-homospermidine were the basic polyamines. The major fatty acids detected in testosterone- or heptanoate-grown cells were C(15:0) and C(17:1)omega8c, minor hydroxylated fatty acids were C(11:0) 3-OH and C(12:0) 3-OH. The G+C content of the DNA was 61.9 mol%. Based on the high 16S rRNA gene sequence divergence and different phenotypic properties from previously described gammaproteobacteria in combination with chemotaxonomic data, strain FS(T) is considered to represent a new genus and species, for which the name Steroidobacter denitrificans gen. nov., sp. nov. is proposed. The type strain of Steroidobacter denitrificans is FS(T) (=DSM 18526(T) =JCM 14622(T)).

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

PubMed

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

PubMed Central

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

PubMed

França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

2015-01-01

Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

PubMed

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were relatively low, ranging from 68.7-97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella.

Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

PubMed Central

Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

2015-01-01

Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the inter-species similarities were relatively low, ranging from 68.7–97.9%. The housekeeping genes rpoB and gyrB1 were demonstrated to be alternative classification markers to the species level based on intra- and inter-species comparisons, whereas based on phylogenetic tree rpoB proved to be reliable phylogenetic marker for the genus Prevotella. PMID:26103050

Kiloniella laminariae gen. nov., sp. nov., an alphaproteobacterium from the marine macroalga Laminaria saccharina.

PubMed

Wiese, Jutta; Thiel, Vera; Gärtner, Andrea; Schmaljohann, Rolf; Imhoff, Johannes F

2009-02-01

A novel alphaproteobacterium, strain LD81(T), was isolated from the marine macroalga Laminaria saccharina. The bacterium is mesophilic and shows a typical marine growth response. It is a chemoheterotrophic aerobe with the potential for denitrification. Growth optima are 25 degrees C, pH 5.5 and 3 % NaCl. Strain LD81(T) has a unique phylogenetic position, not fitting any of the known families of the Alphaproteobacteria. The 16S rRNA gene sequence revealed a distant relationship to species of several orders of the Alphaproteobacteria, with less than 90 % sequence similarity. Phylogenetically, strain LD81(T) is related to the type strains of Terasakiella pusilla (88.4 % 16S rRNA gene sequence similarity) and the three Thalassospira species (88.9-89.2 %). It forms a cluster with these bacteria and a novel as-yet undescribed isolate (KOPRI 13522; 96.6 % sequence similarity). Strain LD81(T) has a relatively low DNA G+C content (51.1 mol%) and, due to its distant phylogenetic position from all other alphaproteobacteria, strain LD81(T) (=NCIMB 14374(T) =JCM 14845(T)) is considered as the type strain of a novel species within a new genus, for which the name Kiloniella laminariae gen. nov., sp. nov. is proposed. The genus Kiloniella represents the type of the new family Kiloniellaceae fam. nov. and order Kiloniellales ord. nov.

Bioprospecting Red Sea Coastal Ecosystems for Culturable Microorganisms and Their Antimicrobial Potential.

PubMed

Al-Amoudi, Soha; Essack, Magbubah; Simões, Marta F; Bougouffa, Salim; Soloviev, Irina; Archer, John A C; Lafi, Feras F; Bajic, Vladimir B

2016-09-10

Microorganisms that inhabit unchartered unique soil such as in the highly saline and hot Red Sea lagoons on the Saudi Arabian coastline, represent untapped sources of potentially new bioactive compounds. In this study, a culture-dependent approach was applied to three types of sediments: mangrove mud (MN), microbial mat (MM), and barren soil (BS), collected from Rabigh harbor lagoon (RHL) and Al-Kharrar lagoon (AKL). The isolated bacteria were evaluated for their potential to produce bioactive compounds. The phylogenetic characterization of 251 bacterial isolates based on the 16S rRNA gene sequencing, supported their assignment to five different phyla: Proteobacteria, Firmicutes, Actinobacteria, Bacteroidetes, and Planctomycetes. Fifteen putative novel species were identified based on a 16S rRNA gene sequence similarity to other strain sequences in the NCBI database, being ≤98%. We demonstrate that 49 of the 251 isolates exhibit the potential to produce antimicrobial compounds. Additionally, at least one type of biosynthetic gene sequence, responsible for the synthesis of secondary metabolites, was recovered from 25 of the 49 isolates. Moreover, 10 of the isolates had a growth inhibition effect towards Staphylococcus aureus, Salmonella typhimurium and Pseudomonas syringae. We report the previously unknown antimicrobial activity of B. borstelensis, P. dendritiformis and M. salipaludis against all three indicator pathogens. Our study demonstrates the evidence of diverse cultured microbes associated with the Red Sea harbor/lagoon environments and their potential to produce antimicrobial compounds.

Small subunit ribosomal RNA genes of tabanids and hippoboscids (Diptera: Brachycera): evolutionary relationships and comparison with other Diptera.

PubMed

Carreno, R A; Barta, J R

1998-11-01

The small subunit ribosomal RNA (SSU rRNA) genes of hippoboscid (Ornithoica vicina Walker) and tabanid (Chrysops niger Macquart) Diptera were sequenced to determine their phylogenetic position within the order and to determine whether or not extensive hypervariable regions in this gene are widespread in the Diptera. A parsimony analysis of an alignment containing 8 dipteran sequences produced a single most parsimonious tree that placed O. vicina as sister group to Drosophila melanogaster Meigen. The tabanid Chrysops niger was sister group to the asilomorphan taxa, and the sister group to the Brachycera was a Tipula sp. although this relationship was not supported by bootstrap analysis. The hippoboscid and tabanid sequences contain extensive hypervariable regions in the V2, V4, V6, and V7 regions as do other Diptera. When these regions of the alignment were excluded from the phylogenetic analysis, a single most parsimonious tree was found. This tree had an identical overall topology to the tree obtained from the total data set. The hypervariable regions in parts of the dipteran SSU rRNA genes were more extensive in the nematocerous dipteran sequences used in this study than in the other dipteran representatives; these hypervariable regions may be of more utility in inferring relationship among species and subspecies than at the suprageneric level.

Methylobacterium phyllosphaerae sp. nov., a pink-pigmented, facultative methylotroph from the phyllosphere of rice.

PubMed

Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min

2009-01-01

A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Yeast diversity during the fermentation of Andean chicha: A comparison of high-throughput sequencing and culture-dependent approaches.

PubMed

Mendoza, Lucía M; Neef, Alexander; Vignolo, Graciela; Belloch, Carmela

2017-10-01

Diversity and dynamics of yeasts associated with the fermentation of Argentinian maize-based beverage chicha was investigated. Samples taken at different stages from two chicha productions were analyzed by culture-dependent and culture-independent methods. Five hundred and ninety six yeasts were isolated by classical microbiological methods and 16 species identified by RFLPs and sequencing of D1/D2 26S rRNA gene. Genetic typing of isolates from the dominant species, Saccharomyces cerevisiae, by PCR of delta elements revealed up to 42 different patterns. High-throughput sequencing (HTS) of D1/D2 26S rRNA gene amplicons from chicha samples detected more than one hundred yeast species and almost fifty filamentous fungi taxa. Analysis of the data revealed that yeasts dominated the fermentation, although, a significant percentage of filamentous fungi appeared in the first step of the process. Statistical analysis of results showed that very few taxa were represented by more than 1% of the reads per sample at any step of the process. S. cerevisiae represented more than 90% of the reads in the fermentative samples. Other yeast species dominated the pre-fermentative steps and abounded in fermented samples when S. cerevisiae was in percentages below 90%. Most yeasts species detected by pyrosequencing were not recovered by cultivation. In contrast, the cultivation-based methodology detected very few yeast taxa, and most of them corresponded with very few reads in the pyrosequencing analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sellimonas intestinalis gen. nov., sp. nov., isolated from human faeces.

PubMed

Seo, Boram; Yoo, Ju Eun; Lee, Yung Mi; Ko, GwangPyo

2016-02-01

A Gram-stain-positive and obligately anaerobic bacterial strain, BR72 T , forming ivory yellow colonies was isolated from a faecal sample of a healthy Korean woman. 16S rRNA gene sequence analysis indicated that strain BR72 T belongs to Clostridium cluster XIVa and represents a distinct phyletic line within the family Lachnospiraceae . The most closely related strains were Clostridium nexile DSM 1787 T (94.1 % 16S rRNA gene sequence similarity), Coprococcus comes ATCC 27758 T (93.5 %), Ruminococcus torques ATCC 27756 T (93.5 %), Ruminococcus lactaris ATCC 29176 T (93.5 %), Clostridium aerotolerans DSM 5434 T (93.1 %) and Eubacterium fissicatena DSM 3598 T (92.9 %). The DNA G+C content of strain BR72 T based on its genome sequence was 45.3 mol%. The major cellular fatty acids were C 16 : 0 , C 14 : 0 , and iso-C 17 : 1 I and/or anteiso-C 17 : 1 B. Acetic acid was produced from glucose fermentation. Other physiological and biochemical comparisons allowed the phenotypic differentiation of strain BR72 T from the members of the family Lachnospiraceae . Based on the phylogenetic and phenotypic findings, this strain is considered to represent a novel species of a new genus belonging to the family Lachnospiraceae and the name Sellimonas intestinalis gen. nov., sp. nov. is proposed. The type strain of Sellimonas intestinalis is BR72 T ( = KCTC 15479 T  = JCM 30749 T ).

Yeast species associated with orange juice: evaluation of different identification methods.

PubMed

Arias, Covadonga R; Burns, Jacqueline K; Friedrich, Lorrie M; Goodrich, Renee M; Parish, Mickey E

2002-04-01

Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice.

Mycobacterium intermedium sp. nov.

PubMed

Meier, A; Kirschner, P; Schröder, K H; Wolters, J; Kroppenstedt, R M; Böttger, E C

1993-04-01

Strains of a new type of slowly growing mycobacterium were repeatedly isolated from sputum from a patient with pulmonary disease. This photochromogenic organism grew at 22, 31, 37, and 41 degrees C, possessed catalase, acid phosphatase, esterase, beta-galactosidase, and arylsulfatase activities, and hydrolyzed Tween. It did not produce nicotinic acid or have nitrate reductase, acetamidase, benzamidase, isonicotinamidase, nicotinamidase, pyrazinamidase, succinidamidase, and acid phosphatase activities. Urease activity was variable. The organism is susceptible to ethambutol and resistant to isoniazid and streptomycin. A mycolic acid analysis revealed the presence of alpha-mycolates, alpha'-mycolates, and keto-mycolates. The results of comparative 16S rRNA sequencing placed this organism at an intermediate position between the rapidly and slowly growing mycobacteria. On the basis of the pattern of enzymatic activities and metabolic properties, the results of fatty acid analyses, and the unique 16S rRNA sequence, we propose that this organism represents a new species, for which we propose the name Mycobacterium intermedium. The type strain is strain 1669/91; a culture of this strain has been deposited in the Deutsche Sammlung von Mikroorganismen und Zellkulturen as strain DSM 44049.

Phylogenetic screening of a bacterial, metagenomic library using homing endonuclease restriction and marker insertion

PubMed Central

Yung, Pui Yi; Burke, Catherine; Lewis, Matt; Egan, Suhelen; Kjelleberg, Staffan; Thomas, Torsten

2009-01-01

Metagenomics provides access to the uncultured majority of the microbial world. The approaches employed in this field have, however, had limited success in linking functional genes to the taxonomic or phylogenetic origin of the organism they belong to. Here we present an efficient strategy to recover environmental DNA fragments that contain phylogenetic marker genes from metagenomic libraries. Our method involves the cleavage of 23S ribsosmal RNA (rRNA) genes within pooled library clones by the homing endonuclease I-CeuI followed by the insertion and selection of an antibiotic resistance cassette. This approach was applied to screen a library of 6500 fosmid clones derived from the microbial community associated with the sponge Cymbastela concentrica. Several fosmid clones were recovered after the screen and detailed phylogenetic and taxonomic assignment based on the rRNA gene showed that they belong to previously unknown organisms. In addition, compositional features of these fosmid clones were used to classify and taxonomically assign a dataset of environmental shotgun sequences. Our approach represents a valuable tool for the analysis of rapidly increasing, environmental DNA sequencing information. PMID:19767618

The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.

PubMed

Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C

1994-12-01

Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.

Streptococcus tangierensis sp. nov. and Streptococcus cameli sp. nov., two novel Streptococcus species isolated from raw camel milk in Morocco.

PubMed

Kadri, Zaina; Vandamme, Peter; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; Elfahime, El Mostafa; Farricha, Omar El; Swings, Jean; Amar, Mohamed

2015-02-01

Biochemical and molecular genetic studies were performed on two unidentified Gram-stain positive, catalase and oxidase negative, non-hemolytic Streptococcus-like organisms recovered from raw camel milk in Morocco. Phenotypic characterization and comparative 16S rRNA gene sequencing demonstrated that the two strains were highly different from each other and that they did not correspond to any recognized species of the genus Streptococcus. Phylogenetic analysis based on 16S rRNA gene sequences showed the unidentified organisms each formed a hitherto unknown sub-line within the genus Streptococcus, displaying a close affinity with Streptococcus moroccensis, Streptococcus minor and Streptococcus ovis. DNA G+C content determination, MALDI-TOF mass spectrometry and biochemical tests demonstrated the bacterial isolates represent two novel species. Based on the phenotypic distinctiveness of the new bacteria and molecular genetic evidence, it is proposed to classify the two strains as Streptococcus tangierensis sp. nov., with CCMM B832(T) (=LMG 27683(T)) as the type strain, and Streptococcus cameli sp. nov., with CCMM B834(T) (=LMG 27685(T)) as the type strain.

Roseomonas wooponensis sp. nov., isolated from wetland freshwater.

PubMed

Lee, Ji Hee; Kim, Mi Sun; Baik, Keun Sik; Kim, Hyang Mi; Lee, Kang Hyun; Seong, Chi Nam

2015-11-01

A non-motile, cocobacilli-shaped and pink-pigmented bacterium, designated strain WW53T, was isolated from wetland freshwater (Woopo wetland, Republic of Korea). Cells were Gram-stain-negative, catalase- and oxidase-positive. The major fatty acids were C18 : 1ω7c/C18 : 1ω6c and C16 : 0.The predominant quinone and polyamine were ubiquinone 10 (Q-10) and spermidine, respectively. The DNA G+C content was 71 mol%. The major polar lipids were phosphatidylethanolamine, phosphatidylcholine and an unknown aminolipid. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain WW53T belongs to the family Acetobacteraceae, and is related to the genus Roseomonas. Strain WW53T was most closely related to Roseomonas stagni HS-69T (95.3 % 16S rRNA gene sequence similarity). Results of a polyphasic taxonomy study suggested that the isolate represents a novel species in the genus Roseomonas, for which the name Roseomonas wooponensis sp. nov. is proposed. The type strain is WW53T ( = KCTC 32534T = JCM 19527T).

Life in the dark: metagenomic evidence that a microbial slime community is driven by inorganic nitrogen metabolism.

PubMed

Tetu, Sasha G; Breakwell, Katy; Elbourne, Liam D H; Holmes, Andrew J; Gillings, Michael R; Paulsen, Ian T

2013-06-01

Beneath Australia's large, dry Nullarbor Plain lies an extensive underwater cave system, where dense microbial communities known as 'slime curtains' are found. These communities exist in isolation from photosynthetically derived carbon and are presumed to be chemoautotrophic. Earlier work found high levels of nitrite and nitrate in the cave waters and a high relative abundance of Nitrospirae in bacterial 16S rRNA clone libraries. This suggested that these communities may be supported by nitrite oxidation, however, details of the inorganic nitrogen cycling in these communities remained unclear. Here we report analysis of 16S rRNA amplicon and metagenomic sequence data from the Weebubbie cave slime curtain community. The microbial community is comprised of a diverse assortment of bacterial and archaeal genera, including an abundant population of Thaumarchaeota. Sufficient thaumarchaeotal sequence was recovered to enable a partial genome sequence to be assembled, which showed considerable synteny with the corresponding regions in the genome of the autotrophic ammonia oxidiser Nitrosopumilus maritimus SCM1. This partial genome sequence, contained regions with high sequence identity to the ammonia mono-oxygenase operon and carbon fixing 3-hydroxypropionate/4-hydroxybutyrate cycle genes of N. maritimus SCM1. Additionally, the community, as a whole, included genes encoding key enzymes for inorganic nitrogen transformations, including nitrification and denitrification. We propose that the Weebubbie slime curtain community represents a distinctive microbial ecosystem, in which primary productivity is due to the combined activity of archaeal ammonia-oxidisers and bacterial nitrite oxidisers.

Identification of Clinical Coryneform Bacterial Isolates: Comparison of Biochemical Methods and Sequence Analysis of 16S rRNA and rpoB Genes▿

PubMed Central

Adderson, Elisabeth E.; Boudreaux, Jan W.; Cummings, Jessica R.; Pounds, Stanley; Wilson, Deborah A.; Procop, Gary W.; Hayden, Randall T.

2008-01-01

We compared the relative levels of effectiveness of three commercial identification kits and three nucleic acid amplification tests for the identification of coryneform bacteria by testing 50 diverse isolates, including 12 well-characterized control strains and 38 organisms obtained from pediatric oncology patients at our institution. Between 33.3 and 75.0% of control strains were correctly identified to the species level by phenotypic systems or nucleic acid amplification assays. The most sensitive tests were the API Coryne system and amplification and sequencing of the 16S rRNA gene using primers optimized for coryneform bacteria, which correctly identified 9 of 12 control isolates to the species level, and all strains with a high-confidence call were correctly identified. Organisms not correctly identified were species not included in the test kit databases or not producing a pattern of reactions included in kit databases or which could not be differentiated among several genospecies based on reaction patterns. Nucleic acid amplification assays had limited abilities to identify some bacteria to the species level, and comparison of sequence homologies was complicated by the inclusion of allele sequences obtained from uncultivated and uncharacterized strains in databases. The utility of rpoB genotyping was limited by the small number of representative gene sequences that are currently available for comparison. The correlation between identifications produced by different classification systems was poor, particularly for clinical isolates. PMID:18160450

Hungatella effluvii gen. nov., sp. nov., an obligately anaerobic bacterium isolated from an effluent treatment plant, and reclassification of Clostridium hathewayi as Hungatella hathewayi gen. nov., comb. nov.

PubMed

Kaur, Sukhpreet; Yawar, Mir; Kumar, P Anil; Suresh, K

2014-03-01

A Gram-stain-positive, rod-shaped, spore-forming and strictly anaerobic bacterium, designated UB-B.2(T), was isolated from an industrial effluent anaerobic digester sample. It grew optimally at 30 °C and pH 7.0. Comparative analysis of the 16S rRNA gene sequence confirmed that strain UB-B.2(T) was closely related to Clostridium hathewayi DSM 13479(T) (97.84% similarity), a member of rRNA gene cluster XIVa of the genus Clostridium, and formed a coherent cluster with other related members of the Blautia (Clostridium) coccoides rRNA group in phylogenetic analyses. The end products of glucose fermentation by strain UB-B.2(T) were acetate and propionate. The G+C content of the DNA was 51.4 mol%. Although strain UB-B.2(T) showed 97.8% 16S rRNA gene sequence identity to the type strain of C. hathewayi, it exhibited only 38.4% relatedness at the whole-genome level. It also showed differences from its closest phylogenetic relative, C. hathewayi DSM 13479(T), in phenotypic characteristics such as hydrolysis of aesculin, starch and urea and fermentation end products. Both strains showed phenotypic differences from the members of rRNA gene cluster XIVa of the genus Clostridium. Based on these differences, C. hathewayi DSM 13479(T) and strain UB-B.2(T) were identified as representatives of a new genus of the family Clostridiaceae. Thus, we propose the reclassification of Clostridium hathewayi as Hungatella hathewayi gen. nov., comb. nov., the type species of the new genus (type strain DSM 13479(T) = CCUG 43506(T) = MTCC 10951(T)). Strain UB-B.2(T) ( = MTCC 11101(T) = DSM 24995(T)) is assigned to the novel species Hungatella effluvii gen. nov., sp. nov as the type strain.

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

PubMed

van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

1992-10-01

The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome

PubMed Central

Durham, Bryndan P.; Grote, Jana; Whittaker, Kerry A.; Bender, Sara J.; Luo, Haiwei; Grim, Sharon L.; Brown, Julia M.; Casey, John R.; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M.; Mine, Aric H.; Nigro, Olivia D.; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K.; Weber, Thomas S.; Wilson, Jesse M.; Church, Matthew J.; DeLong, Edward F.; Karl, David M.; Steward, Grieg F.; Eppley, John M.; Kyrpides, Nikos C.; Schuster, Stephan; Rappé, Michael S.

2014-01-01

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters. PMID:25197450

Draft genome sequence of marine alphaproteobacterial strain HIMB11, the first cultivated representative of a unique lineage within the Roseobacter clade possessing an unusually small genome.

PubMed

Durham, Bryndan P; Grote, Jana; Whittaker, Kerry A; Bender, Sara J; Luo, Haiwei; Grim, Sharon L; Brown, Julia M; Casey, John R; Dron, Antony; Florez-Leiva, Lennin; Krupke, Andreas; Luria, Catherine M; Mine, Aric H; Nigro, Olivia D; Pather, Santhiska; Talarmin, Agathe; Wear, Emma K; Weber, Thomas S; Wilson, Jesse M; Church, Matthew J; DeLong, Edward F; Karl, David M; Steward, Grieg F; Eppley, John M; Kyrpides, Nikos C; Schuster, Stephan; Rappé, Michael S

2014-06-15

Strain HIMB11 is a planktonic marine bacterium isolated from coastal seawater in Kaneohe Bay, Oahu, Hawaii belonging to the ubiquitous and versatile Roseobacter clade of the alphaproteobacterial family Rhodobacteraceae. Here we describe the preliminary characteristics of strain HIMB11, including annotation of the draft genome sequence and comparative genomic analysis with other members of the Roseobacter lineage. The 3,098,747 bp draft genome is arranged in 34 contigs and contains 3,183 protein-coding genes and 54 RNA genes. Phylogenomic and 16S rRNA gene analyses indicate that HIMB11 represents a unique sublineage within the Roseobacter clade. Comparison with other publicly available genome sequences from members of the Roseobacter lineage reveals that strain HIMB11 has the genomic potential to utilize a wide variety of energy sources (e.g. organic matter, reduced inorganic sulfur, light, carbon monoxide), while possessing a reduced number of substrate transporters.

Use of real-time qPCR to quantify members of the unculturable heterotrophic bacterial community in a deep sea marine sponge, Vetulina sp.

PubMed

Cassler, M; Peterson, C L; Ledger, A; Pomponi, S A; Wright, A E; Winegar, R; McCarthy, P J; Lopez, J V

2008-04-01

In this report, real-time quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S-like rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of individual bacterial members of a diverse, yet mostly unculturable, microbial community from a marine sponge. Molecular phylogenetic analyses of bacterial communities derived from Caribbean Lithistid sponges have shown a wide diversity of microbes that included at least six major subdivisions; however, very little overlap was observed between the culturable and unculturable microbial communities. Based on sequence data of three culture-independent Lithistid-derived representative bacteria, we designed probe/primer sets for TaqMan qPCR to quantitatively characterize selected microbial residents in a Lithistid sponge, Vetulina, metagenome. TaqMan assays included specificity testing, DNA limit of detection analysis, and quantification of specific microbial rRNA sequences such as Nitrospira-like microbes and Actinobacteria up to 172 million copies per microgram per Lithistid sponge metagenome. By contrast, qPCR amplification with probes designed for common previously cultured sponge-associated bacteria in the genera Rheinheimera and Marinomonas and a representative of the CFB group resulted in only minimal detection of the Rheiheimera in total DNA extracted from the sponge. These data verify that a large portion of the microbial community within Lithistid sponges may consist of currently unculturable microorganisms.

Mycobacterium ahvazicum sp. nov., the nineteenth species of the Mycobacterium simiae complex.

PubMed

Bouam, Amar; Heidarieh, Parvin; Shahraki, Abodolrazagh Hashemi; Pourahmad, Fazel; Mirsaeidi, Mehdi; Hashemzadeh, Mohamad; Baptiste, Emeline; Armstrong, Nicholas; Levasseur, Anthony; Robert, Catherine; Drancourt, Michel

2018-03-07

Four slowly growing mycobacteria isolates were isolated from the respiratory tract and soft tissue biopsies collected in four unrelated patients in Iran. Conventional phenotypic tests indicated that these four isolates were identical to Mycobacterium lentiflavum while 16S rRNA gene sequencing yielded a unique sequence separated from that of M. lentiflavum. One representative strain AFP-003 T was characterized as comprising a 6,121,237-bp chromosome (66.24% guanosine-cytosine content) encoding for 5,758 protein-coding genes, 50 tRNA and one complete rRNA operon. A total of 2,876 proteins were found to be associated with the mobilome, including 195 phage proteins. A total of 1,235 proteins were found to be associated with virulence and 96 with toxin/antitoxin systems. The genome of AFP-003 T has the genetic potential to produce secondary metabolites, with 39 genes found to be associated with polyketide synthases and non-ribosomal peptide syntases and 11 genes encoding for bacteriocins. Two regions encoding putative prophages and three OriC regions separated by the dnaA gene were predicted. Strain AFP-003 T genome exhibits 86% average nucleotide identity with Mycobacterium genavense genome. Genetic and genomic data indicate that strain AFP-003 T is representative of a novel Mycobacterium species that we named Mycobacterium ahvazicum, the nineteenth species of the expanding Mycobacterium simiae complex.

The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

PubMed Central

Robinett, C C; O'Connor, A; Dunaway, M

1997-01-01

We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

Dissemination and genetic diversity of chlamydial agents in Polish wildfowl: Isolation and molecular characterisation of avian Chlamydia abortus strains.

PubMed

Szymańska-Czerwińska, Monika; Mitura, Agata; Niemczuk, Krzysztof; Zaręba, Kinga; Jodełko, Agnieszka; Pluta, Aneta; Scharf, Sabine; Vitek, Bailey; Aaziz, Rachid; Vorimore, Fabien; Laroucau, Karine; Schnee, Christiane

2017-01-01

Wild birds are considered as a reservoir for avian chlamydiosis posing a potential infectious threat to domestic poultry and humans. Analysis of 894 cloacal or fecal swabs from free-living birds in Poland revealed an overall Chlamydiaceae prevalence of 14.8% (n = 132) with the highest prevalence noted in Anatidae (19.7%) and Corvidae (13.4%). Further testing conducted with species-specific real-time PCR showed that 65 samples (49.2%) were positive for C. psittaci whereas only one was positive for C. avium. To classify the non-identified chlamydial agents and to genotype the C. psittaci and C. avium-positive samples, specimens were subjected to ompA-PCR and sequencing (n = 83). The ompA-based NJ dendrogram revealed that only 23 out of 83 sequences were assigned to C. psittaci, in particular to four clades representing the previously described C. psittaci genotypes B, C, Mat116 and 1V. Whereas the 59 remaining sequences were assigned to two new clades named G1 and G2, each one including sequences recently obtained from chlamydiae detected in Swedish wetland birds. G1 (18 samples from Anatidae and Rallidae) grouped closely together with genotype 1V and in relative proximity to several C. abortus isolates, and G2 (41 samples from Anatidae and Corvidae) grouped closely to C. psittaci strains of the classical ABE cluster, Matt116 and M56. Finally, deep molecular analysis of four representative isolates of genotypes 1V, G1 and G2 based on 16S rRNA, IGS and partial 23S rRNA sequences as well as MLST clearly classify these isolates within the C. abortus species. Consequently, we propose an expansion of the C. abortus species to include not only the classical isolates of mammalian origin, but also avian isolates so far referred to as atypical C. psittaci or C. psittaci/C. abortus intermediates.

Dissemination and genetic diversity of chlamydial agents in Polish wildfowl: Isolation and molecular characterisation of avian Chlamydia abortus strains

PubMed Central

Szymańska-Czerwińska, Monika; Mitura, Agata; Niemczuk, Krzysztof; Zaręba, Kinga; Jodełko, Agnieszka; Pluta, Aneta; Scharf, Sabine; Vitek, Bailey; Aaziz, Rachid; Vorimore, Fabien; Laroucau, Karine; Schnee, Christiane

2017-01-01

Wild birds are considered as a reservoir for avian chlamydiosis posing a potential infectious threat to domestic poultry and humans. Analysis of 894 cloacal or fecal swabs from free-living birds in Poland revealed an overall Chlamydiaceae prevalence of 14.8% (n = 132) with the highest prevalence noted in Anatidae (19.7%) and Corvidae (13.4%). Further testing conducted with species-specific real-time PCR showed that 65 samples (49.2%) were positive for C. psittaci whereas only one was positive for C. avium. To classify the non-identified chlamydial agents and to genotype the C. psittaci and C. avium-positive samples, specimens were subjected to ompA-PCR and sequencing (n = 83). The ompA-based NJ dendrogram revealed that only 23 out of 83 sequences were assigned to C. psittaci, in particular to four clades representing the previously described C. psittaci genotypes B, C, Mat116 and 1V. Whereas the 59 remaining sequences were assigned to two new clades named G1 and G2, each one including sequences recently obtained from chlamydiae detected in Swedish wetland birds. G1 (18 samples from Anatidae and Rallidae) grouped closely together with genotype 1V and in relative proximity to several C. abortus isolates, and G2 (41 samples from Anatidae and Corvidae) grouped closely to C. psittaci strains of the classical ABE cluster, Matt116 and M56. Finally, deep molecular analysis of four representative isolates of genotypes 1V, G1 and G2 based on 16S rRNA, IGS and partial 23S rRNA sequences as well as MLST clearly classify these isolates within the C. abortus species. Consequently, we propose an expansion of the C. abortus species to include not only the classical isolates of mammalian origin, but also avian isolates so far referred to as atypical C. psittaci or C. psittaci/C. abortus intermediates. PMID:28350846

Independent studies using deep sequencing resolve the same set of core bacterial species dominating gut communities of honey bees.

PubMed

Sabree, Zakee L; Hansen, Allison K; Moran, Nancy A

2012-01-01

Starting in 2003, numerous studies using culture-independent methodologies to characterize the gut microbiota of honey bees have retrieved a consistent and distinctive set of eight bacterial species, based on near identity of the 16S rRNA gene sequences. A recent study [Mattila HR, Rios D, Walker-Sperling VE, Roeselers G, Newton ILG (2012) Characterization of the active microbiotas associated with honey bees reveals healthier and broader communities when colonies are genetically diverse. PLoS ONE 7(3): e32962], using pyrosequencing of the V1-V2 hypervariable region of the 16S rRNA gene, reported finding entirely novel bacterial species in honey bee guts, and used taxonomic assignments from these reads to predict metabolic activities based on known metabolisms of cultivable species. To better understand this discrepancy, we analyzed the Mattila et al. pyrotag dataset. In contrast to the conclusions of Mattila et al., we found that the large majority of pyrotag sequences belonged to clusters for which representative sequences were identical to sequences from previously identified core species of the bee microbiota. On average, they represent 95% of the bacteria in each worker bee in the Mattila et al. dataset, a slightly lower value than that found in other studies. Some colonies contain small proportions of other bacteria, mostly species of Enterobacteriaceae. Reanalysis of the Mattila et al. dataset also did not support a relationship between abundances of Bifidobacterium and of putative pathogens or a significant difference in gut communities between colonies from queens that were singly or multiply mated. Additionally, consistent with previous studies, the dataset supports the occurrence of considerable strain variation within core species, even within single colonies. The roles of these bacteria within bees, or the implications of the strain variation, are not yet clear.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Phylogeny of the Defined Murine Microbiota: Altered Schaedler Flora

PubMed Central

Dewhirst, Floyd E.; Chien, Chih-Ching; Paster, Bruce J.; Ericson, Rebecca L.; Orcutt, Roger P.; Schauer, David B.; Fox, James G.

1999-01-01

The “altered Schaedler flora” (ASF) was developed for colonizing germfree rodents with a standardized microbiota. The purpose of this study was to identify each of the eight ASF strains by 16S rRNA sequence analysis. Three strains were previously identified as Lactobacillus acidophilus (strain ASF 360), Lactobacillus salivarius (strain ASF 361), and Bacteroides distasonis (strain ASF 519) based on phenotypic criteria. 16S rRNA analysis indicated that each of the strains differed from its presumptive identity. The 16S rRNA sequence of strain ASF 361 is essentially identical to the 16S rRNA sequences of the type strains of Lactobacillus murinis and Lactobacillus animalis (both isolated from mice), and all of these strains probably belong to a single species. Strain ASF 360 is a novel lactobacillus that clusters with L. acidophilus and Lactobacillus lactis. Strain ASF 519 falls into an unnamed genus containing [Bacteroides] distasonis, [Bacteroides] merdae, [Bacteroides] forsythus, and CDC group DF-3. This unnamed genus is in the Cytophaga-Flavobacterium-Bacteroides phylum and is most closely related to the genus Porphyromonas. The spiral-shaped strain, strain ASF 457, is in the Flexistipes phylum and exhibits sequence identity with rodent isolates of Robertson. The remaining four ASF strains, which are extremely oxygen-sensitive fusiform bacteria, group phylogenetically with the low-G+C-content gram-positive bacteria (Firmicutes, Bacillus-Clostridium group). ASF 356, ASF 492, and ASF 502 fall into Clostridium cluster XIV of Collins et al. Morphologically, ASF 492 resembles members of this cluster, Roseburia cecicola, and Eubacterium plexicaudatum. The 16S rRNA sequence of ASF 492 is identical to that of E. plexicaudatum. Since the type strain and other viable original isolates of E. plexicaudatum have been lost, strain ASF 492 is a candidate for a neotype strain. Strain ASF 500 branches deeply in the low-G+C-content gram-positive phylogenetic tree but is not closely related to any organisms whose 16S rRNA sequences are currently in the GenBank database. The 16S rRNA sequence information determined in the present study should allow rapid identification of ASF strains and should permit detailed analysis of the interactions of ASF organisms during development of intestinal disease in mice that are coinfected with a variety of pathogenic microorganisms. PMID:10427008

Dryland biological soil crust cyanobacteria show unexpected decreases in abundance under long-term elevated CO2.

PubMed

Steven, Blaire; Gallegos-Graves, La Verne; Yeager, Chris M; Belnap, Jayne; Evans, R David; Kuske, Cheryl R

2012-12-01

Biological soil crusts (biocrusts) cover soil surfaces in many drylands globally. The impacts of 10 years of elevated atmospheric CO2 on the cyanobacteria in biocrusts of an arid shrubland were examined at a large manipulated experiment in Nevada, USA. Cyanobacteria-specific quantitative PCR surveys of cyanobacteria small-subunit (SSU) rRNA genes suggested a reduction in biocrust cyanobacterial biomass in the elevated CO2 treatment relative to the ambient controls. Additionally, SSU rRNA gene libraries and shotgun metagenomes showed reduced representation of cyanobacteria in the total microbial community. Taxonomic composition of the cyanobacteria was similar under ambient and elevated CO2 conditions, indicating the decline was manifest across multiple cyanobacterial lineages. Recruitment of cyanobacteria sequences from replicate shotgun metagenomes to cyanobacterial genomes representing major biocrust orders also suggested decreased abundance of cyanobacteria sequences across the majority of genomes tested. Functional assignment of cyanobacteria-related shotgun metagenome sequences indicated that four subsystem categories, three related to oxidative stress, were differentially abundant in relation to the elevated CO2 treatment. Taken together, these results suggest that elevated CO2 affected a generalized decrease in cyanobacteria in the biocrusts and may have favoured cyanobacteria with altered gene inventories for coping with oxidative stress. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Characterization of Chemosynthetic Microbial Mats Associated with Intertidal Hydrothermal Sulfur Vents in White Point, San Pedro, CA, USA

PubMed Central

Miranda, Priscilla J.; McLain, Nathan K.; Hatzenpichler, Roland; Orphan, Victoria J.; Dillon, Jesse G.

2016-01-01

The shallow-sea hydrothermal vents at White Point (WP) in Palos Verdes on the southern California coast support microbial mats and provide easily accessed settings in which to study chemolithoautotrophic sulfur cycling. Previous studies have cultured sulfur-oxidizing bacteria from the WP mats; however, almost nothing is known about the in situ diversity and activity of the microorganisms in these habitats. We studied the diversity, micron-scale spatial associations and metabolic activity of the mat community via sequence analysis of 16S rRNA and aprA genes, fluorescence in situ hybridization (FISH) microscopy and sulfate reduction rate (SRR) measurements. Sequence analysis revealed a diverse group of bacteria, dominated by sulfur cycling gamma-, epsilon-, and deltaproteobacterial lineages such as Marithrix, Sulfurovum, and Desulfuromusa. FISH microscopy suggests a close physical association between sulfur-oxidizing and sulfur-reducing genotypes, while radiotracer studies showed low, but detectable, SRR. Comparative 16S rRNA gene sequence analyses indicate the WP sulfur vent microbial mat community is similar, but distinct from other hydrothermal vent communities representing a range of biotopes and lithologic settings. These findings suggest a complete biological sulfur cycle is operating in the WP mat ecosystem mediated by diverse bacterial lineages, with some similarity with deep-sea hydrothermal vent communities. PMID:27512390

Geodermatophilus sabuli sp. nov., a γ-radiation-resistant actinobacterium isolated from desert limestone.

PubMed

Hezbri, Karima; Ghodhbane-Gtari, Faten; Montero-Calasanz, Maria del Carmen; Sghaier, Haïtham; Rohde, Manfred; Schumann, Peter; Klenk, Hans-Peter; Gtari, Maher

2015-10-01

A novel γ-radiation-resistant and Gram-staining-positive actinobacterium designated BMG 8133T was isolated from a limestone collected in the Sahara desert of Tunisia. The strain produced dry, pale-pink colonies with an optimum growth at 35–40 °C and pH 6.5–8.0. Chemotaxonomic and molecular characteristics of the isolate matched those described for members of the genus Geodermatophilus. The peptidoglycan contained meso-diaminopimelic acid as diagnostic diamino acid. The main polar lipids were phosphatidylcholine, diphosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine and one unspecified glycolipid. MK-9(H4) was the dominant menaquinone. Galactose and glucose were detected as diagnostic sugars. The major cellular fatty acids were branched-chain saturated acids iso-C16 : 0 and iso-C15 : 0. The DNA G+C content of the novel strain was 74.5 %. The 16S rRNA gene sequence showed highest sequence identity with Geodermatophilus ruber (98.3 %). Based on phenotypic results and 16S rRNA gene sequence analysis, strain BMG 8133T is proposed to represent a novel species, Geodermatophilus sabuli sp. nov. The type strain is BMG 8133T ( = DSM 46844T = CECT 8820T).

Dryland biological soil crust cyanobacteria show unexpected decreases in abundance under long-term elevated CO2

USGS Publications Warehouse

Steven, Blaire; Gallegos-Graves, La Verne; Yeager, Chris M.; Belnap, Jayne; Evans, R. David; Kuske, Cheryl R.

2012-01-01

Biological soil crusts (biocrusts) cover soil surfaces in many drylands globally. The impacts of 10 years of elevated atmospheric CO2 on the cyanobacteria in biocrusts of an arid shrubland were examined at a large manipulated experiment in Nevada, USA. Cyanobacteria-specific quantitative PCR surveys of cyanobacteria small-subunit (SSU) rRNA genes suggested a reduction in biocrust cyanobacterial biomass in the elevated CO2 treatment relative to the ambient controls. Additionally, SSU rRNA gene libraries and shotgun metagenomes showed reduced representation of cyanobacteria in the total microbial community. Taxonomic composition of the cyanobacteria was similar under ambient and elevated CO2 conditions, indicating the decline was manifest across multiple cyanobacterial lineages. Recruitment of cyanobacteria sequences from replicate shotgun metagenomes to cyanobacterial genomes representing major biocrust orders also suggested decreased abundance of cyanobacteria sequences across the majority of genomes tested. Functional assignment of cyanobacteria-related shotgun metagenome sequences indicated that four subsystem categories, three related to oxidative stress, were differentially abundant in relation to the elevated CO2 treatment. Taken together, these results suggest that elevated CO2 affected a generalized decrease in cyanobacteria in the biocrusts and may have favoured cyanobacteria with altered gene inventories for coping with oxidative stress.

Stenotrophomonas-Like Bacteria Are Widespread Symbionts in Cone Snail Venom Ducts.

PubMed

Torres, Joshua P; Tianero, Maria Diarey; Robes, Jose Miguel D; Kwan, Jason C; Biggs, Jason S; Concepcion, Gisela P; Olivera, Baldomero M; Haygood, Margo G; Schmidt, Eric W

2017-12-01

Cone snails are biomedically important sources of peptide drugs, but it is not known whether snail-associated bacteria affect venom chemistry. To begin to answer this question, we performed 16S rRNA gene amplicon sequencing of eight cone snail species, comparing their microbiomes with each other and with those from a variety of other marine invertebrates. We show that the cone snail microbiome is distinct from those in other marine invertebrates and conserved in specimens from around the world, including the Philippines, Guam, California, and Florida. We found that all venom ducts examined contain diverse 16S rRNA gene sequences bearing closest similarity to Stenotrophomonas bacteria. These sequences represent specific symbionts that live in the lumen of the venom duct, where bioactive venom peptides are synthesized. IMPORTANCE In animals, symbiotic bacteria contribute critically to metabolism. Cone snails are renowned for the production of venoms that are used as medicines and as probes for biological study. In principle, symbiotic bacterial metabolism could either degrade or synthesize active venom components, and previous publications show that bacteria do indeed contribute small molecules to some venoms. Therefore, understanding symbiosis in cone snails will contribute to further drug discovery efforts. Here, we describe an unexpected, specific symbiosis between bacteria and cone snails from around the world. Copyright © 2017 American Society for Microbiology.

Streptomyces kronopolitis sp. nov., an actinomycete that produces phoslactomycins isolated from a millipede (Kronopolites svenhedind Verhoeff).

PubMed

Liu, Chongxi; Ye, Lan; Li, Yao; Jiang, Shanwen; Liu, Hui; Yan, Kai; Xiang, Wensheng; Wang, Xiangjing

2016-12-01

A phoslactomycin-producing actinomycete, designated strain NEAU-ML8T, was isolated from a millipede (Kronopolites svenhedind Verhoeff) and characterized using a polyphasic approach. 16S rRNA gene sequence analysis showed that strain NEAU-ML8T belongs to the genus Streptomyces with the highest sequence similarities to Streptomyces lydicus NBRC 13058T (99.39 %) and Streptomyces chattanoogensis DSM 40002T (99.25 %). The maximum-likelihood phylogenetic tree based on 16S rRNA gene sequences showed that the isolate formed a distinct phyletic line with NBRC 13058T and S. chattanoogensis DSM 40002T. This branching pattern was also supported by the tree rconstructed with the neighbour-joining method. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain NEAU-ML8T and its phylogenetically closely related strains, which further clarified their relatedness and demonstrated that NEAU-ML8T could be distinguished from NBRC 13058T and S. chattanoogensis DSM 40002T. Therefore, it is concluded that strain NEAU-ML8T can be classified as representing a novel species of the genus Streptomyces, for which the name Streptomyces kronopolitis sp. nov. is proposed. The type strain is NEAU-ML8T (=DSM 101986T=CGMCC 4.7323T).

Novel chemolithotrophic, thermophilic, anaerobic bacteria Thermolithobacter ferrireducens gen. nov., sp. nov. and Thermolithobacter carboxydivorans sp. nov.

PubMed

Sokolova, T; Hanel, J; Onyenwoke, R U; Reysenbach, A-L; Banta, A; Geyer, R; González, J M; Whitman, W B; Wiegel, J

2007-01-01

Three thermophilic strains of chemolithoautotrophic Fe(III)-reducers were isolated from mixed sediment and water samples (JW/KA-1 and JW/KA-2(T): Calcite Spring, Yellowstone N.P., WY, USA; JW/JH-Fiji-2: Savusavu, Vanu Levu, Fiji). All were Gram stain positive rods (approximately 0.5 x 1.8 microm). Cells occurred singly or in V-shaped pairs, and they formed long chains in complex media. All utilized H(2) to reduce amorphous iron (III) oxide/hydroxide to magnetite at temperatures from 50 to 75 degrees C (opt. approximately 73 degrees C). Growth occurred within the pH(60C) range of 6.5-8.5 (opt. pH(60C) 7.1-7.3). Magnetite production by resting cells occurred at pH(60C) 5.5-10.3 (opt. 7.3). The iron (III) reduction rate was 1.3 mumol Fe(II) produced x h(-1) x ml(-1) in a culture with 3 x 10(7) cells, one of the highest rates reported. In the presence or absence of H(2), JW/KA-2(T) did not utilize CO. The G + C content of the genomic DNA of the type strain is 52.7 +/- 0.3 mol%. Strains JW/KA-1 and JW/KA-2(T) each contain two different 16S rRNA gene sequences. The 16S rRNA gene sequences from JW/KA-1, JW/KA-2(T), or JW/JH-Fiji-2 possessed >99% similarity to each other but also 99% similarity to the 16S rRNA gene sequence from the anaerobic, thermophilic, hydrogenogenic CO-oxidizing bacterium 'Carboxydothermus restrictus' R1. DNA-DNA hybridization between strain JW/KA-2(T) and strain R1(T) yielded 35% similarity. Physiological characteristics and the 16S rRNA gene sequence analysis indicated that the strains represent two novel species and are placed into the novel genus Thermolithobacter within the phylum 'Firmicutes'. In addition, the levels of 16S rRNA gene sequence similarity between the lineage containing the Thermolithobacter and well-established members of the three existing classes of the 'Firmicutes' is less than 85%. Therefore, Thermolithobacter is proposed to constitute the first genus within a novel class of the 'Firmicutes', Thermolithobacteria. The Fe(III)-reducing Thermolithobacter ferrireducens gen. nov., sp. nov. is designated as the type species with strain JW/KA-2(T) (ATCC 700985(T), DSM 13639(T)) as its type strain. Strain R1(T) is the type strain for the hydrogenogenic, CO-oxidizing Thermolithobacter carboxydivorans sp. nov. (DSM 7242(T), VKM 2359(T)).

Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

PubMed

Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

2017-11-02

Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had altered diversity profiles. Both bioinformatics 16S rRNA pipelines used in this study (OTU and paired end) presented similar taxonomic profiles at genus level. We determined that DNA extraction from ELBW faecal samples, particularly those infants receiving probiotic supplementation, should include a prolonged beat-beating step. Furthermore, use of the 16S rRNA (V1 + V2 + V3) and (V6 + V7 + V8) regions provides reliable representation of ELBW microbiota profiles, while inclusion of the (V4 + V5) region may not be appropriate for studies where Bifidobacterium constitutes a resident microbiota member.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

PubMed

Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

1999-12-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

NASA Technical Reports Server (NTRS)

Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

1999-01-01

The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.

PubMed

Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun

2014-02-01

Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).

A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

PubMed

Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

2000-12-01

Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

Electrochemical detection of synthetic DNA and native 16S rRNA fragments on a microarray using a biotinylated intercalator as coupling site for an enzyme label.

PubMed

Zimdars, Andreas; Gebala, Magdalena; Hartwich, Gerhard; Neugebauer, Sebastian; Schuhmann, Wolfgang

2015-10-01

The direct electrochemical detection of synthetic DNA and native 16S rRNA fragments isolated from Escherichia coli is described. Oligonucleotides are detected via selective post-labeling of double stranded DNA and DNA-RNA duplexes with a biotinylated intercalator that enables high-specific binding of a streptavidin/alkaline phosphatase conjugate. The alkaline phosphatase catalyzes formation of p-aminophenol that is subsequently oxidized at the underlying gold electrode and hence enables the detection of complementary hybridization of the DNA capture strands due to the enzymatic signal amplification. The hybridization assay was performed on microarrays consisting of 32 individually addressable gold microelectrodes. Synthetic DNA strands with sequences representing six different pathogens which are important for the diagnosis of urinary tract infections could be detected at concentrations of 60 nM. Native 16S rRNA isolated from the different pathogens could be detected at a concentration of 30 fM. Optimization of the sensing surface is described and influences on the assay performance are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

Psychromicrobium silvestre gen. nov., sp. nov., an actinobacterium isolated from alpine forest soils.

PubMed

Schumann, Peter; Zhang, De-Chao; França, Luís; Albuquerque, Luciana; da Costa, Milton S; Margesin, Rosa

2017-03-01

Two Gram-stain-variable, non-motile, catalase-positive and cytochrome c oxidase-negative bacteria, designated AK20-18 T and AM20-54, were isolated from forest soil samples collected in the Italian Alps. Growth occurred at a temperature range of 5-30 °C, at pH 6-9 and in the presence of 0-5 % (w/v) NaCl. The 16S rRNA gene sequence similarity between strains AK20-18 T and AM20-54 was 100 %. Phylogenetic analysis based on 16S rRNA gene sequence showed that strain AK20-18 T had highest 16S rRNA gene sequence similarity with the type strain of Arthrobacter psychrochitiniphilus (96.9 %). The cell-wall peptidoglycan structure of strain AK20-18 T was of the type A3alpha l-Lys-l-Thr-l-Ala2 (A11.27). The whole-cell sugars were galactose, ribose and lesser amounts of mannose. The major respiratory quinone of the two strains was menaquinone 9(H2) [MK-9(H2)], whereas MK-10(H2) was a minor component. The polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and unknown glycolipids. The major cellular fatty acids were anteiso-C15 : 0, iso-C15 : 0, iso-C16 : 0 and anteiso-C17 : 0. The genomic DNA G+C content was 59.9 mol%. Combined data of phylogenetic, phenotypic and chemotaxonomic analyses demonstrated that strains AK20-18 T and AM20-54 represent a novel genus and species, for which the name Psychromicrobium silvestre gen. nov., sp. nov. is proposed. The type strain of Psychromicrobium silvestregen. nov., sp. nov. is AK20-18 T (=DSM 102047 T =LMG 29369 T ).

Tenacibaculum xiamenense sp. nov., an algicidal bacterium isolated from coastal seawater.

PubMed

Li, Yi; Wei, Jun; Yang, Caiyun; Lai, Qiliang; Chen, Zhangran; Li, Dong; Zhang, Huajun; Tian, Yun; Zheng, Wei; Zheng, Tianling

2013-09-01

A Gram-stain-negative, elongated rod-shaped, yellow-pigmented, aerobic bacterial strain, designated WJ-1(T), was isolated from coastal seawater in Xiamen, Fujian province, China. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain WJ-1(T) fell within the genus Tenacibaculum and was most closely associated with Tenacibaculum aestuarii SMK-4(T) (96.7% 16S rRNA gene sequence similarity); lower similarities were shown to other members of the genus Tenacibaculum (<96.2%). The strain formed a distinct lineage with Tenacibaculum litopenaei B-I(T) (96.0%), Tenacibaculum geojense YCS-6(T) (94.5%) and Tenacibaculum jejuense CNURIC 013(T) (95.4%). Growth was observed at temperatures from 16 to 38 °C, at salinities from 2 to 4% and at pH 6-9. The major fatty acids were summed feature 3 (C(16:1)ω6c and/or C(16 1)ω7c), iso-C(17:0) 3-OH, iso-C(15:0) and iso-C(15:0) 3-OH. The DNA G+C content of strain WJ-1(T) was 33.2 mol% and the major respiratory quinone was menaquinone-6 (MK-6). Differential phenotypic properties and phylogenetic distinctiveness in this study distinguished strain WJ-1(T) from all other members of the genus Tenacibaculum. According to the morphology, physiology, fatty acid composition and 16S rRNA gene sequence data, strain WJ-1(T) represents a novel species of the genus Tenacibaculum, for which the name Tenacibaculum xiamenense sp. nov. is proposed. The type strain is WJ-1(T) ( =CGMCC 1.12378(T) =LMG 27422(T)).

Mucilaginibacter antarcticus sp. nov., isolated from tundra soil.

PubMed

Zheng, Ruichen; Zhao, Yiming; Wang, Liqiu; Chang, Xulu; Zhang, Yumin; Da, Xuyang; Peng, Fang

2016-12-01

The novel, pale yellow bacterial strain, designated S14-88T, was isolated from a tundra soil near Antarctic Peninsula, South Shetland Islands, and its taxonomic position was investigated by a genotypic and phenotypic analysis. Cells were facultatively anaerobic, Gram-stain-negative, non-motile and rod-shaped. Growth occurred at 4-28 °C (optimum at 15 °C), at pH 7.0-8.0 (optimum at 7.0) and with 0-0.6 % (w/v) NaCl (optimum, no NaCl). Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain S14-88T formed a lineage within the genus Mucilaginibacter. The 16S rRNA gene sequence similarity between strain S14-88T and the type strains of related species ranged from 92.2 to 96.5 %, and the 16S rRNA gene sequence of S14-88T showed highest similarity of 96.5 % to Mucilaginibacter soyangensis HME6664T. The major cellular fatty acids of strain S14-88T were iso-C15 : 0 and summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c). The major respiratory quinone was menaquinone MK-7, and the main polar lipid was phosphatidylethanolamine. The DNA G+C content of strain S14-88T was 42.3 mol%. On the basis of the evidence presented in this study, strain S14-88T is considered to represent a novel species of the genus Mucilaginibacter, for which the name Mucilaginibacter antarcticus sp. nov. is proposed. The type strain is S14-88T (=CCTCC AB 2015321T=KCTC 52232T).

Lacinutrix cladophorae sp. nov., a flavobacterium isolated from the green alga Cladophora stimpsonii, transfer of Flavirhabdus iliipiscaria Shakeela et al. 2015 to the genus Lacinutrix as Lacinutrix iliipiscaria comb. nov. and emended description of the genus Lacinutrix.

PubMed

Nedashkovskaya, Olga I; Kim, Song-Gun; Zhukova, Natalia V; Lee, Jung-Sook; Mikhailov, Valery V

2016-11-01

A strictly aerobic, Gram-stain-negative, rod-shaped, motile by gliding and yellow-pigmented bacterium, designated strain 7Alg 4T, was isolated from the green alga Cladophora stimpsonii. Phylogenetic analysis based on 16S rRNA gene sequences revealed that the novel strain was affiliated to the family Flavobacteriaceae of the phylum Bacteroidetes, and was most closely related to the recognized species of the genera Lacinutrixand Flavirhabdus, with 16S rRNA gene sequence similarities of 95.1-98.1 and 97.0 %, respectively. Strain 7Alg 4T grew in the presence of 1-5 % NaCl and at 4-32 °C, and hydrolysed aesculin, gelatin, starch and Tween 80. The prevalent fatty acids were iso-C15 : 1 G, iso-C15 : 0, iso-C17 : 0 3-OH, iso-C15 : 0 3-OH and C15 : 0. The polar lipid profile was characterized by the presence of phosphatidylethanolamine, three unidentified aminolipids and four unidentified lipids. The major respiratory quinone was MK-6. The DNA G+C content was 31.9 mol%. On the basis of the differences in 16S rRNA gene sequences, chemotaxonomic and phenotypic characteristics, it is suggested that strain 7Alg 4T represents a novel species of the genus Lacinutrix, for which the name Lacinutrixcladophorae sp. nov. is proposed. The type strain is 7Alg 4T (=KCTC 23036T=KMM 6381T). Reclassification of Flavirhabdus iliipiscaria as Lacinutrix iliipiscaria comb. nov. and an emend of the genus Lacinutrix are also proposed.

Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

PubMed

Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

2015-07-01

Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

Phylogeny of Bacteroides, Prevotella, and Porphyromonas spp. and related bacteria.

PubMed Central

Paster, B J; Dewhirst, F E; Olsen, I; Fraser, G J

1994-01-01

The phylogenetic structure of the bacteroides subgroup of the cytophaga-flavobacter-bacteroides (CFB) phylum was examined by 16S rRNA sequence comparative analysis. Approximately 95% of the 16S rRNA sequence was determined for 36 representative strains of species of Prevotella, Bacteroides, and Porphyromonas and related species by a modified Sanger sequencing method. A phylogenetic tree was constructed from a corrected distance matrix by the neighbor-joining method, and the reliability of tree branching was established by bootstrap analysis. The bacteroides subgroup was divided primarily into three major phylogenetic clusters which contained most of the species examined. The first cluster, termed the prevotella cluster, was composed of 16 species of Prevotella, including P. melaninogenica, P. intermedia, P. nigrescens, and the ruminal species P. ruminicola. Two oral species, P. zoogleoformans and P. heparinolytica, which had been recently placed in the genus Prevotella, did not fall within the prevotella cluster. These two species and six species of Bacteroides, including the type species B. fragilis, formed the second cluster, termed the bacteroides cluster. The third cluster, termed the porphyromonas cluster, was divided into two subclusters. The first contained Porphyromonas gingivalis, P. endodontalis, P. asaccharolytica, P. circumdentaria, P. salivosa, [Bacteroides] levii (the brackets around genus are used to indicate that the species does not belong to the genus by the sensu stricto definition), and [Bacteroides] macacae, and the second subcluster contained [Bacteroides] forsythus and [Bacteroides] distasonis. [Bacteroides] splanchnicus fell just outside the three major clusters but still belonged within the bacteroides subgroup. With few exceptions, the 16 S rRNA data were in overall agreement with previously proposed reclassifications of species of Bacteroides, Prevotella, and Porphyromonas. Suggestions are made to accommodate those species which do not fit previous reclassification schemes. PMID:8300528

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA and is freely available at http://clustomcloud.kopri.re.kr. PMID:26954507

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

High-resolution phylogenetic microbial community profiling

DOE PAGES

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

2016-02-09

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Pneumocystis jirovecii multilocus genotyping profiles in patients from Portugal and Spain.

PubMed

Esteves, F; Montes-Cano, M A; de la Horra, C; Costa, M C; Calderón, E J; Antunes, F; Matos, O

2008-04-01

Pneumonia caused by the opportunistic organism Pneumocystis jirovecii is a clinically important infection affecting AIDS and other immunocompromised patients. The present study aimed to compare and characterise the frequency pattern of DNA sequences from the P. jirovecii mitochondrial large-subunit rRNA (mtLSU rRNA) gene, the dihydropteroate synthase (DHPS) gene and the internal transcribed spacer (ITS) regions of the nuclear rRNA operon in specimens from Lisbon (Portugal) and Seville (Spain). Total DNA was extracted and used for specific molecular sequence analysis of the three loci. In both populations, mtLSU rRNA gene analysis revealed an overall prevalence of genotype 1. In the Portuguese population, genotype 2 was the second most common, followed by genotype 3. Inversely, in the Spanish population, genotype 3 was the second most common, followed by genotype 2. The DHPS wild-type sequence was the genotype observed most frequently in both populations, and the DHPS genotype frequency pattern was identical to distribution patterns revealed in other European studies. ITS types showed a significant diversity in both populations because of the high sequence variability in these genomic regions. The most prevalent ITS type in the Portuguese population was Eg, followed by Cg. In contrast to other European studies, Bi was the most common ITS type in the Spanish samples, followed by Eg. A statistically significant association between mtLSU rRNA genotype 1 and ITS type Eg was revealed.

Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

PubMed Central

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

Molecular phylogenetics and systematics of the bivalve family Ostreidae based on rRNA sequence-structure models and multilocus species tree.

PubMed

Salvi, Daniele; Macali, Armando; Mariottini, Paolo

2014-01-01

The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics.

PubMed

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica . All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/.

Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

PubMed

Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

2016-11-01

Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

PubMed

Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

2015-11-01

A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

In silico Comparison of 19 Porphyromonas gingivalis Strains in Genomics, Phylogenetics, Phylogenomics and Functional Genomics

PubMed Central

Chen, Tsute; Siddiqui, Huma; Olsen, Ingar

2017-01-01

Currently, genome sequences of a total of 19 Porphyromonas gingivalis strains are available, including eight completed genomes (strains W83, ATCC 33277, TDC60, HG66, A7436, AJW4, 381, and A7A1-28) and 11 high-coverage draft sequences (JCVI SC001, F0185, F0566, F0568, F0569, F0570, SJD2, W4087, W50, Ando, and MP4-504) that are assembled into fewer than 300 contigs. The objective was to compare these genomes at both nucleotide and protein sequence levels in order to understand their phylogenetic and functional relatedness. Four copies of 16S rRNA gene sequences were identified in each of the eight complete genomes and one in the other 11 unfinished genomes. These 43 16S rRNA sequences represent only 24 unique sequences and the derived phylogenetic tree suggests a possible evolutionary history for these strains. Phylogenomic comparison based on shared proteins and whole genome nucleotide sequences consistently showed two groups with closely related members: one consisted of ATCC 33277, 381, and HG66, another of W83, W50, and A7436. At least 1,037 core/shared proteins were identified in the 19 P. gingivalis genomes based on the most stringent detecting parameters. Comparative functional genomics based on genome-wide comparisons between NCBI and RAST annotations, as well as additional approaches, revealed functions that are unique or missing in individual P. gingivalis strains, or species-specific in all P. gingivalis strains, when compared to a neighboring species P. asaccharolytica. All the comparative results of this study are available online for download at ftp://www.homd.org/publication_data/20160425/. PMID:28261563

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic▿

PubMed Central

Perreault, Nancy N.; Andersen, Dale T.; Pollard, Wayne H.; Greer, Charles W.; Whyte, Lyle G.

2007-01-01

The springs at Gypsum Hill and Colour Peak on Axel Heiberg Island in the Canadian Arctic originate from deep salt aquifers and are among the few known examples of cold springs in thick permafrost on Earth. The springs discharge cold anoxic brines (7.5 to 15.8% salts), with a mean oxidoreduction potential of −325 mV, and contain high concentrations of sulfate and sulfide. We surveyed the microbial diversity in the sediments of seven springs by denaturing gradient gel electrophoresis (DGGE) and analyzing clone libraries of 16S rRNA genes amplified with Bacteria and Archaea-specific primers. Dendrogram analysis of the DGGE banding patterns divided the springs into two clusters based on their geographic origin. Bacterial 16S rRNA clone sequences from the Gypsum Hill library (spring GH-4) were classified into seven phyla (Actinobacteria, Bacteroidetes, Firmicutes, Gemmatimonadetes, Proteobacteria, Spirochaetes, and Verrucomicrobia); Deltaproteobacteria and Gammaproteobacteria sequences represented half of the clone library. Sequences related to Proteobacteria (82%), Firmicutes (9%), and Bacteroidetes (6%) constituted 97% of the bacterial clone library from Colour Peak (spring CP-1). Most GH-4 archaeal clone sequences (79%) were related to the Crenarchaeota while half of the CP-1 sequences were related to orders Halobacteriales and Methanosarcinales of the Euryarchaeota. Sequences related to the sulfur-oxidizing bacterium Thiomicrospira psychrophila dominated both the GH-4 (19%) and CP-1 (45%) bacterial libraries, and 56 to 76% of the bacterial sequences were from potential sulfur-metabolizing bacteria. These results suggest that the utilization and cycling of sulfur compounds may play a major role in the energy production and maintenance of microbial communities in these unique, cold environments. PMID:17220254

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

NASA Astrophysics Data System (ADS)

Antonielli, Livio; Sessitsch, Angela

2016-04-01

Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field.

PubMed

Crépeau, Valentin; Cambon Bonavita, Marie-Anne; Lesongeur, Françoise; Randrianalivelo, Henintsoa; Sarradin, Pierre-Marie; Sarrazin, Jozée; Godfroy, Anne

2011-06-01

Diversity and function in microbial mats from the Lucky Strike hydrothermal vent field (Mid-Atlantic Ridge) were investigated using molecular approaches. DNA and RNA were extracted from mat samples overlaying hydrothermal deposits and Bathymodiolus azoricus mussel assemblages. We constructed and analyzed libraries of 16S rRNA gene sequences and sequences of functional genes involved in autotrophic carbon fixation [forms I and II RuBisCO (cbbL/M), ATP-citrate lyase B (aclB)]; methane oxidation [particulate methane monooxygenase (pmoA)] and sulfur oxidation [adenosine-5'-phosphosulfate reductase (aprA) and soxB]. To gain new insights into the relationships between mats and mussels, we also used new domain-specific 16S rRNA gene primers targeting Bathymodiolus sp. symbionts. All identified archaeal sequences were affiliated with a single group: the marine group 1 Thaumarchaeota. In contrast, analyses of bacterial sequences revealed much higher diversity, although two phyla Proteobacteria and Bacteroidetes were largely dominant. The 16S rRNA gene sequence library revealed that species affiliated to Beggiatoa Gammaproteobacteria were the dominant active population. Analyses of DNA and RNA functional gene libraries revealed a diverse and active chemolithoautotrophic population. Most of these sequences were affiliated with Gammaproteobacteria, including hydrothermal fauna symbionts, Thiotrichales and Methylococcales. PCR and reverse transcription-PCR using 16S rRNA gene primers targeted to Bathymodiolus sp. symbionts revealed sequences affiliated with both methanotrophic and thiotrophic endosymbionts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Clostridium sphenoides Chronic Osteomyelitis Diagnosed Via Matrix-Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry, Conflicting With 16S rRNA Sequencing but Confirmed by Whole Genome Sequencing.

PubMed

Perkins, Matthew J; Snesrud, Erik; McGann, Patrick; Duplessis, Christopher A

2017-01-01

We report a case of successful treatment of chronic osteomyelitis (emanating from contaminated soil exposure) caused by Clostridium sphenoides, an organism infrequently identified as a cause of human infection and more saliently osteomyelitis (only 1 reported case in the literature). Additional impetus for reporting this case resides in the insights gained regarding pathogen identification exploiting sophisticated molecular platforms coupled to traditional microbial culture-based methods. The fastidious nature of cultivating anaerobic organisms required initial attempts at 16S rRNA sequencing to identify a Clostridium species (Clostridium celerecrescens). However, on exploiting matrix-assisted laser desorption ionization time of flight (MALDI TOF) technology, C. sphenoides was identified, and confirmed on whole genome sequencing. The discrepancies noted in the varying platforms require vigilance to seek complementary testing for conflicting results. Although highly accurate, the MALDI TOF and 16S rRNA sequencing platforms are not immune to false identification particularly in differentiating closely related organisms. More germane, whole genome sequencing should be entertained when conflicting results are obtained from MALDI TOF and 16S rRNA sequencing. Precise species and/or strain level identification can be clinically relevant as antimicrobial sensitivity profiles may be discrepant between closely related species influencing clinical outcomes. Thus, it is incumbent on us to strive to acquire the correct species characterization when resources allow to dictate optimal treatment. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.

Three distinct clades of cultured heterocystous cyanobacteria constitute the dominant N2-fixing members of biological soil crusts of the Colorado Plateau, USA

USGS Publications Warehouse

Yeager, C.M.; Kornosky, J.L.; Morgan, R.E.; Cain, E.C.; Garcia-Pichel, F.; Housman, D.C.; Belnap, J.; Kuske, C.R.

2007-01-01

The identity of the numerically dominant N2-fixing bacteria in biological soil crusts of the Colorado Plateau region and two outlying areas was determined using multiple approaches, to link the environmental diversity of nifH gene sequences to cultured bacterial isolates from the regions. Of the nifH sequence-types detected in soil crusts of the Colorado Plateau, 89% (421/473) were most closely related to nifH signature sequences from cyanobacteria of the order Nostocales. N2-fixing cyanobacterial strains were cultured from crusts and their morphotypes, 16S rRNA gene and nifH gene sequences were characterized. The numerically dominant diazotrophs in the Colorado Plateau crusts fell within three clades of heterocystous cyanobacteria. Two clades are well-represented by phylogenetically and morphologically coherent strains, corresponding to the descriptions of Nostoc commune and Scytonema hyalinum, which are widely recognized as important N2-fixing components of soil crusts. A third, previously-overlooked clade was represented by a phylogenetically coherent but morphologically diverse group of strains that encompass the morphogenera Tolypothrix and Spirirestis. Many of the strains in each of these groups contained at least two nifH copies that represent different clusters in the nifH environmental survey. ?? 2007 Federation of European Microbiological Societies.

High-throughput amplicon sequencing and stream benthic bacteria: identifying the best taxonomic level for multiple-stressor research

PubMed Central

Salis, R. K.; Bruder, A.; Piggott, J. J.; Summerfield, T. C.; Matthaei, C. D.

2017-01-01

Disentangling the individual and interactive effects of multiple stressors on microbial communities is a key challenge to our understanding and management of ecosystems. Advances in molecular techniques allow studying microbial communities in situ and with high taxonomic resolution. However, the taxonomic level which provides the best trade-off between our ability to detect multiple-stressor effects versus the goal of studying entire communities remains unknown. We used outdoor mesocosms simulating small streams to investigate the effects of four agricultural stressors (nutrient enrichment, the nitrification inhibitor dicyandiamide (DCD), fine sediment and flow velocity reduction) on stream bacteria (phyla, orders, genera, and species represented by Operational Taxonomic Units with 97% sequence similarity). Community composition was assessed using amplicon sequencing (16S rRNA gene, V3-V4 region). DCD was the most pervasive stressor, affecting evenness and most abundant taxa, followed by sediment and flow velocity. Stressor pervasiveness was similar across taxonomic levels and lower levels did not perform better in detecting stressor effects. Community coverage decreased from 96% of all sequences for abundant phyla to 28% for species. Order-level responses were generally representative of responses of corresponding genera and species, suggesting that this level may represent the best compromise between stressor sensitivity and coverage of bacterial communities. PMID:28327636

Actinomycetospora rhizophila sp. nov., an actinomycete isolated from rhizosphere soil of a peace lily (Spathi phyllum Kochii).

PubMed

He, Hairong; Zhang, Yuejing; Ma, Zhaoxu; Li, Chuang; Liu, Chongxi; Zhou, Ying; Li, Lianjie; Wang, Xiangjing; Xiang, Wensheng

2015-05-01

A novel actinomycete, designated strain NEAU-B-8(T), was isolated from the rhizosphere soil of a peace lily (Spathi phyllum Kochii) collected from Heilongjiang province, north-east China. Key morphological and physiological characteristics as well as chemotaxonomic features of strain NEAU-B-8(T) were congruent with the description of the genus Actinomycetospora , such as the major fatty acids, the whole-cell hydrolysates, the predominant menaquinone and the phospholipid profile. The 16S rRNA gene sequence analysis revealed that strain NEAU-B-8(T) shared the highest sequence similarities with Actinomycetospora lutea JCM 17982(T) (99.3% 16S rRNA gene sequence similarity), Actinomycetospora chlora TT07I-57(T) (98.4 %), Actinomycetospora straminea IY07-55(T) (98.3%) and Actinomycetospora chibensis TT04-21(T) (98.2%); similarities to type strains of other species of this genus were lower than 98%. The phylogenetic tree based on 16S rRNA gene sequences showed that strain NEAU-B-8(T) formed a distinct branch with A. lutea JCM 17982(T) that was supported by a high bootstrap value of 97% in the neighbour-joining tree and was also recovered with the maximum-likelihood algorithm. However, the DNA-DNA relatedness between strain NEAU-B-8(T) and A. lutea JCM 17982(T) was found to be 50.6 ± 1.2%. Meanwhile, strain NEAU-B-8(T) differs from other most closely related strains in phenotypic properties, such as maximum NaCl tolerance, hydrolysis of aesculin and decomposition of urea. On the basis of the morphological, physiological, chemotaxonomic, phylogenetic and DNA-DNA hybridization data, we conclude that strain NEAU-B-8(T) represents a novel species of the genus Actinomycetospora , named Actinomycetospora rhizophila sp. nov. The type strain is NEAU-B-8(T). ( = CGMCC 4.7134(T) =DSM 46673(T)). © 2015 IUMS.

Pyrosequencing of Bacterial Symbionts within Axinella corrugata Sponges: Diversity and Seasonal Variability

PubMed Central

White, James R.; Patel, Jignasa; Ottesen, Andrea; Arce, Gabriela; Blackwelder, Patricia; Lopez, Jose V.

2012-01-01

Background Marine sponge species are of significant interest to many scientific fields including marine ecology, conservation biology, genetics, host-microbe symbiosis and pharmacology. One of the most intriguing aspects of the sponge “holobiont” system is the unique physiology, interaction with microbes from the marine environment and the development of a complex commensal microbial community. However, intraspecific variability and temporal stability of sponge-associated bacterial symbionts remain relatively unknown. Methodology/Principal Findings We have characterized the bacterial symbiont community biodiversity of seven different individuals of the Caribbean reef sponge Axinella corrugata, from two different Florida reef locations during variable seasons using multiplex 454 pyrosequencing of 16 S rRNA amplicons. Over 265,512 high-quality 16 S rRNA sequences were generated and analyzed. Utilizing versatile bioinformatics methods and analytical software such as the QIIME and CloVR packages, we have identified 9,444 distinct bacterial operational taxonomic units (OTUs). Approximately 65,550 rRNA sequences (24%) could not be matched to bacteria at the class level, and may therefore represent novel taxa. Differentially abundant classes between seasonal Axinella communities included Gammaproteobacteria, Flavobacteria, Alphaproteobacteria, Cyanobacteria, Acidobacter and Nitrospira. Comparisons with a proximal outgroup sponge species (Amphimedon compressa), and the growing sponge symbiont literature, indicate that this study has identified approximately 330 A. corrugata-specific symbiotic OTUs, many of which are related to the sulfur-oxidizing Ectothiorhodospiraceae. This family appeared exclusively within A. corrugata, comprising >34.5% of all sequenced amplicons. Other A. corrugata symbionts such as Deltaproteobacteria, Bdellovibrio, and Thiocystis among many others are described. Conclusions/Significance Slight shifts in several bacterial taxa were observed between communities sampled during spring and fall seasons. New 16 S rDNA sequences and concomitant identifications greatly expand the microbial community profile for this model reef sponge, and will likely be useful as a baseline for any future comparisons regarding sponge microbial community dynamics. PMID:22701613

Hydrocarbon-Degrading Bacteria and the Bacterial Community Response in Gulf of Mexico Beach Sands Impacted by the Deepwater Horizon Oil Spill▿†‡

PubMed Central

Kostka, Joel E.; Prakash, Om; Overholt, Will A.; Green, Stefan J.; Freyer, Gina; Canion, Andy; Delgardio, Jonathan; Norton, Nikita; Hazen, Terry C.; Huettel, Markus

2011-01-01

A significant portion of oil from the recent Deepwater Horizon (DH) oil spill in the Gulf of Mexico was transported to the shoreline, where it may have severe ecological and economic consequences. The objectives of this study were (i) to identify and characterize predominant oil-degrading taxa that may be used as model hydrocarbon degraders or as microbial indicators of contamination and (ii) to characterize the in situ response of indigenous bacterial communities to oil contamination in beach ecosystems. This study was conducted at municipal Pensacola Beach, FL, where chemical analysis revealed weathered oil petroleum hydrocarbon (C8 to C40) concentrations ranging from 3.1 to 4,500 mg kg−1 in beach sands. A total of 24 bacterial strains from 14 genera were isolated from oiled beach sands and confirmed as oil-degrading microorganisms. Isolated bacterial strains were primarily Gammaproteobacteria, including representatives of genera with known oil degraders (Alcanivorax, Marinobacter, Pseudomonas, and Acinetobacter). Sequence libraries generated from oiled sands revealed phylotypes that showed high sequence identity (up to 99%) to rRNA gene sequences from the oil-degrading bacterial isolates. The abundance of bacterial SSU rRNA gene sequences was ∼10-fold higher in oiled (0.44 × 107 to 10.2 × 107 copies g−1) versus clean (0.024 × 107 to 1.4 × 107 copies g−1) sand. Community analysis revealed a distinct response to oil contamination, and SSU rRNA gene abundance derived from the genus Alcanivorax showed the largest increase in relative abundance in contaminated samples. We conclude that oil contamination from the DH spill had a profound impact on the abundance and community composition of indigenous bacteria in Gulf beach sands, and our evidence points to members of the Gammaproteobacteria (Alcanivorax, Marinobacter) and Alphaproteobacteria (Rhodobacteraceae) as key players in oil degradation there. PMID:21948834

Hydrocarbonoclastic bacteria isolated from petroleum contaminated sites in Tunisia: isolation, identification and characterization of the biotechnological potential.

PubMed

Mahjoubi, Mouna; Jaouani, Atef; Guesmi, Amel; Ben Amor, Sonia; Jouini, Ahlem; Cherif, Hanen; Najjari, Afef; Boudabous, Abdellatif; Koubaa, Nedra; Cherif, Ameur

2013-09-25

Petroleum hydrocarbons are important energy resources used by industry and in our daily life, whose production contributes highly to environmental pollution. To control such risk, bioremediation constitutes an environmentally friendly alternative technology that has been established and applied. It constitutes the primary mechanism for the elimination of hydrocarbons from contaminated sites by natural existing populations of microorganisms. In this work, a collection of 125 strains, adapted to grow on minimal medium supplemented with crude oil, was obtained from contaminated sediments and seawater from a refinery harbor of the Bizerte coast in the North of Tunisia. The diversity of the bacterial collection was analyzed by amplification of the internal transcribed spacers between the 16S and the 23S rRNA genes (ITS-PCR) and by 16S rRNA sequencing. A total of 36 distinct ITS haplotypes were detected on agarose matrix. Partial 16S rRNA gene sequencing performed on 50 isolates showed high level of identity with known sequences. Strains were affiliated to Ochrabactrum, Sphingobium, Acinetobacter, Gordonia, Microbacterium, Brevundimonas, Novosphingobium, Stenotrophomonas, Luteibacter, Rhodococcus, Agrobacterium, Achromobacter, Bacilllus, Kocuria and Pseudomonas genera. Acinetobacter and Stenotrophomons were found to be the most abundant species characterized by a marked microdiversity as shown through ITS typing. Culture-independent approach (DGGE) showed high diversity in the microbial community in all the studied samples with a clear correlation with the hydrocarbon pollution rate. Sequencing of the DGGE bands revealed a high proportion of Proteobacteria represented by the Alpha and Gamma subclasses. The predominant bacterial detected by both dependent and independent approaches were the Proteobacteria. The biotechnological potential of the isolates revealed a significant production of biosurfactants with important emulsification activities useful in bioremediation. The highest emulsification activity was detected in Pseudomonas geniculata with 52.77% of emulsification. Our overall results suggest that the obtained bacterial isolates may constitute potential candidates for bioremediation and can be useful for biotechnological applications. Copyright © 2013 Elsevier B.V. All rights reserved.

Candidate OP Phyla: Importance, Ecology and Cultivation Prospects.

PubMed

Rohini Kumar, M; Saravanan, V S

2010-10-01

OP phyla were created in the domain bacteria, based on the group of 16S rRNA gene sequences recovered from the Obsidian Pool. However, due to the lack of cultured representative it is referred to as candidate phyla. Wider ecological occurrence was predicted for the OP phyla, especially OP3, OP10 and OP11. Recently, members of phylum OP5 and OP10 were cultured, providing clues to their cultivation prospects. At last the bioprospecting potentials of the OP members are discussed herein.

Bacterial community comparisons by taxonomy-supervised analysis independent of sequence alignment and clustering

PubMed Central

Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.

2011-01-01

High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204

Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.

PubMed

Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R

2013-01-01

The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.

Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

PubMed Central

Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

2009-01-01

The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

ScienceCinema

Tremblay, Julien

2018-01-22

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien

2012-06-01

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

NASA Technical Reports Server (NTRS)

Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

1992-01-01

Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

Multigenetic characterization of 'Candidatus Xenohaliotis californiensis'.

PubMed

Cicala, Francesco; Moore, James D; Cáceres-Martínez, Jorge; Del Río-Portilla, Miguel A; Hernández-Rodríguez, Mónica; Vásquez-Yeomans, Rebeca; Rocha-Olivares, Axayácatl

2017-01-01

'Candidatus Xenohaliotis californiensis' (or Ca.Xc) is the aetiological agent of withering syndrome, a chronic wasting disease affecting most if not all North American species of abalone, and has been described as a Rickettsiales-like prokaryote. Genetic data regarding this species are limited to the 16S rRNA gene. The inability to grow it axenically has hindered its genetic and genomic characterization and, in consequence, a thorough analysis of its systematics. Here, we amplified and sequenced five genes (16S rRNA, 23S rRNA, ftsZ, virD4 and virB11) of Ca.Xc from infected abalone to analyse its phylogenetic position. Phylogenies from concatenated DNA and amino acid sequences with representative genera of most Rickettsiales unequivocally place Ca.Xc in the family Anaplasmataceae. Furthermore, the family has two reciprocally monophyletic lineages: one leading to (Neorickettsia, Ca.Xc) and the other to ((Ehrlichia, Anaplasma), Wolbachia)). A molecular-clock Bayesian reconstruction places Ca.Xc as the most basal lineage in Anaplasmataceae. These phylogenetic hypotheses shed light on patterns of host evolution and of ecological transitions. Specifically, Neorickettsia and Ca.Xc inhabit aquatic hosts whereas the remaining Anaplasmataceae are found in terrestrial hosts. Additionally, our evolutionary timeline places the directly transmitted marine Ca.Xc as the basal Anaplasmataceae, ancestral to both freshwater and terrestrial species with adaptations leading to more complex life cycles involving intermediate vectors or reservoir species; this supports the hypothesis of a marine origin for this bacterial family.

The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

PubMed

Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

2016-01-01

In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

A Molecular Phylogeny of Hemiptera Inferred from Mitochondrial Genome Sequences

PubMed Central

Song, Nan; Liang, Ai-Ping; Bu, Cui-Ping

2012-01-01

Classically, Hemiptera is comprised of two suborders: Homoptera and Heteroptera. Homoptera includes Cicadomorpha, Fulgoromorpha and Sternorrhyncha. However, according to previous molecular phylogenetic studies based on 18S rDNA, Fulgoromorpha has a closer relationship to Heteroptera than to other hemipterans, leaving Homoptera as paraphyletic. Therefore, the position of Fulgoromorpha is important for studying phylogenetic structure of Hemiptera. We inferred the evolutionary affiliations of twenty-five superfamilies of Hemiptera using mitochondrial protein-coding genes and rRNAs. We sequenced three mitogenomes, from Pyrops candelaria, Lycorma delicatula and Ricania marginalis, representing two additional families in Fulgoromorpha. Pyrops and Lycorma are representatives of an additional major family Fulgoridae in Fulgoromorpha, whereas Ricania is a second representative of the highly derived clade Ricaniidae. The organization and size of these mitogenomes are similar to those of the sequenced fulgoroid species. Our consensus phylogeny of Hemiptera largely supported the relationships (((Fulgoromorpha,Sternorrhyncha),Cicadomorpha),Heteroptera), and thus supported the classic phylogeny of Hemiptera. Selection of optimal evolutionary models (exclusion and inclusion of two rRNA genes or of third codon positions of protein-coding genes) demonstrated that rapidly evolving and saturated sites should be removed from the analyses. PMID:23144967

Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

PubMed Central

Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

2000-01-01

Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Phylogenetic diversity of bacterial communities in bovine rumen as affected by diets and microenvironments.

PubMed

Kim, Minseok; Morrison, Mark; Yu, Zhongtang

2011-09-01

Phylogenetic analysis was conducted to examine ruminal bacteria in two ruminal fractions (adherent fraction vs. liquid fraction) collected from cattle fed with two different diets: forage alone vs. forage plus concentrate. One hundred forty-four 16S rRNA gene (rrs) sequences were obtained from clone libraries constructed from the four samples. These rrs sequences were assigned to 116 different operational taxonomic units (OTUs) defined at 0.03 phylogenetic distance. Most of these OTUs could not be assigned to any known genus. The phylum Firmicutes was represented by approximately 70% of all the sequences. By comparing to the OTUs already documented in the rumen, 52 new OTUs were identified. UniFrac, SONS, and denaturing gradient gel electrophoresis analyses revealed difference in diversity between the two fractions and between the two diets. This study showed that rrs sequences recovered from small clone libraries can still help identify novel species-level OTUs.

Bifidobacterium aquikefiri sp. nov., isolated from water kefir.

PubMed

Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter

2016-03-01

A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T  = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.

PubMed

Lynch, T; Gregson, D; Church, D L

2016-03-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene

PubMed Central

Gregson, D.; Church, D. L.

2016-01-01

Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

DOE PAGES

Lan, Yemin; Rosen, Gail; Hershberg, Ruth

2016-05-03

The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

Microbacterium agarici sp. nov., Microbacterium humi sp. nov. and Microbacterium pseudoresistens sp. nov., isolated from the base of the mushroom Agaricus blazei.

PubMed

Young, C-C; Busse, H-J; Langer, S; Chu, Jiunn-Nan; Schumann, P; Arun, A B; Shen, Fo-Ting; Rekha, P D; Kämpfer, P

2010-04-01

Three Gram-positive, rod-shaped bacteria (strains CC-SBCK-209( T), CC-12309(T) and CC-5209(T)) were isolated from the stalk of the edible mushroom Agaricus blazei grown in the laboratory. 16S rRNA gene sequence analysis indicated that all three isolates clearly belonged to the genus Microbacterium. Strains CC-SBCK-209( T) and CC-12309(T) were most related closely to the type strain of Microbacterium halotolerans (95.9 and 96.1 % 16S rRNA gene sequence similarity, respectively). These two novel strains shared 97.9 % 16S rRNA gene sequence similarity. Levels of similarity to the type strains of all other recognized Microbacterium species were lower than 95.5 %. The third strain (CC-5209( T)) showed the highest 16S rRNA gene sequence similarity to the type strain of Microbacterium resistens (97.6 %); levels of similarity to the type strains of all other recognized Microbacterium species were lower than 96 %. The quinone systems of strains CC-SBCK-209(T), CC-12309(T) and CC-5209(T) consisted of MK-11/MK-12, MK-11/MK-10 and MK-13 as major compounds, respectively. All three strains contained ornithine in their peptidoglycan. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol and an unknown glycolipid. The polyamine pattern consisted of spermidine and spermine as predominant components. Fatty acid profiles (anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0 ) as major components) supported the affiliation of all three strains to the genus Microbacterium. The results of physiological and biochemical tests and DNA-DNA hybridization experiments allowed the clear phenotypic and genotypic differentiation of strains CC-SBCK-209(T) and CC-12309( T) from M. halotolerans and other closely related Microbacterium species. Strain CC-5209(T) could be differentiated clearly from M. resistens both genotypically and phenotypically. Based on these data, the novel strains are considered to represent three novel species of the genus Microbacterium. The names proposed for these organisms are Microbacterium agarici sp. nov. [type strain CC-SBCK-209( T) (=DSM 21798(T)=CCM 7686(T))], Microbacterium humi sp. nov. [type strain CC-12309(T) (=DSM 21799(T)=CCM 7687(T))] and Microbacterium pseudoresistens sp. nov. [type strain CC-5209(T) (=DSM 22185(T)=CCM 7688(T))].

Erwinia teleogrylli sp. nov., a Bacterial Isolate Associated with a Chinese Cricket

PubMed Central

Liu, Bo; Luo, Jin; Li, Wei; Long, Xiu-Feng; Zhang, Yu-Qin; Zeng, Zhi-Gang; Tian, Yong-Qiang

2016-01-01

A bacterial isolate (SCU-B244T) was obtained in China from crickets (Teleogryllus occipitalis) living in cropland deserted for approximately 10 years. The isolated bacteria were Gram-negative, facultatively anaerobic, oxidase-negative rods. A preliminary analysis of the 16S rRNA gene sequence indicated that the strain belongs to either the genus Erwinia or Pantoea. Analysis of multilocus sequence typing based on concatenated partial atpD, gyrB and infB gene sequences and physiological and biochemical characteristics indicated that the strain belonged to the genus Erwinia, as member of a new species as it was distinct from other known Erwinia species. Further analysis of the 16S rRNA gene showed SCU-B244T to have 94.71% identity to the closest species of that genus, Erwinia oleae (DSM 23398T), which is below the threshold of 97% used to discriminate bacterial species. DNA-DNA hybridization results (5.78±2.52%) between SCU-B244T and Erwinia oleae (DSM 23398T) confirmed that SCU-B244T and Erwinia oleae (DSM 23398T) represent different species combined with average nucleotide identity values which range from 72.42% to 74.41. The DNA G+C content of SCU-B244T was 55.32 mol%, which also differs from that of Erwinia oleae (54.7 to 54.9 mol%). The polyphasic taxonomic approach used here confirmed that the strain belongs to the Erwinia group and represents a novel species. The name Erwinia teleogrylli sp. nov. is proposed for this novel taxon, for which the type strain is SCU-B244T (= CGMCC 1.12772T = DSM 28222T = KCTC 42022T). PMID:26800121

Geothermomicrobium terrae gen. nov., sp. nov., a novel member of the family Thermoactinomycetaceae.

PubMed

Zhou, En-Min; Yu, Tian-Tian; Liu, Lan; Ming, Hong; Yin, Yi-Rui; Dong, Lei; Tseng, Min; Nie, Guo-Xing; Li, Wen-Jun

2014-09-01

Strains YIM 77562(T) and YIM 77580, two novel Gram-staining-positive, filamentous bacterial isolates, were recovered from the Rehai geothermal field, Tengchong, Yunnan province, south-west China. Good growth was observed at 50-55 °C and pH 7.0. Aerial mycelium was absent on all media tested. Substrate mycelium was well-developed, long and moderately flexuous, and formed abundant, single, warty, ornamented endospores. Phylogenetic analysis of the 16S rRNA gene sequences of the two strains indicated that they belong to the family Thermoactinomycetaceae. Similarity levels between the 16S rRNA gene sequences of the two strains and those of type strains of members of the Thermoactinomycetaceae were 88.33-93.24 %; the highest sequence similarity was with Hazenella coriacea DSM 45707(T). In both strains, the predominant menaquinone was MK-7, the diagnostic diamino acid was meso-diaminopimelic acid and the major cellular fatty acids were iso-C14 : 0, iso-C15 : 0 and iso-C16 : 0. The major polar lipids were diphosphatidylglycerol, phosphatidylmethylethanolamine, unidentified polar lipids and unidentified phospholipids. The genomic DNA G+C contents of strains YIM 77562(T) and YIM 77580 were 45.5 and 44.2 mol%, respectively. DNA-DNA relatedness data suggest that the two isolates represent a single species. Based on phylogenetic analyses and physiological and biochemical characteristics, it is proposed that the two strains represent a single novel species in a new genus, Geothermomicrobium terrae gen. nov., sp. nov. The type strain of Geothermomicrobium terrae is YIM 77562(T) ( = CCTCC AA 2011022(T) = JCM 18057(T)). © 2014 IUMS.

High Diversity of Planctomycetes in Soils of Two Lichen-Dominated Sub-Arctic Ecosystems of Northwestern Siberia

PubMed Central

Ivanova, Anastasia A.; Kulichevskaya, Irina S.; Merkel, Alexander Y.; Toshchakov, Stepan V.; Dedysh, Svetlana N.

2016-01-01

A wide variety of terrestrial ecosystems in tundra have a ground vegetation cover composed of reindeer lichens (genera Cladonia and Cetraria). The microbial communities of two lichen-dominated ecosystems typical of the sub-arctic zone of northwestern Siberia, that is a forested tundra soil and a shallow acidic peatland, were examined in our study. As revealed by molecular analyses, soil and peat layers just beneath the lichen cover were abundantly colonized by bacteria from the phylum Planctomycetes. Highest abundance of planctomycetes detected by fluorescence in situ hybridization was in the range 2.2–2.7 × 107 cells per gram of wet weight. 16S rRNA gene fragments from the Planctomycetes comprised 8–13% of total 16S rRNA gene reads retrieved using Illumina pair-end sequencing from the soil and peat samples. Lichen-associated assemblages of planctomycetes displayed unexpectedly high diversity, with a total of 89,662 reads representing 1723 operational taxonomic units determined at 97% sequence identity. The soil of forested tundra was dominated by uncultivated members of the family Planctomycetaceae (53–71% of total Planctomycetes-like reads), while sequences affiliated with the Phycisphaera-related group WD2101 (recently assigned to the order Tepidisphaerales) were most abundant in peat (28–51% of total reads). Representatives of the Isosphaera–Singulisphaera group (14–28% of total reads) and the lineages defined by the genera Gemmata (1–4%) and Planctopirus–Rubinisphaera (1–3%) were present in both habitats. Two strains of Singulisphaera-like bacteria were isolated from studied soil and peat samples. These planctomycetes displayed good tolerance of low temperatures (4–15°C) and were capable of growth on a number of polysaccharides, including lichenan, a characteristic component of lichen-derived phytomass. PMID:28066382

Towards Defining the Ecological Niches of Novel Coastal Gulf of Mexico Bacterial Isolates

NASA Astrophysics Data System (ADS)

Henson, M. W.; Thrash, C.; Nall, E.

2016-02-01

The study of microbial contributions to biogeochemistry is critical to understanding the cycles of fundamental compounds and gain predictive capabilities in a changing environment. Such study requires observation of microbial communities and genetics in nature, coupled with experimental testing of hypotheses both in situ and in laboratory settings. This study combines dilution-to-extinction based high-throughput culturing (HTC) with cultivation-independent and geochemical measurements to define potential ecological niches of novel bacterial isolates from the coastal northern Gulf of Mexico (cnGOM). Here we report findings from the first of a three-year project. In total, 43 cultures from seven HTC experiments were capable of being repeatedly transferred. Sanger sequencing of the 16S rRNA gene identified these isolates as belonging to the phyla Gammaproteobacteria, Alphaproteobacteria, Actinobacteria, and Betaproteobacteria. Eight are being genome sequenced, with two selected for further physiological characterization due to their phylogenic novelty and potential ecological significance. Strain LSUCC101 likely represents a novel family of Gammaproteobacteria (best blast hit to a cultured representative showed 91% sequence identity) and strain LSUCC96 belongs to the OM252 clade, with the Hawaiian isolate HIMB30 as its closest relative. Both are small (0.3-0.5 µm) cocci. The environmental importance of both LSUCC101 and LSUCC96 was illustrated by their presence within the top 30 OTU0.03 of cnGOM 16S rRNA gene datasets as well as within clone libraries from coastal regions around the world. Ongoing work is determining growth efficiencies, substrate utilization profiles, and metabolic potential to elucidate the roles of these organisms in the cnGOM. Comparative genomics will examine the evolutionary divergence of these organisms from their closest neighbors, and metagenomic recruitment to genomes will help identify strain-based variation from different coastal regions.

Acinetobacter kookii sp. nov., isolated from soil.

PubMed

Choi, Ji Young; Ko, Gwangpyo; Jheong, Weonghwa; Huys, Geert; Seifert, Harald; Dijkshoorn, Lenie; Ko, Kwan Soo

2013-12-01

Two Gram-stain-negative, non-fermentative bacterial strains, designated 11-0202(T) and 11-0607, were isolated from soil in South Korea, and four others, LUH 13522, LUH 8638, LUH 10268 and LUH 10288, were isolated from a beet field in Germany, soil in the Netherlands, and sediment of integrated fish farms in Malaysia and Thailand, respectively. Based on 16S rRNA, rpoB and gyrB gene sequences, they are considered to represent a novel species of the genus Acinetobacter. Their 16S rRNA gene sequences showed greatest pairwise similarity to Acinetobacter beijerinckii NIPH 838(T) (97.9-98.4 %). They shared highest rpoB and gyrB gene sequence similarity with Acinetobacter johnsonii DSM 6963(T) and Acinetobacter bouvetii 4B02(T) (85.4-87.6 and 78.1-82.7 %, respectively). Strain 11-0202(T) displayed low DNA-DNA reassociation values (<40 %) with the most closely related species of the genus Acinetobacter. The six strains utilized azelate, 2,3-butanediol, ethanol and dl-lactate as sole carbon sources. Cellular fatty acid analyses showed similarities to profiles of related species of the genus Acinetobacter: summed feature 3 (C16 : 1ω7c, C16 : 1ω6c; 24.3-27.2 %), C18 : 1ω9c (19.9-22.1 %), C16 : 0 (15.2-22.0 %) and C12 : 0 (9.2-14.2 %). On the basis of the current findings, it is concluded that the six strains represent a novel species, for which the name Acinetobacter kookii sp. nov. is proposed. The type strain is 11-0202(T) ( = KCTC 32033(T) = JCM 18512(T)).

Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction)

PubMed Central

Busti, Elena; Bordoni, Roberta; Castiglioni, Bianca; Monciardini, Paolo; Sosio, Margherita; Donadio, Stefano; Consolandi, Clarissa; Rossi Bernardi, Luigi; Battaglia, Cristina; De Bellis, Gianluca

2002-01-01

Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode) which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene) contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria. PMID:12243651

Genetic Diversity Among Botulinum Neurotoxin Producing Clostridial Strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, K K; Smith, T J; Helma, C H

2006-07-06

Clostridium botulinum is a taxonomic designation for many diverse anaerobic spore forming rod-shaped bacteria which have the common property of producing botulinum neurotoxins (BoNTs). The BoNTs are exoneurotoxins that can cause severe paralysis and even death in humans and various other animal species. A collection of 174 C. botulinum strains were examined by amplified fragment length polymorphism (AFLP) analysis and by sequencing of the 16S rRNA gene and BoNT genes to examine genetic diversity within this species. This collection contained representatives of each of the seven different serotypes of botulinum neurotoxins (BoNT A-G). Analysis of the16S rRNA sequences confirmed earliermore » reports of at least four distinct genomic backgrounds (Groups I-IV) each of which has independently acquired one or more BoNT serotypes through horizontal gene transfer. AFLP analysis provided higher resolution, and can be used to further subdivide the four groups into sub-groups. Sequencing of the BoNT genes from serotypes A, B and E in multiple strains confirmed significant sequence variation within each serotype. Four distinct lineages within each of the BoNT A and B serotypes, and five distinct lineages of serotype E strains were identified. The nucleotide sequences of the seven serotypes of BoNT were compared and show varying degrees of interrelatedness and recombination as has been previously noted for the NTNH gene which is linked to BoNT. These analyses contribute to the understanding of the evolution and phylogeny within this species and assist in the development of improved diagnostics and therapeutics for treatment of botulism.« less

Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

2013-01-16

The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Diversity of cultured photosynthetic flagellates in the North East Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-06-01

During the MALINA cruise (summer 2009) an extensive effort was undertaken to isolate phytoplankton strains from the North East (NE) Pacific Ocean, the Bering Strait, and the Beaufort Sea. Strains were isolated by flow cytometry sorting (FCS) and pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18S rRNA gene sequence similarity) mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas) which was almost the only phytoplankter recovered within picoplankton (≤ 2 μm) size range. Strains of Arctic Micromonas as well as three unidentified strains related to the same genus were identified in further details by sequencing the Internal Transcribed Spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. The unidentified strains form a genotype likely belonging to a new genus within the family Mamiellaceae to which Micromonas belongs. Other green algae genotypes from the genera Nephroselmis, Chlamydomonas, Pyramimonas were also isolated whereas Heterokontophyta included Pelagophyceae, Dictyochophyceae and Chrysophyceae. Dictyochophyceae included Pedinellales which could not be identified to the genus level whereas Chrysophyceae comprised Dinobryon faculiferum. Moreover, we isolated Rhodomonas sp. as well as a few Haptophyta and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by Scanning Electron Microscopy (SEM) and 28S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Diversity of cultured photosynthetic flagellates in the northeast Pacific and Arctic Oceans in summer

NASA Astrophysics Data System (ADS)

Balzano, S.; Gourvil, P.; Siano, R.; Chanoine, M.; Marie, D.; Lessard, S.; Sarno, D.; Vaulot, D.

2012-11-01

During the MALINA cruise (summer 2009), an extensive effort was undertaken to isolate phytoplankton strains from the northeast (NE) Pacific Ocean, the Bering Strait, the Chukchi Sea, and the Beaufort Sea. In order to characterise the main photosynthetic microorganisms occurring in the Arctic during the summer season, strains were isolated by flow cytometry sorting (FCS) and single cell pipetting before or after phytoplankton enrichment of seawater samples. Strains were isolated both onboard and back in the laboratory and cultured at 4 °C under light/dark conditions. Overall, we isolated and characterised by light microscopy and 18 S rRNA gene sequencing 104 strains of photosynthetic flagellates which grouped into 21 genotypes (defined by 99.5% 18 S rRNA gene sequence similarity), mainly affiliated to Chlorophyta and Heterokontophyta. The taxon most frequently isolated was an Arctic ecotype of the green algal genus Micromonas (Arctic Micromonas), which was nearly the only phytoplankter recovered within the picoplankton (< 2 μm) size range. Strains of Arctic Micromonas as well as other strains from the same class (Mamiellophyceae) were identified in further detail by sequencing the internal transcribed spacer (ITS) region of the rRNA operon. The MALINA Micromonas strains share identical 18 S rRNA and ITS sequences suggesting high genetic homogeneity within Arctic Micromonas. Three other Mamiellophyceae strains likely belong to a new genus. Other green algae from the genera Nephroselmis, Chlamydomonas, and Pyramimonas were also isolated, whereas Heterokontophyta included some unidentified Pelagophyceae, Dictyochophyceae (Pedinellales), and Chrysophyceae (Dinobryon faculiferum). Moreover, we isolated some Cryptophyceae (Rhodomonas sp.) as well as a few Prymnesiophyceae and dinoflagellates. We identified the dinoflagellate Woloszynskia cincta by scanning electron microscopy (SEM) and 28 S rRNA gene sequencing. Our morphological analyses show that this species possess the diagnostic features of the genus Biecheleria, and the 28 S rRNA gene topology corroborates this affiliation. We thus propose the transfer of W. cincta to the genus Biecheleria and its recombination as Biecheleria cincta.

Candida vulturna pro tempore sp. nov., a dimorphic yeast species related to the Candida haemulonis species complex isolated from flowers and clinical sample.

PubMed

Sipiczki, Matthias; Tap, Ratna Mohd

2016-10-01

In a taxonomic study of yeasts isolated from flowers in Cagayan de Oro, Mindenao Island, The Philippines, strains were identified as representing Kabatiella microsticta, Metschnikowia koreensis and a hitherto undescribed dimorphic species. Sequences of the D1/D2 domains of the LSU 26S rRNA genes, the internal transcribed spacer (ITS) regions and the SSU 18S rRNA genes were identical in the strains of the last-named group and differed from the corresponding sequences of the type strain of the closest related species, Candida duobushaemulonii, by 4 % (D1/D2), 7 % (ITS) and 1 % (SSU). In an independent study, a strain with D1/D2 and ITS sequences very similar to those of the Philippine strains was isolated in Malaysia from the blood of a patient dying of aspiration pneumonia. Both groups of isolates were moderately sensitive to anidulafungin, caspofungin, fluconazole, itraconazole and voriconazole but resistant to amphotericin B. Molecular phylogenetic analysis of the sequences placed the Philippine and Malaysian isolates close to the Candida haemulonis complex of Candida species. To reflect the geographical location of the sites of sample collection, the novel species name Candida vulturna pro tempore sp. nov. is proposed to accommodate these strains. The type strain is 11-1170T (=CBS 14366T=CCY 094-001-001T=NCAIM-Y02177T) isolated in Cagayan de Oro, The Philippines. Mycobank: MB 817222.

PCR amplification and DNA sequencing of Demodex injai from otic secretions of a dog.

PubMed

Milosevic, Milivoj A; Frank, Linda A; Brahmbhatt, Rupal A; Kania, Stephen A

2013-04-01

The identification of Demodex mites from dogs is usually based on morphology and location. Mites with uncharacteristic features or from unusual locations, hosts or disease manifestations could represent new species not previously described; however, this is difficult to determine based on morphology alone. The goal of this study was to identify and confirm Demodex injai in association with otitis externa in a dog using PCR amplification and DNA sequencing. Otic samples were obtained from a beagle in which a long-bodied Demodex mite was identified. For comparison, Demodex mite samples were collected from a swab and scraping of the dorsal skin of a wire-haired fox terrier and an otic sample from a dog with generalized and otic demodicosis. To identify the Demodex mite, DNA was extracted, and 16S rRNA was amplified by PCR, sequenced and compared with Demodex sequences available in public databases and from separate samples morphologically diagnosed as D. injai and Demodex canis. PCR amplification of the long-bodied mite rRNA DNA obtained from otic samples was approximately 330 bp and was identical to that from the mite morphologically identified as D. injai obtained from the dorsal skin of a dog. Furthermore, the examined mite did not have any significant homology to any of the reported genes from Demodex spp. These results confirmed that the demodex mites in this case were D. injai. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

Bradyrhizobium paxllaeri sp. nov. and Bradyrhizobium icense sp. nov., nitrogen-fixing rhizobial symbionts of Lima bean (Phaseolus lunatus L.) in Peru.

PubMed

Durán, David; Rey, Luis; Mayo, Juan; Zúñiga-Dávila, Doris; Imperial, Juan; Ruiz-Argüeso, Tomás; Martínez-Romero, Esperanza; Ormeño-Orrillo, Ernesto

2014-06-01

A group of strains isolated from root nodules of Phaseolus lunatus (Lima bean) in Peru were characterized by genotypic, genomic and phenotypic methods. All strains possessed identical 16S rRNA gene sequences that were 99.9% identical to that of Bradyrhizobium lablabi CCBAU 23086(T). Despite having identical 16S rRNA gene sequences, the Phaseolus lunatus strains could be divided into two clades by sequence analysis of recA, atpD, glnII, dnaK and gyrB genes. The genome sequence of a representative of each clade was obtained and compared to the genomes of closely related species of the genus Bradyrhizobium. Average nucleotide identity values below the species circumscription threshold were obtained when comparing the two clades to each other (88.6%) and with all type strains of the genus Bradyrhizobium (≤92.9%). Phenotypes distinguishing both clades from all described and closely related species of the genus Bradyrhizobium were found. On the basis of the results obtained, two novel species, Bradyrhizobium paxllaeri sp. nov. (type strain LMTR 21(T) = DSM 18454(T) = HAMBI 2911(T)) and Bradyrhizobium icense sp. nov. (type strain LMTR 13(T) = HAMBI 3584(T) = CECT 8509(T) = CNPSo 2583(T)), are proposed to accommodate the uncovered clades of Phaseolus lunatus bradyrhizobia. These species share highly related but distinct nifH and nodC symbiosis genes. © 2014 IUMS.

Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

PubMed Central

Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

2017-01-01

RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse microbial communities, most notably by OTU-based analysis, even communities with low-biomass samples. PMID:29016661

Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

PubMed

Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

2015-01-01

Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Communities of archaea and bacteria in a subsurface radioactive thermal spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota.

PubMed

Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga

2007-01-01

Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.

Sustained transmission of high-level azithromycin-resistant Neisseria gonorrhoeae in England: an observational study.

PubMed

Fifer, Helen; Cole, Michelle; Hughes, Gwenda; Padfield, Simon; Smolarchuk, Christa; Woodford, Neil; Wensley, Adrian; Mustafa, Nazim; Schaefer, Ulf; Myers, Richard; Templeton, Kate; Shepherd, Jill; Underwood, Anthony

2018-05-01

Between Nov 3, 2014, and Feb 24, 2017, 70 cases of high-level azithromycin-resistant (HL-AziR; minimum inhibitory concentration [MIC] ≥256 mg/L) Neisseria gonorrhoeae were reported from across England. Whole-genome sequencing was done to investigate this outbreak to determine whether the ongoing outbreak represented clonal spread of an HL-AziR N gonorrhoeae strain identified in Leeds. We also wanted to elucidate the molecular mechanisms of azithromycin resistance in N gonorrhoeae in the UK. In this observational study, whole-genome sequencing was done on the HL-AziR N gonorrhoeae isolates from England. As comparators, 110 isolates from the UK and Ireland with a range of azithromycin MICs were also sequenced, including eight isolates from Scotland with azithromycin MICs ranging from 0·12 mg/L to 1·00 mg/L that were N gonorrhoeae multi-antigen sequence type 9768 (ST9768), which was the sequence type initially responsible for the outbreak. The presence of mutations or genes associated with azithromycin resistance was also investigated. 37 of the 60 HL-AziR isolates from England belonged to ST9768, and were genetically similar (mean 4·3 single-nucleotide polymorphisms). A 2059A→G mutation was detected in three or all four alleles of the 23S rRNA gene. Five susceptible ST9768 isolates had one mutated 23S rRNA allele and one low-level resistant ST9768 isolate had two mutated alleles. Sustained transmission of a successful HL-AziR clone was seen across England. Mutation 2059A→G was found in isolates with lower azithromycin MICs. Azithromycin exposure might have provided the selection pressure for one or two mutated copies of the 23S rRNA gene to recombine with wild-type copies, leading to three or four mutated copies and the HL-AziR phenotype. HL-AziR could emerge in isolates with low azithromycin MICs and eliminate the effectiveness of azithromycin as part of dual therapy for the treatment of gonorrhoea. Public Health England. Copyright © 2018 Elsevier Ltd. All rights reserved.

Archaeal communities in boreal forest tree rhizospheres respond to changing soil temperatures.

PubMed

Bomberg, Malin; Münster, Uwe; Pumpanen, Jukka; Ilvesniemi, Hannu; Heinonsalo, Jussi

2011-07-01

Temperature has generally great effects on both the activity and composition of microbial communities in different soils. We tested the impact of soil temperature and three different boreal forest tree species on the archaeal populations in the bulk soil, rhizosphere, and mycorrhizosphere. Scots pine, silver birch, and Norway spruce seedlings were grown in forest humus microcosms at three different temperatures, 7-11.5°C (night-day temperature), 12-16°C, and 16-22°C, of which 12-16°C represents the typical mid-summer soil temperature in Finnish forests. RNA and DNA were extracted from indigenous ectomycorrhiza, non-mycorrhizal long roots, and boreal forest humus and tested for the presence of archaea by nested PCR of the archaeal 16S rRNA gene followed by denaturing gradient gel electrophoresis (DGGE) profiling and sequencing. Methanogenic Euryarchaeota belonging to Methanolobus sp. and Methanosaeta sp. were detected on the roots and mycorrhiza. The most commonly detected archaeal 16S rRNA gene sequences belonged to group I.1c Crenarchaeota, which are typically found in boreal and alpine forest soils. Interestingly, also one sequence belonging to group I.1b Crenarchaeota was detected from Scots pine mycorrhiza although sequences of this group are usually found in agricultural and forest soils in temperate areas. Tree- and temperature-related shifts in the archaeal population structure were observed. A clear decrease in crenarchaeotal DGGE band number was seen with increasing temperature, and correspondingly, the number of euryarchaeotal DGGE bands, mostly methanogens, increased. The greatest diversity of archaeal DGGE bands was detected in Scots pine roots and mycorrhizas. No archaea were detected from humus samples from microcosms without tree seedling, indicating that the archaea found in the mycorrhizosphere and root systems were dependent on the plant host. The detection of archaeal 16S rRNA gene sequences from both RNA and DNA extractions show that the archaeal populations were living and that they may have significant contribution to the methane cycle in boreal forest soil, especially when soil temperatures rise.

Patterns of microbial diversity along a salinity gradient in the Guerrero Negro solar saltern, Baja CA Sur, Mexico

PubMed Central

Dillon, Jesse G.; Carlin, Mark; Gutierrez, Abraham; Nguyen, Vivian; McLain, Nathan

2013-01-01

The goal of this study was to use environmental sequencing of 16S rRNA and bop genes to compare the diversity of planktonic bacteria and archaea across ponds with increasing salinity in the Exportadora de Sal (ESSA) evaporative saltern in Guerrero Negro, Baja CA S., Mexico. We hypothesized that diverse communities of heterotrophic bacteria and archaea would be found in the ESSA ponds, but that bacterial diversity would decrease relative to archaea at the highest salinities. Archaeal 16S rRNA diversity was higher in Ponds 11 and 12 (370 and 380 g l−1 total salts, respectively) compared to Pond 9 (180 g l−1 total salts). Both Pond 11 and 12 communities had high representation (47 and 45% of clones, respectively) by Haloquadratum walsbyi-like (99% similarity) lineages. The archaeal community in Pond 9 was dominated (79%) by a single uncultured phylotype with 99% similarity to sequences recovered from the Sfax saltern in Tunisia. This pattern was mirrored in bop gene diversity with greater numbers of highly supported phylotypes including many Haloquadratum-like sequences from the two highest salinity ponds. In Pond 9, most bop sequences, were not closely related to sequences in databases. Bacterial 16S rRNA diversity was higher than archaeal in both Pond 9 and Pond 12 samples, but not Pond 11, where a non-Salinibacter lineage within the Bacteroidetes >98% similar to environmental clones recovered from Lake Tuz in Turkey and a saltern in Chula Vista, CA was most abundant (69% of community). This OTU was also the most abundant in Pond 12, but only represented 14% of clones in the more diverse pond. The most abundant OTU in Pond 9 (33% of community) was 99% similar to an uncultured gammaproteobacterial clone from the Salton Sea. Results suggest that the communities of saltern bacteria and archaea vary even in ponds with similar salinity and further investigation into the ecology of diverse, uncultured halophile communities is warranted. PMID:24391633

Red-pink pigmented Hymenobacter coccineus sp. nov., Hymenobacter lapidarius sp. nov. and Hymenobacter glacialis sp. nov., isolated from rocks in Antarctica.

PubMed

Sedláček, Ivo; Králová, Stanislava; Kýrová, Kamila; Mašlaňová, Ivana; Busse, Hans-Jürgen; Staňková, Eva; Vrbovská, Veronika; Němec, Miroslav; Barták, Miloš; Holochová, Pavla; Švec, Pavel; Pantůček, Roman

2017-06-01

Four rod-shaped and Gram-stain-negative bacterial strains, CCM 8647, CCM 8649T, CCM 8643T and CCM 8648T, were isolated from rock samples collected on James Ross Island, Antarctica. Extensive biotyping, fatty acid profiling, chemotaxonomy, 16S rRNA gene sequencing and whole-genome sequencing was applied to isolates to clarify their taxonomic position. Phylogenetic analysis based on 16S rRNA gene sequencing indicated that all four isolates belonged to the genus Hymenobacter. Strains CCM 8649T and CCM 8647 were most closely related to Hymenobacter arizonensis OR362-8T (94.4 % 16S rRNA gene sequence similarity), strain CCM 8643T to Hymenobacter terrae DG7AT (96.3 %) and strain CCM 8648T to Hymenobacter glaciei VUG-A130T (96.3 %). The predominant fatty acids of CCM 8649T and CCM 8647 were summed feature 3 (C16 : 1ω7c/C16 : 1ω6c), C16 : 1ω5c and iso-C15 : 0, whereas those of CCM 8643T and CCM 8648T were summed feature 3 (C16 : 1ω7c/C16 : 1ω6c) and C16 : 1ω5c. The quinone systems contained exclusively menaquinone MK-7. The major polyamine was sym-homospermidine. All four strains contained the major polar lipid phosphatidylethanolamine. The G+C content of genomic DNA ranged from 60-63 mol%. Whole-genome sequencing data supported the finding that isolates represented distinct species of the genus Hymenobacter. On the basis of the results obtained, three novel species are proposed for which the names Hymenobacter coccineus sp. nov., Hymenobacter lapidarius sp. nov. and Hymenobacter glacialis sp. nov. are suggested, with the type strains CCM 8649T (=LMG 29441T=P5239T), CCM 8643T (=LMG 29435T=P3150T) and CCM 8648T (=LMG 29440T=P5086T), respectively.

Detection and identification of Theileria infection in sika deer ( Cervus nippon ) in China.

PubMed

He, Lan; Khan, Muhanmad Kasib; Zhang, Wen-Jie; Zhang, Qing-Li; Zhou, Yan-Qin; Hu, Min; Zhao, Junlong

2012-06-01

The sika deer ( Cervus nippon ) is a first-grade state-protected animal in China and designated a threatened species by the World Conservation Union. To detect hemoparasite infection of sika deer, blood samples were collected from 24 animals in the Hubei Province Deer Center. Genomic DNA was extracted, and the V4 hypervariable region encoding 18S rRNA was analyzed by reverse line blot hybridization assay. PCR products hybridized with Babesia / Theileria genus-specific probes but failed to hybridize with any of the Babesia or Theileria species-specific probes, suggesting the presence of a novel, or variant, species. Here 18S rRNA and internal transcribed spacer (ITS) genes were amplified, cloned, and sequenced from 7 isolates. Alignment and BlastN of the cloned sequences revealed high similarities to the homologous 18S rRNA genes and ITS genes of Theileria cervi (AY735122), Theileria sp. CNY1A (AB012194), and Theileria sp. ex Yamaguchi (AF529272). Phylogenetic analysis based on the 18S rRNA gene and ITS sequences showed that all cloned sequences were grouped within the Theileria clade. Phylogeny based on the 18S rRNA gene divided the organisms into 2 groups. Group 1 was closest to Theileria sp. ex Yamaguchi (AF529272), and group 2 was distinct from all other identified Theileria and Babesia species. These results suggest the existence of Theileria sp. infection in sika deer in China. To our knowledge, this is the first report of cervine Theileria sp. in China.

Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

PubMed Central

2011-01-01

Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

Effects of Cr(III) and CR(VI) on nitrification inhibition as determined by SOUR, function-specific gene expression and 16S rRNA sequence analysis of wastewater nitrifying enrichments

EPA Science Inventory

The effect of Cr(III) and Cr(VI) on ammonia oxidation, the transcriptional responses of functional genes involved in nitrification and changes in 16S rRNA level sequences were examined in nitrifying enrichment cultures. The nitrifying bioreactor was operated as a continuous react...

Root-knot nematodes in golf course greens of the western United States

USDA-ARS?s Scientific Manuscript database

A survey of 238 golf courses in ten of the Western U.S. found root-knot nematodes (Meloidogyne spp.) in 60 % of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, ITS-rRNA and mtDNA gene sequences were used to identify specimens from 110 golf courses. The...

Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

PubMed

Flynn, A N; Lyndon, C A; Church, D L

2013-08-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

Phylogeny of Theileria buffeli genotypes identified in the South African buffalo (Syncerus caffer) population.

PubMed

Chaisi, Mamohale E; Collins, Nicola E; Oosthuizen, Marinda C

2014-08-29

Theileria buffeli/orientalis is a group of benign and mildly pathogenic species of cattle and buffalo in various parts of the world. In a previous study, we identified T. buffeli in blood samples originating from the African buffalo (Syncerus caffer) in the Hluhluwe-iMfolozi Game Park (HIP) and the Addo Elephant Game Park (AEGP) in South Africa. The aim of this study was to characterise the 18S rRNA gene and complete internal transcribed spacer (ITS1-5.8S-ITS2) region of T. buffeli samples, and to establish the phylogenetic position of this species based on these loci. The 18S rRNA gene and the complete ITS region were amplified from DNA extracted from blood samples originating from buffalo in HIP and AEGP. The PCR products were cloned and the resulting recombinants sequenced. We identified novel T. buffeli-like 18S rRNA and ITS genotypes from buffalo in the AEGP, and novel Theileria sinensis-like 18S rRNA genotypes from buffalo in the HIP. Phylogenetic analyses indicated that the T. buffeli-like sequences were similar to T. buffeli sequences from cattle and buffalo in China and India, and the T. sinensis-like sequences were similar to T. sinensis 18S rRNA sequences of cattle and yak in China. There was extensive sequence variation between the novel T. buffeli genotypes of the African buffalo and previously described T. buffeli and T. sinensis genotypes. The presence of organisms with T. buffeli-like and T. sinensis-like genotypes in the African buffalo could be of significant importance, particularly to the cattle industry in South Africa as these animals might act as sources of infections to naïve cattle. This is the first report on the characterisation of the full-length 18S rRNA gene and ITS region of T. buffeli and T. sinensis genotypes in South Africa. Our study provides invaluable information towards the classification of this complex group of benign and mildly pathogenic species. Copyright © 2014 Elsevier B.V. All rights reserved.

Classification of thermophilic actinobacteria isolated from arid desert soils, including the description of Amycolatopsis deserti sp. nov.

PubMed

Busarakam, Kanungnid; Brown, Ros; Bull, Alan T; Tan, Geok Yuan Annie; Zucchi, Tiago D; da Silva, Leonardo José; de Souza, Wallace Rafael; Goodfellow, Michael

2016-02-01

The taxonomic position of 26 filamentous actinobacteria isolated from a hyper-arid Atacama Desert soil and 2 from an arid Australian composite soil was established using a polyphasic approach. All of the isolates gave the diagnostic amplification product using 16S rRNA oligonucleotide primers specific for the genus Amycolatopsis. Representative isolates had chemotaxonomic and morphological properties typical of members of the genus Amycolatopsis. 16S rRNA gene analyses showed that all of the isolates belong to the Amycolatopsis methanolica 16S rRNA gene clade. The Atacama Desert isolates were assigned to one or other of two recognised species, namely Amycolatopsis ruanii and Amycolatopsis thermalba, based on 16S rRNA gene sequence, DNA:DNA relatedness and phenotypic data; emended descriptions are given for these species. In contrast, the two strains from the arid Australian composite soil, isolates GY024(T) and GY142, formed a distinct branch at the periphery of the A. methanolica 16S rRNA phyletic line, a taxon that was supported by all of the tree-making algorithms and by a 100 % bootstrap value. These strains shared a high degree of DNA:DNA relatedness and have many phenotypic properties in common, some of which distinguished them from all of the constituent species classified in the A. methanolica 16S rRNA clade. Isolates GY024(T) and GY142 merit recognition as a new species within the A. methanolica group of thermophilic strains. The name proposed for the new species is Amycolatopsis deserti sp. nov.; the type strain is GY024(T) (=NCIMB 14972(T) = NRRL B-65266(T)).

Characterization of bacterial community associated with phytoplankton bloom in a eutrophic lake in South Norway using 16S rRNA gene amplicon sequence analysis.

PubMed

Parulekar, Niranjan Nitin; Kolekar, Pandurang; Jenkins, Andrew; Kleiven, Synne; Utkilen, Hans; Johansen, Anette; Sawant, Sangeeta; Kulkarni-Kale, Urmila; Kale, Mohan; Sæbø, Mona

2017-01-01

Interactions between different phytoplankton taxa and heterotrophic bacterial communities within aquatic environments can differentially support growth of various heterotrophic bacterial species. In this study, phytoplankton diversity was studied using traditional microscopic techniques and the bacterial communities associated with phytoplankton bloom were studied using High Throughput Sequencing (HTS) analysis of 16S rRNA gene amplicons from the V1-V3 and V3-V4 hypervariable regions. Samples were collected from Lake Akersvannet, a eutrophic lake in South Norway, during the growth season from June to August 2013. Microscopic examination revealed that the phytoplankton community was mostly represented by Cyanobacteria and the dinoflagellate Ceratium hirundinella. The HTS results revealed that Proteobacteria (Alpha, Beta, and Gamma), Bacteriodetes, Cyanobacteria, Actinobacteria and Verrucomicrobia dominated the bacterial community, with varying relative abundances throughout the sampling season. Species level identification of Cyanobacteria showed a mixed population of Aphanizomenon flos-aquae, Microcystis aeruginosa and Woronichinia naegeliana. A significant proportion of the microbial community was composed of unclassified taxa which might represent locally adapted freshwater bacterial groups. Comparison of cyanobacterial species composition from HTS and microscopy revealed quantitative discrepancies, indicating a need for cross validation of results. To our knowledge, this is the first study that uses HTS methods for studying the bacterial community associated with phytoplankton blooms in a Norwegian lake. The study demonstrates the value of considering results from multiple methods when studying bacterial communities.

Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

PubMed

Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

2018-05-24

Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

Tenacibaculum todarodis sp. nov., isolated from a squid.

PubMed

Shin, Su-Kyoung; Kim, Eunji; Yi, Hana

2018-05-01

A Gram-stain-negative, rod-shaped, aerobic bacterial strain, designated LPB0136 T , was isolated from a squid Todarodes pacificus, caught in the East Sea, off Korea. LPB0136 T contained a circular chromosome of 3.02 Mb with a DNA G+C content of 30.7 mol%. The genome included 2726 protein-coding genes and three copies of rRNA operons. Phylogenetic analysis of the 16S rRNA gene sequence indicated that this isolate represents a member of the genus Tenacibaculum with an independent genomic species status, showing sequence similarities of 95.9 % to Tenacibaculum aestuarii SMK-4 T and Tenacibaculum caenipelagi HJ-26M T . The detected respiratory quinone (MK-6) and major polar lipid (phosphatidylethanolamine) were similar to the chemotaxonomic profile of other species of the genus Tenacibaculum. The major cellular fatty acids profile (iso-C15 : 0, iso-C15 : 0 3-OH and iso-C15 : 0G) was also similar to those of members of genus Tenacibaculum, but the contents and amounts differed from those of closely related neighbours. Many biochemical and physiological characteristics also distinguished the isolate from other species within the genus Tenacibaculum. On the basis of the pholyphasic taxonomic data determined in this study, strain LPB0136 T represents a novel species of the genus Tenacibaculum, for which the name Tenacibaculum todarodis sp. nov. is proposed. The type strain is LPB0136 T (=KACC 18887 T =JCM 31564 T ).

Genetic characterization of Rhipicephalus sanguineus (sensu lato) ticks from dogs in Portugal.

PubMed

Dantas-Torres, Filipe; Maia, Carla; Latrofa, Maria Stefania; Annoscia, Giada; Cardoso, Luís; Otranto, Domenico

2017-03-13

The taxonomic status of the brown dog tick Rhipicephalus sanguineus (sensu stricto) is a subject of on-going debate; there is a consensus that populations of this tick species should be referred to as R. sanguineus (sensu lato) until its taxonomic status is resolved. Recent genetic studies revealed the existence of more than one lineage of R. sanguineus (s.l.) in temperate countries. In this study, we assessed the genetic identity of ticks collected from rural dogs living in several areas located in all major geographical regions of Portugal. A total of 347 ticks were collected from rural dogs living in different regions of Portugal. These ticks were morphologically identified and partial mitochondrial 16S rRNA gene sequences (~300 bp) were obtained from representative specimens. The ticks were morphologically identified as Ixodes ricinus (seven males and 27 females), Rhipicephalus bursa (one male), Rhipicephalus pusillus (one female) and R. sanguineus (s.l.) (two larvae, 101 nymphs, 108 males and 100 females). Partial mitochondrial 16S rRNA gene sequences were obtained from 58 R. sanguineus (s.l.) specimens, and all of them were genetically identified as belonging to the so-called temperate lineage of R. sanguineus (s.l.) CONCLUSIONS: These results strongly suggest that the temperate species of R. sanguineus (s.l.) is the only representative of this tick group found on dogs in Portugal. It also adds weight to the hypothesis that Rhipicephalus turanicus is not present in this country, although further investigations are necessary to confirm this.

Megasphaera hexanoica sp. nov., a medium-chain carboxylic acid-producing bacterium isolated from a cow rumen.

PubMed

Jeon, Byoung Seung; Kim, Seil; Sang, Byoung-In

2017-07-01

Strain MHT, a strictly anaerobic, Gram-stain-negative, non-spore-forming, spherical coccus or coccoid-shaped microorganism, was isolated from a cow rumen during a screen for hexanoic acid-producing bacteria. The microorganism grew at 30-40 °C and pH 5.5-7.5 and exhibited production of various short- and medium-chain carboxylic acids (acetic acid, butyric acid, pentanoic acid, isobutyric acid, isovaleric acid, hexanoic acid, heptanoic acid and octanoic acid), as well as H2 and CO2 as biogas. Phylogenetic analysis based on 16S rRNA gene sequencing demonstrated that MHT represents a member of the genus Megasphaera, with the closest relatives being Megapsphaera indica NMBHI-10T (94.1 % 16S rRNA sequence similarity), Megasphaera elsdenii DSM 20460T (93.8 %) and Megasphaera paucivorans DSM 16981T (93.8 %). The major cellular fatty acids produced by MHT included C12 : 0, C16 : 0, C18 : 1cis 9, and C18 : 0, and the DNA G+C content of the MHT genome is 51.8 mol%. Together, the distinctive phenotypic and phylogenetic characteristics of MHT indicate that this microorganism represents a novel species of the genus Megasphaera, for which the name Megasphaera hexanoica sp. nov. is herein proposed. The type strain of this species is MHT (=KCCM 43214T=JCM 31403T).

Metagenomic analysis of microbial community of an Amazonian geothermal spring in Peru.

PubMed

Paul, Sujay; Cortez, Yolanda; Vera, Nadia; Villena, Gretty K; Gutiérrez-Correa, Marcel

2016-09-01

Aguas Calientes (AC) is an isolated geothermal spring located deep into the Amazon rainforest (7°21'12″ S, 75°00'54″ W) of Peru. This geothermal spring is slightly acidic (pH 5.0-7.0) in nature, with temperatures varying from 45 to 90 °C and continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). Pooled water sample was analyzed at 16S rRNA V3-V4 hypervariable region by amplicon metagenome sequencing on Illumina HiSeq platform. A total of 2,976,534 paired ends reads were generated which were assigned into 5434 numbers of OTUs. All the resulting 16S rRNA fragments were then classified into 58 bacterial phyla and 2 archaeal phyla. Proteobacteria (88.06%) was found to be the highest represented phyla followed by Thermi (6.43%), Firmicutes (3.41%) and Aquificae (1.10%), respectively. Crenarchaeota and Euryarchaeota were the only 2 archaeal phyla detected in this study with low abundance. Metagenomic sequences were deposited to SRA database which is available at NCBI with accession number SRX1809286. Functional categorization of the assigned OTUs was performed using PICRUSt tool. In COG analysis "Amino acid transport and metabolism" (8.5%) was found to be the highest represented category whereas among predicted KEGG pathways "Metabolism" (50.6%) was the most abundant. This is the first report of a high resolution microbial phylogenetic profile of an Amazonian hot spring.

Lactobacillus perolens sp. nov., a soft drink spoilage bacterium.

PubMed

Back, W; Bohak, I; Ehrmann, M; Ludwig, W; Pot, B; Kersters, K; Schleifer, K H

1999-09-01

Lactic acid bacteria that are able to spoil soft drinks with low pH comprise a limited number of acidotolerant or acidophilic species of the genera Lactobacillus, Leuconostoc and Weissella. Various Gram-positive rods causing turbidity and off-flavour were isolated from orange lemonades. Physiological and biochemical studies including SDS-PAGE whole-cell protein analysis showed a homogeneous group of organisms. The 16S rRNA gene sequence analysis of two representatives revealed that they formed a phylogenetically distinct line within the genus Lactobacillus. All strains were facultatively heterofermentative, producing L-lactic acid. Based on the data presented a new species L. perolens is proposed. The name refers to the off-flavour caused by high amounts of diacetyl. The type strain of L. perolens is DSM 12744 (LMG 18936). A rRNA targeted oligonucleotide probe was designed that allows a fast and reliable identification of L. perolens.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Agaricicola taiwanensis gen. nov., sp. nov., an alphaproteobacterium isolated from the edible mushroom Agaricus blazei.

PubMed

Chu, Jiunn-Nan; Arun, A B; Chen, Wen-Ming; Chou, Jui-Hsing; Shen, Fo-Ting; Rekha, P D; Kämpfer, P; Young, Li-Sen; Lin, Shih-Yao; Young, Chiu-Chung

2010-09-01

A Gram-negative, beige-pigmented, aerobic, motile, club-shaped bacterium, designated strain CC-SBABM117(T), was isolated from the stipe of the edible mushroom Agaricus blazei Murrill. 16S rRNA gene sequence analysis demonstrated that the strain shared <93 % similarity with the type strains of species in the genera Pannonibacter, Methylopila, Nesiotobacter and Stappia. The organism was unable to produce acid from carbohydrates, but utilized a number of organic acids and amino acids. Ubiquinone 10 (Q-10) was the major respiratory quinone and C(18 : 1) ω 7c, C(19 : 0) cyclo ω 8c, C(16 : 0) and C(18 : 0) were the predominant fatty acids. The predominant polar lipids were diphosphatidylglycerol, phosphatidylcholine, phosphatidylglycerol and phosphatidylethanolamine. The DNA G+C content of strain CC-SBABM117(T) was 62.7 mol%. On the basis of 16S rRNA gene sequence analysis and chemotaxonomic and physiological data, strain CC-SBABM117(T) is considered to represent a novel species of a new genus, for which the name Agaricicola taiwanensis gen. nov., sp. nov. is proposed. The type strain of Agaricicola taiwanensis is CC-SBABM117(T) (=BCRC 17964(T) =CCM 7684(T)).

Sphingomonas azotifigens sp. nov., a nitrogen-fixing bacterium isolated from the roots of Oryza sativa.

PubMed

Xie, Cheng-Hui; Yokota, Akira

2006-04-01

Three yellow-pigmented strains associated with rice plants were characterized by using a polyphasic approach. The nitrogen-fixing abilities of these strains were confirmed by acetylene reduction assay and nifH gene detection. The three strains were found to be very closely related, with 99.9 % 16S rRNA gene sequence similarity and greater than 70 % DNA-DNA hybridization values, suggesting that the three strains represent a single species. 16S rRNA gene sequence analysis indicated that the strains were closely related to Sphingomonas trueperi, with 99.5 % similarity. The chemotaxonomic characteristics (G+C content of the DNA of 68.0 mol%, ubiquinone Q-10 system, 2-OH as the only hydroxy fatty acid and homospermidine as the sole polyamine) were similar to those of members of the genus Sphingomonas. Based on DNA-DNA hybridization values and physiological characteristics, the three novel strains could be differentiated from other recognized species of the genus Sphingomonas. The name Sphingomonas azotifigens sp. nov. is proposed to accommodate these bacterial strains; the type strain is Y39T (=NBRC 15497T = IAM 15283T = CCTCC AB205007T).

Gaetbulibacter aestuarii sp. nov., isolated from shallow coastal seawater, and emended description of the genus Gaetbulibacter.

PubMed

Park, Seong Chan; Choe, Han Na; Baik, Keun Sik; Lee, Kang Hyun; Seong, Chi Nam

2012-01-01

A rod-shaped, yellow and strictly aerobic marine bacterium, designated KYW382(T), was isolated from seawater collected from the South Sea, Republic of Korea. Cells were Gram-negative and catalase- and oxidase-positive. The major fatty acids were iso-C(15:1) G, iso-C(15:0), iso-C(17:0) 3-OH, iso-C(15:0) 3-OH and anteiso-C(15:0). The DNA G+C content was 32.4 mol%. A phylogenetic tree based on 16S rRNA gene sequences showed that strain KYW382(T) constituted an evolutionary lineage within the radiation enclosing the members of the genus Gaetbulibacter. The closest neighbour was Gaetbulibacter saemankumensis SMK-12(T) (96.1% 16S rRNA gene sequence similarity). A number of phenotypic characteristics distinguished strain KYW382(T) from the described members of the genus Gaetbulibacter. On the basis of the data presented in this study, strain KYW382(T) represents a novel species, for which the name Gaetbulibacter aestuarii sp. nov. is proposed. The type strain is KYW382(T) (=KCTC 23303(T) =JCM 17455(T)). An emended description of the genus Gaetbulibacter is also given.

Lysobacter spongiicola sp. nov., isolated from a deep-sea sponge.

PubMed

Romanenko, Lyudmila A; Uchino, Masataka; Tanaka, Naoto; Frolova, Galina M; Mikhailov, Valery V

2008-02-01

An aerobic, Gram-negative bacterium, strain KMM 329(T), was isolated from a deep-sea sponge specimen from the Philippine Sea and subjected to a polyphasic taxonomic investigation. Comparative 16S rRNA gene sequence analysis showed that strain KMM 329(T) clustered with the species of the genus Lysobacter. The highest level of 16S rRNA gene sequence similarity (97.0 %) was found with respect to Lysobacter concretionis KCTC 12205(T); lower values (96.4-95.2 %) were obtained with respect to the other recognized Lysobacter species. The value for DNA-DNA relatedness between strain KMM 329(T) and L. concretionis KCTC 12205(T) was 47 %. Branched fatty acids 16 : 0 iso, 15 : 0 iso, 11 : 0 iso 3-OH and 17 : 1 iso were found to be predominant. Strain KMM 329(T) had a DNA G+C content of 69.0 mol%. On the basis of the phenotypic, chemotaxonomic, DNA-DNA hybridization and phylogenetic data, strain KMM 329(T) represents a novel species of the genus Lysobacter, for which the name Lysobacter spongiicola sp. nov. is proposed. The type strain is KMM 329(T) (=NRIC 0728(T) =JCM 14760(T)).

[Diversity and antimicrobial activities of cultivable bacteria isolated from Jiaozhou Bay].

PubMed

Wang, Yiting; Zhang, Chuanbo; Qi, Lin; Jia, Xiaoqiang; Lu, Wenyu

2016-12-04

Marine microorganisms have a great potential in producing biologically active secondary metabolites. In order to study the diversity and antimicrobial activity, we explored 9 sediment samples in different observation sites of Jiaozhou bay. We used YPD and Z2216E culture medium to isolate bacteria from the sediments; 16S rRNA was sequenced for classification and identification of the isolates. Then, we used Oxford cup method to detect antimicrobial activities of the isolated bacteria against 7 test strains. Lastly, we selected 16 representatives to detect secondary-metabolite biosynthesis genes:PKSI, NRPS, CYP, PhzE, dTGD by PCR specific amplification. A total of 76 bacterial strains were isolated from Jiaozhou bay; according to the 16S rRNA gene sequence analysis. These strains could be sorted into 11 genera belonging to 8 different families:Aneurinibacillus, Brevibacillus, Microbacterium, Oceanisphae, Bacillus, Marinomonas, Staphylococcus, Kocuria, Arthrobacters, Micrococcus and Pseudoalteromonas. Of them 34 strains showed antimicrobial activity against at least one of the tested strains. All 16 strains had at least one function genes, 5 strains possessed more than three function genes. Jiaozhou bay area is rich in microbial resources with potential in providing useful secondary metabolites.

Peptoniphilus catoniae sp. nov., isolated from a human faecal sample from a traditional Peruvian coastal community.

PubMed

Patel, Nisha B; Tito, Raul Y; Obregón-Tito, Alexandra J; O'Neal, Lindsey; Trujillo-Villaroel, Omar; Marin-Reyes, Luis; Troncoso-Corzo, Luzmila; Guija-Poma, Emilio; Lewis, Cecil M; Lawson, Paul A

2016-05-01

A novel Gram-stain-positive, coccus-shaped, obligately anaerobic bacterium was isolated from a faecal sample obtained from an individual in a traditional community located off the southern coast of Peru. Comparative 16S rRNA gene sequence analysis showed the novel bacterium belonged to the genus Peptoniphilus but showed no particular relationship with any species, demonstrating less than 91 % 16S rRNA gene sequence similarity with all members of the genus. The major cellular fatty acids of the novel isolate were determined to be C10 : 0, C14 : 0, C16 : 0, C18 : 1ω9c and C18 : 2ω6,9c/anteiso-C18 : 0. The DNA G+C content was 34.4 mol%. End-products of metabolism from peptone-yeast-glucose broth (PYG) were determined to be acetate and butyrate. Based on the phenotypic, chemotaxonomic and phylogenetic results, the organism represents a novel species of the genus Peptoniphilus, for which the name Peptoniphilus catoniae sp. nov. is proposed. The type strain is M6.X2DT ( = DSM 29874T = CCUG 66798T).

Nocardioides albertanoniae sp. nov., isolated from Roman catacombs.

PubMed

Alias-Villegas, Cynthia; Jurado, Valme; Laiz, Leonila; Miller, Ana Z; Saiz-Jimenez, Cesareo

2013-04-01

A Gram-reaction-positive, aerobic, non-spore-forming, rod- or coccoid-shaped, strain, CD40127(T), was isolated from a green biofilm covering the wall of the Domitilla Catacombs in Rome, Italy. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CD40127(T) belongs to the genus Nocardioides, closely related to Nocardioides luteus DSM 43366(T) and Nocardioides albus DSM 43109(T) with 98.86 % and 98.01 % similarity values, respectively. Strain CD40127(T) exhibited 16S rRNA gene sequence similarity values below 96.29 % with the rest of the species of the genus Nocardioides. The G+C content of the genomic DNA was 69.7 mol%. The predominant fatty acid was iso-C16 : 0 and the major menaquinone was MK-8(H4) in accordance with the phenotypes of other species of the genus Nocardioides. A polyphasic approach using physiological tests, fatty acid profiles, DNA base ratios and DNA-DNA hybridization showed that isolate CD40127(T) represents a novel species within the genus Nocardioides, for which the name Nocardioides albertanoniae is proposed. The type strain is CD40127(T) ( = DSM 25218(T) = CECT 8014(T)).

Culturable bacterial diversity at the Princess Elisabeth Station (Utsteinen, Sør Rondane Mountains, East Antarctica) harbours many new taxa.

PubMed

Peeters, Karolien; Ertz, Damien; Willems, Anne

2011-07-01

We studied the culturable heterotrophic bacterial diversity present at the site of the new Princess Elisabeth Station at Utsteinen (Dronning Maud Land, East Antarctica) before construction. About 800 isolates were picked from two terrestrial microbial mat samples after incubation on several growth media at different temperatures. They were grouped using rep-PCR fingerprinting and partial 16S rRNA gene sequencing. Phylogenetic analysis of the complete 16S rRNA gene sequences of 93 representatives showed that the isolates belonged to five major phyla: Actinobacteria, Bacteroidetes, Proteobacteria, Firmicutes and Deinococcus-Thermus. Isolates related to the genus Arthrobacter were the most prevalent whereas the genera Hymenobacter, Deinococcus, Cryobacterium and Sphingomonas were also recovered in high numbers in both samples. A total of 35 different genera were found, the majority of which has previously been reported from Antarctica. For the genera Aeromicrobium, Aurantimonas, Rothia, Subtercola, Tessaracoccus and Xylophilus, this is the first report in Antarctica. In addition, numerous potential new species and new genera were recovered; many of them currently restricted to Antarctica, particularly in the phyla Bacteroidetes and Deinococcus-Thermus. Copyright © 2011 Elsevier GmbH. All rights reserved.

Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

PubMed

Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

2015-01-01

Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

Paenibacillus sonchi sp. nov., a nitrogen-fixing species isolated from the rhizosphere of Sonchus oleraceus.

PubMed

Hong, Yuan-Yuan; Ma, Yu-Chao; Zhou, Yu-Guang; Gao, Fei; Liu, Hong-Can; Chen, San-Feng

2009-11-01

A nitrogen-fixing bacterium, designated strain X19-5(T), was isolated from rhizosphere soil of Sonchus oleraceus. Phylogenetic analysis based on a fragment of the nifH gene and the full-length 16S rRNA gene sequence revealed that strain X19-5(T) was a member of the genus Paenibacillus. Strain X19-5(T) showed the highest 16S rRNA gene sequence similarity (98.8 %) with Paenibacillus graminis RSA19(T) and below 97 % similarity with other recognized members of the genus. The level of DNA-DNA relatedness between strain X19-5(T) and P. graminis RSA19(T) was 45.7 %. The DNA G+C content of strain X19-5(T) was 46.8 mol%. The major fatty acids were anteiso-C(15 : 0), C(16 : 0) and iso-C(16 : 0). On the basis of its phenotypic characteristics and the level of DNA-DNA hybridization, strain X19-5(T) is considered to represent a novel species of the genus Paenibacillus, for which the name Paenibacillus sonchi sp. nov. is proposed. The type strain is X19-5(T) (=CCBAU 83901(T)=LMG 24727(T)).

Methylobacterium gossipiicola sp. nov., a pink-pigmented, facultatively methylotrophic bacterium isolated from the cotton phyllosphere.

PubMed

Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Senthilkumar, Murugaiyan; Lee, Jung-Sook; Lee, Keun-Chul

2012-01-01

A pink, aerobic, facultatively methylotrophic, motile, Gram-negative rod, designated Gh-105(T), was isolated from the phyllosphere of cotton from Coimbatore (Tamilnadu, India). 16S rRNA gene sequence analysis showed clearly that the isolate belonged to the Methylobacterium cluster. Strain Gh-105(T) was most closely related to Methylobacterium adhaesivum AR27(T) (99% 16S rRNA gene sequence similarity) and Methylobacterium iners 5317S-33(T) (97.5%). The isolate grew with C(1) compounds such as methanol and dichloromethane, but not with formaldehyde, formate, methylamine, trimethylamine or methane, as sole carbon sources and carried mxaF, which encodes methanol dehydrogenase and supports methylotrophic metabolism. The major fatty acid was C(18:1)ω7c and the G+C content of the genomic DNA was 64.2 mol%. Physiological and biochemical data and DNA-DNA relatedness with M. adhaesivum KACC 12195(T) and M. iners KACC 11765(T) revealed clear phenotypic and genotypic differences. For this reason, we propose that strain Gh-105(T) (=CCM 7572(T) =NRRL B-51692(T)) represents the type strain of a novel species, with the name Methylobacterium gossipiicola sp. nov.

Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions

PubMed Central

Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake

2015-01-01

Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756

'Candidatus Phytoplasma palmicola', associated with a lethal yellowing-type disease of coconut (Cocos nucifera L.) in Mozambique.

PubMed

Harrison, Nigel A; Davis, Robert E; Oropeza, Carlos; Helmick, Ericka E; Narváez, María; Eden-Green, Simon; Dollet, Michel; Dickinson, Matthew

2014-06-01

In this study, the taxonomic position and group classification of the phytoplasma associated with a lethal yellowing-type disease (LYD) of coconut (Cocos nucifera L.) in Mozambique were addressed. Pairwise similarity values based on alignment of nearly full-length 16S rRNA gene sequences (1530 bp) revealed that the Mozambique coconut phytoplasma (LYDM) shared 100% identity with a comparable sequence derived from a phytoplasma strain (LDN) responsible for Awka wilt disease of coconut in Nigeria, and shared 99.0-99.6% identity with 16S rRNA gene sequences from strains associated with Cape St Paul wilt (CSPW) disease of coconut in Ghana and Côte d'Ivoire. Similarity scores further determined that the 16S rRNA gene of the LYDM phytoplasma shared <97.5% sequence identity with all previously described members of 'Candidatus Phytoplasma'. The presence of unique regions in the 16S rRNA gene sequence distinguished the LYDM phytoplasma from all currently described members of 'Candidatus Phytoplasma', justifying its recognition as the reference strain of a novel taxon, 'Candidatus Phytoplasma palmicola'. Virtual RFLP profiles of the F2n/R2 portion (1251 bp) of the 16S rRNA gene and pattern similarity coefficients delineated coconut LYDM phytoplasma strains from Mozambique as novel members of established group 16SrXXII, subgroup A (16SrXXII-A). Similarity coefficients of 0.97 were obtained for comparisons between subgroup 16SrXXII-A strains and CSPW phytoplasmas from Ghana and Côte d'Ivoire. On this basis, the CSPW phytoplasma strains were designated members of a novel subgroup, 16SrXXII-B.

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

PubMed

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

Influence of changing plant food sources on the gut microbiota of saltmarsh detritivores.

PubMed

Dittmer, Jessica; Lesobre, Jérôme; Raimond, Roland; Zimmer, Martin; Bouchon, Didier

2012-10-01

Changes in agricultural land-use of saltmarshes along the German North Sea coast have favoured the succession of the marsh grass Elytrigia atherica over the long-established Spartina anglica. Consequently, E. atherica represents a potential food source of increasing importance for plant-feeding soil detritivores. Considering the importance of this ecological guild for decomposition processes and nutrient cycling, we focussed on two sympatric saltmarsh soil macrodetritivores and their associated gut microbiota to investigate how the digestive processes of these species may be affected by changing plant food sources. Using genetic fingerprints of partial 16S rRNA gene sequences, we analysed composition and diversity of the bacterial gut community in a diplopod and an amphipod crustacean in relation to different feeding regimes representing the natural vegetation changes. Effects of syntopy on the host-specific gut microbiota were also taken into account by feeding the two detritivore species either independently or on the same plant sample. Bacterial community composition was influenced by both the host species and the available plant food sources, but the latter had a stronger effect on microbial community structure. Furthermore, bacterial diversity was highest after feeding on a mixture of both plant species, regardless of the host species. The gut microbiota of these two detritivores can thus be expected to change along with the on-going succession at the plant community level in this environment. Cloning and sequencing of bacterial 16S rRNA gene fragments further indicated a host-related effect since the two detritivores differed in terms of predominant bacterial taxa: diplopods harboured mainly representatives of the phyla Bacteroidetes and Gammaproteobacteria. In contrast, the genus Vibrio was found for the amphipod host across all feeding conditions.

Molecular and morphological characterization of the tapeworm Taenia hydatigena (Pallas, 1766) in sheep from Iran.

PubMed

Rostami, S; Salavati, R; Beech, R N; Babaei, Z; Sharbatkhori, M; Baneshi, M R; Hajialilo, E; Shad, H; Harandi, M F

2015-03-01

Although Taenia hydatigena is one of the most prevalent taeniid species of livestock, very little molecular genetic information exists for this parasite. Up to 100 sheep isolates of T. hydatigena were collected from 19 abattoirs located in the provinces of Tehran, Alborz and Kerman. A calibrated microscope was used to measure the larval rostellar hook lengths. Following DNA extraction, fragments of cytochrome c oxidase 1 (CO1) and 12S rRNA genes were amplified by the polymerase chain reaction method and the amplicons were subjected to sequencing. The mean total length of large and small hooks was 203.4 μm and 135.9 μm, respectively. Forty CO1 and 39 12S rRNA sequence haplotypes were obtained in the study. The levels of pairwise nucleotide variation between individual haplotypes of CO1 and 12S rRNA genes were determined to be between 0.3-3.4% and 0.2-2.1%, respectively. The overall nucleotide variation among all the CO1 haplotypes was 9.7%, and for all the 12S rRNA haplotypes it was 10.1%. A significant difference was observed between rostellar hook morphometry and both CO1 and 12S rRNA sequence variability. A significantly high level of genetic variation was observed in the present study. The results showed that the 12S rRNA gene is more variable than CO1.

PCR detection of uncultured rumen bacteria.

PubMed

Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

2012-07-01

16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

NASA Astrophysics Data System (ADS)

Chen, K.

2017-01-01

With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

PubMed

Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

2015-03-01

Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

Species Diversity of Puerto Rican Heterotermes (Dictyoptera: Rhinotermitidae) Revealed by Phylogenetic Analyses of Two Mitochondrial Genes

PubMed Central

Jones, Susan C.; Jenkins, Tracie M.

2016-01-01

The goal of this study was to infer Heterotermes (Froggatt) (Dictyoptera: Rhinotermitidae) species diversity on the island of Puerto Rico from phylogenetic analyses of DNA sequence data from two mitochondrial genes, 16S rRNA and cytochrome oxidase II (COII). This termite genus is a structural pest known to be well adapted to arid environments in subtropical and tropical regions worldwide including Puerto Rico and many other Caribbean islands. Extensive sampling was accomplished across Puerto Rico, and phylogenetic analyses of individual gene sequences from these samples indicated robust datasets of congruent gene tree topologies showing three monophyletic groups: H. cardini (Snyder), H. convexinotatus (Snyder), and H. tenuis (Hagen). We found that H. cardini and H. convexinotatus were widespread in the arid coastal regions of Puerto Rico, whereas H. tenuis was uncommon and may represent a relatively new introduction. We found only H. convexinotatus on Culebra Island. We provide strong evidence that Puerto Rico may be linked to the Heterotermes in southern Florida, USA, since its GenBank 16S sequence was identical to that of seven Puerto Rican H. cardini sequences. Our study represents the first records of H. cardini from Puerto Rico and Grand Bahama.

Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

PubMed

van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

1993-01-01

Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

Genetic differences in internal transcribed spacer 1 between Dermanyssus gallinae from wild birds and domestic chickens.

PubMed

Brännström, S; Morrison, D A; Mattsson, J G; Chirico, J

2008-06-01

We investigated the presence of the poultry red mite or the chicken mite, Dermanyssus gallinae De Geer, Acari: Dermanyssidae, in wild bird populations in four different geographical regions of Sweden. The mites identified as D. gallinae were compared genetically with D. gallinae from egg-producing poultry farms in the same regions. The small subunit (SSU) gene, the 5.8S ribosomal RNA (rRNA) gene and the two internal transcribed spacers (ITS) of the rRNA genes were used in the genetic analysis. All D. gallinae mites had identical SSU rRNA, 5.8S rRNA and ITS2 sequences independent of their origin. By contrast, we identified significant differences in the ITS1 sequences. Based on the differences in the ITS1 sequences, the mites could be divided into two genotypes, of wild and domesticated origin, with no variation within the groups. These results imply that wild bird populations are of low importance, if any, as natural reservoirs of D. gallinae in these four geographical regions of Sweden.

Cultivation-dependent and cultivation-independent characterization of hydrocarbon-degrading bacteria in Guaymas Basin sediments.

PubMed

Gutierrez, Tony; Biddle, Jennifer F; Teske, Andreas; Aitken, Michael D

2015-01-01

Marine hydrocarbon-degrading bacteria perform a fundamental role in the biodegradation of crude oil and its petrochemical derivatives in coastal and open ocean environments. However, there is a paucity of knowledge on the diversity and function of these organisms in deep-sea sediment. Here we used stable-isotope probing (SIP), a valuable tool to link the phylogeny and function of targeted microbial groups, to investigate polycyclic aromatic hydrocarbon (PAH)-degrading bacteria under aerobic conditions in sediments from Guaymas Basin with uniformly labeled [(13)C]-phenanthrene (PHE). The dominant sequences in clone libraries constructed from (13)C-enriched bacterial DNA (from PHE enrichments) were identified to belong to the genus Cycloclasticus. We used quantitative PCR primers targeting the 16S rRNA gene of the SIP-identified Cycloclasticus to determine their abundance in sediment incubations amended with unlabeled PHE and showed substantial increases in gene abundance during the experiments. We also isolated a strain, BG-2, representing the SIP-identified Cycloclasticus sequence (99.9% 16S rRNA gene sequence identity), and used this strain to provide direct evidence of PHE degradation and mineralization. In addition, we isolated Halomonas, Thalassospira, and Lutibacterium sp. with demonstrable PHE-degrading capacity from Guaymas Basin sediment. This study demonstrates the value of coupling SIP with cultivation methods to identify and expand on the known diversity of PAH-degrading bacteria in the deep-sea.

Cultivation-dependent and cultivation-independent characterization of hydrocarbon-degrading bacteria in Guaymas Basin sediments

PubMed Central

Gutierrez, Tony; Biddle, Jennifer F.; Teske, Andreas; Aitken, Michael D.

2015-01-01

Marine hydrocarbon-degrading bacteria perform a fundamental role in the biodegradation of crude oil and its petrochemical derivatives in coastal and open ocean environments. However, there is a paucity of knowledge on the diversity and function of these organisms in deep-sea sediment. Here we used stable-isotope probing (SIP), a valuable tool to link the phylogeny and function of targeted microbial groups, to investigate polycyclic aromatic hydrocarbon (PAH)-degrading bacteria under aerobic conditions in sediments from Guaymas Basin with uniformly labeled [13C]-phenanthrene (PHE). The dominant sequences in clone libraries constructed from 13C-enriched bacterial DNA (from PHE enrichments) were identified to belong to the genus Cycloclasticus. We used quantitative PCR primers targeting the 16S rRNA gene of the SIP-identified Cycloclasticus to determine their abundance in sediment incubations amended with unlabeled PHE and showed substantial increases in gene abundance during the experiments. We also isolated a strain, BG-2, representing the SIP-identified Cycloclasticus sequence (99.9% 16S rRNA gene sequence identity), and used this strain to provide direct evidence of PHE degradation and mineralization. In addition, we isolated Halomonas, Thalassospira, and Lutibacterium sp. with demonstrable PHE-degrading capacity from Guaymas Basin sediment. This study demonstrates the value of coupling SIP with cultivation methods to identify and expand on the known diversity of PAH-degrading bacteria in the deep-sea. PMID:26217326

Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis)

USGS Publications Warehouse

Rhodes, M.W.; Kator, H.; McNabb, A.; Deshayes, C.; Reyrat, J.-M.; Brown-Elliott, B. A.; Wallace, R.; Trott, K.A.; Parker, J.M.; Lifland, B.; Osterhout, G.; Kaattari, I.; Reece, K.; Vogelbein, W.; Ottinger, C.A.

2005-01-01

A group of slowly growing photochromogenic mycobacteria was isolated from Chesapeake Bay striped bass (Morone saxatilis) during an epizootic of mycobacteriosis. Growth characteristics, acid-fastness and 16S rRNA gene sequencing results were consistent with those of the genus Mycobacterium. Biochemical reactions, growth characteristics and mycolic acid profiles (HPLC) resembled those of Mycobacterium shottsii, a non-pigmented mycobacterium also isolated during the same epizootic. Sequencing of the 16S rRNA genes, the gene encoding the exported repeated protein (erp) and the gene encoding the 65 kDa heat-shock protein (hsp65) and restriction enzyme analysis of the hsp65 gene demonstrated that this group of isolates is unique. Insertion sequences associated with Mycobacterium ulcerans, IS2404 and IS2606, were detected by PCR. These isolates could be differentiated from other slowly growing pigmented mycobacteria by their inability to grow at 37 ??C, production of niacin and urease, absence of nitrate reductase, negative Tween 80 hydrolysis and resistance to isoniazid (1 ??g ml-1), p-nitrobenzoic acid, thiacetazone and thiophene-2-carboxylic hydrazide. On the basis of this polyphasic study, it is proposed that these isolates represent a novel species, Mycobacterium pseudoshottsii sp. nov. The type strain, L15T, has been deposited in the American Type Culture Collection as ATCC BAA-883T and the National Collection of Type Cultures (UK) as NCTC 13318T. ?? 2005 IUMS.

Mucilaginibacter carri sp. nov., isolated from a car air conditioning system.

PubMed

Kim, Dong-Uk; Lee, Hyosun; Kim, Hyun; Kim, Song-Gun; Park, So Yoon; Ka, Jong-Ok

2016-04-01

A Gram-stain-negative, pink bacterial strain, designated PR0008KT, was isolated from an automobile evaporator core in Korea. The cells were obligately aerobic and rod-shaped. The strain grew at 10-40 °C (optimum, 20 °C), at pH 5-8 (optimum, 7), and in the presence of 0-1.5% (w/v) NaCl. Phylogenetically, the strain was closely related to members of the genus Mucilaginibacter (93.4-97.0% 16S rRNA sequence similarities) and showed a high sequence similarity with Mucilaginibacter litoreus BR-18T, Mucilaginibacter lutimaris BR-3T and Mucilaginibacter soli R9-65T (97.0%, 96.9% and 96.9% 16S rRNA sequence similarity, respectively). It contained summed feature 3 (C16:1ω7c and/or C16:1ω6c), C16 : 0, iso-C17:0 3-OH and C16:0 as the predominant fatty acids and MK-7 as the major menaquinone. The polar lipids were phosphatidylethanolamine, one unknown aminophospholipid, two unknown aminolipids and two unknown polar lipids. The DNA G+C content of this strain was 47.4 mol%. Based on the phenotypic, genotypic and chemotaxonomic data, strain PR0008KT represents a novel species in the genus Mucilaginibacter, for which the name Mucilaginibacter carri sp. nov. (=KACC 17938T=NBRC 111539T) is proposed.

Arthrobacter ruber sp. nov., isolated from glacier ice.

PubMed

Liu, Qing; Xin, Yu-Hua; Chen, Xiu-Ling; Liu, Hong-Can; Zhou, Yu-Guang; Chen, Wen-Xin

2018-05-01

A Gram-stain-positive strain designated MDB1-42 T was isolated from ice collected from Midui glacier in Tibet, PR China. Strain MDB1-42 T was catalase-positive, oxidase-negative and grew optimally at 25-28 °C and pH 7.0. Phylogenetic analysis based on 16S rRNA gene sequences revealed that MDB1-42 T represented a member of the genus Arthrobacter. The highest level of 16S rRNA gene sequence similarity (99.86 %) was found with Arthrobacter agilis NBRC 15319 T . Multilocus sequence analysis revealed low similarity of 91.93 % between MDB1-42 T and Arthrobacter agilis NBRC 15319 T . Average nucleotide identity and digital DNA-DNA hybridization values between MDB1-42 T and the most closely related strain, Arthrobacter agilis DSM 20550 T , were 81.36 and 24.5 %, respectively. The genomic DNA G+C content was 69.0 mol%. The major cellular fatty acids of MDB1-42 T were anteiso-C15 : 0 and anteiso-C17:0. The polar lipids were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol, one unidentified glycolipid and one unidentified lipid. The predominant menaquinone was MK-9(H2). On the basis of results obtained using a polyphasic approach, a novel species Arthrobacter ruber sp. nov. is proposed, with MDB1-42 T (=CGMCC 1.9772 T =NBRC 113088 T ) as the type strain.

Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

PubMed

Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

2018-05-29

Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

A Systematic Approach for Discovering Novel, Clinically Relevant Bacteria

PubMed Central

Simmon, Keith E.; Fisher, Mark A.

2012-01-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006–June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities. PMID:22377371

A systematic approach for discovering novel, clinically relevant bacteria.

PubMed

Schlaberg, Robert; Simmon, Keith E; Fisher, Mark A

2012-03-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006-June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities.

16S rRNA Gene Sequencing for Deciphering the Colorectal Cancer Gut Microbiome: Current Protocols and Workflows.

PubMed

Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman

2018-01-01

The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.

[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

PubMed

Petrov, N B; Vladychenskaia, N S

2005-01-01

Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Identification by 16S rRNA Gene Sequencing of an Actinomyces hongkongensis Isolate Recovered from a Patient with Pelvic Actinomycosis

PubMed Central

Flynn, A. N.; Lyndon, C. A.

2013-01-01

A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532

Comparison between rpoB and 16S rRNA Gene Sequencing for Molecular Identification of 168 Clinical Isolates of Corynebacterium

PubMed Central

Khamis, Atieh; Raoult, Didier; La Scola, Bernard

2005-01-01

Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

PubMed

Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

2015-11-13

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

PubMed Central

Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

2015-01-01

To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

rRNA Gene Internal Transcribed Spacer 1 and 2 Sequences of Asexual, Anthropophilic Dermatophytes Related to Trichophyton rubrum

PubMed Central

Summerbell, R. C.; Haugland, R. A.; Li, A.; Gupta, A. K.

1999-01-01

The ribosomal region spanning the two internal transcribed spacer (ITS) regions and the 5.8S ribosomal DNA region was sequenced for asexual, anthropophilic dermatophyte species with morphological similarity to Trichophyton rubrum, as well as for members of the three previously delineated, related major clades in the T. mentagrophytes complex. Representative isolates of T. raubitschekii, T. fischeri, and T. kanei were found to have ITS sequences identical to that of T. rubrum. The ITS sequences of T. soudanense and T. megninii differed from that of T. rubrum by only a small number of base pairs. Their continued status as species, however, appears to meet criteria outlined in the population genetics-based cohesion species concept of A. R. Templeton. The ITS sequence of T. tonsurans differed from that of the biologically distinct T. equinum by only 1 bp, while the ITS sequence of the recently described species T. krajdenii had a sequence identical to that of T. mentagrophytes isolates related to the teleomorph Arthroderma vanbreuseghemii. PMID:10565922

Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

PubMed Central

Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

2012-01-01

The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

Use of 16S-23S rRNA spacer-region (SR)-PCR for identification of intestinal clostridia.

PubMed

Song, Yuli; Liu, Chengxu; Molitoris, Denise; Tomzynski, Thomas J; Mc Teague, Maureen; Read, Erik; Finegold, Sydney M

2002-12-01

The suitability of a species identification technique based on PCR analysis of 16S-23S rRNA spacer region (SR) polymorphism for human intestinal Clostridium species was evaluated. This SR-PCR based technique is highly reproducible and successfully differentiated the strains tested, which included 17 ATCC type strains of Clostridium and 152 human stool Clostridium isolates, at the species or intraspecies level. Ninety-eight of 152 stool isolates, including C. bifermentans, C. butyricum, C. cadaveris, C. orbiscindens, C. paraputrificum, C. pefringens, C. ramosum, C. scindens, C. spiroforme, C. symbiosum and C. tertium, were identified to species level by SR-PCR patterns that were identical to those of their corresponding ATCC type strains. The other 54 stool isolates distributed among ten SR-PCR patterns that are unique and possibly represent ten novel Clostridium species or subspecies. The species identification obtained by SR-PCR pattern analysis completely agreed with that obtained by 16S rRNA sequencing, and led to identification that clearly differed from that obtained by cellular fatty acid analysis for 23/152 strains (15%). These results indicate that SR-PCR provides an accurate and rapid molecular method for the identification of human intestinal Clostridium species.

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

PubMed

Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

2012-01-01

The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

PubMed Central

Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

2012-01-01

Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

Mitochondrial DNA Sequence Divergence among Meloidogyne incognita, Romanomermis culicivorax, Ascaris suum, and Caenorhabditis elegans

PubMed Central

Powers, T. O.; Harris, T. S.; Hyman, B. C.

1993-01-01

Mitochondrial DNA sequences were obtained from the NADH dehydrogenase subunit 3 (ND3), large rRNA, and cytochrome b genes from Meloidogyne incognita and Romanomermis culicivorax. Both species show considerable genetic distance within these same genes when compared with Caenorhabditis elegans or Ascaris suum, two species previously analyzed. Caenorhabditis, Ascaris, and Meloidogyne were selected as representatives of three subclasses in the nematode class Secernentea: Rhabditia, Spiruria, and Diplogasteria, respectively. Romanomermis served as a representative out-group of the class Adenophorea. The divergence between the phytoparasitic lineage (represented by Meloidogyne) and the three other species is so great that virtually every variable position in these genes appears to have accumulated multiple mutations, obscuring the phylogenetic information obtainable from these comparisons. The 39 and 42% amino acid similarity between the M. incognita and C. elegans ND3 and cytochrome b coding sequences, respectively, are approximately the same as those of C. elegans-mouse comparisons for the same genes (26 and 44%). This discovery calls into question the feasibility of employing cloned C. elegans probes as reagents to isolate phytoparasitic nematode genes. The genetic distance between the phytoparasitic nematode lineage and C. elegans markedly contrasts with the 79% amino acid similarity between C. elegans and A. suum for the same sequences. The molecular data suggest that Caenorhabditis and Ascaris belong to the same subclass. PMID:19279810

Lactobacillus fabifermentans sp. nov. and Lactobacillus cacaonum sp. nov., isolated from Ghanaian cocoa fermentations.

PubMed

De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter

2009-01-01

Two Gram-positive bacterial strains, LMG 24284T and LMG 24285T, were isolated from different spontaneous cocoa bean heap fermentations in Ghana. Analysis of their 16S rRNA gene sequences indicated that they were members of the Lactobacillus plantarum and Lactobacillus salivarius species groups, respectively. DNA-DNA hybridization experiments with their nearest phylogenetic neighbours demonstrated that both strains represented novel species that could be differentiated from their nearest neighbours by pheS sequence analysis, whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism analysis and biochemical characterization. Therefore, two novel Lactobacillus species are proposed, Lactobacillus fabifermentans sp. nov. (type strain LMG 24284T =DSM 21115T) and Lactobacillus cacaonum sp. nov. (type strain LMG 24285T =DSM 21116T).

New progress in snake mitochondrial gene rearrangement.

PubMed

Chen, Nian; Zhao, Shujin

2009-08-01

To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.

Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale.

PubMed

Aminov, Rustam I; Walker, Alan W; Duncan, Sylvia H; Harmsen, Hermie J M; Welling, Gjalt W; Flint, Harry J

2006-09-01

Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation.